Upload
amos-bishop
View
223
Download
0
Tags:
Embed Size (px)
Citation preview
Genetics:Getting Down to the Basics.Turner syndrome
Ginette Talbot, MSc, GCGGenetic Counsellor
May 23, 2015
Overview Brief review of clinical features Learning the language: chromosomes,
genes What are genes? How does Turner syndrome happen? X-inactivation: is it important? Types of Turner syndrome How to read a karyotype Fun facts about the X chromosome
http://musom.marshall.edu/graphicdesign/ibooks/Genetics.html
Goodman RM, Gorlin RJ. The Malformed Infant and Child. Oxford University Press. 1983.
What are genes? Genes give instructions to the body to
make certain products, structures, etc. Eg. Hair colour, height, organs ~30,000 genes in our body Present in almost every cell Many genes need to work in pairs, but
some only need one functional copy
Another way to think about genes… English alphabet: A, B, C, D, E,… Example of English sentence: A cat in the hat. DNA alphabet: C, G, A, T,… Example of DNA code:
CGATTATGTGCATTGCCCCAT…
Code for SHOX gene
Another way to think about DNA…
Gene working properly. A cat in the hat.A cat in the hat. Gene with half its function.A cat in the hot.A cat in the hat. Gene cannot give proper instructions.A cat in the hot.A cat in the hot.
With some genes on the X chromosome Gene working properly. A cat in the hat.A cat in the hat. Gene cannot function properly.A cat in the hat.But… not enough!This is also called ‘haploinsufficiency’
How does Turner syndrome happen? Remember high school Biology? ‘Reproductive cycles of the cell’?
What are the chances of this happening in another pregnancy? Most cases happen by chance;
recurrence risk is considered to be low. For women WITH Turner syndrome, the
risk of having children with Turner may be increased depending of the individual karyotype (for those who can conceive naturally)
X-inactivation Happens to all individuals with more than one X
chromosome Eg. 46,XX; 47,XXX; 47,XXY ONLY 1 X chromosome remains completely active The other X chromosomes becomes permanently
inactive*This makes sense if you think about males having only one X chromosome*Some genes stay active on both X chromosomes (or X and Y in males)
(1)
How is this important for Turner syndrome? Some genes stay activated on both
chromosomes If there is only one X chromosome,
genes cannot work in pairs properly This disruption of instructions leads to
the symptoms we see in Turner syndrome
Important genes on the X chromosome SHOX: bone development and growth Xp11: short stature; ovarian
delvelopment impaired in approx. 50 % Xq13, POF, BMP15: ovarian
development Many genes have unknown function
‘Types’ of Turner syndrome Reminder: There is a lot of variability of
symptoms regardless of the type ‘Classic’: Typically individuals who are
missing one entire X chromosome ‘Partial’: Individuals with a part of the X
chromosome missing, or structural changes of one X chromosome
‘Mosaic’: Individuals with two X chromosomes in some cells, and others with only one X chromosome
Examples 45, X 45, X/46, XX 45, X/46,X,r(X) 45,X/46,X,del(Xp) 45, XO 46,X,dup(X)
Classic TS
Mosaic TS
Structural variant TS
Mosaic TS +Structural variant
Relative Frequencies of Turner Syndrome KaryotypesStandard monosomy
45,X 46 %
X mosaicism X/XX, X/XXX 7 %
Isochromosome Xq
45,X/46,X,i(Xq)46,X,i(Xq)
18 %
Ring 45,X/46,X,r(X) 16 %
Deletion Xp 45,X/46,X,del(Xp)46,X,del(Xp)
5 %
Structural abnormality of Y
6 %
Other 2 %
Jacobs et al. (1997).
So… how DO you read a karyotype?
Total # of chromosomes
Sex chromosomes
45,X
So… how DO you read a karyotype?
45,X[16]/46,X,IDIC(X)(P22)[14]
Total # of chromosomes
Sex chromosomes
# of colonies analyzed
Mosaicism
Abbreviation for structural changeEg. DUP > duplication DEL > deletion IDIC > isodicentric r > ring i > isochromosome
Description of where the structural change is
Structural changes
Structural changes (con’t)
Structural changes (con’t)
Structural changes (con’t)
Fun Facts About the X Chromosome X chromosome represents about 5 % of
total DNA X chromosome likely has 800-900 genes
(~30,000 genes in the genome) 75-80 % of cases, the single X
chromosome comes from the egg Males cannot survive without an X
chromosome (45,Y does not exist)
Thank-you!
QUESTIONS?
Bibliography Alberts B, Johnson A, Lewis J, et al. Molecular Biology of the Cell. 4th
edition. New York: Garland Science; 2002. Gardner RJM, Sutherland GR. 3rd edition. Chromosome abnormalities
and genetic counseling. Oxford Univeristy Press. 2004. Goodman RM, Gorlin RJ. The Malformed Infant and Child. Oxford
University Press. 1983. Zhong Q, Layman LC. Genetic considerations in the patient with
Turner syndrome--45,X with or without mosaicism. Fertil Steril. 2012 Oct;98(4):775-9.