splice site of genes for which splicing is inhibited by ICP27.
In genesfor which ICP27 activated intronic PAS, intronic cytosine
stretcheswere more common (Fig. S6D) than were exonic cytosine
stretches(Fig. S6C), suggesting that intronic cytosines may play a
more im-portant role in polyadenylation from intronic PAS of these
tran-scripts in the presence of ICP27.
Splicing Inhibition Mediated by ICP27 and Cytosine-Rich
SequencesDoes Not Require the ICP27 N-Terminal RGG Motif. ICP27
increasedthe unspliced to spliced ratio of a chimeric mRNA in which
theC-rich HSV-2 ICP34.5 intron was replaced with the similarly
sizedintron 2 from the ICP27-insensitive KSHVK8 gene (Fig. 4A and
B),whereas neither HSV-1 nor HSV-2 ICP27 significantly
inhibitedsplicing of mutant chimeric mRNAs in which ICP34.5 exon 1
wasalso replaced with corresponding KSHV K8 exon 2 sequences or
inwhich point mutations of cytosines in ICP34.5 exon 1 were
in-troduced (Fig. 4B). Mutation of ATXN2L exon 18 C-rich
sequences,whether immediately upstream of the 5′ splice site or
further up-stream, sharply reduced ICP27-mediated intron 18
splicing inhibitionin reporter assays, whereas mutation of C-rich
sequences in intron 18or in downstream exon 19 did not (Fig. 4 C
and D). Together, theseresults indicate that exonic C-rich
sequences near the 5′ splice siteare more important for
ICP27-mediated splicing inhibition thanintronic sequences. KSHV K8
intron 2 is normally alternativelyspliced and contains suboptimal
splicing sites (28, 29). Splicing in aKSHVK8 splicing reporter
containing both K8 introns 1 and 2 is notinhibited by ICP27 (18).
Introduction of cytosines by G to C and Ato C mutations in the K8
exon 2 sequence upstream of the 5′splice site in pK8ccct (Fig. 4E),
greatly increased its sensitivity toICP27-mediated splicing
inhibition (Fig. 4F), further confirmingthat C-rich sequences near
the 5′ splice site are involved in ICP27-mediated splicing
inhibition. Additionally, an ICP27-expressingplasmid mutant with
deletion of the ICP27 N-terminal RGG/SRPK-1 motif and adjacent
downstream potential RNA bindingsequences was nearly as efficient
as wild-type ICP27 in inhibitingpK8ccct mutant splicing, further
indicating that ICP27 interactionswith the RNA sequence and SRPK-1
through the RGG motif arenot required for ICP27-mediated specific
splicing inhibition.
Suboptimal Splice Sites Contribute to ICP27-Mediated Splicing
Inhibition.Replacement of the suboptimal ATXN2L intron 18 5′ and 3′
splicesites with consensus sequences moderately increased basal
splicingefficiency in the absence of ICP27, but nearly abolished
ICP27-mediated splicing inhibition (Fig. 4 G and H). This finding
suggeststhat the suboptimal splice sites that flank all of the
identified ICP27-targeted introns are required for efficient
ICP27-mediated splicinginhibition, which is also in agreement with
a previous report thatoptimization of PML intron 7 splicing sites
abolished its sensitivityto ICP27-mediated splicing inhibition
(20).
DiscussionHSV-1 and -2 ICP27 modify the pre-mRNA processing of a
selectgroup of cellular genes, leading to use of cryptic intronic
PAS, useof downstream cryptic 5′ splice sites, and retention of
specific
introns, reducing the expression of targeted genes while
increasingthe protein coding diversity of these genes. Both the
N-terminalRGG domain and the C-terminal domain of ICP27 are
requiredfor efficient use of intronic PAS, with the C-terminal
domainbeing apparently more important for regulating alternative
splic-ing. Shared sequence elements (suboptimal splice sites and
C-richsequences near the 5′ splice site) and the reduced use of a
specific5′ splice site in all cases of these ICP27-mediated effects
suggestthat different forms of ICP27-mediated aberrant
pre-mRNAprocessing likely have overlapping mechanisms.Our results
confirm ICP27’s role in cotranscriptional cellular
pre-mRNA splicing and polyadenylation of specific
transcripts,consistent with the results using splicing reporters
(Figs. S7 andS8). Our findings, including identification of
prematurely cleavedand polyadenylated transcripts by Northern
hybridization in wildtype, but not in ICP27 deletion mutant
virus-infected cells, wouldnot have been predicted by a recent
report (14), which positedthat ICP27 had no role in regulating
cellular cotranscriptionalpre-mRNA splicing or termination of
cellular transcripts.In vitro polyadenylation experiments suggested
that ICP27 is
involved in promoting polyadenylation from “weak” PASs of
lategenes, including UL44 (glycoprotein C) (30–33), suggesting
thatICP27 likely directly influences both polyadenylation and
splicing.ICP27’s impact on polyadenylation from intronic PAS
typicallylocated within 1 kb of the 5′ splice site mirrors that
recently ob-served when U1 snRNP’s binding to the 5′ splice site
was inhibited,also relieving its inhibition of CPSF binding to the
downstreamPAS (34–36). We hypothesize that ICP27 may thus interfere
withU1 snRNP’s binding to 5′ splice sites in the context of
specificintrons, through direct or indirect interaction with the
C-rich se-quences near the 5′ splice site (Fig. 4I). Recent crystal
structurestudies demonstrated that the structure of ICP27 does not
have KHdomains and that its C-terminal region does not fold into a
poten-tially RNA-binding hnRNPK-like structure (4, 5). ICP27’s
RGGmotif has been shown to directly bind RNA (37, 38) and appears
toplay a significant role in alternative polyadenylation and a
lesser rolein splicing inhibition. However, our in vitro
transfection experimentsand previous reports (18, 20) showing that
the RGG motif is notrequired for ICP27-mediated splicing inhibition
suggest that theremay be other RNA binding sites in ICP27 or that
unknown adaptorproteins are involved in recognizing the C-rich
sequences near the 5′splice site. We also note that the precise
nature of the C-rich se-quences important for ICP27 effects has not
yet been defined.For LEPR and PPR1R8 (Table S1), some RNAs were
alterna-
tively polyadenylated using intronic PAS, and others used an
al-ternative 5′ splice site, suggesting that the relative kinetics
of splicingand polyadenylation are important for alternative
polyadenylation,as has been hypothesized (39). Thus, it appears
that the fate ofICP27-targeted pre-mRNA is determined by the
strength andproximity of splice sites, availability of C-rich
sequences near the 5′splice site, availability and proximity of an
intronic PAS, the size ofthe intron (with larger introns more
likely to show use of an alter-native 5′ splice site or intronic
PAS, and with smaller intronsmore likely to be retained), and
efficiency of RNA polymeraseII transcription (i.e., reduced
efficiency or “pausing” of RNA
NIC
HSV-
2
ATXN2L
26 27 28
NFS11 2
β-Actin
E
GAPDH
2 3
10 11
18 19
19 20
16 17
2 3
4 5
HSV-
1d2
7-1d4
-5m1
5pF
lagpIC
P27
pΔRR
2pM
15
POLR2A
ATXN2LControlB
A
ICP27 mutant plasmids
pΔRR2
pM15
pICP27(WT) 133 171
RGG Box
P465L G466E
CNFS1
POLR2A
ICP27
Control
Control
Chromosome 17 (HG19) (+)
Chromosome 20 (HG19) (-)
D34283.7KBps 34287.3KBps
278
1700
0
Chromosome 16 (HG19) (+)
ICP27
28845.3KBps 28847.8KBps
898
7420
0
7414.2KBps 7417.9KBps
1711
17040
0
ICP27
1 512
Fig. 3. ICP27-induced retention of specific introns insome host
genes. (A–C) Read counts mapping toPOLR2A (last intron retention;
A), NFS1 (intron 1 re-tention; B), and ATXN2L (multiple internal
intronretention; C). Arrows indicate significant differencesin read
counts. (D) Schematic diagrams of inserts inHSV-2 ICP27 expression
plasmids. (E) Effect of ICP27mutations in HSV-1 viruses (Fig. 1E)
and HSV-2 plas-mids on intron retention of cellular genes by
RT-PCRof infected (8 hpi) or transfected HEK293 cells. Ar-rows
denote RT-PCR primers (Table S2). Exons arenumbered in boxes. NIC,
noninfected control.
Tang et al. PNAS | October 25, 2016 | vol. 113 | no. 43 |
12259
MICRO
BIOLO
GY
Dow
nloa
ded
by g
uest
on
Mar
ch 2
9, 2
021
http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1609695113/-/DCSupplemental/pnas.201609695SI.pdf?targetid=nameddest=SF6http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1609695113/-/DCSupplemental/pnas.201609695SI.pdf?targetid=nameddest=SF6http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1609695113/-/DCSupplemental/pnas.201609695SI.pdf?targetid=nameddest=SF7http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1609695113/-/DCSupplemental/pnas.201609695SI.pdf?targetid=nameddest=SF8http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1609695113/-/DCSupplemental/pnas.201609695SI.pdf?targetid=nameddest=ST1http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1609695113/-/DCSupplemental/pnas.201609695SI.pdf?targetid=nameddest=ST2
polymerase II at the TSS or at suboptimal 3′ splice sites
favorsalternative polyadenylation). Because ICP27 appears to
targetless abundant transcripts and expression of many genes is
tissue-specific, it is possible that ICP27 has tissue-specific
targets.ICP27-induced aberrant pre-mRNA processing likely leads
to
reduced expression of many affected cellular genes and
alter-ation in the UTR sequence of other cellular transcripts
thatmay alter mRNA stability. ICP27-induced aberrant
pre-mRNAprocessing likely also leads to expression of novel
truncated orframeshifted host cell proteins, expanding the genomic
materialavailable to the virus. Although aberrant pre-mRNAs
containingpremature termination codons (PTCs) are often subjected
todegradation via nonsense-mediated decay (NMD) (40), at leastsome
ICP27-mediated aberrant pre-mRNAs contain PTCs are ableto escape
NMD and express proteins, including full-length glyco-protein C and
HSV-2 ICP34.5β (16, 18). It thus seems likely that atleast some of
these host transcripts can also express novel proteins.Recent
studies suggested that the virion host shutoff-RNase (vhs)protein,
previously thought to nonspecifically degrade host andviral mRNAs,
more selectively targets specific host mRNAs, butnot GC-rich viral
mRNAs (41, 42). Because the GC content ofICP27-targeted genes is
similar to that of HSV genes, they alsolikely escape selective
degradation by vhs. Thus, by specificallymodifying pre-mRNA
processing of HSV-like GC-rich transcriptsthat are likely spared by
the virion host shutoff protein, ICP27contributes to virus-induced
host shutoff required for efficientviral growth.
ICP27 affects pre-mRNA processing of >200 genes in
ICP27-transfected cells involved in important cellular pathways,
implyinga broad program of ICP27-mediated cellular modification to
favorthe virus, and helping to explain the observation that ICP27
ex-pression is toxic to the cell and is both required for efficient
virusgrowth and for severe symptoms (43–45). Of the affected
genes,>30, including PML, STING, TRAF6, PPP6C, MAP3K7,
FBXW11,IFNAR2, NFKB1, RELA, and CREBP, are related to
innateimmunity pathways, which is consistent with ICP27’s known
rolein regulating innate immunity (46–49). Although it would not
bepractical to separately examine these effects in each of
thesegenes, it seems likely that the combined effect of these
alterationsexceeds that of any one. It has been reported that
ICP27-inducedintron retention in PML appears to alter viral growth
(20), thatalternative splicing in viral gC plays an important role
in viralimmune evasion by regulating the relative expression of
full-lengthand secreted forms of gC (16), and that ICP27 alters
viral neu-rovirulence through inhibition of HSV-2 ICP34.5 splicing
(18).Although HSV is the first virus and ICP27 is the first viral
or
cellular protein shown to promote expression of
pre-mRNAsprematurely cleaved and polyadenylated from intronic PAS,
wesuspect that other viruses or unidentified cellular genes also
en-code this function. Further investigation will likely yield
insightboth into mechanisms of viral pathogenesis, potentially
leading toidentification of new targets for antiviral strategies,
and into themechanisms by which the cell itself controls
alternative poly-adenylation and splicing of selected genes. ICP27
could also
+ + + ++ + + +
+ + + +pK8exon2(K8 intron2)
K8 Intron 2 ICP34.5 Exon2K8 Exon2
- -- -
- -
- - - -- -
- -
- -
- -- -
- ---
-90 -1 1 29
-20-39
DC
+ ++ + +
---
--
-
ATXN-C1M ATXN-C1-2MpATNX2L-18-19
+ ++ + +
---
--
-
M-5ss M-3sspATNX2L-
18-19 M-5-3ss
++ --
18 19pATXN2L-18-19-170 1 89
-5-44
ATXN2L-C1M
ATXN2L-C1-2M
M-5-3ssM-3ssM-5ss
5’ss 3’ssConsensus
+
+
ATXN2L-IN-M
C1-2-IN-M
++ +-
---+
ATXN-IN-M C1-2-IN-M
C1-2-IN-E-M
++ --
C1-2-IN-E-M
A B
E
G H
K8 Intron 2 K8 Exon3K8 Exon2-90 -1 1 90
K8 Intron 2 K8 Exon3K8 Exon2 X X X-90 -1 1 90
F+ +
+ +-
---
pK8wt pK8ccct
- +- +--
--
--
ICP27
Tubulin
K8 Intron 2ICP34.5 Exon2ICP34.5 Exon 1
-90 -1 1 29
-1
X X 18 X X 19-170 1 89-1
18 19-170 1 89-1
X X 18 X X 19-170 1 89-1
X X 18 X X
18 -170 1 89-1
18 -170 1 89-1
X 19 X-170 1 89-1
18 19pATXN2L-18-19-170 1 89-1
ICP27? ?5’ss5’
CAP
5’ss
U1
CPSF
snRNP
AAUAAAPAS
U2SAP
145snRNP
CCCC(U)
I
3’ss
CTD
CCCCCCGCUCCCCGCCCGC
AAACAAGCUCCCCGCCCGCAAACAAGCUAAAAGCCCGC
CCAGCCAUGAUGCAGCCCAUGGCCCACUACCCCUC
CAAGCAAUGAUGCAGCACAUGGCAGACUACGAGUC
CAG/GUGACU CUCCUCUCUCUGUCCCGCCAG/CCGGCAG/GUAAGU
CUCCUCUCUCUUUCCCUCCAG/GUCC
X X X
X X X
X X X
CUCCUCUCUCUUUCCCUCCAG/GUCCCAG/GUAAGUCAG/GUAAGU
UUUUCCCUCCAG/GUCC
pK8wtpK8cct
pICP34.5-K8
pICP34.5-K8
pK8exon2
C-Box1M
C-Box1M
C-Box1-2M
C-Box1-2M
pFlagpICP27pBS27
pFlagpICP27
pFlagpICP27pΔRR2
pFlagpICP27
CCCC(U)
ICP27
Fig. 4. Suboptimal splice sites and C-rich sequences mediate
splicing inhibition by ICP27. (A, C, E, and G) Reporters used in B,
D, F, and H, respectively, which showsplicing analysis by RT-PCR of
cells also transfected with HSV-2 ICP27 constructs (Fig. 3D) or
HSV-1 ICP27 (pBS27). (B) Splicing analysis of KSHV K8/HSV-2
ICP34.5constructs. ICP27-mediated splicing inhibition requires
C-rich sequences in the 5′ exon of pICP34.5-K8. (D) Splicing
analysis of ATXNL mutant constructs. ICP27-mediated splicing
inhibition requires C-rich sequences (mutations shown by X) in the
5′ exon of pATXN2L-18-19. (F) Splicing analysis of KSHV K8 exon 2
mutations.Introducing C mutations (at X) in the 5′ exon of an
ICP27-insensitive reporter enhances splicing inhibition by ICP27,
independently of the N-terminal RGG motif.(H) Splicing analysis of
ATXN2L mutants. Optimizing ATXN2L intron 18 splice sites abolishes
ICP27-mediated splicing inhibition. (I) Proposed mechanism of
ICP27-mediated cotranscriptional aberrant pre-mRNA processing.
ICP27 (known to interact with U1 snRNP, U2 snRNP and the Pol II
CTD) may prevent U1 binding to 5′ splicesites near C-rich
sequences, causing inefficient spliceosome assembly and relief of
U1-snRNP-mediated inhibition of CPSF binding to intronic PAS. CPSF,
cleavage andpolyadenylation specificity factor, Pol II CTD, RNA
polymerase II C-terminal domain. Mutations are colored; arrows
denote RT-PCR primers.
12260 | www.pnas.org/cgi/doi/10.1073/pnas.1609695113 Tang et
al.
Dow
nloa
ded
by g
uest
on
Mar
ch 2
9, 2
021
www.pnas.org/cgi/doi/10.1073/pnas.1609695113
potentially be used as a template for future design of
proteinsthat influence cellular gene expression in this manner.
MethodsHEK293 cells were transfected with pICP27 or pFlag vector
by using Lip-ofectamine 2000. More than 95% transfection efficiency
was achieved, asdetermined by fluorescence microscopy of cells
transfected with the sameamount of pEGFP-C1 (Clontech). At 48 h
after transfection, total RNAs werepurified with the All-Prep
DNA/RNA Kit (Qiagen). cDNA libraries were pre-pared from
polyadenylated RNA by using the Truseq RNA Sample Kit V2(Illumina)
and were sequenced on the HiSeq 2500 according to the
manu-facturer’s instructions (Illumina). The two samples shared a
single sequencerlane. The resulting paired-end sequencing data were
first aligned to theHG19 reference human genome by using Partek
Flow and then furtheranalyzed by using the Partek Genomics Suite
according to the softwareinstructions. A total of 19,655 genes were
selected after applying expression-
level filters (≥0.5 fpkm) for both the control (pFlag
vector-transfected sam-ple) and the ICP27 (ICP27-transfected
sample) from a total of 45,000 iden-tified genes. Genes were ranked
by scores of differential expression. Theexpression profile of each
of the first 12,000 genes for both control and ICP27samples was
visually examined. Other methods are described in SI Materialsand
Methods.
Supporting information includes SI Materials and Methods, Figs.
S1–S8,and Tables S1 and S2.
ACKNOWLEDGMENTS. We thank Drs. Keith Peden and Haruhiko Murata
forcritical reading of the manuscript; Dr. Rong Wang for performing
the RNA-seq; Dr. Haiyan Lei for help with Partek Flow software; Dr.
Stephen Rice forproviding the HSV-1 ICP27 mutant viruses and
expression plasmids and HSV-1strain KOS; Dr. Masatoshi Hagiwara for
providing the HSV-2 ICP27 expressionplasmids; and Dr. Zhiming Zheng
for providing the KSHV K8 expression plasmid.This study was
supported by the Center for Biologics Evaluation and
Research’sintramural research program.
1. Roizman B, Knipe DM, Whitley RJ (2013) Herpes simplex
viruses. Fields Virology, edsKnipe D, Howley PM (Lippincott,
Philadelphia), 6th ed, vol 2, pp 1823–1897.
2. Zhou C, Knipe DM (2002) Association of herpes simplex virus
type 1 ICP8 and ICP27proteins with cellular RNA polymerase II
holoenzyme. J Virol 76(12):5893–5904.
3. Dai-Ju JQ, Li L, Johnson LA, Sandri-Goldin RM (2006) ICP27
interacts with the C-ter-minal domain of RNA polymerase II and
facilitates its recruitment to herpes simplexvirus 1 transcription
sites, where it undergoes proteasomal degradation during
in-fection. J Virol 80(7):3567–3581.
4. Tunnicliffe RB, et al. (2015) The structure of the folded
domain from the signaturemultifunctional protein ICP27 from herpes
simplex virus-1 reveals an intertwined dimer.Sci Rep 5:11234.
5. Patel V, et al. (2015) Structure of the C-terminal domain of
the multifunctional ICP27protein from herpes simplex virus 1. J
Virol 89(17):8828–8839.
6. Sandri-Goldin RM, Hibbard MK (1996) The herpes simplex virus
type 1 regulatoryprotein ICP27 coimmunoprecipitates with anti-Sm
antiserum, and the C terminusappears to be required for this
interaction. J Virol 70(1):108–118.
7. Phelan A, Carmo-Fonseca M, McLaughlan J, Lamond AI, Clements
JB (1993) A herpessimplex virus type 1 immediate-early gene
product, IE63, regulates small nuclear ri-bonucleoprotein
distribution. Proc Natl Acad Sci USA 90(19):9056–9060.
8. Bryant HE, Wadd SE, Lamond AI, Silverstein SJ, Clements JB
(2001) Herpes simplexvirus IE63 (ICP27) protein interacts with
spliceosome-associated protein 145 and in-hibits splicing prior to
the first catalytic step. J Virol 75(9):4376–4385.
9. Escudero-Paunetto L, Li L, Hernandez FP, Sandri-Goldin RM
(2010) SR proteins SRp20 and 9G8contribute to efficient export of
herpes simplex virus 1 mRNAs. Virology 401(2):155–164.
10. Sandri-Goldin RM, Hibbard MK, Hardwicke MA (1995) The
C-terminal repressor re-gion of herpes simplex virus type 1 ICP27
is required for the redistribution of smallnuclear
ribonucleoprotein particles and splicing factor SC35; however,
these alter-ations are not sufficient to inhibit host cell
splicing. J Virol 69(10):6063–6076.
11. Sciabica KS, Dai QJ, Sandri-Goldin RM (2003) ICP27 interacts
with SRPK1 to mediate HSVsplicing inhibition by altering SR protein
phosphorylation. EMBO J 22(7):1608–1619.
12. Koffa MD, et al. (2001) Herpes simplex virus ICP27 protein
provides viral mRNAs withaccess to the cellular mRNA export
pathway. EMBO J 20(20):5769–5778.
13. Mears WE, Rice SA (1998) The herpes simplex virus
immediate-early protein ICP27shuttles between nucleus and
cytoplasm. Virology 242(1):128–137.
14. Rutkowski AJ, et al. (2015) Widespread disruption of host
transcription termination inHSV-1 infection. Nat Commun 6:7126.
15. Ellison KS, Rice SA, Verity R, Smiley JR (2000) Processing
of alpha-globin and ICP0 mRNAin cells infected with herpes simplex
virus type 1 ICP27mutants. J Virol 74(16):7307–7319.
16. Sedlackova L, et al. (2008) Herpes simplex virus type 1
ICP27 regulates expression of a variant,secreted form of
glycoprotein C by an intron retention mechanism. J Virol
82(15):7443–7455.
17. Park D, Lalli J, Sedlackova-Slavikova L, Rice SA (2015)
Functional comparison of herpessimplex virus 1 (HSV-1) and HSV-2
ICP27 homologs reveals a role for ICP27 in virionrelease. J Virol
89(5):2892–2905.
18. Tang S, Guo N, Patel A, Krause PR (2013) Herpes simplex
virus 2 expresses a novel formof ICP34.5, a major viral
neurovirulence factor, through regulated alternative splicing.J
Virol 87(10):5820–5830.
19. Davis KL, Korom M, Morrison LA (2014) Herpes simplex virus 2
ICP34.5 confers neu-rovirulence by regulating the type I interferon
response. Virology 468-470:330–339.
20. Nojima T, et al. (2009) Herpesvirus protein ICP27 switches
PML isoform by alteringmRNA splicing. Nucleic Acids Res
37(19):6515–6527.
21. Murn J, et al. (2015) Control of a neuronal morphology
program by an RNA-bindingzinc finger protein, Unkempt. Genes Dev
29(5):501–512.
22. Mears WE, Rice SA (1996) The RGG box motif of the herpes
simplex virus ICP27 protein me-diates an RNA-binding activity and
determines in vivo methylation. J Virol 70(11):7445–7453.
23. Marcet-Palacios M, et al. (2011) Granzyme B inhibits
vaccinia virus production through pro-teolytic cleavage of
eukaryotic initiation factor 4 gamma 3. PLoS Pathog
7(12):e1002447.
24. Hsin JP, Manley JL (2012) The RNA polymerase II CTD
coordinates transcription andRNA processing. Genes Dev
26(19):2119–2137.
25. Spencer CA, Dahmus ME, Rice SA (1997) Repression of host RNA
polymerase II tran-scription by herpes simplex virus type 1. J
Virol 71(3):2031–2040.
26. Kaehler C, et al. (2012) Ataxin-2-like is a regulator of
stress granules and processingbodies. PLoS One 7(11):e50134.
27. Zhu L, et al. (2009) Patterns of exon-intron architecture
variation of genes in eu-karyotic genomes. BMC Genomics 10:47.
28. Tang S, Zheng ZM (2002) Kaposi’s sarcoma-associated
herpesvirus K8 exon 3 contains three5′-splice sites and harbors a
K8.1 transcription start site. J Biol Chem 277(17):14547–14556.
29. Yamanegi K, Tang S, Zheng ZM (2005) Kaposi’s
sarcoma-associated herpesvirusK8beta is derived from a spliced
intermediate of K8 pre-mRNA and antagonizesK8alpha (K-bZIP) to
induce p21 and p53 and blocks K8alpha-CDK2 interaction. J
Virol79(22):14207–14221.
30. Dobrikova E, Shveygert M, Walters R, Gromeier M (2010)
Herpes simplex virus pro-teins ICP27 and UL47 associate with
polyadenylate-binding protein and control itssubcellular
distribution. J Virol 84(1):270–279.
31. McGregor F, Phelan A, Dunlop J, Clements JB (1996)
Regulation of herpes simplexvirus poly (A) site usage and the
action of immediate-early protein IE63 in the early-late switch. J
Virol 70(3):1931–1940.
32. Perkins KD, Gregonis J, Borge S, Rice SA (2003)
Transactivation of a viral target geneby herpes simplex virus ICP27
is posttranscriptional and does not require the en-dogenous
promoter or polyadenylation site. J Virol 77(18):9872–9884.
33. Hann LE, Cook WJ, Uprichard SL, Knipe DM, Coen DM (1998) The
role of herpessimplex virus ICP27 in the regulation of UL24 gene
expression by differential poly-adenylation. J Virol
72(10):7709–7714.
34. Kaida D, et al. (2010) U1 snRNP protects pre-mRNAs from
premature cleavage andpolyadenylation. Nature
468(7324):664–668.
35. Berg MG, et al. (2012) U1 snRNP determines mRNA length and
regulates isoformexpression. Cell 150(1):53–64.
36. Almada AE, Wu X, Kriz AJ, Burge CB, Sharp PA (2013) Promoter
directionality iscontrolled by U1 snRNP and polyadenylation
signals. Nature 499(7458):360–363.
37. Corbin-Lickfett KA, Souki SK, Cocco MJ, Sandri-Goldin RM
(2010) Three arginineresidues within the RGG box are crucial for
ICP27 binding to herpes simplex virus 1GC-rich sequences and for
efficient viral RNA export. J Virol 84(13):6367–6376.
38. Corbin-Lickfett KA, Chen IH, Cocco MJ, Sandri-Goldin RM
(2009) The HSV-1 ICP27 RGGbox specifically binds flexible, GC-rich
sequences but not G-quartet structures. NucleicAcids Res
37(21):7290–7301.
39. Elkon R, Ugalde AP, Agami R (2013) Alternative cleavage and
polyadenylation: Ex-tent, regulation and function. Nat Rev Genet
14(7):496–506.
40. Lykke-Andersen S, Jensen TH (2015) Nonsense-mediated mRNA
decay: An intricatemachinery that shapes transcriptomes. Nat Rev
Mol Cell Biol 16(11):665–677.
41. Shu M, Taddeo B, Zhang W, Roizman B (2013) Selective
degradation of mRNAs by theHSV host shutoff RNase is regulated by
the UL47 tegument protein. Proc Natl Acad SciUSA
110(18):E1669–E1675.
42. Taddeo B, Zhang W, Roizman B (2013) The herpes simplex virus
host shutoff RNasedegrades cellular and viral mRNAs made before
infection but not viral mRNA madeafter infection. J Virol
87(8):4516–4522.
43. Wu N, Watkins SC, Schaffer PA, DeLuca NA (1996) Prolonged
gene expression and cellsurvival after infection by a herpes
simplex virus mutant defective in the immediate-early genes
encoding ICP4, ICP27, and ICP22. J Virol 70(9):6358–6369.
44. Gillis PA, Okagaki LH, Rice SA (2009) Herpes simplex virus
type 1 ICP27 induces p38 mito-gen-activated protein kinase
signaling and apoptosis in HeLa cells. J Virol 83(4):1767–1777.
45. Kolb AW, Lee K, Larsen I, Craven M, Brandt CR (2016)
Quantitative trait locus basedvirulence determinant mapping of the
HSV-1 genome in murine ocular infection:Genes involved in viral
regulatory and innate immune networks contribute to viru-lence.
PLoS Pathog 12(3):e1005499.
46. Johnson KE, Song B, Knipe DM (2008) Role for herpes simplex
virus 1 ICP27 in theinhibition of type I interferon signaling.
Virology 374(2):487–494.
47. Melchjorsen J, Sirén J, Julkunen I, Paludan SR, Matikainen S
(2006) Induction of cy-tokine expression by herpes simplex virus in
human monocyte-derived macrophagesand dendritic cells is dependent
on virus replication and is counteracted by ICP27targeting
NF-kappaB and IRF-3. J Gen Virol 87(Pt 5):1099–1108.
48. Stingley SW, et al. (2000) Global analysis of herpes simplex
virus type 1 transcriptionusing an oligonucleotide-based DNA
microarray. J Virol 74(21):9916–9927.
49. Kim JC, et al. (2008) HSV-1 ICP27 suppresses NF-kappaB
activity by stabilizingIkappaBalpha. FEBS Lett
582(16):2371–2376.
50. Yeo G, Burge CB (2004) Maximum entropy modeling of short
sequence motifs withapplications to RNA splicing signals. J Comput
Biol 11(2-3):377–394.
51. Frith MC, Saunders NF, Kobe B, Bailey TL (2008) Discovering
sequence motifs witharbitrary insertions and deletions. PLoS Comput
Biol 4(4):e1000071.
Tang et al. PNAS | October 25, 2016 | vol. 113 | no. 43 |
12261
MICRO
BIOLO
GY
Dow
nloa
ded
by g
uest
on
Mar
ch 2
9, 2
021
http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1609695113/-/DCSupplemental/pnas.201609695SI.pdf?targetid=nameddest=STXThttp://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1609695113/-/DCSupplemental/pnas.201609695SI.pdf?targetid=nameddest=STXThttp://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1609695113/-/DCSupplemental/pnas.201609695SI.pdf?targetid=nameddest=STXThttp://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1609695113/-/DCSupplemental/pnas.201609695SI.pdf?targetid=nameddest=SF1http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1609695113/-/DCSupplemental/pnas.201609695SI.pdf?targetid=nameddest=SF8http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1609695113/-/DCSupplemental/pnas.201609695SI.pdf?targetid=nameddest=ST1http://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1609695113/-/DCSupplemental/pnas.201609695SI.pdf?targetid=nameddest=ST2
