A

ccdwfBp

©

K

1

aapdaet

ases

PP

0d

Available online at www.sciencedirect.com

Journal of Virological Methods 146 (2007) 129–135

Grapevine vitivirus A eradication in Vitis vinifera explants byantiviral drugs and thermotherapy

Alessandra Panattoni a,∗, Federica D’Anna a, Caterina Cristani b, Enrico Triolo a

a Department of Tree Science, Entomology and Plant Pathology “G. Scaramuzzi”, University of Pisa, Italyb Department of Plant Crop Biology, University of Pisa, Italy

Received 28 March 2007; received in revised form 5 June 2007; accepted 11 June 2007Available online 23 July 2007

bstract

Grapevine shoot cultures infected by Grapevine vitivirus A (GVA) were grown on Quorin–Lepoivre basic medium and submitted to in vitrohemotherapy and thermotherapy sanitation techniques. Ribavirin (Rb) at 20 g ml−1, dihydroxypropyladenine (DHPA) at 60 g ml−1 and theirombination (RbDH) were added to the proliferating medium for three subsequent subcultures of 30 days each. Phytotoxicity was observed onrug-treated plantlets, which displayed a high percentage of mortality for each drug at doses higher than those aforementioned. Sequential ELISAere performed at the end of each subculture and ELISA-negative explants were submitted to RT-PCR. ELISA showed no antiviral activity

ollowing DHPA administration. Rb and RbDH treatment produced ELISA-negative explants which were assayed by RT-PCR and nested PCR.

iomolecular results showed no virus eradication in Rb treated explants but RbDH administration generated a percentage (40.0%) of GVA-freelantlets that permitted restoration of a new healthy generation of explants.

Sixty percent (60%) of GVA eradication as confirmed by RT-PCR was obtained by in vitro thermotherapy at 36 ◦C for 57 days.2007 Elsevier B.V. All rights reserved.

y; Viti

raiAraRdrpdh

eywords: Chemotherapy; Dihydroxypropyladenine; Ribavirin; Thermotherap

. Introduction

The detrimental effects of virus infections on the quantitynd quality yield highlight the importance of virus-free prop-gation material and underline the need to produce virus-freelant material for the growth industry in agriculture, in accor-ance with the European Union directives for grapevine. Thusnumber of virus elimination protocols have been set up, in

xperimental conditions only, using several different techniqueso repair infected plants. So far, success rates have been variable.

The ability to control plant viral disease with chemicals hasgreat potential for agriculture where viral diseases caused

ignificant economic losses. However, difficulties have beenncountered in developing effective drugs that eliminate or sub-tantially reduce replication of phytoviruses. In medical therapy,

∗ Corresponding author at: Department of Tree Science, Entomology and Plantathology “G. Scaramuzzi”, Sez. Plant Pathology, Via del Borghetto 80, 56124isa, Italy.

E-mail address: apanatto@agr.unipi.it (A. Panattoni).

a

gtsotie

166-0934/$ – see front matter © 2007 Elsevier B.V. All rights reserved.oi:10.1016/j.jviromet.2007.06.008

s vinifera explant; GVA

esearch into the most rational strategy for the design of drugsgainst specific viral targets appears as an expanding approachn the search for specific antiviral compounds for viral agents.ll the steps included in the viral replication cycles can rep-

esent a target for chemotherapeutic intervention; and therere a number of host enzymes involved in viral DNA andNA synthesis which may be considered targets for antiviralrugs. In one of the reviews on molecular targets for antivi-al drugs in medical research, De Clercq (2001) selected eightotential types of enzymes, including inosine monophosphateehydrogenase (IMPDH) and S-adenosilhomocysteine (SAH)ydrolase, as targets for inhibitors with broad-spectrum antiviralctivity.

IMPDH inhibitors are some of the most extensively investi-ated classes. IMP-dehydrogenase is an enzyme which catalyzeshe conversion of inosine 5′-monophosphate (IMP) to xantho-ine 5′-monophosphate (XMP), in the metabolic branch point

f the purine synthetic pathway. By blocking conversion of IMPo XMP, IMPDH inhibitors constitute a mechanism involvedn the interruption of DNA and RNA synthesis (Franchettit al., 1996). Ribavirin (1-�-d-ribofuranosil-1,2,4-triazolo-3-

1 ologic

cimvpmt

enthcDn(

acL(

hbtIvrh

v(e(t

lcGi

idc(m2tsp

myecle

eb

aav2

VIttP

2

2

Vpa1(maPe

otbbecosWa(to

2

Cc

t

Vd

30 A. Panattoni et al. / Journal of Vir

arbossamide) (Rb) is the first IMPDH inhibitor drug. Ribavirins known as a potent chemotherapeutic agent with a multifacetedode of action, inhibiting both the capping and elongation of

iral mRNA. In particular, it prevents guanosine 5′-phosphateool synthesis and the methylation reaction of the synthesizedRNA cap (Smith, 1984; Lerch, 1987), thereby inhibiting syn-

hesis of viral nucleic acid.S-Adenosilhomocysteine (SAH) hydrolase is another key

nzyme in methylation reactions depending on adenosylmethio-ine (SAM) as the methyl donor, including those methylationshat are required for the maturation of viral mRNAs. SAHydrolase inhibitors can block those reactions involved in theapping of viral mRNA (Borchardt, 1980; De Clercq, 2004).ihydroxypropyladenine ((R,S)-9-(2,3-dihydroxypropyl) ade-ine) (DHPA) is one of the oldest drugs belonging to this groupDe Clercq et al., 1978).

Monette (1983), Stevenson and Monette (1983), Barba etl. (1990) and Mainardi (1993) described the experiences ofhemotherapy with Rb and DHPA, separately, on Vitis vinifera. explants infected by Grapevine leafroll associated virus

GLRaV).The combination of thermotherapy and shoot tip techniques

as been used successfully to eliminate harmful viruses in grape,ut meristematic culture regeneration after heat treatment isime-consuming and at times associated with a low success rate.n vitro infected explants are generally characterized by a higherirus titre compared with in vivo mother plants; thus they rep-esent a rapid and also space-saving technique for obtaining aigher number of infected plantlets, which can then be treated.

Thermotherapy associated with shoot tips on in vitro V.inifera was reported by Monette (1983), Leonhardt et al.1998), Malossini et al. (2003) and Panattoni et al. (2004). Itsfficacy for control of GLRaV and Grapevine fanleaf nepovirusGFLV) varied, with different healing percentages observed inhese studies.

In a field monitoring trial in central Italy, an exceedingly highevel of infection by different viruses was observed in V. viniferav Sagrantino, which excluded the detection of healthy plants.rapevine vitivirus A (GVA) was one of the most frequent single

nfections observed in this cultivar (Materazzi et al., 2004).GVA is implicated in the aetiology of Kober stem groov-

ng (KSG), one of the four economically important grapevineiseases of the rugose wood complex (Saldarelli et al., 2000)ausing severe reduction in growth and yield of affected plantsGarau et al., 1994; Boscia et al., 2001). GVA, which is a typeember of the Vitivirus genus (Martelli, 1997; Dovas and Katis,

003) is considered as a phloem-associated virus with filamen-ous particles of about 800 nm in length, and contains positiveense single-stranded RNA that is capped at the 5′ terminus andolyadenylated at the 3′ end.

Natural sources of resistance to GVA are unknown. Ther-otherapy and meristematic cultures of infected grapevine have

ielded few promising results (Minafra and Boscia, 2003). Wang

t al. (2003) obtained GVA eradication in shoot tips duringryopreservation treatment originally designed as a means ofong-term storage of V. vinifera germoplasm. Recently, Gambinot al. (2006) obtained GVA-free explants through somatic

a82d

al Methods 146 (2007) 129–135

mbryogenesis. In addition, no chemotherapic treatment haseen reported to date on GVA-infected grapevine.

In previous trials treatment with Rb on Nicotiana benthami-na explants was effective against GVA (Panattoni et al., 2000)nd with Tiazofurin (IMPDH inhibitors) administration on initro V. vinifera explants infected by GLRaV-3 (Panattoni et al.,007).

The aim of the present research was to eradicate GVA in. vinifera L. cv Sagrantino explants by chemotherapy withMPDH, SAH hydrolase inhibitors and their combination, andhermotherapy treatment using molecular assays as reverseranscription-polymerase chain reaction (RT-PCR) and nestedCR for virus identification.

. Materials and methods

.1. Sources of in vitro material

In vitro grapevine explants were obtained from field-grown. vinifera cv Sagrantino naturally infected by GVA. Selectedlants were transferred to an insect-proof green-house andssayed by enzime-linked immunosorbent assay (ELISA) foryear, testing for GLRaV-1 to -8; Grapevine fleck maculavirus

GFKV), GFLV, GVA, Grapevine vitivirus B (GVB), Arabicosaic nepovirus (ArMV), each test being conducted at the

ppropriate time for each virus. ELISA was followed by RT-CR, discarding material with mixed infections in order to usexplants characterized by GVA single infection only.

Internodes from non-GVA-infected Sagrantino were used tobtain in vitro explants as negative controls for GVA diagnos-ic tests. Internodes from selected plants were surface sterilizedefore transfer to culture tubes with fresh Quorin–Lepoivreasic medium (1977). All explants were kept in a controllednvironment chamber that assured maintenance of virus-freeonditions. Environmental parameters were: temperature regimef 22 ± 1 ◦C, 16 h photoperiod and 50 Em−2 s−1 light inten-ity provided by cool-white fluorescent tubes (Philips TLD 18

33) according to Stevenson and Monette (1983) and Barba etl. (1990). Explants were transferred to QL modified mediumBertoni et al., 2000) at 30 days intervals. After an acclimatiza-ion period, each plantlet was assayed by ELISA and maintainedn fresh medium.

.2. Antiviral drugs

Dihydroxypropyladenine was kindly provided by Prof. E. Delercq (Rega Institute, Leuven, Belgium); ribavirin was pur-hased from Sigma Chemical (Milan, Italy).

Drugs were hydrated in stock solution and, immediately prioro use, ultra-filtered and added to the proliferation medium.

In previous experiments, a preliminary screening of healthy. vinifera cv Sagrantino explants was carried out to determinerug-induced phytotoxicity. Explants were submitted to 30-day

dministration at four concentrations for each drug (20, 40, 60,0 g ml−1). For drug-treatment either alone or in combination0 g ml−1 Rb and 60 g ml−1 DHPA were chosen with very fewetrimental effects. To define phytotoxicity levels, the number

A. Panattoni et al. / Journal of Virological Methods 146 (2007) 129–135 131

Table 1DNA primer pairs for RT-PCR amplification of GVA

Name Sequence T (◦C) Position Amplicon size (bp)

G1 5′ATACTCTCTTCGGGTACATCGC3′ 61 6532 398G4 5′GTGCATGGCCTGTATCACAGT3′ 6909MP 5′TGCCAGAGGTGTTTGAGACAAT3′ 59 6369 986C

N d exp

oa

ct1t1h

2

1aTtfm

2

biamfErlratr

2

uI(ggE

a

tstiaftwo

tpa

2

bvT4peTc9psaTa

2

dp2a(Pcbff

Pdt 5′TTTTTGTCTTCGTGTGACAACCT3′

ame, sequence, annealing temperature adopted, position on GVA sequence an

f dead explants out of the total treated explants were countedt the end of the subculture for each dose.

The treatment trials involved drug administration for threeonsecutive subcultures, for a total treatment time of 90 days. Athe end of trials, explants were maintained in in vitro cultures foryear on unsupplemented medium and transferred subsequently

o a rooting medium (QL medium plus IBA 0.5 mg l−1 and NAA.0 mg l−1) for in vivo acclimatization in an insect-proof green-ouse.

.3. In vivo thermotherapy

Treatment was carried out in a controlled chamber at 36 ◦C,6 h photoperiod, 50 Em−2 s−1 light intensity and 60 ± 10% rel-tivity humidity (RH) for a period of 57 days, on 15 replicates.he treatment was repeated twice. It was decided to continue

he heat treatment until the viability of explants was securedor post-treatment proliferation and acclimatization on rootingedium.

.4. Virus detection by ELISA

The ELISA was performed according to the method describedy Clark and Adams (1977). Tissue samples from non-GVA-nfected and GVA-infected explants were used as negative (HC)nd positive (IC) controls, respectively. After each healing treat-ent, the apical portion of surviving explants was transferred to

resh supplemented medium and the residue was assayed byLISA. Optical density at 405 nm wavelength (OD405) was

ecorded by photometer (Titertek multiskan, Flow Lab., Switzer-and). A reading more than twice that of HC samples wasegarded as positive (Monette, 1983). Data were normalizeds R value (OD-treated explant/OD-HC), identifying the R = 2hreshold as the cut-off between the positive versus the negativeesponse.

.5. RT-PCR

Total GVA-RNA was extracted from grapevine explantssing components of the Plant RNeasy kit from Qiagen (Milan,taly) according to the methods described by MacKenzie et al.1997). Approximately 0.2 g tissue was ground in liquid nitro-en, then homogenised with 2 ml of lysis buffer composed of 4 M

uanidine isothiocyanate, 0.2 M sodium acetate pH 5.0, 25 mMDTA, 2.5% (w/v) PVP-40, and 1% (v/v) 2-mercaptoethanol.

The homogenate was incubated for 30 min at 37 ◦C. Anliquot of 1 ml from the lysate was transferred to a microcen-

2

t

7332-

ected amplicon size

rifuge tube, mixed with 100 �l of 20% (w/v) sarkosyl, andhake-incubated for 10 min at 70 ◦C. The mixture was appliedo a Qiashredder spin column and centrifuged for 2 min at max-mum speed in a microcentrifuge. After a step with ethanol,liquots were loaded onto an RNeasy column, and centrifugedor 30 s at 8000 × g. The column was washed with buffer RW1,hen DNase I incubation mix was applied to the column. RNAas eluted in 100 �l of RNase-free water and stored at −80 ◦Cr used for RT-PCR.

GVA amplification was carried out with primer pairs designedo amplify fragments located in ORF 4 that encodes the coatrotein (CP). For each primer sequence, annealing temperaturend amplicon size are shown in Table 1.

.5.1. RT-PCR amplificationRNAs were detected using a one step RT-PCR procedure

ased on the Qiagen One Step RT-PCR kit. A 50 �l-reactionolume containing 5 �l of total RNA (about 500 ng) was used.he RT-PCR mixture contained 1× one step RT-PCR buffer,00 �M of each dNTP, 0.6 �M of both forward and reverserimers, and 2 �l of one step RT-PCR enzyme mix (a Qiagennzyme blend containing OmniscriptTM, SensiscriptTM Reverseranscriptases and HotStartTaqTM DNA polymerase). Amplifi-ation was performed in a thermocycler (GenAmp PCR System700, PE Applied Biosystems, Foster City, USA). The cyclingrofile consisted of a first step at 50 ◦C for 30 min (reverse tran-cription), followed by 15 min incubation at 95 ◦C and 35 cyclest 94 ◦C for 30 s, the appropriate annealing temperature (seeable 1) for 45 s, 72 ◦C for 60 s; finally, the extension step wast 72 ◦C for 10 min.

.5.2. Nested PCR amplificationA twenty-five microliters PCR was performed using 1 �l

irectly from the first round RT-PCR product or of an appro-riate dilution. The reaction mixture contained 1× PCR buffer,mM MgCl2, 200 �M of each dNTP, 0.6 �M of each forwardnd reverse primer, and 0.6 U HotStartTaq DNA polymeraseQiagen). Nested PCR was performed on the first round RT-CR product of primer pair MP/CPdt using primers G1/G4. Theycling profile consisted of 15 min incubation at 95 ◦C, followedy 35 cycles at 94 ◦C for 30 s, annealing temperature (Table 2)or 45 s, 72 ◦C for 60 s; finally, the extension step was at 72 ◦Cor 10 min.

.5.3. Analysis of amplified productsAliquots (25 �l) of the PCR products were analysed by elec-

rophoresis on a 1.5% agarose gel in 1× TBE buffer, stained

132 A. Panattoni et al. / Journal of Virological Methods 146 (2007) 129–135

Table 2Mortality observed for each drug, after 30 days administration at different con-centrations on non-GVA-infected V. vinifera cv Sagrantino explants

Drugs (�g ml−1) 0 20 40 60 80

RD

wtia

3

3

wvsabIoo

3

wAn

3tdHteleot

3i

TToe

T

369

Fig. 1. ELISA after 30, 60 and 90 days of Rb administration on in vitroVitis vinifera/GVA explants. R represents the mean value obtained by sepa-ras

pe9t

3Rtd5below the threshold. Seventy-five percent of treated explantsexhibited ELISA-negative values after the second cycle, and atthe end of therapy 100% healing was achieved (Table 3; Fig. 3).

ELISA-negative plantlets were assayed by RT-PCR.

b 0 (15)a 7 (15) 14 (15) 15 (15) 15 (15)HPA 0 (15) 0 (15) 0 (15) 3 (15) 8 (15)

a Number of dead explants out of total treated healthy explants.

ith 10 �g/ml ethidium bromide, and photographed over a UVransilluminator. The fragment size was determined by compar-son with DNA molecular markers (1 kb DNA ladder Invitrogennd 100 bp DNA ladder MBI Fermentas).

. Results

.1. Chemotherapic trials

No mortality attributable to the micropropagation techniqueas observed in untreated healthy control explants. Mortalityalues recorded for healthy explants propagated on a mediumupplemented with the two drugs at different concentrationsre shown in Table 2. No appreciable differences on mortalityetween healthy and infected treated plantlets were observed.n RbDH treatment, the mortality rate was the same as thatbserved in Rb administration as shown in Table 3 as the numberf ELISA-negative explants out of the assayed explants.

.1.1. Detection of GVA by ELISAELISA readings (R) of treated and untreated infected explants

ere examined at the end of each therapeutic period (30 days).ll data represent the mean value obtained by separating ELISA-egative from ELISA-positive results for each subculture.

.1.1.1. Ribavirin treatment. At 20 �gml−1 concentration, upo 60 days, 62.5% of plantlets submitted to Rb administrationisplayed no differences in optical density between treated andC samples (Table 3; Fig. 1). All plantlets characterized by

he stated absence of differences maintained this status until thend of therapy (90 days). The effect of drug toxicity on plant-et growth was evident, allowing only eight ELISA-negativexplants to be obtained out of the total 15 replicates at the endf therapy. RT-PCR was carried out on ELISA-negative samples

o confirm their virus-free condition.

.1.1.2. DHPA treatment. DHPA was ineffective against GVAn V. vinifera explants, although the OD values of treated

able 3herapeutic efficacy, expressed as ELISA-negative, of different concentrationsf Rb, DHPA and RbDH administration at varying times on infected V. viniferaxplants

reatment days ELISA-negative explants (%)

Rb 20 �g ml−1 DHPA 60 �g ml−1 RbDH 20 + 0 �g ml−1

0 0/9a (0.0) 0/13 (0.0) 5/9 (55.5)0 5/8 (62.5) 0/13 0.0 6/8 (75.0)0 8/8 (100) 0/13 0.0 6/6 (100)

a Number of ELISA-negative/assayed explants.

FVits

ating ELISA-negative from ELISA-positive results for each subculture, R = 2s threshold value distinguishes positive vs. negative responses. Bars refer to thetandard deviation.

lantlets decreased during the later stages of treatment, withoutver reaching OD values of healthy plantlets by the end of the0-day treatment (Table 3, Fig. 2). No explants were submittedo RT-PCR.

.1.1.3. Combined ribavirin + DHPA (RbDH) treatment.bDH treatment showed a notable effect on OD values of

reated explants, producing plantlets characterized by noifferences in OD between treated and healthy samples. Thus in5.5% of treated plantlets the first ELISA value (30 days) was

ig. 2. ELISA after 30, 60 and 90 days of DHPA administration on in vitro. vinifera/GVA explants. R represents the mean value obtained by separat-ng ELISA-negative from ELISA-positive results for each subculture, R = 2 ashreshold value distinguishes positive vs. negative responses. Bars refer to thetandard deviation.

A. Panattoni et al. / Journal of Virological Methods 146 (2007) 129–135 133

Fig. 3. ELISA after 30, 60 and 90 days of RbDH administration on in vitroV. vinifera/GVA explants. R represents the mean value obtained by separatingEod

3

twpf

3eosc

duocc

FaH

Fig. 5. Agarose gel analysis of RT-PCR assay with primers MP/CPdt on infectedV. vinifera explants treated with ribavirin. Lane 1, no GVA-infected explant(Em

ys

3ucpct

3

rdma

LISA-negative from ELISA-positive data for each subculture, R = 2 as thresh-ld value distinguishes positive vs. negative responses. Bars refer to the standardeviation.

.1.2. Detection of GVA by RT-PCRRT-PCR amplification was carried out in order to determine

he health status of ELISA-negative explants. All primer pairsere tested for the ability to detect GVA (Fig. 4), using as tem-late RNAs from untreated in vitro samples, along with RNAsrom the Rb and RbDH treated plantlets.

.1.2.1. Ribavirin treatment. ELISA-negative Rb treatedxplants produced a PCR product corresponding to the sizef GVA, analogous to the infected control amplicon. Thishowed the presence of virions in the plantlets, probably in aoncentration below the ELISA threshold (Fig. 5).

Nested PCR and PCR amplification. Nested PCR wasesigned to test further the correspondence of the RT-PCR prod-

cts to the targeted sequence, and for higher specificity detectionf GVA templates present in very low amounts. Nested PCR wasarried out with primers G1/G4, using as template the amplifi-ation products of primers MP and CPdt. Nested PCR assays

ig. 4. Agarose gel analysis of RT-PCR assay with primers MP/CPdt (lane 2)nd G1/G4 (lane 3) on infected V. vinifera explant: IC (lane 1, no GVA-infected:C; lane 4, molecular weight marker (100 bp DNA ladder, MBI fermentas).

igpi

Ffiwnrf

HC); lane 2, infected explant no treated (IC); lane 3, control water; lanes 4–11,LISA-negative explants after ribavirin treatments; lane12, molecular weightarker (1 kb DNA ladder, Gibco BRL).

ielded the expected amplification product, with the resultshown in Fig. 6.

.1.2.2. RbDH treatment. With RbDH treatment, no PCR prod-cts were obtained from the ELISA-negative samples, in anyombination of primers. This confirmed the absence of viralarticles, in agreement with the results of ELISA. Nested PCR,arried out in the same conditions of Rb treatment, confirmedhe absence of GVA products in RbDH treated explants (Fig. 7).

.2. Thermotherapic trials

Treatment time was not fixed in advance because it waselated to the health condition of the treated plantlets. Fifty-sevenays represented the longest heat treatment period necessary toaintain viable explants and obtain plantlets capable of restoring

cceptable proliferating rates.However, during the healing period, no apparent bud sprout-

ng or shoot extension was visible so no significant macroscopicrowth on plantlets was observed. Thermal stress produced aroliferation rate on explants (1:1) lower than in HC (non-GVA-nfected) samples (4:1), but this was overcome after the end

ig. 6. Agarose gel analysis of nested PCR assay with primers G1/G4 on ampli-cation products of primer MP/CPdt of infected V. vinifera explants treatedith ribavirin. Lane 1 no GVA-infected explant (HC); lane 2, infected explanto treated (IC); lane 3, control water; lanes 4–11, ELISA-negative explants afteribavirin treatments; lane12, molecular weight marker (100 bp DNA ladder, MBIermentas).

134 A. Panattoni et al. / Journal of Virological Methods 146 (2007) 129–135

Fig. 7. Agarose gel analysis of nested PCR assay with primers G1/G4 on ampli-fication products of primer MP/CPdt on infected V. vinifera explants treated withRbDH. Lane 1 molecular weight marker (100 bp DNA ladder, Gibco BRL), lanes2e(

oc

ep

3

wSvcec

3

tupmPm

4

gAa2oac

vtov

Fig. 8. Agarose gel analysis of nested PCR assay with primers G1/G4 onamplification products of primer MP/CPdt on infected V. vinifera explants afterthermotherapy. Lane 1, control water; lane 2, infected explant no treated (IC),liG

dtTrRbstp

daKfCtw

wt

eearata

ao

wtf

, 3, 4, 5, 6, 7, ELISA-negative explants after RbDH treatments, lane 8, infectedxplant no treated (IC); lane 9, control water; lane 10, no GVA-infected explantHC).

f therapy once plantlets had been placed in the proliferatinghamber for a few weeks.

At the end of thermal treatment, only the apical portion ofach explants (about 1 cm) was taken and transferred to freshroliferation medium.

.2.1. Detection of GVA by ELISAELISA readings of treated and untreated infected explants

ere examined at the end of the therapeutic cycle (57 days).ixty percent of treated plantlets were characterized by an Ralue similar to that of HC (non-GVA-infected), with an opti-al density of approximately OD = 0.098 nm. ELISA-negativexplants were assayed by RT-PCR to confirm their virus-freeondition.

.2.2. Detection of GVA by RT-PCRRT-PCR amplification was carried out in order to determine

he health status of ELISA-negative explants. No PCR prod-cts were obtained from the samples, in any combination ofrimers. This confirmed the absence of viral particles, in agree-ent with the results of the immunoenzymatic assay and nestedCR conducted in the same conditions of chemotherapic treat-ents (Fig. 8).

. Discussion

GVA has proven difficult to eliminate from infectedrapevine, as documented by the few published results.dvances in the possibility of GVA elimination have been

chieved by in vitro somatic embryogenesis (Gambino et al.,006), meristem cultures (Bottalico et al., 2000), combinationf thermotherapy and meristem culture (Guidoni et al., 1997)nd cryopreservation (Wang et al., 2003), although success per-entages varied.

Rb and DHPA separately, have been used against several

iruses on herbaceous plants, but only scanty data on the con-rol of woody plant viruses are available. This is the first reportn a chemotherapic experiment aimed at eradicating GVA in V.inifera.

fpua

anes 3–15, ELISA-negative explants after thermotherapy, lane 16, no GVA-nfected explant (HC); lane 17, molecular weight marker (100 bp DNA ladder,ibco BRL).

Twenty micrograms per milliliter Rb administration for 90ays was the highest tolerable dose producing a marked reduc-ion in virus replication, below levels detectable by ELISA.he immunoenzymatic assay showed a decreased level of virus

eplication throughout all treatment cycles. Despite this result,T-PCR established that the degree of virus eradication achievedy Rb was not sufficiently effective to obtain GVA-free explants,ince biomolecular assays confirmed the presence of virus inreated ELISA-negative tissue, where viral concentration wasrobably lower than in untreated infected tissue.

The low virus concentration in infected tissue and its unevenistribution in the host make detection by ELISA difficult to usend unreliable due to the low sensitivity of this test (Dovas andatis, 2003). Moreover, the poor virus antigenicity still impairs

requently serological detection of GVA (De Meyer et al., 2000;hevaleer et al., 1995). Therefore, the apparent contrast between

he results of the ELISA and RT-PCR can be explained by theell-known different sensitivity characterizing the two methods.DHPA alone had no detrimental effects on GVA, although a

eak virostatic action was achieved at 60 �g ml−1, as shown byhe absorbance of treated explants.

Combined administration of Rb and DHPA proved to be moreffective than single drugs in eliminating virus. Thus GVA wasradicated successfully by RbDH, producing virus-free explantss confirmed by RT- and nested-PCR. It is known that GVAequires 5′-capping to maturity its mRNA as Rb and DHPA areble to interact with this phase of RNA process. It is probablehat two different ways could act on the same target in a synergicction blocking GVA capping.

This result documents a chemotherapic eradication of GVAnd a new possibility of controlling virus replication in the casef infection not sensitive to single drug administration.

GVA eradication was also obtained after heating stress andithout recourse to meristem techniques, thereby avoiding

he difficulties involved in stimulating very small meristemsor plant regeneration. Thermotherapy has been combined

requently with meristem cultures, but differently from micro-ropagation, meristem culture technique are related to possiblendesirable onset of somaclonal variations and juvenility char-cters in regenerated plantlets that call for further investigations.

ologic

bkpfe

ait2maertonag

R

B

B

B

B

B

C

C

D

D

D

D

D

F

G

G

G

L

L

M

M

M

M

M

M

M

P

P

P

Q

R

S

S

S

A. Panattoni et al. / Journal of Vir

The positive results obtained with the two techniques muste considered valuable since virus eradication protocols havenown limits like: thermal stress induced by thermotherapy,hytotoxicity related to chemotherapy, genetic modificationsor both treatments. The best technique will be obtained by thexperimentation on the specific binome host/virus.

These results show the importance of setting an appropri-te virus eradication technique for control of GVA. Grapevines the only woody crop that is the object of a compulsory cer-ification program required by the European union (Directive005/43/CE) which prescribes that plant propagation materialust be free from specific harmful virus pathogens (Rowhani et

l., 2005). GVA is one of these viruses and testing for its pres-nce plays a major role in certifying a grape pseudo-clone witheference to the government regulations. As the ability to restorehe healthy condition of an infected grape-variety is crucial inrder to obtain its registration, the possibility of repairing someative ‘minor vines’, such as Sagrantino in Italy, can help tovert the risk of a progressive reduction of genetic variability inrapevine germoplasm.

eferences

arba, M., Cupidi, A., Martino, L., 1990. Comparison of different methodsto obtain virus-free grape propagative material. In: Proceedings of the XInternational Council for the Study of Viruses and Virus Diseases of theGrapevine, Volos, Grece, pp. 399–406.

ertoni, P., Biricolti, S., Panattoni, A., Triolo, E., 2000. Micropropagazione edeffetti di alcune molecole ad attivita antivirale: indagini su Sangiovese. In:Proceedings of the International Symposium: Il Sangiovese, Florence, Italy,pp. 321–325.

ottalico, G., Savino, V., Campanale, A., 2000. Improvements in grapevinesanitation protocols. In: Proceedings of the XIII International Council for theStudy of Viruses and Virus Diseases of the Grapevine, Adelaide, Australia,p. 167.

orchardt, R.T., 1980. S-Adenosyl-l-methionine-dependent macromoleculemethyltransferases: potential targets for the design of chemotherapeuticagents. J. Med. Chem. 23, 347–357.

oscia, D., Digiaro, M., Safi, M., Garau, R., Zhou, Z., Minafra, A., Sabanad-zovic, N.A.G., Bottalico, G., Potere, O., 2001. Production of monoclonalantibodies to grapevine virus D and contribution to the study of its aetiolog-ical role in grapevine diseases. Vitis 40 (2), 69–74.

hevaleer, S.C., Clauzel, J.M., Walter, B., Fritsch, C., 1995. Use of animmunocapture-polymerase chain reaction procedures for the detectionof grapevine virus A in Kober stem grooving-infected grapevine. J. Phy-topathol. 143, 369–373.

lark, M.F., Adams, N., 1977. Characteristics of a microplate method forenzyme-linked immunosorbent assay for the detection of plant viruses. J.Gen. Virol. 37, 475–483.

e Clercq, E., 2004. Antivirals and antiviral strategies. Nat. Rev. 2, 704–720.

e Clercq, E., 2001. Molecular targets for antiviral agents. J. Pharmacol. Exp.Ther. 297, 1–10.

e Clercq, E., Descamps, J., De Somer, P., Holy, A., 1978. (S)-9-(2,3-Diossipropil)adenine: an aliphatic nucleoside analog with broad-spectrumantiviral activity. Science 200, 563–565.

e Meyer, J., Gaudin, M., Bourquin, L., Jakab, G., Malnoe, P., Gugerli, P., 2000.New primers for the molecular identification and detection of grapevinevirus A (GVA). In: Proceedings of the XIII International Council for theStudy of Viruses and Virus Diseases of the Grapevine, Adelaide, Australia,p. 167.

W

al Methods 146 (2007) 129–135 135

ovas, C.I., Katis, N.I., 2003. A spot nested RT-PCR method for the simultane-ous detection of members of the Vitivirus and Foveavirus genera in grapevine.J. Virol. Methods 170, 99–106.

ranchetti, P., Capellacci, L., Grifantini, M., 1996. IMP dehydrogenase as atarget of antitumor and antiviral chemotherapy. Il Farmaco 51 (7), 457–469.

ambino, G., Bondaz, J., Gribaudo, I., 2006. Detection and elimination ofviruses in callus, somatic embryos and regenerated plantlets of grapevine.Eur.J. Plant Pathol. 114, 397–404.

arau, R., Prota, V.A., Piredda, R., Boscia, D., Prota, U., 1994. On the possiblerelationship between Kober stem grooving and grapevine virus A. Vitis 33,161–163.

uidoni, S., Mannini, F., Ferrandino, A., Argamante, N., Di Stefano, R., 1997.The effect of grapevine leafroll and Rugose wood sanitation on agronomicperformance and berry and leaf phenolic content of a nebbiolo clone. Am.J. Enol. Viticult. 48 (4), 438–442.

erch, B., 1987. On the inhibition of plant virus multiplication by ribavirin.Antiviral Res. 7, 257–270.

eonhardt, W., Wawrosch, Ch., Auer, A., Kopp, B., 1998. Monitoring of virusdiseases in Austrian grapevine varieties and virus elimination using in vitrothermotherapy. Plant Cell Tissue Organ Cult. 52, 71–74.

acKenzie, D.J., McLean, M.A., Mukerji, S., Green, M., 1997. Improved RNAextraction from woody plants for detection of viral pathogens by reversetranscription-polymerase chain reaction. Plant Dis. 81 (2), 222–226.

ainardi, M., 1993. Chemioterapia antivirale nelle piante: indagini in vitro sualcuni virus delle drupacee. Doctoral Dissertation. University of Pisa, Italy,101 pp.

alossini, U., Roncador, I., Ciccotti, A.M., Bertamini, M., Nedunchezhian,N., 2003. Grapevine viruses (GLRaV1 + GVA) inhibits pigments, RuBPCand photosynthetic activities in field grown grapevine (Vitis vinifera L. cvMarzemino) leaves. In: Proceedings of the XVI International Council for theStudy of Viruses and Virus Diseases of the Grapevine, Bari, Italy, p. 254.

artelli, G., 1997. Vitivirus, a new genus of plant viruses. Arch. Virol. 142,1929–1932.

aterazzi, A., Triolo, E., Luvisi, A., 2004. Il Sagrantino a Montefalco el’Aleatico all’Elba: due casi difficili per la selezione sanitaria. In: NationalCongress, La vite, Torino 2–3 dicembre 2004 (e-book).

inafra, A., Boscia, D., 2003. An overview of rugose wood-associated viruses.In: Proceedings of the XVI International Council for the Study of Virusesand Virus Diseases of the Grapevine, Bari, Italy, p. 244.

onette, P.L., 1983. Virus eradication through in vitro techniques. Int. PlantPropagations Soc. 33, 90–100.

anattoni, A., D’Anna, F., Triolo, E., 2007. Antiviral activity of Tiazofurinand mycophenolic acid against grapevine leafroll associated virus 3 in Vitisvinifera explants. Antiviral Res. 73 (3), 206–211.

anattoni, A., D’Anna, F., Triolo, E., 2004. Effetti della termoterapia su espiantiin vitro di Sangiovese infetti da GLRaV-3. In: Proceedings of the 2nd Inter-national Symposium on “Il Sangiovese identita e peculiarita: vitigno tipicoed internazionale”, Florence, Italy, p. 58.

anattoni, A., Materazzi, A., Triolo, E., 2000. GVA eradication in Nicotianabenthamiana explants cultivated in vitro in presence of ribavirin. J. PlantPathol. 83 (2), 238.

uorin, M., Lepoivre, P., 1977. Etude de millieux adaptes aux cultures in vitrode prunus. Acta Hortic. 78, 437–442.

owhani, A., Uyemoto, J.K., Golino, D.A., Martelli, G., 2005. Pathogen testingand certification of Vitis and Prunus species. Annu. Rev. Phytopathol. 43,261–278.

aldarelli, P., Dell’Orco, M., Minafra, A., 2000. Infectious cDNA clones of twograpevine viruses. Arch. Virol. 145, 397–405.

mith, R.A., 1984. Background and mechanisms of ribavirin. In: Clinical Appli-cation of Ribavirin. Academic Press, Inc, pp. 1–18.

tevenson, J.H., Monette, P.L., 1983. Delay of onset of leafroll symptoms expres-

sion in Vitis vinifera Liemberg from ribavirin-treated in vitro cultures. Can.J. Plant Sci. 63, 557–560.

ang, Q., Marassi, M., Li, P., Gafny, R., Sela, I., Tanne, E., 2003. Eliminationof grapevine virus A (GVA) by cryopreservation of in vitro-grown shoot tipsof Vitis vinifera L. Plant Sci. 165, 321–327.