33
Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Embed Size (px)

Citation preview

Page 1: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Genetics:Getting Down to the Basics.Turner syndrome

Ginette Talbot, MSc, GCGGenetic Counsellor

May 23, 2015

Page 2: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Overview Brief review of clinical features Learning the language: chromosomes,

genes What are genes? How does Turner syndrome happen? X-inactivation: is it important? Types of Turner syndrome How to read a karyotype Fun facts about the X chromosome

Page 3: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

http://musom.marshall.edu/graphicdesign/ibooks/Genetics.html

Goodman RM, Gorlin RJ. The Malformed Infant and Child. Oxford University Press. 1983.

Page 4: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015
Page 5: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015
Page 6: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015
Page 7: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015
Page 8: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015
Page 9: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015
Page 10: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

What are genes? Genes give instructions to the body to

make certain products, structures, etc. Eg. Hair colour, height, organs ~30,000 genes in our body Present in almost every cell Many genes need to work in pairs, but

some only need one functional copy

Page 11: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Another way to think about genes… English alphabet: A, B, C, D, E,… Example of English sentence: A cat in the hat. DNA alphabet: C, G, A, T,… Example of DNA code:

CGATTATGTGCATTGCCCCAT…

Code for SHOX gene

Page 12: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Another way to think about DNA…

Gene working properly. A cat in the hat.A cat in the hat. Gene with half its function.A cat in the hot.A cat in the hat. Gene cannot give proper instructions.A cat in the hot.A cat in the hot.

Page 13: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

With some genes on the X chromosome Gene working properly. A cat in the hat.A cat in the hat. Gene cannot function properly.A cat in the hat.But… not enough!This is also called ‘haploinsufficiency’

Page 14: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

How does Turner syndrome happen? Remember high school Biology? ‘Reproductive cycles of the cell’?

Page 15: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015
Page 16: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015
Page 17: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

What are the chances of this happening in another pregnancy? Most cases happen by chance;

recurrence risk is considered to be low. For women WITH Turner syndrome, the

risk of having children with Turner may be increased depending of the individual karyotype (for those who can conceive naturally)

Page 18: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

X-inactivation Happens to all individuals with more than one X

chromosome Eg. 46,XX; 47,XXX; 47,XXY ONLY 1 X chromosome remains completely active The other X chromosomes becomes permanently

inactive*This makes sense if you think about males having only one X chromosome*Some genes stay active on both X chromosomes (or X and Y in males)

Page 19: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

(1)

Page 20: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

How is this important for Turner syndrome? Some genes stay activated on both

chromosomes If there is only one X chromosome,

genes cannot work in pairs properly This disruption of instructions leads to

the symptoms we see in Turner syndrome

Page 21: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Important genes on the X chromosome SHOX: bone development and growth Xp11: short stature; ovarian

delvelopment impaired in approx. 50 % Xq13, POF, BMP15: ovarian

development Many genes have unknown function

Page 22: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

‘Types’ of Turner syndrome Reminder: There is a lot of variability of

symptoms regardless of the type ‘Classic’: Typically individuals who are

missing one entire X chromosome ‘Partial’: Individuals with a part of the X

chromosome missing, or structural changes of one X chromosome

‘Mosaic’: Individuals with two X chromosomes in some cells, and others with only one X chromosome

Page 23: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Examples 45, X 45, X/46, XX 45, X/46,X,r(X) 45,X/46,X,del(Xp) 45, XO 46,X,dup(X)

Classic TS

Mosaic TS

Structural variant TS

Mosaic TS +Structural variant

Page 24: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Relative Frequencies of Turner Syndrome KaryotypesStandard monosomy

45,X 46 %

X mosaicism X/XX, X/XXX 7 %

Isochromosome Xq

45,X/46,X,i(Xq)46,X,i(Xq)

18 %

Ring 45,X/46,X,r(X) 16 %

Deletion Xp 45,X/46,X,del(Xp)46,X,del(Xp)

5 %

Structural abnormality of Y

6 %

Other 2 %

Jacobs et al. (1997).

Page 25: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

So… how DO you read a karyotype?

Total # of chromosomes

Sex chromosomes

45,X

Page 26: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

So… how DO you read a karyotype?

45,X[16]/46,X,IDIC(X)(P22)[14]

Total # of chromosomes

Sex chromosomes

# of colonies analyzed

Mosaicism

Abbreviation for structural changeEg. DUP > duplication DEL > deletion IDIC > isodicentric r > ring i > isochromosome

Description of where the structural change is

Page 27: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Structural changes

Page 28: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Structural changes (con’t)

Page 29: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Structural changes (con’t)

Page 30: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Structural changes (con’t)

Page 31: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Fun Facts About the X Chromosome X chromosome represents about 5 % of

total DNA X chromosome likely has 800-900 genes

(~30,000 genes in the genome) 75-80 % of cases, the single X

chromosome comes from the egg Males cannot survive without an X

chromosome (45,Y does not exist)

Page 32: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Thank-you!

QUESTIONS?

Page 33: Genetics: Getting Down to the Basics. Turner syndrome Ginette Talbot, MSc, GCG Genetic Counsellor May 23, 2015

Bibliography Alberts B, Johnson A, Lewis J, et al. Molecular Biology of the Cell. 4th

edition. New York: Garland Science; 2002. Gardner RJM, Sutherland GR. 3rd edition. Chromosome abnormalities

and genetic counseling. Oxford Univeristy Press. 2004. Goodman RM, Gorlin RJ. The Malformed Infant and Child. Oxford

University Press. 1983. Zhong Q, Layman LC. Genetic considerations in the patient with

Turner syndrome--45,X with or without mosaicism. Fertil Steril. 2012 Oct;98(4):775-9.