• Home

  • Documents

  • gRNA/shRNA hit distribution (CML-P cell line) 100% 60% ... · 60% hits/gene gRNA shRNA gRNA/shRNA...
1

gRNA/shRNA hit distribution (CML-P cell line) 100% 60% ... · 60% hits/gene gRNA shRNA gRNA/shRNA hit distribution (CML-R cell line) 100% hits/gene shRNA RNAi/CRlSPR: shared Gene

  • Upload
    others

  • View
    8

  • Download
    0

Embed Size (px)

Citation preview

Page 1: gRNA/shRNA hit distribution (CML-P cell line) 100% 60% ... · 60% hits/gene gRNA shRNA gRNA/shRNA hit distribution (CML-R cell line) 100% hits/gene shRNA RNAi/CRlSPR: shared Gene

Improved delivery of Cas9 protein/gRNA complexes …...ORIGINAL RESEARCH PAPER Improved delivery of Cas9 protein/gRNA complexes using lipofectamine CRISPRMAX Xin Yu . Xiquan Liang

Improved delivery of Cas9 protein/gRNA complexes …...ORIGINAL RESEARCH PAPER Improved delivery of Cas9 protein/gRNA complexes using lipofectamine CRISPRMAX Xin Yu . Xiquan Liang

Documents
Oligo sequence for shRNA cloning TurboGFP shRNA upper strand CCGGCGTGATCTTCACCGACAAGATCTCGAGATCTTGTC…

Oligo sequence for shRNA cloning TurboGFP shRNA upper strand CCGGCGTGATCTTCACCGACAAGATCTCGAGATCTTGTC…

Documents
CRISPR / Cas9-mediated Gene Knockout to Address Primary ... · LNP-based liver knockout approach is limited to 20-mer of gRNA Potential to treat PH1 with either: 1. CRISPR / Cas9-mediated

CRISPR / Cas9-mediated Gene Knockout to Address Primary ... · LNP-based liver knockout approach is limited to 20-mer of gRNA Potential to treat PH1 with either: 1. CRISPR / Cas9-mediated

Documents
Inducible Dharmacon TRIPZ Lentiviral shRNA · IRES PuroR WPRE shRNA AmpR pUCori SV40 ori UBC pTRIPZ 5 ʹ 3' SIN LT R 3 ʹ SI N LT R Ψ RRE tRFP TRE rtTA3 IRES PuroR WPRE shRNA hCMV

Inducible Dharmacon TRIPZ Lentiviral shRNA · IRES PuroR WPRE shRNA AmpR pUCori SV40 ori UBC pTRIPZ 5 ʹ 3' SIN LT R 3 ʹ SI N LT R Ψ RRE tRFP TRE rtTA3 IRES PuroR WPRE shRNA hCMV

Documents
Supplementary Information for - PNAS · 2020. 2. 22. · shRNA-resistant CPSF6 (GenBank NM_007007.2; synonymous mutations in the nucleotide sequence targeted by CPSF6 shRNA were introduced)

Supplementary Information for - PNAS · 2020. 2. 22. · shRNA-resistant CPSF6 (GenBank NM_007007.2; synonymous mutations in the nucleotide sequence targeted by CPSF6 shRNA were introduced)

Documents
One step generation of customizable gRNA vectors for

One step generation of customizable gRNA vectors for

Documents
CRISPR / Cas9-mediated Gene Knockout to Address Primary … · 2020. 4. 29. · LNP-based liver knockout approach is limited to 20-mer of gRNA Potential to treat PH1 with either:

CRISPR / Cas9-mediated Gene Knockout to Address Primary … · 2020. 4. 29. · LNP-based liver knockout approach is limited to 20-mer of gRNA Potential to treat PH1 with either:

Documents
shRNA: The Basics Einstein Presentation Title...2012/02/29  · Einstein Presentation Title Albert Einstein College of Medicine Presentation Subtitle shRNA: The Basics! Deborah Smith,

shRNA: The Basics Einstein Presentation Title...2012/02/29  · Einstein Presentation Title Albert Einstein College of Medicine Presentation Subtitle shRNA: The Basics! Deborah Smith,

Documents
CUGA 7 gRNA Synthesis Kit...別冊 参考資料（CUGA® 7 gRNA Synthesis Kit） 1 はじめに CUGA® 7 gRNA Synthesis Kit は、ゲノム編集に必要なガイドRNA（guide RNA,

CUGA 7 gRNA Synthesis Kit...別冊 参考資料（CUGA® 7 gRNA Synthesis Kit） 1 はじめに CUGA® 7 gRNA Synthesis Kit は、ゲノム編集に必要なガイドRNA（guide RNA,

Documents
Cas9/gRNA-mediated genome editing of yeast …Cas9/gRNA-mediated genome editing of yeast mitochondria and Chlamydomonas chloroplasts Byung-Chun Yoo, Narendra S. Yadav, Emil M. Orozco

Cas9/gRNA-mediated genome editing of yeast …Cas9/gRNA-mediated genome editing of yeast mitochondria and Chlamydomonas chloroplasts Byung-Chun Yoo, Narendra S. Yadav, Emil M. Orozco

Documents
PLATINUM Select MLP Retroviral shRNA-mir - transOMIC · Platinum Select MLP Retroviral shRNA-mir collections are available as individual constructs, target gene sets, gene families

PLATINUM Select MLP Retroviral shRNA-mir - transOMIC · Platinum Select MLP Retroviral shRNA-mir collections are available as individual constructs, target gene sets, gene families

Documents
Brown, Cheryl Yvette; Sadlon, Timothy John; Gargett, Tessa ...€¦ · Title: Robust, reversible gene knockdown using a single lentiviral shRNA vector Authors: Cheryl Y. Brown1, Timothy

Brown, Cheryl Yvette; Sadlon, Timothy John; Gargett, Tessa ...€¦ · Title: Robust, reversible gene knockdown using a single lentiviral shRNA vector Authors: Cheryl Y. Brown1, Timothy

Documents
CRISPR-dCas9 complex Detectiontime: 5 min Target Gene DNA … · 2019. 3. 25. · Graphene Graphene-based Field Channel Effect Transistor Cartridge DNA Sample Target Gene gRNA dCAS9-Ghraphene

CRISPR-dCas9 complex Detectiontime: 5 min Target Gene DNA … · 2019. 3. 25. · Graphene Graphene-based Field Channel Effect Transistor Cartridge DNA Sample Target Gene gRNA dCAS9-Ghraphene

Documents
Multidimensional pooled shRNA screens in human THP-1 cells

Multidimensional pooled shRNA screens in human THP-1 cells

Documents
GRNA NATURAL RESOURCES MANAGEMENT PLAN 2020-2025 · 2020. 11. 19. · 2020 Draft 4.4 file = GRNANatResMgtPlanD4.4_RH_20200208 2020-2025 GRNA Natural Resources Management Plan Page

GRNA NATURAL RESOURCES MANAGEMENT PLAN 2020-2025 · 2020. 11. 19. · 2020 Draft 4.4 file = GRNANatResMgtPlanD4.4_RH_20200208 2020-2025 GRNA Natural Resources Management Plan Page

Documents
Invitrogen TrueGuide Synthetic gRNA · TrueGuide™ Synthetic Guide RNA User Guide 3 Prepare working stock of TrueGuide™ Synthetic gRNA 1.Before opening, centrifuge each TrueGuide

Invitrogen TrueGuide Synthetic gRNA · TrueGuide™ Synthetic Guide RNA User Guide 3 Prepare working stock of TrueGuide™ Synthetic gRNA 1.Before opening, centrifuge each TrueGuide

Documents
CRISPR SYSTEM DESIGN GUIDE gRNA RNAs · 2020-06-26 · CRISPR-mediated knock-out screens are a powerful tool to investigate gene function directly in mammalian cells. Genes of interest

CRISPR SYSTEM DESIGN GUIDE gRNA RNAs · 2020-06-26 · CRISPR-mediated knock-out screens are a powerful tool to investigate gene function directly in mammalian cells. Genes of interest

Documents
AAV-1 Helper Free shRNA Expression System (GFP)

AAV-1 Helper Free shRNA Expression System (GFP)

Documents
shRNA Lentiviral Packaging Service - System Biosciences · 2019-09-27 · shRNA. Why choose SBI ? SBI’s custom service scientists have significant packaging expertise and over 10

shRNA Lentiviral Packaging Service - System Biosciences · 2019-09-27 · shRNA. Why choose SBI ? SBI’s custom service scientists have significant packaging expertise and over 10

Documents
Gene editing and modulation tools for long non-coding RNA ... · GENE EDITING AND MODULATION TOOLS FOR LONG NON-CODING RNA APPLICATIONS P2 5. Functional Validation of Dual-gRNA Vector

Gene editing and modulation tools for long non-coding RNA ... · GENE EDITING AND MODULATION TOOLS FOR LONG NON-CODING RNA APPLICATIONS P2 5. Functional Validation of Dual-gRNA Vector

Documents
PLATINUM Select TM shRNA-mir - transOMIC 1. Harnessing the endogenous microRNA pathway to trigger RNAi. Green cartoons (on the right) show where siRNA, shRNA and shRNA-mir enter

PLATINUM Select TM shRNA-mir - transOMIC 1. Harnessing the endogenous microRNA pathway to trigger RNAi. Green cartoons (on the right) show where siRNA, shRNA and shRNA-mir enter

Documents
Design high specificity CRISPR-Cas9 gRNAs: principles and ... · Similar principle as gRNA design for wild-type Cas9 Two gRNAs are needed to target each strand of the target gene

Design high specificity CRISPR-Cas9 gRNAs: principles and ... · Similar principle as gRNA design for wild-type Cas9 Two gRNAs are needed to target each strand of the target gene

Documents
Genome-wide shRNA screening identifies genes involved in fulvestrant … · Pedro André Dias Ramos Licenciatura em Bioquímica Genome-wide shRNA screening identifies genes involved

Genome-wide shRNA screening identifies genes involved in fulvestrant … · Pedro André Dias Ramos Licenciatura em Bioquímica Genome-wide shRNA screening identifies genes involved

Documents
pGreenPuro™ shRNA Cloning and Expression Lentivector · Cloning and Expression Vector. Specifically, it provides critical instructions on designing and synthesizing shRNA templates,

pGreenPuro™ shRNA Cloning and Expression Lentivector · Cloning and Expression Vector. Specifically, it provides critical instructions on designing and synthesizing shRNA templates,

Documents
shRNA Feb 2013

shRNA Feb 2013

Documents
NIH Public Access Cancer Gene Ther B Guo …...Targeted therapy via oral administration of attenuated Salmonella expression plasmid-vectored Stat3-shRNA cures orthotopically transplanted

NIH Public Access Cancer Gene Ther B Guo …...Targeted therapy via oral administration of attenuated Salmonella expression plasmid-vectored Stat3-shRNA cures orthotopically transplanted

Documents
Coupling shRNA screens with single-cell RNA-Seq identifies

Coupling shRNA screens with single-cell RNA-Seq identifies

Documents
shERWOOD UltramiR Retroviral shRNA (pLMN) - … · shERWOOD UltramiR Retroviral shRNA (pLMN) ... Neomycin selection (Neomycin kill curve) The pLMN retroviral vector has a neomycin

shERWOOD UltramiR Retroviral shRNA (pLMN) - … · shERWOOD UltramiR Retroviral shRNA (pLMN) ... Neomycin selection (Neomycin kill curve) The pLMN retroviral vector has a neomycin

Documents
shERWOOD - UltramiR shRNA Collections - … - UltramiR shRNA Collections Incorporating advances in shRNA design and processing for superior potency and specificity s h E R W OO D -

shERWOOD - UltramiR shRNA Collections - … - UltramiR shRNA Collections Incorporating advances in shRNA design and processing for superior potency and specificity s h E R W OO D -

Documents
static-content.springer.com10.1245... · Web viewThe National RNAi Core Facility, Academia Sinica provided CDC25A, PDCD4, c-Myc, and IκBα shRNA. The target sequences for shRNA are

static-content.springer.com10.1245... · Web viewThe National RNAi Core Facility, Academia Sinica provided CDC25A, PDCD4, c-Myc, and IκBα shRNA. The target sequences for shRNA are

Documents