Greetings to All on Behalf of My Mother Land India

Agronomic Investigation of New Microbial Isolates as Biofertilizers in Sweet Potato

(Ipomoea batatas L. Lam) Grown in an Ultisol of India

K. Susan John, Neetha Soma John and I.P. Anjana DeviCentral Tuber Crops Research Institute (CTCRI)

(Indian Council of Agricultural Research), Thiruvananthapuram, Kerala, India, email: susanctcri@gmail.com

3

1

2

4

5

8

6 7

9

101. TNAU, Coimbatore2. ANGRAU, Hyderabad3. KKV, Dapoli4. NAU, Navasari5. IGKV, Jagadalpur6. NDUA&T, Faizabad7. RAU, Dholi8. BAU, Ranchi9. BCKV, Kalyani10. AAU, Jorhat11. ICAR RC NEH, Shillong12. CARI, Port Blair13. CAU, Imphal14. MPUAT, Udaipur15. UAS, Dharwad16. CTCRI, HQ17. CTCRI, RC

ALL INDIA NET WORK ON TUBER CROPSStarted during 1968

11

12

13

14

15

16

17

The sole institute in the world exclusively dedicated to researcThe sole institute in the world exclusively dedicated to research on h on Tropical Tuber Crops Tropical Tuber Crops

Head quarters Thiruvananthapuram, Kerala

Regional centre Bhubaneswar, Orissa

Research carried out under 5 DivisionsDivision of Crop Improvement Division of Crop ProductionDivision of Crop Protection Division of Crop UtilizationSection of Social Sciences

Cassava( Manihot esculenta Crantz)Sweet potato( Ipomoea batatas Lam L.)

Yams(Dioscorea sp.)

Elephant foot yam(Amorphophalluspaeonifolius)

Taro(Colocasia sp.)

Tannia (Xanthosoma sagittifolium)

Arrowroot(Maranta arundinaceae)

(Coleus rotundifolius)

MANDATETo undertake basic, strategic and applied research for generating technologies to enhance productivity and utilisation potential of tuber crops viz., cassava, sweet potato, yams, aroids (EFY, taro, tannia), coleus and yam bean (other than potato)

To act as a national repository of scientific information on tuber crops

To coordinate network research with State Agricultural Universities for generating location specific technologies

To act as a centre of human resources development for various clientele systems involved in tuber crops research and development

To undertake transfer of tuber crops technologies through consultancy, outreach programmes and linkage with developmental agencies

"Greater emphasis on tuberous crops such as potato, tapioca and sweet potato to make them available at cheaper rates"

Dr. A P J Abdul Kalam(Former president of India)

3

1

2

4

5

8

6 7

9

101. TNAU, Coimbatore2. ANGRAU, Hyderabad3. KKV, Dapoli4. NAU, Navasari5. IGKV, Jagadalpur6. NDUA&T, Faizabad7. RAU, Dholi8. BAU, Ranchi9. BCKV, Kalyani10. AAU, Jorhat11. ICAR RC NEH, Shillong12. CARI, Port Blair13. CAU, Imphal14. MPUAT, Udaipur15. UAS, Dharwad16. CTCRI, HQ17. CTCRI, RC

ALL INDIA NET WORK ON TUBER CROPSStarted during 1968

11

12

13

14

15

16

17

IntroductionSweet potato is grown in the tropics and warm temperate regions of the world

Globally, grown in developing countries in an area of 9 mha having a production of 124 mt with a productivity of 13.7 t ha-1 (FAOSTAT, 2006)

China ranks first in area (4.7 m ha) and production (70 m t) with a productivity of 14 t ha-1 (FAOSTAT, 2001)

Third most important tuber crop in India after potato and cassava

India occupies 12th, 8th and 5th rank globally in terms of area, production and productivity with an area of 0.14 mha, production 1.21 mt and productivity 8.87 t ha-1(CMIE,2006)

In India, grown in Orissa, West Bengal, Uttar Pradesh, Bihar and Jharkand accounting 77% of area and 82% of production

In Kerala, it is grown in an area of 505 ha with a production of 6405 t and productivity is 12.68 t ha-1 ( Farm guide,2009)

SWEET POTATO GROWING BELT OF INDIA

Facts about sweet potatoNo. of varieties released from CTCRI-27

Propagation through vine cuttings

Method of planting-Mounds, ridges, furrows and flat beds

Nutrient management-NPK@50:25:50 kg ha-1+ FYM @5 t ha-1

Major pest- Sweet potato weevil- Mass trapping of adult weevils using sex pheromone

Post harvest utilization- Roots and leaves as human food and roots and vines as animal feed

Processed into industrial starch, alcohol, noodles and other products viz., jam, jelly, pickles, squashes etc.,

Has an average protein content comparable to that of rice (1.3-10.0% on DWB) (Purcell et al., 1972)

It is also a good source of Ca, ascorbic acid, and ß- carotene.

Orange fleshed sweet potato contains β carotene and anthocyanin which are cheap source of vitamin A and antioxidants

Orange fleshed sweet potato can combat vitamin A deficiency in developing countries ( Harvest plus Programme)

ST-14Sree Kanaka

β carotene 8 mg/100gβ carotene 10.50 mg/100g

Orange- fleshed sweet potato

Some sweet potato varieties released from CTCRI

Sree Arun

N fixers, P solubilizers and K mobilizers are the most beneficial soil microorganisms for use as biofertilizers in agriculture

The main objective of using biofertilizers is to reduce fertilizer quantity there by reduce the cost of production and an eco-friendly practice

Exploitation of agro-biodiversity for identifying useful microorganisms for nutrient management as well as biocontrol is a thrust area in the present day agriculture to substitute for chemical fertilizers and pesticides and to maintain soil health

ObjectiveTo screen, isolate, identify and characterize potent N fixers and P solubilizers from the biodiversity hot spots of Western ghats ofKerala and to agronomically evaluate their efficacy as a substitute to chemical fertilizers in sweet potato to enhance growth and yield

Significance of the present study

Methodologya. Microbiological work

Survey and collection of soil samples - High biodiversity hot spot areas of South IndiaMicrobial ( bacteria, fungi & actinomycetes) enumeration - Serial dilution and plate countingFrom the bacterial population, screening for P solubilizers -Pikovskaya’s agar mediaN fixers - Jensen’s nitrogen free solid mediumP solubilizing capacity- Vanado molybdo phosphoric yellow colour method N fixing capacity - Kjeldhal method

b. Preparation of biofertilizer

Mass multiplication of potent isolates 100 ml of the broth containing the isolates mixed with sand and charred rice husk (1:4) aseptically

Sampling locations –AGASTHYAMALAI RANGES

Trivandrum

Palode RF

Pechiparai RF

Kulathupuzha RF

Neyyar RF

Kalakkad RF

Kollam

Nagarcoil

Thenmala RF

Lower Kothayar RFKothayar RFAryan Kau RF

Ponmudi RF

Kottur ExtensionKottur RF

Peppara RF

c. Molecular characterization of the biofertilizer microbes

Isolation of the genomic DNA (Sambrook et al. 1989)

Amplification of 16s rDNA - Forward 8F primer 5'AGAGTTTGATCCTGGCTCAG3' and reverse 1492R primer 5'CGGCTACCTTGTTACGACTT3’ (Babu et al. 2004)

Agarose Gel Electrophoresis (AGE) with 100 bp marker (NE Biolabs)

The band cut, eluted and purified using the QIA quick gel extraction kit, QIAGEN

Sequencing of the eluted product - Genei, Bangalore

Sequence analysis - National Centre of Biotechnology Information (NCBI) database -Basic Local Alignment Search Tool (BLAST)

Treatment details of the pot experimentTreat Treatments

T1 Soil test based fertilizer (STBF) recommendation (NPK@ 39:0:41.5 kg ha‐1)T2 Package of Practice (POP) recommendation for sweet potato (NPK @ 50:25:50 kg ha‐1)

T3 Phosphate  solubilizing bacteria aloneT4 STBF + biofertilizer (PSB) (NPK@ 39:0:41.5 kg ha‐1)T5 NK + ¼ P + biofertilizer  (NK @ 50:50 kgha‐1 + P@ ¼ of 25 kgha‐1)T6 NK + ½ P + biofertilizer    (NK @ 50:50 kgha‐1+P@ ½ of 25 kgha‐1)T7 NK + ¾ P +biofertilizers    (NK@ 50:50 kgha‐1+ P@ ¾ of 25 kgha‐1)T8 NK @ 50:50 kgha‐1 + biofertilizerT9 Absolute control

d. Agronomic investigation of the bio fertilizer efficacy

1. P solubilizera. Controlled condition experiment in pots

No. of treatments - 9 Replication - 3 Design – CRDInitial status

Organic carbon-1.36%, Available P-184 kg ha-1, Exchangeable K-159 kg ha-1

Quantity of N- 78%, Available P-0, Exchangeable K-83% of POP rate (Aiyer,Nair,1985)

A View of the Pot Experiment

Treatment details

T1-STBF T2 - POP T3 - PSB -1 T4 - PSB-2

T5 - POP+PSB-1 T6 - POP+PSB-2 T7- 25 %P+ PSB-1

T8- 25 %P+ PSB-2 T9 - 50 % P + PSB-1 T10 - 50% P + PSB-2

T11 - 75% P+PSB-1 T12 - 75% P+PSB-2

N & K @50:50 kg ha-1

b. Field experimentDesign-RBD Treatments -12 Replication- 2 No. of seasons- 2

A View of the Field Experiment

d. Agronomic investigation of the biofertilizer efficacy1. N fixer

a. Controlled condition experiments in potsNo. of treatments - 8 Replication - 3 Design - CRD

Initial status Organic carbon- 0.26%, Av. P- 216.16 kg ha-1, Exch. K- 303.52 kg ha-1

Quantity of N-117%, P- 0, K- 48% of POP rate ( Aiyer and Nair,1985)

Treat. No. Treatments

T1 Soil test based ferlilizer (STBF) recommendation (NPK @ 58.5:0:24 kg ha-1)T2 POP recommendation for sweet potato (NPK@ 50:25:50 kg ha-1)T3 N fixer alone

T4 N fixer + STBF (NPK@58.5:0:24 kg ha-1)T5 N fixer + N(3/4 of STBF), P, K (STBF) i.e. (NPK @44:0:24 kg ha-1)T6 N fixer + N(1/2 of STBF), P, K(STBF) i.e. (NPK @29.25:0:24 kg ha-1)

T7 N fixer + N(1/4 of STBF), P, K(STBF) i.e. (NPK @14.6:0:24 kg ha-1)

T8 Absolute control

ResultsNo. of microbes isolated- 505

No. of bacteria - 341

No. of P solubilizers - 169

No. of N fixers - 194

P solubilization efficacy of the 2 potent isolates

PSB-1- 150 µg g-1 - Enterobacter sp.

PSB-2- 112.5 µg g-1 - Pantoea agglomerans

N fixing capacity of the N fixer bacteria – 4%

- Alcaligenes feacalis

Influence of P solubilizers on tuber yield of sweet potato (pot trial)

Zonation of P solubilizers in Pikovskayas agar medium 16s rDNA amplified product

A View of the Crop Harvest ( P solubilizer field experiment)

TreatmentTuber yield

( t ha-1)

Vine yield

(t ha-1)

Root: shoot ratio

Harvest index

Soil P(kg ha-1)

Tuber P (%)

Vine P

(%)

P solublizers( x 103

cfu g-1

soil)STBF 14.34 15.42 1.57 0.610 32.09 0.234 0.547 256POP 17.59 17.13 2.01 0.665 17.67 0.264 0.553 251PSB -1 10.71 7.50 1.96 0.630 12.15 0.262 0.484 220PSB-2 12.30 16.00 1.47 0.595 14.21 0.278 0.382 210POP+PSB-1 24.92 26.25 1.48 0.595 18.22 0.428 0.551 231POP+PSB-2 9.46 14.67 1.77 0.635 9.76 0.234 0.605 17525 %P+ PSB-1 19.88 28.08 0.95 0.480 20.09 0.219 0.484 11925 %P+ PSB-2 16.46 7.52 3.47 0.775 8.68 0.334 0.531 19450 % P + PSB-1 16.42 20.38 1.42 0.585 15.72 0.253 0.568 21550% P + PSB-2 16.00 20.54 1.60 0.610 30.57 0.352 0.711 16475% P+PSB-1 14.29 14.38 1.49 0.595 27.11 0.184 0.395 15575% P+PSB-2 9.75 11.17 1.01 0.495 11.82 0.267 0.309 188CD 7.097 3.339 1.016 NS 13.06 NS NS NS

Effect of P solubilizers on growth and yield of sweet potato ( Field experiment) (Mean of 2 seasons)

Molecular characterization of N fixer

Influence of N fixer on sweet potato growth

Figure 1 Influence of N fixing bacteria on growth characters of sweet potato

0

20

40

60

80

100

120

140

160

180

200

T1 T2 T3 T4 T5 T6 T7 T8

Treatments

Gro

wth

cha

ract

ers

Vine length(cm) Leaf number Leaf length(cm) Leaf breadth(cm)

Effect of N fixers on tuber yield of sweet potato

For sweet potato, among the two P solubilizers, Enterobacter sp. was more effective

By applying the P solubilizers, P dose can be reduced to 75% of POP

By applying N fixer, N dose can be reduced to 25% of POP

Explored the beneficial effect of new microbial isolates of N fixers and P solubilizers as a substitute to chemical fertilizers

Reducing cost of production, improving P status of the soil

Conclusions

Future Thrust areasFormulation of microbial consortium containing bio fertilizer cum bio

control agents

Agronomic investigation of the bio consortium for nutrient as well as disease management for tropical tuber crops

Popularization and large scale production of the bio consortium as a component of INM strategy for major crops

This paper forms a part of ICAR net work project on ‘ AMAAS ( Application of Microorganisms in Agriculture and Allied Sectos’)

Funding from Indian Council of Agricultural Research

NBAIM ( National Beurea of Agriculturally Important Microorganisms) for the national level coordination of the project

Director, CTCRI, DG & DDG, ICAR for granting permission

ESA for providing an opportunity for oral presentation and for free registration and accommodation for attending the congress

Department of Biotechnology, Govt. of India for international travel grant support

Acknowledgements

Thank you and Welcome to Thank you and Welcome to GodGod’’s Own Country s Own Country