Embed Size (px)
Citation preview
Clemson UniversityTigerPrints
All Dissertations Dissertations
12-2014
Genetic Dissection of Neuromuscular DiseasesAffecting Domestic DogsCaitlin RinzClemson University
Follow this and additional works at: https://tigerprints.clemson.edu/all_dissertations
Part of the Genetics and Genomics Commons
This Dissertation is brought to you for free and open access by the Dissertations at TigerPrints. It has been accepted for inclusion in All Dissertations byan authorized administrator of TigerPrints. For more information, please contact [email protected].
Recommended CitationRinz, Caitlin, "Genetic Dissection of Neuromuscular Diseases Affecting Domestic Dogs" (2014). All Dissertations. 1678.https://tigerprints.clemson.edu/all_dissertations/1678
GENETIC DISSECTION OF NEUROMUSCULAR DISEASES
AFFECTING DOMESTIC DOGS
________________________________________________________
A Thesis
Presented to
the Graduate School of
Clemson University
________________________________________________________
In Partial Fulfillment
of the Requirements for the Degree
Doctor of Philosophy
Genetics
________________________________________________________
by
Caitlin Rinz
December 2014
________________________________________________________
Accepted by:
Dr. Leigh Anne Clark
Dr. Amy Lawton-Rauh
Dr. Meredith Morris
Dr. Christopher Saski
ii
ABSTRACT
The domestic dog, Canis familiaris, has a unique population structure that lends
itself to the study of hereditary diseases. Purebred dogs populations are genetically
isolated and as a result are affected by more than 400 naturally occurring diseases, many
of which have human counterparts. In the last 15 years, dogs have emerged as a model
for the study of human hereditary diseases, fueling the development of resources
including a 7.6X coverage reference genome and single nucleotide polymorphism (SNP)
genotyping arrays.
Congenital myasthenic syndrome (CMS) is a neuromuscular disorder of both
humans and dogs in which transmission across the neuromuscular junction is
compromised. Affected individuals exhibit generalized muscle weakness that is
exacerbated with exercise. To date, 18 genes are known to harbor mutations causative for
CMS in humans. We characterized a novel CMS in a family of Labrador Retrievers.
Using whole genome SNP profiles we identified COLQ as a candidate gene. In the
neuromuscular junction, ColQ acts as an anchor for acetylcholinesterase, which is
responsible for terminating the signal for muscle contraction. Sequencing revealed a
missense mutation in exon 14 that predicts the substitution of a threonine for an
isoleucine at a conserved position.
The Jack Russell Terrier (JRT) is the first dog breed in which CMS was reported
in the 1970s. Immunohistochemistry revealed an acetylcholine receptor (AChR)
deficiency in affected dogs. Analysis of microsatellites flanking the five AChR subunit
genes indicated that haplotypes encompassing CHRNB1 and CHRNE are consistent with
iii
inheritance identical by descent. Sequencing revealed a frameshift mutation in exon 7 of
CHRNE (G193RfsX272) that is homozygous in recent CMS cases, as well as those from
the 1970s.
Congenital idiopathic megaesophagus (ME) is another neuromuscular condition
observed in both humans and dogs characterized by an enlarged esophagus. Affected
dogs are unable to move food into their stomachs, resulting in regurgitation and frequent
aspiration pneumonia. ME is prevalent among German Shepherd Dogs (GSDs). We
employed a genome-wide association study to identify genomic regions harboring genes
underlying ME. Using 19 affected and 177 unaffected GSDs, we identified an associated
region on chromosome 12.
iv
Acknowledgements
I would like to thank my family – my parents Anita and Dave, my sisters Alex
and Cyndee, my brothers Josh and Nate – for their love and support during my time as a
PhD student and throughout my life. Thank you to everyone in my lab – Dr. Leigh Anne
Clark, Dr. Kate Tsai, Dr. Alison Starr-Moss, Dr. Rooksie Noorai – for their instruction,
help, and guidance. To Jacquelyn Evans, who joined us as a graduate student, and the
various other undergraduate students that worked in our lab, thank you for teaching me
patience and reminding me how exciting genetics can be to work with and learn. To my
other committee members, Dr. Amy Lawton-Rauh, Dr. Meredith Morris, and Dr. Chris
Saski, thank you for your help and your suggestions from other points of view and
helping me to see things outside of the scope of my lab. To the dog owners, breeders, and
veterinarians, thank you for your enthusiasm for and participation in our studies. Finally,
to Lily, Joy, Rylie, Beau, and all the other dogs in my life, thank you for reminding me
why I do what I do and why finding the mutations involved in canine genetic diseases is
so important.
v
TABLE OF CONTENTS
Page
TITLE PAGE .................................................................................................................... i
ABSTRACT ..................................................................................................................... ii
ACKNOWLEDGMENTS .............................................................................................. iv
LIST OF TABLES ........................................................................................................... v
LIST OF FIGURES ........................................................................................................ vi
CHAPTERS
1. INTRODUCTION ........................................................................................... 1
Dog as a Model System ........................................................................... 1
Identification of Pathogenic Mutations .................................................... 4
Congenital Myasthenic Syndromes ......................................................... 9
Congenital Idiopathic Megaesophagus .................................................. 16
The Bigger Picture ................................................................................. 17
References .............................................................................................. 20
2. A COLQ MISSENSE MUTATION IN LABRADOR
RETRIEVERS HAVING CONGENITAL
MYASTHENIC SYNDROME ...................................................................... 27
Abstract .................................................................................................. 28
Introduction ............................................................................................ 29
Materials and Methods ........................................................................... 31
Results .................................................................................................... 37
Discussion .............................................................................................. 45
Acknowledgements ................................................................................ 48
References .............................................................................................. 48
3. A CHRNE FRAMESHIFT MUTATION CAUSES
CONGENITAL MYASTHENIC SYNDROME
IN JACK RUSSELL TERRIERS .................................................................. 51
Abstract .................................................................................................. 51
Introduction ............................................................................................ 52
Materials and Methods ........................................................................... 54
vi
Table of Contents (Continued) Page
Results .................................................................................................... 59
Discussion .............................................................................................. 64
Acknowledgements ................................................................................ 68
References .............................................................................................. 68
4. GENOME-WIDE ASSOCIATION STUDIES FOR
MULTIPLE DISEASES OF THE GERMAN
SHEPHERD DOG ......................................................................................... 71
Abstract .................................................................................................. 75
Introduction ............................................................................................ 75
Materials and Methods ........................................................................... 79
Results .................................................................................................... 82
Discussion .............................................................................................. 88
Acknowledgements ................................................................................ 93
References .............................................................................................. 93
5. CONCLUSIONS, FUTURE DIRECTIONS, AND
APPLICATIONS ........................................................................................... 99
A COLQ Missense Mutation in Labrador Retrievers
Having Congenital Myasthenic Syndrome ................................ 99
A CHRNE frameshift mutation causes congenital
myasthenic syndrome in Jack Russell Terriers ........................ 101
Genome-wide association studies for multiple diseases
of the German Shepherd Dog .................................................. 102
Final Thoughts ..................................................................................... 103
References ............................................................................................ 105
APPENDICES ............................................................................................................. 106
Appendix One (Chapter Two Supplementary Figures) ................................... 107
Appendix Two (Chapter Four Supplementary Figures) .................................. 112
Appendix Three (Addendum to Chapter Four) ................................................ 119
v
LIST OF TABLES
Table Page
1.1 Genes involved in human CMS cases and their positions in the NMJ .................... 10
3.1 Microsatellite markers flanking candidate genes ..................................................... 57
3.2 Primers (5'-3') for amplification of CHRNB1 and CHRNE ..................................... 58
3.3 Jack Russell Terriers genotyped for G193RfsX272 ................................................ 64
4.1 Frequency data for SNP 12.60274687 in GSDs with and without ME ................... 86
vi
LIST OF FIGURES
Figure Page
1.1 Linkage disequilibrium (LD) in and between breeds ................................................ 2
1.2 Proteins of the neuromuscular junction ................................................................... 11
2.1 Multigenerational pedigree of Labrador Retrievers ................................................. 36
2.2 Peroneal MNCV of an affected Labrador Retriever recorded at the
extensor digitorum brevis muscle with stimulation at the level of
the hock, stifle, and hip ...................................................................................... 39
2.3 Repetitive stimulation of the peroneal motor nerve of an affected
Labrador Retriever at 2Hz (A), 5Hz (B), and 50Hz (C) .................................... 39
2.4 Cryosections (8µm) of intercostal muscle from a normal dog, a
Labrador Retriever with CMS (end-plate AChE deficiency),
and a Jack Russell Terrier with CMS due to AChR deficiency
(neuromuscular disease control) are illustrated ................................................. 41
2.5 Microsatellite and SNP haplotypes (color-coded bars below
individuals) are shown for 3 candidate genes .................................................... 43
2.6 (A) Sequence from the 5’ end of the C-terminal domain of
ColQ in mammals.
(B) BtsI digest results for the Labrador Retriever family ........................................ 44
3.1 Microsatellite haplotypes flanking the AChR subunit genes ................................... 62
3.2 Direct sequences from unaffected, carrier, and affected Jack
Russell Terriers .................................................................................................. 63
3.3 Amino acid alignment of wild-type dog CHRNE and sequence
with G193RfsX272 mutation ............................................................................. 65
4.1 Principal component analysis of the GSD cohort shows all 197
dogs clustering together ..................................................................................... 83
4.2 Manhattan plots showing the results for GWAS using 48,415
SNPs ................................................................................................................... 84
vii
4.3 GWAS using 48,415 SNPs with 100,000 permutations .......................................... 87
1
CHAPTER ONE
INTRODUCTION
Dog as a Model System
Diseases and disorders have plagued mankind from the beginning of the species,
and the attempts to study these diseases have led to both great discoveries and great
moral outrage. As scientists began to recognize commonalities with the creatures around
us, they began to use model organisms for the study of human diseases to continue the
discoveries while staying within ethical boundaries. These animals, including the most
well-known models Drosophila melanogaster (fruit fly), Mus musculus (mouse), and
Rattus spp. (rat), were used in place of humans due to ethical concerns about
experimenting on humans and, later, because their genomes are similar to that of humans.
In addition, numerous other model organisms have contributed to our knowledge of
genes and heredity. Among these is Canis familiaris, the domestic dog. Like other model
organisms, dogs produce more offspring than humans, can be selectively bred, and have
shorter lifespans, features which allow for the assembly of large pedigrees and the study
of disease progression. Other characteristics of dogs enable opportunities for study that
are not available in traditional model systems.
First, the dog population as a whole is divided into specific breeds, each of which
is a genetically isolated population as a result of artificial selection [1]. This artificial
selection took the form of two bottlenecks in the domestic dog’s history: the original
domestication from the gray wolf and the derivation of specific breeds possessing
2
desirable traits such as behavior/personality, speed, aggression, coat color, height, and
others [2]. In order to maintain breed standards, a concept known as the “breed barrier”
was instituted; that is, dogs are considered “purebred” only if both of their parents are
registered as members of the same breed, and there is no crossbreeding between the
different breeds. Therefore, no new genetic variation is introduced into registered dog
breeds. This genetic isolation leads to linkage disequilibrium (LD) – the inheritance of
alleles at adjacent loci more often together than would be observed by chance – that is
longer within the same breed (several megabases; [2]) and shorter between different
breeds (tens of kilobases; [2]) (Figure 1). In genomic mapping studies, the longer LD
within a breed is often used to initially identify a region of interest associated with the
trait under study [2]. Shorter LD between breeds is then used to narrow these regions by
adding additional breeds to the study, assuming a founder mutation [2].
3
Figure 1. Linkage disequilibrium (LD) in and between breeds. Studies using LD assume
a founder mutation (blue crescent) in a common ancestor of multiple breeds. As the
breeds diverge from one another through selection for different traits, different
recombination events will occur around the location of the founder mutation in each
breed. Therefore, while the length of the shared LD within a breed will be longer, the
length of the shared LD between breeds will be relatively shorter as can be observed at
the bottom of the figure.
Because dogs are kept as pets, they are exposed to many of the same
environmental factors as humans, allowing for environmental comparisons to be made
between dogs and humans [1]. The majority of pet owners keeps dogs in their houses,
take them along on trips in the car or to parks, and otherwise share their daily lives and
concurrent environmental influences with their pets. Additionally, most pets receive
medical care comparable to that of humans as the majority of owners take their dogs to a
veterinarian on a regular basis [1]. Veterinary care involves medical history records as
well as treatment, which contributes information on disease etiology and progression that
can be used in studies [1].
Moreover, there is a very large pet population in the United States, with about 70
million dogs as pets as of 2012 [3]. Thus, there is rarely a need for establishing the
colonies necessary for the study of mice, rats, and other such model organisms. Blood or
buccal cells can be collected from affected and unaffected dogs from this general pet
population for this isolation of genomic DNA.
Lastly, and perhaps most importantly, there are about 220 naturally-occurring
diseases in dogs that have an analogous disease in humans, and this list is continually
growing [4]. The occurrence of spontaneous diseases in dogs provides a model system
that more closely follows the progression as well as the etiology of a given disease than
4
an experimentally induced version of the same disease [1]. There are even documented
cases of the same genotype causing the same phenotype in both dogs and humans, such
as the C2T mutation causing retinitis pigmentosa in humans and progressive rod-cone
degeneration in dogs [5], further supporting the dog as a system that closely parallels
humans.
Identification of Pathogenic Mutations
In the dog, as in other animals, there are three types of mutations that can result in
new phenotypes: de novo somatic mutations, de novo germline mutations, and founder
mutations. In the case of a de novo somatic mutation, the affected dog is the first to
harbor the causative mutation as it is a result of a change in that individual’s somatic cell
DNA. As this type of mutation does not occur in germline cells, it is not passed on to
offspring, and only the dog in which the mutation originated is affected. In the case of a
de novo germline mutation, the mutation originates in a parent’s germline cells and then
is passed on to the offspring. While, the parent is not affected, one offspring does exhibit
the new phenotype. The new mutation may now be present in the germline cells of the
affected offspring, it will be passed on to their offspring and so on down the generations.
This type of mutation will potentially appear multiple times on a pedigree after the dog in
which the original mutation event occurred.
Founder mutations originate in an ancestor that was among the founders of a
population, in this case the dog breeds discussed here, and are present in both the somatic
cells (resulting in affected or carrier dogs) and the germline cells (resulting in affected or
5
carrier offspring). In dog breeds, founder mutations result in multiple carriers and
affected dogs within a breed as the original mutation occurred in a common ancestor.
Such mutations are present in several generations in pedigrees and can sometimes be
traced back to the original ancestor. This type of mutation makes genetic studies using
LD within and between dog breeds possible. In cases of founder mutations from a more
distant common ancestor of several breeds, the mutation may be present in multiple dog
breeds (i.e., the SILV insertion causative for merle coat color in Shetland Sheepdogs,
Collies, and several other breeds [6]). Other founder mutations that originate in dogs that
were founders of a specific breed will be observed within that breed but not in other
breeds (i.e., the CHAT mutation in Old Danish Pointing Dogs [7] and the COLQ mutation
in Labrador Retrievers that both result in congenital myasthenic syndromes [8]). These
differences must be taken into account when conducting genetic studies in dogs.
One practical approach to studies of genetic diseases in dogs is the candidate gene
approach, in which genes known to harbor causative mutations in other species for the
same trait or disease are evaluated for mutations in the species under study. For dog
studies, these candidate genes are usually found in cases of the same disease in humans.
For example, Winkler and colleagues identified a mutation involved in oculocutaneous
albinism in Doberman Pinschers by evaluating four genes known to harbor mutations for
this condition in humans [9]. By examining markers flanking each of the candidate genes,
they found that the affected dogs shared the same marker alleles around SLC45A2 [9].
Sequencing of this gene revealed a 4,081bp deletion that causes the loss of the end of
exon 7 [9].
6
If no potential candidate genes are known, or if too many candidate genes are
known – making sequencing all of them not financially feasible – mapping approaches
can be utilized. In the first years of the 21st century, the whole genome of a Boxer was
sequenced to 7.6x coverage (canFam1 and canFam2 builds) [2]. This whole genome
reference sequence was used to identify single nucleotide polymorphisms (SNPs), which
are single bases at specific loci that vary between individuals in over 1% of the
population scanning the Boxer sequence for supported alternative alleles, 2) comparing
the Boxer sequence to that of the Standard Poodle (1.5x coverage; [10]), and 3)
comparing the Boxer sequence to from 9 other dog breeds (0.02x coverage), 1 coyote
(0.004x coverage), and 4 gray wolves (0.004x coverage) [2]. To facilitate more
comprehensive data collection, the gaps in the genome were later filled in, resulting in the
build known as canFam3 [11]. These sequences were used to create SNP arrays which
allow for the simultaneous genotyping of tens of thousands of markers.
The SNP arrays developed from the builds of the canine genome have allowed for
the use of genome-wide association studies (GWASs) in the dog. GWAS involves the use
of marker data across the genome, usually SNP data, in identifying regions of association
with a disease or trait based on case/control analyses. Performing a GWAS with cases
and controls from one breed can reveal regions of interest within the genome due to the
long LD that is present within breeds [2]. Because of this LD structure, surprisingly small
numbers of dogs can be used to identify genomic regions harboring positional candidate
genes for simple recessive diseases [12,13]. As technology is advanced, these tools for
studying genetics and heredity in the dog continue to change and improve.
7
Closer relationships among dogs of one breed create longer LD within that breed,
resulting in longer chromosomal segments that are inherited together. In mapping studies,
this longer LD can be exploited to identify regions that have many markers inherited with
the allele causative for the trait or disease of interest [2]. Therefore, the longer LD within
breeds allows for simple Mendelian traits to be mapped using small sample sizes. For
example, the causative mutation for episodic falling syndrome (EFS), an autosomal
recessive disease of Cavalier King Charles Spaniels, was identified through the use of a
population of seven unaffected, five affected, and one obligate carrier [13]. These dogs
were genotyped on an Affymetrix SNP array, a case/control analysis run, and the p-
values for each SNP calculated [13]. Recombination events in an obligate carrier and one
of the affected dogs defined a 3.48Mb shared haplotype on canine chromosome 7 (CFA
7). Investigation of positional candidate genes led to the discovery of a causative
microdeletion in BCAN [13].
The short LD between breeds can also be advantageous, particularly in the study
of complex diseases. For example, canine squamous cell carcinoma of the digit (SCCD)
is a complex disease that affects several breeds, including Standard Poodles [14]. Thirty-
one affected Standard Poodles and thirty-four unaffected Standard Poodles were used in a
GWAS covering 36,897 SNPs [14]. Through this analysis, the authors identified an
association on CFA15 [14]. Thirty-eight cases and thirty controls were then used for
recombination mapping and another association analysis in order to further narrow this
region [14]. These analyses revealed KITLG as a candidate gene, which the authors then
sequenced; however, none of the variants identified segregated with SCCD [14].
8
Analyses of Standard Poodles compared to Giant Schnauzers and Briards resulted in an
association with a 144.9kb segment of CFA15, and eventually the authors were able to
narrow the region even further to a 5.7kb haplotype that included KITLG [14]. They
investigated the copy numbers of this region between cases and controls and found that
the affected dogs had more copies of this region compared to the unaffected dogs [14].
Therefore, the authors posit that a copy number variation (CNV) at this locus is the cause
of SCCD [14].
Many genetic diseases involve both a genetic and environmental component. An
example is dermatomyositis (DM). DM is an inflammatory skin disease with variable
ages of onset observed primarily in Collies and Shetland Sheepdogs [15-17]. The
occurrence of this disease in two breeds but not across the dog population indicates a
strong heritable component; however, anecdotal reports describe the onset of clinical
signs occurring following vaccinations, abandonment, and other stressors, suggesting an
environmental trigger. In fact, human cases of DM are associated with alleles of the
major histocompatibility complex (MHC), but not all individuals with the DM genotype
will develop the disease [18]. Complex diseases like DM require larger study populations
to detect genomic region(s) playing a role in pathogenesis (e.g.,[19]).
While many studies have made use of the dog’s unique genetic structure, there are
few studies in which the functions of genes and causative mutations identified in the dog
are examined. That is, unlike many human studies involving the transfection of mice
models with the human mutation to determine if that mutation results in a similar
phenotype to that of the human, there are few studies in the dog that involve such
9
functional studies. There are also far fewer studies in the dog leading to therapies for
genetic diseases. Therefore, there is room for development of this field in the canine
genetics world, particularly as it pertains to therapies for dog genetic diseases. In other
words, through the development of functional genomics studies in the dog, therapies that
can be used to treat genetic diseases of the dog may be found, and these therapies may
also be of use for the humans affected with analogous diseases.
Congenital Myasthenic Syndromes
Congenital myasthenic syndrome (CMS) is a disease that affects both humans and
dogs. CMSs affect between 25 and 125 per million people and usually presents very early
in life, with the specific age of onset varying by type [20]. CMSs are disorders of the
neuromuscular junction (NMJ), the region in which the motor neuron sends the signal for
muscle contraction to the muscle. There are three regions within the NMJ: the
presynaptic region, the synapse, and the postsynaptic region. In normal transmission
across the NMJ (Figure 2), ACh is produced in the motor neuron, a process in which
choline acetyltransferase (ChAT) is involved [20]. ACh is released from the motor
neuron and travels across the NMJ to bind to the AChRs, triggering muscle contraction.
AChE breaks down excess ACh so that the muscle contraction is not prolonged [21],
while ColQ attaches to and anchors asymmetric AChE to the basal lamina of the muscle
cell. Other proteins involved in this process, such as agrin [20], rapsyn [20], Nav1.4 [20],
MuSK [20], and Dok-7 [22], mostly participate in the development of the NMJ, in
clustering of the AChRs, or in the process of muscle contraction (Figure 2). Other
10
proteins listed in Table 1 are glycosylation genes in which mutations have also been
found to cause CMS [23].
Gene Protein Region of
NMJ Type of CMS
% of
CMS
Cases
CHAT Choline acetyltransferase Presynaptic
Lambert-Eaton-like CMS
Defects in ACh resynthesis
Paucity of Synaptic Vesicles
4-5%
COLQ
Collagen-like tail subunit
of asymmetric
acetylcholinesterase
Synaptic Basal
Lamina Endplate AChE Deficiency 10-15%
LAMB2 β2-laminin Synaptic Basal
Lamina Β2-laminin Deficiency
AGRN Agrin Synaptic Basal
Lamina Agrin Anomaly Rare
CHRNA1
Alpha subunit of the
muscle acetylcholine
receptor
Postsynaptic
AChR Deficiency
Slow-Channel CMS
Fast-Channel CMS
<1%
CHRNB1 Beta subunit of the muscle
acetylcholine receptor Postsynaptic
AChR Deficiency
Slow-Channel CMS
Fast-Channel CMS
<1%
CHRND
Delta subunit of the
muscle acetylcholine
receptor
Postsynaptic
AChR Deficiency
Slow-Channel CMS
Fast-Channel CMS
<1%
CHRNE
Epsilon subunit of the
muscle acetylcholine
receptor
Postsynaptic
AChR Deficiency
Slow-Channel CMS
Fast-Channel CMS
49%
CHRNG
Gamma subunit of the
muscle acetylcholine
receptor
Postsynaptic Escobar Syndrome
RAPSN Rapsyn Postsynaptic Rapsyn Deficiency 15-20%
SCN4A
Sodium channel, voltage-
gated, type IV, alpha
subunit (Nav1.4)
Postsynaptic Sodium Channel Myasthenia Rare
MUSK Muscle, skeletal, receptor
tyrosine kinase (MuSK) Postsynaptic Anomalies of MuSK Rare
DOK7
Downstream of kinase-7
or Docking protein 7
(Dok-7)
Postsynaptic Limb-Girdle Myasthenia 10-15%
PLEC1 Plectin Postsynaptic Plectin Deficiency
GFPT1 Glutamine-fructose-6-
phosphate transaminase 1 Glycosylation GFPT1 Defect 2%
DPAGT1
Dolichyl-phosphate
(UDP-N-
acetylglucosamine) N-
acetylglucosaminephosph
otransfera e 1 (GlcNAc-1-
P transferase)
Glycosylation DPAGT1 Defect
ALG2 alpha-1,3/1,6- Glycosylation ALG2 Defect
11
mannosyltransferase
(ALG2)
ALG14
UDP-N-
acetylglucosaminyltransfe
rase subunit (ALG14)
Glycosylation ALG14 Defect
Table 1. Genes involved in human CMS cases and their positions in the NMJ [20,23].
Figure 2. Proteins of the neuromuscular junction. Pathway described above in text.
12
In muscles, the AChR is made up of 5 subunits: alpha (α; encoded by CHRNA1),
beta (β; encoded by CHRNB1), gamma (γ; encoded by CHRNG), delta (δ; encoded by
CHRND), and epsilon (ε; encoded by CHRNE). Until the 31st week of development, the
AChR is comprised of 2 α subunits, 1 β subunit, 1 γ subunit, and 1 δ subunit. At that
time, the γ subunit is replaced by the ε subunit). ACh attaches to the AChR at the α/δ and
the α/ε interfaces [20], triggering the contraction of the muscle cell through the
conformational change of the AChR penatmer [20].
In humans, the most common mutations in CMS occur in genes encoding the
AChR subunits that comprise the adult AChR, with approximately 50% of the mutations
in CHRNE and less than 1% each in CHRNA1, CHRNB1, and CHRND [20]. There are
three types of CMS that are caused by mutations in these genes: slow-channel CMS
(SCCMS), fast-channel CMS (FCCMS), and AChR deficiency [20,23]. Each of these
types has different clinical signs and different mutations in these 4 genes associated with
them [20,23].
While almost all forms of CMS are autosomal recessive, SCCMS is inherited in
an autosomal dominant manner [24-27]. The onset of SCCMS can occur from childhood
to adulthood with a range of severity, and the clinical signs include severe weakness of
the finger extensor, wrist, and neck muscles as well as progressive respiratory problems
[20]. These clinical signs are the product of the AChR’s extended activation due to ACh
in the NMJ, which in turn results in extended muscle contraction resulting in repetitive
compound muscle action potentials (CMAPs) [28]. Eventually, these changes result in
damage to the junctional folds, which cause a loss of AChRs [20].
13
Fast-channel CMS (FCCMS) is inherited as an autosomal recessive trait [24-
25,29] and in many ways is the opposite of SCCMS. The mutations causing FCCMS can
affect one or multiple functions of the AChR, including the AChR’s gating efficiency, its
channel kinetics stabilization, and/or its ACh affinity [20]. Unlike in SCCMS, the
structure of the postsynaptic membranes in FCCMS is conserved [20]. The severity of the
clinical signs ranges from mild to severe [20] and can include bulbar muscle weakness
and apneic, or respiratory, crisis [23].
AChR deficiency is inherited in an autosomal recessive manner, and the
associated mutations are homozygous or compound heterozygous [20]. The majority of
these mutations are located in CHRNE [20]. The onset of clinical signs is early, and they
range from mild to severe, including weakness of the limb and bulbar muscles as well as
ptosis and external ophthalmoplegia [20]. This type of CMS is marked by a reduction of
AChR in the postsynaptic region [20], but the junctional folds are not damaged [20]. In
some cases, a milder phenotype is observed due to the presence of the γ subunit, the fetal
subunit which the ε subunit replaces during development [20].
Another common form of CMS, referred to as end-plate AChE deficiency (EAD),
is an autosomal recessive disorder caused by mutations in COLQ and represents
approximately 10-15% of CMS cases [20]. Due to the lack of AChE in the NMJ,
cholinesterase inhibitors either do not affect or can worsen the clinical signs of EAD [20].
COLQ encodes the collagen-like tail subunit of asymmetric acetylcholinesterase, and
three of these subunits form a homotrimer that attached to asymmetric AChE. ColQ
anchors this complex to the basal lamina of the muscle cell and in this position, and
14
AChE breaks down excess ACh so that the muscle contraction is not continuous [21]. In
EAD CMS cases, the absence of ColQ (and therefore AChE) at the NMJ results in the
accumulation of ACh, which leads to continuous muscle contraction and, ultimately,
AChR desensitization [30].
Another approximately 15-20% of CMS cases involve missense and frameshift
mutations in RAPSN [31] [32] [33] and are referred to as rapsyn deficiency [23]. These
mutations are also inherited in an autosomal recessive manner [20]. There are two types
of rapsyn deficiency – early and late onset [20]. In early-onset rapsyn deficiency, the
clinical signs range from mild to severe and include neonatal respiratory failure,
hypotonia, episodic apnea, and arthrogryposis multiplex congenital [20]. Late-onset
rapsyn deficiency includes clinical signs such as weakness of the limbs and facial
muscles [20,34]. At the NMJ, rapsyn is involved in consolidating the AChRs at the
endplate by associating with itself and then aggregating the AChRs, attaching them to the
cytoskeleton of the muscle cell [20]. In cases of rapsyn-deficiency CMS, however, the
mutations in RAPSN result in either the inability of rapsyn to associate with itself [35] or
to cluster with AChR [20].
DOK7 mutations account for about 10-15% of CMS cases [36]. This type of CMS
is known as DOK7-associated limb-girdle-myasthenia, and these mutations are inherited
in an autosomal recessive manner [20]. The clinical signs include ptosis, waddling gait,
and weakness of the limbs and torso muscles [20]. DOK7 encodes the protein
downstream of kinase-7 (docking protein 7, or Dok-7), which plays a role in
15
synaptogenesis [20]. In addition, Dok-7 interacts with another protein of the NMJ known
as MuSK [22] and acts as an activator of the kinase activity of MuSK [20].
The treatment of CMS varies with the location of the causative mutation. For
example, anticholinesterase medication (cholinesterase inhibitors) are usually used for the
treatment of many cases of AChR subunit mutation CMS, but they are either ineffective
or can worsen clinical signs in CMSs caused by COLQ mutations [30,37-38]. Therefore,
it is important to determine the type of CMS before deciding on the form of treatment.
Most CMS studies are conducted in humans as CMSs are rare in veterinary
medicine. In dogs, CMS usually presents when the puppies are around 6 to 12 weeks old.
The clinical signs of CMS can vary, but the common clinical signs include generalized
muscle weakness. Many owners opt to euthanize their dogs if the dogs’ clinical signs
progress. There are a few treatments available, but the efficacy of these treatments varies
from case to case, usually corresponding with the gene involved [39]. For example, most
CMSs involving mutations in AChR subunit genes can be treated with anticholinesterase
medication, while clinical signs in CMSs involving mutations in COLQ are made worse
if the same medication is administered [39-40]. To date, cases of CMS have been
reported in Jack Russell Terriers [41], Springer Spaniels [42], Smooth Fox Terriers [43],
Old Danish Pointing Dogs [44], and Miniature Dachshunds [45]. While these studies
describe the clinical aspects of CMS such as the clinical signs, onset, and possible mode
of inheritance, as of this writing, molecular genetics studies have only identified two
mutations in veterinary CMSs: a CHRNE missense mutation in Brahman cows [46] and a
CHAT missense mutation in Old Danish Pointing Dogs [7].
16
Congenital Idiopathic Megaesophagus
Megaesophagus (ME) is another disease that affects both humans and dogs. This
disease is characterized by the dilation of the esophagus [47]. In humans, ME most often
occurs secondary to esophageal achalasia [48]. In dogs, ME can be either acquired or
inherited [47]. Because the muscles of the esophagus are affected, this disorder results in
the inability to swallow food and affected individuals are malnourished.
In dogs, both secondary acquired and congenital idiopathic forms of ME have
been observed [47]. Secondary acquired ME is usually associated with another disorder
such as myasthenia gravis or congenital myasthenic syndrome [43,49-50]. The congenital
form of megaesophagus, known as congenital idiopathic ME usually presents before
maturity, most often shortly after the puppies are weaned [47]. The clinical sign after
which the disease is named is an enlarged esophagus, which can be visualized by
radiographs and/or barium swallow [47].
Another clinical sign is regurgitation, which should be differentiated from
vomiting for an accurate diagnosis [47]. Regurgitation occurs when food or water is
expelled from the mouth or esophagus that has not been in the stomach [47]. Vomiting,
on the other hand, occurs when material is forcibly expelled from the stomach [47]. In
dogs affected with megaesophagus, the food that they ingest is mostly either regurgitated
or trapped in the enlarged esophagus [47]. Because of this, affected dogs suffer from
malnourishment, and the food trapped in the esophagus can be inhaled, resulting in
aspiration pneumonia, which can be fatal [47].
17
While there is no cure for congenital ME, there are treatments available, including
the use of a Bailey chair, a device that elevates the dog’s food dish and head so that
gravity can move the food to the stomach [47]. In addition, high-calorie food can be used
to increase the amount of nutrients the dog consumes at each meal [47]. This disease is
prevalent in several dog breeds, including Dachshund, German Shepherd Dogs,
Miniature Schnauzers, Wire Fox Terriers, Great Danes, and Rhodesian Ridgebacks, but it
has also been observed in other breeds [51]. Congenital ME is hereditary and appears to
have different modes of inheritance in different breeds (e.g., [51-60]. In German
Shepherd Dogs, one of the breeds affected by congenital ME, the mode of inheritance
appears to be more complex than a simple recessive or dominant trait [61].
The Bigger Picture
The following chapters describe my investigations into the genetic underpinnings
of CMS in the Labrador Retriever [8], CMS in the Jack Russell Terrier, and congenital
ME in the German Shepherd Dog [61]. In chapter two, a novel CMS was identified in a
family of Labrador Retrievers in which a missense mutation in COLQ is associated with
the CMS phenotype [8]. Candidate genes were identified using a novel approach in dogs
in which the SNP genotypes obtained through array analysis were evaluated for
frequencies following the pattern of recessive inheritance (i.e., 1.0 in affected dogs and
between 0.14 and 0.5 in unaffected parents and littermates) [8]. This method of
examining the allele frequencies within a family was adapted from a method described in
a paper by Roach and colleagues [62]. In this work, the authors used a family of 4 (2
18
parents and 2 affected offspring) to identify genomic regions segregating with 2 recessive
disorders [62]. With this method, 3 functional and positional candidate genes and a
mutation that segregates with CMS in this Labrador Retriever family were identified [8].
In chapter three, another form of CMS was identified in Jack Russell Terriers. In
our original family, there were 2 affected siblings, 1 unaffected sibling, and both parents
were healthy. The affected puppies presented with fatigue and muscle weakness. CMS
has been previously reported in Jack Russell Terriers [41,63-65]. CMS was first
described in this breed in 1974 [41]. A later study also described clinical signs similar to
those of the Jack Russell Terriers in our study [63]. Further studies found an AChR
deficiency in affected Jack Russell Terriers [64]. Wallace and Palmer reported that CMS
in Jack Russell Terriers appears to be autosomal recessive [65]. We concluded that the
CMS described in the 1970s and 1980s in Jack Russell Terriers is very similar and most
likely the same disease that observed in our study family [41,63-64]. Because the affected
dogs had an AChR deficiency, a candidate gene approach was used and the 5 genes
encoding receptor proteins were investigated. A frameshift mutation in CHRNE that
segregates with the CMS phenotype in modern cases and those from the 70’s and 80’s
was identified.
CMS can be devastating to breeders and dog owners as they usually progress until
the dog’s quality of life is so poor that the owners opt for euthanizing the animals. In
chapters two and three, tests for CMS in Labrador Retrievers and Jack Russell Terriers
were developed [8]. With these tests, breeders can screen their dogs before breeding
them, thereby lowering the chances of breeding carriers together. If carrier matings are
19
avoided, it is likely that the recessive diseases can be eliminated from the population.
This is particularly important in dogs because they are closed breeding populations with
low genetic diversity. Because these screens can detect carriers, breeders then have the
option to breed a carrier to a non-carrier so that carriers with other desirable traits do not
have to be completely removed from the breeding pool.
In addition, the results of the CMS studies indicate that, at least for the three
known CMS mutations in dogs [7-8], CMS is inherited as an autosomal recessive
disorder. Furthermore, different dog breeds exhibit different CMSs, indicating that other
affected breeds most likely harbor mutations in different genes than those already
identified (e.g., [7-8]). Veterinarians should also be made aware that, like human CMS
cases, different types require different treatments.
In chapter four, our study of congenital ME in German Shepherd Dogs, utilized a
GWAS approach [61]. Whole genome SNP profiles from 19 affected and 177 unaffected
German Shepherd Dogs were used in a case/control study with German Shepherd Dogs
affected with congenital ME as cases and German Shepherd Dogs that were either
healthy or diagnosed with other diseases as controls [61]. Through this analysis, a
segment on CFA12 associated with congenital ME harboring several SNPs was defined
[61]. Several additional affected German Shepherd Dogs were genotyped for these SNPs
[61]. While a candidate gene was not identified, SNP 12.60274687 was found to be
strongly associated with the congenital ME phenotype [61].
Congenital ME is most likely the result of a founder mutation in the German
Shepherd Dog as many members of this breed are affected. However, unlike the simple
20
recessive mutations observed in the two cases of CMS, congenital ME appears to have a
more complex inheritance pattern [61]. The fact that the SNP associated with the
congenital ME phenotype was present among healthy control dogs suggests incomplete
penetrance, perhaps due to modifier loci [61] or the involvement of an environmental
component. A second GWAS conducted using other breeds affected with ME could
allow for the identification of a smaller shared haplotype, while re-sequencing of the
associated region in an affected dog could yield candidate causal mutations.
In conclusion, different approaches have been used in my studies to investigate
the genetic causes of three different diseases of dogs. While chapters three and four
utilize standard candidate gene and GWAS approaches, respectively, chapter two
demonstrates for the first time that whole genome SNP profiles from nuclear family
members can be used to assess genomic inheritance patterns and identify functional and
positional candidate genes. In addition, genetic tests have been developed that are now
available for CMS in the Labrador Retriever and the Jack Russell Terrier. Used properly,
these tests will facilitate the elimination of CMS in these breeds.
References
1. Ostrander EA, Galibert F, Patterson DF (2000) Canine genetics comes of age. Trends
Genet 16: 117-124.
2. Lindblad-Toh K, Wade CM, Mikkelsen TS, Karlsson EK, Jaffe DB, et al. (2005)
Genome sequence, comparative analysis and haplotype structure of the domestic dog.
Nature 438: 803-819.
3. American Veterinary Medical Association (2012) U.S. Pet Ownership &
Demographics Sourcebook. Available:
21
https://www.avma.org/KB/Resources/Statistics/Pages/Market-research-statistics-US-Pet-
Ownership-Demographics-Sourcebook.aspx. Accessed 18 October 2014.
4. The University of Sydney (2014) OMIA - Online Mendelian Inheritance in Animals.
Accessed 17 November 2014. Available: http://omia.angis.org.au/home/.
5. Zangerl B, Goldstein O, Philp AR, Lindauer SJP, Pearce-Kelling SE, et al. (2006)
Identical mutation in a novel retinal gene causes progressive rod-cone degeneration in
dogs and retinitis pigmentosa in humans. Genomics 88: 551-563.
6. Clark LA, Wahl JM, Rees CA, Murphy KE (2006) Retrotransposon insertion in SILV
is responsible for merle patterning of the domestic dog. Proc Natl Acad Sci U S A 10:
1376-1381.
7. Proschowsky HF, Flagstad A, Cirera S, Joergensen CB, Fredholm M (2007)
Identification of a Mutation in the CHAT Gene of Old Danish Pointing Dogs Affected
with Congenital Myasthenic Syndrome. J Hered 98: 539–543.
8. Rinz CJ, Levine J, Minor KM, Humphries HD, Lara R, et al. (2014) A COLQ
Missense Mutation in Labrador Retrievers Having Congenital Myasthenic Syndrome.
PLoS One 9: e106425.
9. Winkler PA, Gornik KR, Ramsey DT, Dubielzig RR, Venta PJ, et al. (2014) A Partial
Gene Deletion of SLC45A2 Causes Oculocutaneous Albinism in Doberman Pinscher
Dogs. PLoS One 9(3): e92127.
10. Kirkness EF, Bafna V, Halpern AL, Levy S, Remington K, et al. (2003) The dog
genome: survey sequencing and comparative analysis. Science 301: 1898-1903.
11. Hoeppner MP, Lundquist A, Pirun M, Meadows JRS, Zamani N, et al. (2014) An
Improved Canine Genome and a Comprehensive Catalogue of Coding Genes and Non-
Coding Transcripts. PLoS One 9: e91172.
12. Vernau KM, Runstadler JA, Brown EA, Cameron JM, Huson HJ, et al. (2013)
Genome-Wide Association Analysis Identifies a Mutation in the Thiamine Transporter 2
(SLC19A3) Gene Associated with Alaskan Husky Encephalopathy. PLoS One 8: e57195.
13. Gill JL, Tsai KL, Krey C, Noorai RE, Vanbellinghen J-F, et al. (2012) A canine
BCAN microdeletion associated with episodic falling syndrome. Neurobiol Dis 45: 130-
136.
14. Karyadi DM, Karlins E, Decker B, vonHoldt BM, Carpintero-Ramirez G, et al.
(2013) A copy number variant at the KITLG locus likely confers risk for canine
squamous cell carcinoma of the digit. PLoS Genet 9: e1003409.
22
15. Haupt KH, Prieur DJ, Moore MP, Hargis AM, Hegreberg GA, et al. (1985) Familial
canine dermatomyositis: clinical, electrodiagnostic, and genetic studies. Am J Vet Res
46: 1861–9.
16. Hargis A, Mundell A (1992) Familial canine dermatomyositis. Compend Contin Educ
Vet. 4: 855–64.
17. Scott DW, Miller WH, Griffin CE (2000) Congenital and hereditary defects. In:
Muller and Kirk’s Small Animal Dermatology, 6th edn. Philadelphia, PA, W.B. Saunders
pp.940–6.
18. Miller FW, Cooper RG, Vencovský J, Rider LG, Danko K, et al. (2013) Genome-
wide association study of dermatomyositis reveals genetic overlap with other
autoimmune disorders. Arthritis Rheum 65: 3239-3247.
19. Tsai KL, Starr-Moss AN, Venkataraman GM, Robinson C, Kennedy LJ, et al. (2013)
Alleles of the major histocompatibility complex play a role in the pathogenesis of
pancreatic acinar atrophy in dogs. Immunogenetics 65: 501-509.
20. Abicht A, Müller JS, Lochmüller H (2012) Congenital Myasthenic Syndromes.
GeneReviews Available: http://www.ncbi.nlm.nih.gov/books/NBK1168/. Accessed 27
February 2014.
21. Katz B, Miledi R (1973) The Binding of Acetylcholine to Receptors and its Removal
from the Synaptic Cleft. J Physiol 231: 549-574.
22. Okada K, Inoue A, Okada M, Murata Y, Kakuta S, et al. (2006) The muscle protein
Dok-7 is essential for neuromuscular synaptogenesis. Science 312: 1802-1805.
23. Hantaï D, Nicole S, Eymard B (2013) Congenital myasthenic syndromes: an update.
Curr Opin Neurol 26: 561-568.
24. Ohno K, Engel AG (2004) Congenital myasthenic syndromes: gene mutations.
Neuromuscul Disord 14: 117-122.
25. Engel AG, Sine SM (2005) Current understanding of congenital myasthenic
syndromes. Curr Opin Pharmacol 5: 308-321.
26. Navedo MF, Lasalde-Dominicci JA, Báez-Pagán CA, Díaz-Pérez L, Rojas LV, et al.
(2006) Novel beta subunit mutation causes a slow-channel syndrome by enhancing
activation and decreasing the rate of agonist dissociation. Mol Cell Neurosci 32: 82-90.
23
27. Shen XM, Deymeer F, Sine SM, Engel AG. (2006) Slow-channel mutation in
acetylcholine receptor alphaM4 domain and its efficient knockdown. Ann Neurol 60:
128-136.
28. Harper CM, Engel AG (1998) Quinidine sulfate therapy for the slow-channel
congenital myasthenic syndrome. Ann Neurol 43: 480-484.
29. Palace J, Lashley D, Bailey S, Jayawant S, Carr A, et al. (2012) Clinical features in a
series of fast channel congenital myasthenia syndrome. Neuromuscul Disord 22: 112-
117.
30. Engel AG, Lambert EH, Gomez MR (1977) A New Myasthenic Syndrome with End-
Plate Acetylcholinesterase Deficiency, Small Nerve Terminals, and Reduced
Acetylcholine Release. Ann Neurol 1: 315-330.
31. Ohno K, Engel AG, Shen X-M, Selcen D, Brengman J, et al. (2002) Rapsyn
Mutations in Humans Cause Endplate Acetylcholine-Receptor Deficiency and
Myasthenic Syndrome. Am J Hum Genet 70: 875-885.
32. Müller JS, Abicht A, Burke G, Cossins J, Richard P, et al. (2004) The Congenital
Myasthenic Syndrome mutation RAPSN N88K derives from an ancient Indo-European
founder. J Med Genet 41: e104.
33. Gaudon K, Pénisson-Besnier I, Chabrol B, Bouhour F, Demay L, et al. (2010)
Multiexon deletions account for 15% of congenital myasthenic syndromes with RAPSN
mutations after negative DNA sequencing. J Med Genet 47: 795-796.
34. Ohno K, Sadeh M, Blatt I, Brengman JM, Engel AG. (2003) E-box mutations in the
RAPSN promoter region in eight cases with congenital myasthenic syndrome. Hum Mol
Genet 12: 739–748.
35. Cossins J, Burke G, Maxwell S, Spearman H, Man S, et al. (2006) Diverse molecular
mechanisms involved in AChR deficiency due to rapsyn mutations. Brain 129: 2773-
2783.
36. Selcen D, Milone M, Shen XM, Harper CM, Stans AA, et al. (2008) Dok-7
myasthenia: phenotypic and molecular genetic studies in 16 patients. Ann Neurol 64: 71-
87.
37. Ohno K, Engel AG, Brengman JM, Shen X-M, Heidenreich F, et al. (2000) The
Spectrum of Mutations Causing End-Plate Acetylcholinesterase Deficiency. Ann Neurol
47:162–170.
24
38. Hutchinson DO, Walls TJ, Nakano S, Camp S, Taylor P, et al. (1993) Congenital
endplate acetylcholinesterase deficiency. Brain 116: 633-653.
39. Engel AG (2007) The Therapy of Congenital Myasthenic Syndromes.
Neurotherapeutics 4: 252-257.
40. Harper CM, Engel AG (2000) Treatment of 31 congenital myasthenic syndrome
patients with 3,4-diaminopyridine. Neurology 54: A395.
41. Palmer AC, Barker J (1974) Myasthenia in the dog. Vet Rec 95: 452-454.
42. Johnson RP, Watson AD, Smith J, Cooper BJ (1975) Myasthenia in Springer Spaniel
littermates. J Small Anim Pract 16: 641-647.
43. Miller LM, Lennon VA, Lambert EH, Reed SM, Hegreberg GA, et al. (1983)
Congenital myasthenia in 13 smooth fox terriers. J Am Vet Med Assoc 182: 694-697.
44. Flagstad A, Trojaborg W, Gammeltoft S (1989) Congenital myasthenic syndrome in
the dog breed Gammel Dansk Hønsehund: clinical, electrophysiological, pharmacological
and immunological comparison with acquired myasthenia gravis. Acta Vet Scand 30: 89-
102.
45. Dickinson PJ, Sturges BK, Shelton GD, LeCouteur RA (2005) Congenital
Myasthenia Gravis in Smooth-Haired Miniature Dachshund Dogs. J Vet Intern Med 19:
920-923.
46. Kraner S, Sieb JP, Thompson PN, Steinlein OK (2002) Congenital myasthenia in
Brahman calves caused by homozygosity for a CHRNE truncating mutation.
Neurogenetics 4: 87-91.
47. Guilford WG (1990) Megaesophagus in the dog and cat. Semin Vet Med Surg (Small
Anim) 5: 37–45.
48. Gockel I, Becker J, Wouters MM, Niebisch S, Gockel HR, et al. (2014) Common
variants in the HLA-DQ region confer susceptibility to idiopathic achalasia. Nat Genet
46: 901-904.
49. Knauer CM, Carbone JV, Brandborg LL, Silverman, Jr. S (1985) Alimentary tract
and liver, in Krupp MA (ed): Current Medical Diagnosis and Treatment. Norwalk, CT,
Lange, pp.352-431.
50. Boudrieu RJ, Rogers WA (1985) Megaesophagus in the dog: A review of 50 cases. J
Am Anim Hosp Assoc 21: 33-40.
25
51. Osbourne CA, Clifford DH, Jessen C (1967) Hereditary esophageal achalasia in dogs.
J Am Vet Med Assoc 151: 572-581.
52. Strating A, Clifford DH (1966) Canine achalasia with special reference to hereditary.
Southwest Vet 19: 135-137.
53. Cox VS, Wallace LJ, Anderson VE, Rushmer RA (1980) Hereditary esophageal
dysfunction in the Miniature Schnauzer dog. Am J Vet Res 41: 326-330.
54. Harvey CE, O’Brien JA, Durie VR, Miller DJ, Veenema R (1974) Megaesophagus in
the dog: A clinical survey of 79 cases. J Am Vet Med Assoc 165: 443-446.
55. Strombeck DR (1979) Small Animal Gastroenterology (ed 1). Davis, CA, Stonegate.
pp.52-67.
56. Breshears DE (1965) Esophageal dilation in six-week-old male German Shepherd
pups. Vet Med Small Anim Clin 60: 1034-1036.
57. Palmer CS (1968) Achalasia or cardiospasms in Great Dane puppies. Vet Med Small
Anim Clin 63: 574-578.
58. Leib MA (1983) Megaesophagus in the dog. Comp Cont Educ Pract Vet 5: 825-833.
59. Schwartz A, Ravin CE, Greenspan RH, Schoemann RS, Burt JK (1976) Congenital
neuromuscular esophageal disease in a litter of Newfoundland puppies. J Am Vet Radiol
Soc 17:101.
60. Spy GM (1963) Megaesophagus in a litter of Greyhounds. Vet Rec 75: 853-854.
61. Tsai KL, Noorai RE, Starr-Moss AN, Quignon P, Rinz CJ, et al. (2012) Genome-
wide association studies for multiple diseases of the German Shepherd Dog. Mamm
Genome 23: 203-11.
62. Roach JC, Glusman G, Smit AFA, Huff CD, Hubley R, et al. (2010) Analysis of
Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing. Science 328:
636-639.
63. Palmer AC, Goodyear JV (1978) Congenital myasthenia in the Jack Russell Terrier.
Vet Rec 103: 433-434.
64. Oda K, Lambert EH, Lennon VA, Palmer AC (1984) Congenital canine myasthenia
gravis: I. Deficient junctional acetylcholine receptors. Muscle Nerve 7: 705-716.
26
65. Wallace ME, Palmer AC (1984) Recessive mode of inheritance in myasthenia gravis
in the Jack Russell Terrier. Vet Rec 114: 350.
27
CHAPTER TWO
A COLQ MISSENSE MUTATION IN LABRADOR RETRIEVERS
HAVING CONGENITAL MYASTHENIC SYNDROME
Caitlin J. Rinz1; Jonathan Levine
2; Katie M. Minor
3; Hammon D. Humphries
4; Renee
Lara5; Alison N. Starr-Moss
1; Ling T. Guo
4; D. Colette Williams
6; G. Diane Shelton
4*;
Leigh Anne Clark1*
Author Affiliations 1Department of Genetics and Biochemistry, College of Agriculture, Forestry, and Life
Sciences, 154 Poole Agricultural Center, Clemson University, Clemson, SC 29634 2Department of Small Animal Clinical Sciences, College of Veterinary Medicine and
Biomedical Sciences, Texas A&M University, College Station, TX 77843 3Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine,
University of Minnesota, St. Paul, MN 55108 4Department of Pathology, School of Medicine, University of California San Diego, La
Jolla, CA 92093 5Kingdom Animal Hospital, 824 E. Villa Maria, Bryan, TX 77802
6R. Prichard Veterinary Medical Teaching Hospital, University of California Davis,
Davis, CA 95616
Author Contributions
Conceived and designed the experiments – GDS LAC. Performed the experiments: CJR,
JL, HDH, LTG, DCW. Analyzed the data: CJR, JL, GDS, LAC. Contributed
reagents/materials/analysis tools: KMM, RL, ANSM. Contributed to the writing of the
manuscript: CJR, ANSM, GDS, LAC.
Citation
Rinz CJ, Levine J, Minor KM, Humphries HD, Lara R, et al. (2014) A COLQ Missense
Mutation in Labrador Retrievers Having Congenital Myasthenic Syndrome. PLoS ONE
9(8): e106425. doi:10.1371/journal.pone.0106425
Editor
Claire Wade, University of Sydney, Australia
Received May 23, 2014; Accepted July 29, 2014; Published August 28, 2014
Copyright: © 2014 Rinz et al. This is an open-access article distributed under the terms of
the Creative Commons Attribution License, which permits unrestricted use, distribution,
and reproduction in any medium, provided the original author and source are credited.
Data Availability
The authors confirm that all data underlying the findings are fully available without
restriction. All relevant data are within the paper and its Supporting Information files.
28
Funding: Research reported in this publication was supported by the National Institute of
Arthritis and Musculoskeletal and Skin Diseases of the National Institutes of Health
under Award Number R15AR062868 (LAC) and the Canine Health Foundation under
Award Number 01311 (ANSM). The content is solely the responsibility of the authors
and does not necessarily represent the official views of the National Institutes of Health
or Canine Health Foundation. The funders had no role in study design, data collection
and analysis, decision to publish, or preparation of the manuscript.
Competing Interests
The authors have declared that no competing interests exist.
[email protected] (GDS); [email protected] (LAC)
Copyright Permission
“PLOS applies the Creative Commons Attribution (CC BY) license to all works we
publish (read the human-readable summary or the full license legal code). Under the CC
BY license, authors retain ownership of the copyright for their article, but authors allow
anyone to download, reuse, reprint, modify, distribute, and/or copy articles in PLOS
journals, so long as the original authors and source are cited. No permission is required
from the authors or the publishers.” (http://www.plosone.org/static/license)
Abstract
Congenital myasthenic syndromes (CMSs) are heterogeneous neuromuscular disorders
characterized by skeletal muscle weakness caused by disruption of signal transmission
across the neuromuscular junction (NMJ). CMSs are rarely encountered in veterinary
medicine, and causative mutations have only been identified in Old Danish Pointing
Dogs and Brahman cattle to date. Herein, we characterize a novel CMS in 2 Labrador
Retriever littermates with an early onset of marked generalized muscle weakness.
Because the sire and dam share 2 recent common ancestors, CMS is likely the result of
29
recessive alleles inherited identical by descent (IBD). Genome-wide SNP profiles
generated from the Illumina HD array for 9 nuclear family members were used to
determine genomic inheritance patterns in chromosomal regions encompassing 18
functional candidate genes. SNP haplotypes spanning 3 genes were consistent with
autosomal recessive transmission, and microsatellite data showed that only the segment
encompassing COLQ was inherited IBD. COLQ encodes the collagenous tail of
acetylcholinesterase, the enzyme responsible for termination of signal transduction in the
NMJ. Sequences from COLQ revealed a variant in exon 14 (c.1010T>C) that results in
the substitution of a conserved amino acid (I337T) within the C-terminal domain. Both
affected puppies were homozygous for this variant, and 16 relatives were heterozygous,
while 288 unrelated Labrador Retrievers and 112 dogs of other breeds were wild-type. A
recent study in which 2 human CMS patients were found to be homozygous for an
identical COLQ mutation (c.1010T>C; I337T) provides further evidence that this
mutation is pathogenic. This report describes the first COLQ mutation in canine CMS and
demonstrates the utility of SNP profiles from nuclear family members for the
identification of private mutations.
Introduction
Skeletal muscle contraction is stimulated by the emission of the neurotransmitter
acetylcholine (ACh) by the motor neuron, and terminated by acetylcholinesterase (AChE)
in the neuromuscular junction (NMJ). Disruption of signal transmission within the NMJ
resulting from presynaptic, synaptic, or post-synaptic defects causes congenital
30
myasthenic syndromes (CMSs), heterogeneous neuromuscular disorders characterized by
skeletal muscle weakness and fatigue. Mutations causing CMSs in humans have been
identified in 18 genes to date, with a majority of cases attributed to CHRNE, COLQ,
RAPSN, and DOK7 [1]. Mutations are predominantly autosomal recessive, and often act
in compound heterozygosity [2-5].
Naturally-occurring CMSs are rarely described in veterinary medicine; when they
do occur, they are usually in animals between 6 to 12 weeks of age, appear to be familial,
and are characterized by severe generalized skeletal muscle weakness. The first report of
canine CMS was in the Jack Russell Terrier in 1974 [6]. Since that time, acetylcholine
receptor (AChR) deficiency has been confirmed in Jack Russell Terriers [7], as well as
Smooth Fox Terriers [8]. CMS has also been clinically described in families of Springer
Spaniels [9], Miniature Smooth-Haired Dachshunds [10], and Old Danish Pointing Dogs
[11]. Characterization of CMS at the molecular level has only been achieved in Old
Danish Pointing Dogs (missense mutation in CHAT) [12], and in young Brahman cows
(deletion in CHRNE) [13].
Diagnosis of CMS is challenging and relies on clinical evaluation, morphological
studies of muscle and peripheral nerves, electrodiagnostic studies, the absence of serum
antibodies against muscle AChRs, demonstration of AChR deficiency, and most recently,
molecular genetic studies. We have identified a novel canine CMS in a family of
Labrador Retrievers. Affected littermates exhibited signs clinically distinct from
neuromuscular disorders previously characterized in the breed: exercise-induced collapse
(EIC) [14], centronuclear myopathy (CNM) [15], and myotubular myopathy [16].
31
While genome-wide association studies (GWAS) are an efficient approach for the
identification of recessive alleles, they require several unrelated affected individuals [17-
19]. In the absence of a population suitable for GWAS, we utilized genome-wide SNP
profiles from a nuclear family to evaluate inheritance patterns in chromosomal regions
harboring all 18 candidate genes. Described herein is the clinical characterization of CMS
in a Labrador Retriever family and identification of a missense mutation in COLQ.
Materials and Methods
Animals
The dogs evaluated in this study were members of a Labrador Retriever family.
The dam and sire were clinically normal and both tested clear for the EIC [14] and CNM
[15] mutations affecting the Labrador Retriever breed. At 6 weeks of age, 2 female
puppies from a litter of 9 were presented to the Texas A&M University (TAMU)
Veterinary Teaching Hospital with a 3- to 4-week history of exercise-induced
tetraparesis. One puppy was euthanized for progression of clinical signs at 7 weeks of
age. Further evaluation including electrophysiology and blood and tissue collection was
performed prior to euthanasia of the second puppy. No clinical signs of weakness were
observed in 6 littermates (1 puppy died at birth), and a neuromuscular disease had not
been previously identified in this family.
32
Sample Collection and DNA Isolation
Whole blood was drawn from family members by their primary care
veterinarians. Buccal swabs were collected from additional Labrador Retrievers, both
related and unrelated to the affected dogs. DNAs from Labrador Retrievers and other
breeds previously collected for unrelated studies were also available. Informed owner
consent and all samples were obtained in accordance with protocols approved by the
Clemson University Institutional Review Board (IBC2008-17). Owner consent was
obtained for post-mortem tissue collection from both affected puppies at TAMU.
Genomic DNA was isolated using Gentra Puregene Blood Kit (Qiagen).
Electrophysiology
Electrodiagnostics on the affected second puppy, including electromyography
(EMG), measurement of motor nerve conduction velocity (MNCV), and measurement of
the decrement in the compound muscle action potential (CMAP) following repetitive
nerve stimulation, were performed on the left side under general inhalational anesthesia
using a Nicolet Viking Select EMG/evoked potential system (Nicolet, Biomedical Inc.).
Insulated stainless steel needle electrodes were used for both nerve stimulation and
recording from muscle, while a platinum subdermal electrode (Grass-Telefactor) was
employed as a ground. MNCV of the peroneal and ulnar nerves was determined by
dividing the distance between proximal and distal stimulation sites by the difference in
latency of the corresponding CMAP recorded from the extensor digitorum brevis muscle
and palmar interosseous muscles, respectively, after supramaximal stimulation (2Hz
33
stimulus rate, 0.2ms stimulus duration). Amplitude (peak to peak) was measured from
CMAPs derived from stimulation at the proximal and distal stimulation sites. Repetitive
nerve stimulation parameters included stimulation frequencies of 1, 2, 3, 5, 10, 20, or
50Hz.
Histopathology, Histochemistry, and Immunohistochemistry
Specimens collected post-mortem from the second puppy included the
infraspinatus, extensor carpi radialis, triceps brachii, biceps femoris, quadriceps, and
cranial tibial muscles on the right side. The muscles were frozen in isopentane pre-cooled
in liquid nitrogen and stored at -80ºC until further processing. Light microscopic
evaluation of histological and histochemical stains and reactions was performed
according to standard protocols [20] and included hematoxylin and eosin, modified
Gomori trichrome, periodic acid Schiff, phosphorylase, esterase, myofibrillar ATPase
reaction at preincubation pH of 9.8, 4.5, and 4.3, reduced nicotinamide adenine
dinucleotide-tetrazolium reductase, succinic dehydrogenase, acid phosphatase, and oil red
O.
Specimens from the radial and peroneal nerves were immersion fixed in 2.5%
glutaraldehyde in 0.1M phosphate buffer before shipment to the laboratory. Upon receipt,
nerves were post-fixed in 1% aqueous osmium tetroxide for 3h to 4h and then dehydrated
in a graded alcohol series and propylene oxide. After infiltration with a 1:1 mixture of
propylene oxide and araldite resin for 4h, nerves were placed in 100% araldite resin
overnight and then embedded in fresh araldite resin. Thick sections (1µm) were cut and
stained with paraphenylediamine prior to light microscopic evaluation.
34
For immunohistochemical localization of motor end-plates, serial cryosections
(8µm) were obtained from the external intercostal muscle of 1 affected Labrador
Retriever, archived frozen muscle of a previously diagnosed Jack Russell Terrier with
CMS due to AChR deficiency (neuromuscular disease control), and a normal dog (wild-
type control). Sections from each dog were incubated with the esterase reaction for
identification of presumptive motor end-plates or Alexa Fluor 594 α-bungarotoxin
(1:1000, Molecular Probes) for localization of AChRs at the motor end-plate. Serial
sections were evaluated with light microscopy (esterase reaction) and fluorescent
microscopy (red fluorescence) and localization of stainings compared.
AChR Quantification and Antibody-bound AChR
AChR was extracted from external intercostal muscle specimens of both affected
puppies by a procedure modified from that of Lindstrom and Lambert [21]. The muscle
specimens were stored at -70ºC prior to homogenization and extraction of AChR in 2%
Triton X-100. Solubilized AChRs were labeled by incubation with an excess of 125
I-α-
bungarotoxin (125
I-αbgt) followed by sequential addition of high titer rat-anti-AChR
antibody and precipitation with goat anti-rat IgG. The precipitate was pelleted, washed,
and quantitated in a gamma counter. The amount of AChR complexed with 125
I-αbgt was
quantified and expressed in terms of moles of 125
I-αbgt precipitated per gram of tissue.
The concentration of in-situ antibody-AChR complexes was determined by precipitation
with goat anti-rat serum in the presence of normal rat serum. Quantitative serum AChR
35
antibody concentrations were determined as previously described using an
immunoprecipitation radioimmunoassay procedure [22].
SNP Profiling
Eighteen candidate genes were selected based on their involvement in human
CMSs. Candidate genes were distributed across 13 canine chromosomes: 3 (DOK7), 5
(AGRN, CHRNB1, CHRNE, DPAGT1), 6 (ALG14), 9 (SCN4A), 10 (GFPT1), 11 (ALG2,
MUSK), 13 (PLEC1), 18 (RAPSN), 20 (LAMB2), 23 (COLQ), 25 (CHRNG, CHRND), 28
(CHAT), and 36 (CHRNA1) [1]. The Illumina CanineHD Infinium BeadChip was used to
profile 173,662 SNPs representing all chromosomes for 9 nuclear family members: 7
littermates and both parents (Figure 1). Arrays were processed according to
manufacturer’s protocols. Allele frequencies were calculated using a case/control analysis
conducted with PLINK [23]. Chromosomal regions harboring candidate genes were
evaluated for SNP haplotypes with frequencies of 1.0 in the CMS cases and between 0.14
and 0.50 in the controls. Individual genotypes in regions fitting these parameters were
then manually examined to ensure that no unaffected littermates were homozygous for
the allele present in the affected dogs.
36
Figure 1. Multigenerational pedigree of Labrador Retrievers. Filled individual icons
denote affected dogs and semi-filled icons denote obligate carriers. Asterisks mark
individuals selected for whole-genome SNP profiling.
Microsatellite Analysis
PCR for amplification of individual microsatellite markers was performed using
materials and thermal cycling parameters previously described [24,25]. Products were
resolved with GeneScan 600 LIZ size standard (Applied Biosystems) on an ABI 3730XL
DNA Analyzer (Applied Biosystems). GeneMapper Software version 4.0 (Applied
Biosystems) was used to visualize the microsatellite signals.
Sanger Sequencing
Primers were designed to amplify all coding regions and splice sites of CHRNG,
CHRND, and COLQ. Products were amplified using ReddyMix Master Mix (Thermo
Scientific) with 0.4µM of each primer and 50ng of DNA. Products were purified using
the Qiax II Gel Extraction Kit (Qiagen) or an ExoSAP master mix consisting of 0.5 units
37
of Exonuclease I (New England BioLabs) and 0.25 units of SAP (Promega). Primer
sequences and purification methods for each amplicon are given in Table S1. Sequencing
products were resolved on an ABI 3730XL DNA Analyzer (Applied Biosystems).
Restriction Enzyme Digest
Detection of the COLQ variant was accomplished using the endonuclease BtsI,
which recognizes the following sequence and cutsite (^): 5’…NN^CACTGC…3’. The
digestion was performed using BtsI CutSmart (New England BioLabs) with 2.5μL 10X
buffer, 0.40μL BtsI, 1μg DNA, and water adjusted accordingly for a total reaction
volume of 25μL. Products were resolved on a 2% agarose gel.
Results
Clinical Description
Neurological examination was consistent with a generalized neuromuscular
disease with marked short-strided tetraparesis that worsened with exercise. Postural
reactions were preserved with the exception of hopping which was diminished in all
limbs when the puppies were made to bear full weight. Spinal reflexes including the
patellar, cranial tibial, and flexor withdrawals were reduced in all limbs. A
pyridostigmine bromide challenge resulted in worsening of muscle weakness.
38
Electrophysiology
EMG was performed on the left side of the body and included the supraspinatus,
infraspinatus, triceps, biceps, extensor carpi radialis, superficial and deep digital flexor,
interosseous, biceps femoris, rectus femoris, cranial tibial, and gastrocnemius muscles.
Abnormal EMG activity was not identified in any muscle group. Peroneal and ulnar
MNCV was likely age appropriate (41m/sec and 31m/sec, respectively; reported values
for normal dogs 1 to 6 months of age 32m/sec to 55m/sec and 25m/sec to 48m/sec)
[26,27]. The peroneal and ulnar nerve CMAP amplitudes were reduced at all stimulus
sites (1.9mV to 2.1mV and 2.6mV to 2.9mV, respectively, reference ≥8mV, peak-to-
peak) (Figure 2) [27]. F-waves were not recordable upon stimulation of either the
peroneal or ulnar nerve. Repetitive stimulation of the peroneal nerve revealed a
decrement in the CMAP amplitude of 22% at 2Hz, 33% at 5Hz, and 35% at 50Hz when
the first and third CMAPs were compared (Figure 3). Decrements greater than 10% are
considered significant.
39
Figure 2. Peroneal MNCV of an affected Labrador Retriever recorded at the extensor
digitorum brevis muscle with stimulation at the level of the hock, stifle, and hip.
Although the CV was normal considering the dog’s age, the amplitude of the CMAP was
uniformly diminished. The timebase between vertical columns on the x-axis is 2msec and
the voltage measured between adjacent rows on the y-axis is 2mV. Control tracings are
from the peroneal nerve of a healthy 5 month old Beagle. Note: labeling varies with the
control amplitudes measured from baseline to peak, peak-to-peak amplitudes are within
normal limits (≥8mV). Latency 2 markings also vary.
Figure 3. Repetitive stimulation of the peroneal motor nerve of an affected Labrador
Retriever at 2Hz (A), 5Hz (B), and 50Hz (C). Decrement of the CMAP was observed at
all tested frequencies. Sweep speed and sensitivity settings are identical to those in Figure
40
2. Control tracings are from the peroneal nerve of a healthy 5-month-old Beagle with no
decrement seen at low frequency stimulation and normal pseudofaciliation (CMAP gets
taller and narrower) with tetanic stimulation.
Histopathology, Histochemistry, and Immunohistochemistry
Myofiber size was appropriate in all muscles evaluated and no specific
abnormalities were identified, making a congenital myopathy unlikely. Multifocal areas
of esterase reactivity were identified, but it could not be determined from this reaction if
staining correlated with localization of motor end-plates. In the Labrador Retriever with
CMS, esterase staining was evident in multiple locations but did not fully correlate with
AChR labeling (Figure 4). There was a good correlation with esterase staining and
AChR labeling in the normal dog. In the Jack Russell Terrier with CMS (neuromuscular
disease control), several end-plates were stained with esterase; however, no AChRs were
labeled in the serial muscle section, consistent with the marked decrease in muscle
AChRs described in this breed. There was no evidence of axonal degeneration,
demyelination, or abnormalities of supporting structures in the peripheral nerve
evaluations, excluding a congenital polyneuropathy.
41
Figure 4. Cryosections (8µm) of intercostal muscle from a normal dog, a Labrador
Retriever with CMS (end-plate AChE deficiency), and a Jack Russell Terrier with CMS
due to AChR deficiency (neuromuscular disease control) are illustrated. For each dog,
histochemical staining for esterase activity (brown stain) is shown along with a serial
section demonstrating immunofluorescent localization of α-bungarotoxin for AChR and
end-plate localization (red color). Muscle nuclei are blue (Dapi stain). There is a good
correlation between esterase staining (brown) and α-bungarotoxin localization (red) in the
control dog muscle. Although esterase staining is present in the Labrador Retriever
muscle (arrows), the localization correlates poorly with that of AChRs. In the CMS Jack
Russell Terrier esterase staining was present; however, staining for AChR was markedly
decreased or absent, consistent with a markedly decreased AChR content. Bar = 50µm
for all images.
42
AChR Quantification and Antibody-bound AChR
The concentration of AChR was determined from external intercostal muscle
samples collected origin to insertion following euthanasia of both affected Labrador
Retriever puppies. The AChR concentration was decreased in both puppies (0.07pmol/gm
and 0.10pmol/gm tissue, reference 0.2pmol/gm to 0.4pmol/gm). AChR antibodies were
not detected bound to muscle AChRs or in the serum.
Analysis of Family Genomic Inheritance Patterns
Over 172,000 SNPs across 40 canine chromosomes were genotyped for each of 9
nuclear family members. Allele frequencies in regions on the 13 chromosomes harboring
candidate genes were evaluated for a pattern consistent with a recessive trait (Table S2).
SNP haplotypes on both chromosomes 23 and 25 were homozygous in the cases and had
frequencies of 0.36 and 0.29, respectively, in the unaffected individuals. Chromosome 23
harbors COLQ, while the region on chromosome 25 includes both CHRNG and CHRND.
Because the sire and dam share 2 recent common ancestors, we hypothesized that
the causative mutation was inherited identical by descent (IBD). To determine whether
the aforementioned segments of chromosomes 23 and 25 were inherited IBD, we
genotyped polymorphic microsatellite markers in each region. Genotypes revealed
homozygosity in the affected dogs for markers flanking COLQ, providing evidence that
the segment on chromosome 23 is IBD (Figure 5). Affected dogs were heterozygous for
43
haplotypes encompassing CHRNG and CHRND, suggesting that the chromosome 25
segment was not inherited from a recent common ancestor.
Figure 5. Microsatellite and SNP haplotypes (color-coded bars below individuals) are
shown for 3 candidate genes. Positions (in Mb) are according to CanFam 2. Filled
individual icons denote affected dogs and semi-filled icons denote obligate carriers.
Chromosome 23 haplotypes (blue) are inherited IBD in both affected dogs.
Sequencing of CHRNG, CHRND, and COLQ
No nonsynonymous variants were identified in CHRNG. A single
nonsynonymous variant in exon 4 of CHRND did not segregate with a recessive
phenotype. Sequence data for COLQ revealed 3 nonsynonymous variants, only 1 of
44
which segregated with a recessive trait. The exon 14 variant, c.1010T>C, predicts the
substitution of isoleucine with threonine at residue 337 (Figure 6A).
Screening of c.1010T>C Variant
PCR amplicons from the COLQ exon 14 primer set are 470bp in size. BtsI cleaves
the amplicon only in individuals having the c.1010T>C allele, yielding fragments of
204bp and 266bp. Heterozygotes for the variant have all 3 fragments sizes (Figure 6B).
Digestion with Bts1 was used to genotype the variant for 49 additional members
of this Labrador Retriever family, 288 unrelated Labrador Retrievers, and 112 dogs
representing 65 other breeds (Table S3). Of the 58 family members, 40 were homozygous
wild-type, 16 were heterozygous, and only the 2 affected dogs described herein were
homozygous for the variant. The variant was not present in any unrelated Labrador
Retrievers or dogs from other breeds.
45
Figure 6. (A) Sequence from the 5’ end of the C-terminal domain of ColQ in mammals.
Identical residues are denoted by an asterisk, conserved substitutions by a colon, and
semi-conserved substitutions by a period. Residues altered in human CMS cases are
highlighted in yellow [4,30,32,37]. (B) BtsI digest results for the Labrador Retriever
family. PCR amplicons from COLQ exon 14 are 470bp in size and cleaved into 204 and
266bp fragments in the presence of c.1010T>C. Three clinically normal littermates were
identified as carriers, denoted by semi-filled icons.
Discussion
The probands in this study presented with an early onset neuromuscular disorder
characterized by severe exercise-induced weakness. The lack of specific morphological
changes in muscle and peripheral nerve biopsies excluded an underlying congenital
myopathy or neuropathy. Electrodiagnostic findings and decreased AChR concentration
in the muscle indicated a disorder of neuromuscular transmission. The autoimmune
disease myasthenia gravis was eliminated based on the early age of onset and an absence
of AChR antibodies in serum and AChR-bound antibodies in the muscle. The clinical
diagnosis in the Labrador Retrievers was CMS.
While clinical signs and electrophysiological findings are generally similar
between presynaptic, synaptic, and postsynaptic forms of CMS, a notable observation in
the affected puppies was a worsening of the phenotype upon administration of an AChE
inhibitor. This response indicates desensitization of the AChRs from overexposure to
ACh and is consistent with a synaptic form of CMS referred to as end-plate AChE
deficiency (EAD) [5]. EAD accounts for 10% to 15% of all human cases of CMSs and is
always caused by mutations in COLQ [5]. COLQ encodes a collagen strand that
homotrimerizes to form the tail subunit of asymmetric AChE. ColQ anchors AChE to the
basal lamina where the enzyme hydrolyzes ACh, thereby limiting the length of the
46
synaptic response [28]. In the absence of ColQ, ACh accumulates, causing prolonged
muscle contraction and eventually the desensitization of AChR [29].
Through the examination of SNP allele frequencies in the Labrador Retriever
family, we identified 2 chromosomes harboring CMS candidate genes that showed an
inheritance pattern consistent with autosomal recessive transmission. Whereas human
forms of CMS are often caused by compound heterozygosity, low levels of genetic
diversity within purebred dog populations make simple recessive alleles more common.
Linebreeding in this Labrador Retriever family makes it likely that the sire and dam
inherited the mutation from a common ancestor and that the affected puppies are
homozygous for a chromosome segment transmitted IBD. Analysis of polymorphic
microsatellites showed that the regions flanking COLQ are IBD, whereas those flanking
the other 2 identified candidate genes are not.
Sequencing of COLQ in the Labrador Retrievers revealed a missense mutation
that predicts the replacement of a conserved hydrophobic isoleucine with a hydrophilic
threonine in the C-terminal domain. ColQ has 3 domains: an N-terminal proline-rich
attachment domain (PRAD), a collagenic central domain, and a C-terminal domain. The
PRAD serves to attach the ColQ strand to an AChE tetramer. The collagen domain
assembles the triple helix, while the C-terminal domain is involved in both the formation
of the triple helix [30] and anchoring of the structure to the basal lamina [30,31].
In humans, mutations responsible for EAD have been identified in each domain of
COLQ and have different functional consequences depending on their location [4]. In the
C-terminus, missense mutations in residues ranging from positions 342 to 452 are
47
thought to inhibit the attachment of ColQ to the basal lamina of the muscle cell [30-33].
Some C-terminus mutations (e.g., V322D) may prevent the formation of the ColQ triple
helix [32]. In the affected Labrador Retrievers, localization of the esterase reaction
showed a poor correlation between AChE and AChR. This finding suggests improper
anchoring of ColQ to the basal lamina, or mislocalization. Insufficient muscle samples
prevented us from conducting a sedimentation profile of AChE to determine the exact
consequence of the I337T mutation identified.
Linebreeding practices expedite the appearance of recessive diseases in purebred
dog populations. The availability of genetic tests for the detection of carrier dogs allows
for selective breeding to prevent widespread dissemination of the deleterious allele to the
breed while maintaining genetic diversity. Because only 2 affected littermates were
available for study herein, GWAS techniques could not be applied. The analysis of
chromosomal inheritance patterns indicated a single functional and positional candidate
gene and led to the discovery of the COLQ c.1010T>C mutation; however, our approach
does not exclude the possibility that another mutation exists in a novel CMS gene.
While this manuscript was in revision, Matlik et al. reported that an identical
mutation (c.1010T>C; I337T) was homozygous in 2 human CMS patients with EAD
[34]. The affected children were first cousins from consanguineous relationships; both
sets of parents were heterozygous for the mutation [34]. The substitution was the only
variation identified in COLQ and was determined to be pathogenic through a prediction
program [34]. Although uncommon, identical changes at the DNA level between humans
and dogs with similar phenotypes have been previously identified [35,36]. The
48
identification of c.1010T>C in humans and dogs diagnosed with CMS strongly supports
the causality of the mutation and shows that conservation of residue 337 is critical for
proper function of ColQ.
Supporting Information
Please refer to Appendix One: Supplementary Material for Chapter Two.
Acknowledgements
The authors would like to thank the dog owners and veterinarians who contributed DNA
samples for this study.
References
1. Hantaï D, Nicole S, Eymard B (2013) Congenital myasthenic syndromes: an update.
Curr Opin Neurol 26: 561-8.
2. Ohno K, Brengman J, Tsujino A, Engel AG (1998) Human endplate
acetylcholinesterase deficiency caused by mutations in the collagen-like tail subunit
(ColQ) of the asymmetric enzyme. Proc Natl Acad Sci U S A 95: 9654–9659.
3. Ishigaki K, Nicolle D, Krejci E, Leroy J-P, Koenig J, et al. (2003) Two novel
mutations in the COLQ gene cause endplate acetylcholinesterase deficiency.
Neuromuscul Disord 13: 236–244.
4. Mihaylova V, Müller JS, Vilchez JJ, Salih MA, Kabiraj MM, et al. (2008) Clinical and
molecular genetic findings in COLQ-mutant congenital myasthenic syndromes. Brain
131: 747-759.
5. Abicht A, Müller JS, Lochmüller H (2012) Congenital Myasthenic Syndromes.
GeneReviews Available: http://www.ncbi.nlm.nih.gov/books/NBK1168/. Accessed 27
February 2014.
6. Palmer AC, Barker J (1974) Myasthenia in the dog. Vet Rec 95: 452-454.
49
7. Oda K, Lambert EH, Lennon VA, Palmer AC (1984) Congenital canine myasthenia
gravis: I. Deficient junctional acetylcholine receptors. Muscle Nerve 7: 705-716.
8. Miller LM, Lennon VA, Lambert EH, Reed SM, Hegreberg GA, et al. (1983)
Congenital myasthenia in 13 smooth fox terriers. J Am Vet Med Assoc 182: 694-697.
9. Johnson RP, Watson AD, Smith J, Cooper BJ (1975) Myasthenia in Springer Spaniel
littermates. J Small Anim Pract 16: 641-647.
10. Dickinson PJ, Sturges BK, Shelton GD, LeCouteur RA (2005) Congenital
Myasthenia Gravis in Smooth-Haired Miniature Dachshund Dogs. J Vet Intern Med 19:
920–923.
11. Flagstad A, Trojaborg W, Gammeltoft S (1989) Congenital myasthenic syndrome in
the dog breed Gammel Dansk Hønsehund: clinical, electrophysiological, pharmacological
and immunological comparison with acquired myasthenia gravis. Acta Vet Scand 30: 89-
102.
12. Proschowsky HF, Flagstad A, Cirera S, Joergensen CB, Fredholm M (2007)
Identification of a Mutation in the CHAT Gene of Old Danish Pointing Dogs Affected
with Congenital Myasthenic Syndrome. J Hered 98: 539–543.
13. Kraner S, Sieb JP, Thompson PN, Steinlein OK (2002) Congenital myasthenia in
Brahman calves caused by homozygosity for a CHRNE truncating mutation.
Neurogenetics 4: 87-91.
14. Patterson EE, Minor KM, Tchernatynskaia AV, Taylor SM, Shelton GD, et al. (2008)
A canine DNM1 mutation is highly associated with the syndrome of exercised-induced
collapse. Nat Genet 40: 1235-1239.
15. Pelé M, Tiret L, Kessler J-L, Blot S, Panthier J-J (2005) SINE exonic insertion in the
PTPLA gene leads to multiple splicing defects and segregates with the autosomal
recessive centronuclear myopathy in dogs. Hum Mol Genet 14: 1417-1427.
16. Beggs AH, Bohm J, Snead E, Kozlowski M, Maurer M, et al. (2010). MTM1
mutation associated with X-linked myotubular myopathy in Labrador retrievers. Proc
Natl Acad Sci U S A 107: 14697-14702.
17. Gill JL, Tsai KL, Krey C, Noorai RE, Vanbellinghen J-F, et al. (2012) A canine
BCAN microdeletion associated with episodic falling syndrome. Neurobiol Dis 45: 130–
136.
18. Safra N, Bassuk AG, Ferguson PJ, Aguilar M, Coulson RL, et al. (2013) Genome-
Wide Association Mapping in Dogs Enables Identification of the Homeobox Gene,
50
NKX2-8, as a Genetic Component of Neural Tube Defects in Humans. PLoS Genet 9:
e1003646.
19. Vernau KM, Runstadler JA, Brown EA, Cameron JM, Huson HJ, et al. (2013)
Genome-Wide Association Analysis Identifies a Mutation in the Thiamine Transporter 2
(SLC19A3) Gene Associated with Alaskan Husky Encephalopathy. PLoS One 8: e57195.
20. Dubowitz V, Sewry CA (2007). Histological and histochemical stains and reactions.
In: Dubowitz V, Sewry CA, editors. Muscle Biopsy: A Practical Approach, 3rd ed.
London: Saunders Elsevier: pp. 21-39.
21. Lindstrom JM, Lambert EH (1978) Content of acetylcholine receptor and antibodies
bound to receptor in myasthenia gravis, experimental autoimmune myasthenia gravis, and
Eaton-Lambert syndrome. Neurology 28: 130-138.
22. Lindstrom J, Shelton D, Fujii Y (1988) Myasthenia gravis. Adv Immunol 42: 233-
284.
23. Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA, et al. (2007) PLINK: a
tool set for whole-genome association and population-based linkage analyses. Am J Hum
Genet 81: 559-575.
24. Cargill EJ, Clark LA, Steiner JM, Murphy KE (2002) Multiplexing of canine
microsatellite markers for whole-genome screens. Genomics 80: 250-3.
25. Clark LA, Tsai KL, Steiner JM, Williams DA, Guerra T, et al. (2004) Chromosome-
specific microsatellite multiplex sets for linkage studies in the domestic dog. Genomics
84: 550-554.
26. Swallow JS, Griffiths IR (1977) Age related changes in the motor nerve conduction
velocity in dogs. Res Vet Sci 23: 29-32.
27. Sims MH, Redding RW (1980) Maturation of nerve conduction velocity and the
evoked muscle potential in the dog. Am J Vet Res 41: 1247-52.
28. Katz B, Miledi R (1973) The Binding of Acetylcholine to Receptors and its Removal
from the Synaptic Cleft. J Physiol 231: 549-574.
29. Engel AG, Lambert EH, Gomez MR (1977) A New Myasthenic Syndrome with End-
Plate Acetylcholinesterase Deficiency, Small Nerve Terminals, and Reduced
Acetylcholine Release. Ann Neurol 1: 315-330.
51
30. Ohno K, Engel AG, Brengman JM, Shen X-M, Heidenreich F, et al. (2000) The
Spectrum of Mutations Causing End-Plate Acetylcholinesterase Deficiency. Ann Neurol
47: 162–170.
31. Kimbell LM, Ohno K, Engel AG, Rotundo RL (2004) C-terminal and Heparin-
binding Domains of Collagenic Tail Subunit Are Both Essential for Anchoring
Acetylcholinesterase at the Synapse. J Biol Chem 279: 10997–11005.
32. Nakata T, Ito M, Azuma Y, Otsuka K, Noguchi Y, et al. (2013) Mutations in the C-
Terminal Domain of ColQ in Endplate Acetylcholinesterase Deficiency Compromise
ColQ–MuSK Interaction. Hum Mutat 00: 1–8.
33. Arredondo J, Lara M, Ng F, Gochez DA, Lee DC, et al. (2014) COOH‑terminal
collagen Q (COLQ) mutants causing human deficiency of endplate acetylcholinesterase
impair the interaction of ColQ with proteins of the basal lamina. Hum Genet 133: 599-
616.
34. Matlik HN, Milhem RM, Saadeldin IY, Al-Jaibeji HS, Al-Gazali L, et al. (2014)
Clinical and Molecular Analysis of a Novel COLQ Missense Mutation Causing
Congenital Myasthenic Syndrome in a Syrian Family. Pediatr Neurol 51: 165–169.
35. Zangerl B, Goldstein O, Philp AR, Lindauer SJ, Pearce-Kelling SE, et al. (2006)
Identical mutation in a novel retinal gene causes progressive rod-cone degeneration in
dogs and retinitis pigmentosa in humans. Genomics 88: 551-563.
36. Seppälä EH, Reuser AJ, Lohi H (2013) A nonsense mutation in the acid α-
glucosidase gene causes Pompe disease in Finnish and Swedish Lapphunds. PLoS One 8:
e56825.
37. Wargon I, Richard P, Kuntzer T, Sternberg D, Nafissi S, et al. (2012) Long-term
follow-up of patients with congenital myasthenic syndrome caused by COLQ mutations.
Neuromuscul Disord 22: 318–324.
51
CHAPTER THREE
A CHRNE FRAMESHIFT MUTATION CAUSES CONGENITAL MYASTHENIC
SYNDROME IN JACK RUSSELL TERRIERS
Caitlin J. Rinz1, Vanda A. Lennon
2, Fiona James
3, Roberto Poma
3, H. Dale Humphries
4,
Gary Johnson5, Leigh Anne Clark
1*, and G. Diane Shelton
4*
Author Affiliations
1Department of Genetics and Biochemistry, College of Agriculture, Forestry, and Life
Sciences, 154 Poole Agricultural Center, Clemson University, Clemson, SC 29634 2Department of Laboratory Medicine, Mayo Clinic College of Medicine, Rochester, MN
55905
3Department of Clinical Studies, Ontario Veterinary College, University of Guelph, ON
N1G 2W1, Canada
4Department of Pathology, School of Medicine, University of California San Diego, La
Jolla, CA 92093 5Veterinary Medical Diagnostic Laboratory, University of Missouri, Columbia, MO
65205
[email protected] (GDS); [email protected] (LAC)
Author Contributions
Conceived and designed the experiments – GDS LAC. Performed the experiments: CJR,
JL, HDH, FJ, RP. Analyzed the data: CJR, GDS, LAC. Contributed
reagents/materials/analysis tools: LAC, VAL, GJ. Contributed to the writing of the
manuscript: CJR, GDS, LAC.
Notice
This chapter is being developed into a manuscript for later publication.
Abstract
Congenital myasthenic syndromes (CMSs) are a group of neuromuscular
disorders that result from the disruption of transmission across the neuromuscular
52
junction (NMJ). As part of this signaling, acetylcholine (ACh) travels across the synaptic
cleft and binds to the acetylcholine receptors (AChRs) on the post-synaptic membrane.
Over half of reported CMS cases in humans involve mutations in the genes encoding the
subunits of the AChR. While most published cases are human, CMSs have been reported
in a few dog breeds, including the Jack Russell Terrier (JRT). CMS with an early onset
of generalized weakness and exercise intolerance was described in JRTs in the 1970s, but
has not been characterized at the molecular level. Immunohistochemistry showed a
deficiency of AChRs in JRT CMS, and the genes that encode the 5 subunits of the AChR
were selected as candidate genes. Microsatellite alleles were utilized to determine
haplotypes for the chromosomal regions surrounding each of the 5 genes encoding the
subunits. Haplotypes flanking CHRNB1 and CHRNE, located adjacent to each other on
chromosome 5, segregated with the CMS phenotype in a JRT family. Sequences of the
splice sites and exons from both genes revealed a single base insertion in exon 7 of
CHRNE (G193RfsX272) that is homozygous in affected JRTs and heterozygous in
obligate carriers. The insertion was not detected in 245 unrelated JRTs. Herein, we
describe the genetic cause of CMS in the JRT.
Introduction
Contraction of skeletal muscles is triggered by signaling across the neuromuscular
junction (NMJ) and involves several proteins. In general, acetylcholine (ACh) is
produced in the motor neuron, travels across the synapse, and activates muscle
contraction by binding to the acetylcholine receptors (AChRs). The excess ACh is then
53
broken down by acetylcholinesterase (AChE), terminating the signal for muscle
contraction [1]. Mutations in the genes that encode proteins involved in this signaling
pathway and disrupt the transmission across the NMJ can result in congenital myasthenic
syndromes (CMSs).
In approximately 50% of human cases, causative mutations are identified in one
of the subunits of the AChR [2]. Most CMSs are inherited in an autosomal recessive
manner, and compound heterozygosity is often observed [2-5]. While the specific
symptoms vary depending upon the compromised protein [2], generalized skeletal muscle
weakness is the most common clinical sign.
While rare, cases of CMS are observed in other animals, including cows [6] and
dogs [7-12]. These cases appear to be familial and clinical signs usually present when the
animals are between 6 and 12 weeks old, with severe and widespread weakness of the
skeletal muscles as the most common clinical sign. The first report of CMS in the dog
was in 1974 in a Jack Russell Terrier (JRT) [7]. Clinical signs were first noted at 8 weeks
of age, beginning with rapid fatigue onset [7]. The dog responded to anticholinesterase
medication, and a month-long increase in muscle strength was achieved [7]. Two half-
siblings (same sire) also showed clinical signs including fatigue after exercise, one at 5
weeks of age and another at about 6 to 7 weeks of age [7]. Four years later, another case
of CMS in this breed was reported, and the clinical signs were described as a progressive
weakness affecting the limbs that was exacerbated by exercise and responded well to
anticholinesterase drugs [13]. Immunohistochemistry studies in affected tissues indicated
that JRTs with CMS have an endplate AChR deficiency [14]. CMS in JRTs is consistent
54
with an autosomal recessive inheritance [15]. While CMS has afflicted the JRT for at
least 40 years, cases are sporadic and the causative mutation has yet to be identified.
Here, we describe recent cases of CMS in JRTs with investigation into the genetic cause
of this disorder.
Materials and Methods
Animals
Two intact male 7-week-old JRT puppies were presented to the Ontario
Veterinary College (OVC) Neurology Service for evaluation of generalized weakness. Of
seven puppies in the litter, six survived birth. The dams of both dam and sire were
reported to be full sisters. The breeder noted that the puppies appeared normal until
approximately six weeks of age when one puppy started to show signs different from the
other littermates. The puppies responded dramatically to the short-acting
anticholinesterase drug edrophonium chloride and then to the longer-acting
anticholinesterase drug pyridostigmine bromide. After 6 weeks of treatment, drug
resistance developed and the pups were humanely euthanized.
Electrophysiology
Electrodiagnostics were performed on both affected puppies and included
electromyography (EMG), measurement of motor nerve conduction velocity (MNCV),
and measurement of the decrement in the compound muscle action potential (CMAP)
following repetitive nerve stimulation. Studies were performed on the left side under
55
general inhalational anesthesia using a Nicolet Viking Select EMG/evoked potential
system (Nicolet, Biomedical Inc.). Insulated stainless steel needle electrodes were used
for both nerve stimulation and recording from muscle, while a platinum subdermal
electrode (Grass-Telefactor) was employed as a ground. MNCV of the peroneal and
ulnar nerves was determined by dividing the distance between proximal and distal
stimulation sites by the difference in latency of the corresponding CMAP recorded from
the extensor digitorum brevis muscle and palmar interosseous muscles, respectively, after
supramaximal stimulation (2Hz stimulus rate, 0.2ms stimulus duration). Amplitude (peak
to peak) was measured from CMAPs derived from stimulation at the proximal and distal
stimulation sites. Repetitive nerve stimulation parameters included stimulation
frequencies of 1, 2, 3, 5, 10, 20, or 50Hz.
Sample Collection and Nucleic Acid Isolation
Whole blood was drawn from the 2 affected puppies, an unaffected sibling, and
the dam of a JRT family by clinicians at the OVC. Informed owner consent and all
samples were obtained in accordance with protocols approved by the University of
Guelph Institutional Review Board. Blood was unavailable from the deceased sire.
Additional JRT DNA samples collected for unrelated studies were provided by the
Veterinary Medical Diagnostic Laboratory of the University of Missouri. Left ventricle
tissue from an affected JRT from Florida was obtained. Tissue samples collected during
the studies performed by the Mayo Clinic [14,16] were also provided. Limb muscle
samples were obtained from the 2 affected puppies. Genomic DNA was isolated from the
56
tissues using the Gentra Puregene DNA Extraction Kits (Qiagen). RNA was isolated
from limb muscle tissues and from the left ventricle tissue from the affected Florida JRT
using the ISOLATE RNA Mini Kit (Bioline).
AChR Quantification and Antibody-Bound AChR
AChR was extracted from external intercostal muscle specimens of both affected
puppies by a procedure modified from that of Lindstrom and Lambert [17]. The muscle
specimens were stored at -70ºC prior to homogenization and extraction of AChR in 2%
Triton X-100. Solubilized AChRs were labeled by incubation with an excess of 125
I-α-
bungarotoxin (125
I-αbgt) followed by sequential addition of high titer rat-anti-AChR
antibody and precipitation with goat anti-rat IgG. The precipitate was pelleted, washed,
and quantitated in a gamma counter. The amount of AChR complexed with 125
I-αbgt was
quantified and expressed in terms of moles of 125
I-αbgt precipitated per gram of tissue.
The concentration of in-situ antibody-AChR complexes was determined by precipitation
with goat anti-rat serum in the presence of normal rat serum. Quantitative serum AChR
antibody concentrations were determined as previously described using an
immunoprecipitation radioimmunoassay procedure [18].
Microsatellite Analysis
Microsatellite markers flanking the candidate genes (Table 1) were amplified
using protocols described by Clark and colleagues [19], with the exception that each
microsatellite was amplified individually. Products were resolved on an ABI 3730XL
57
DNA Analyzer (Applied Biosystems) with GeneScan 600 LIZ size standard (Applied
Biosystems). Microsatellite signals were visualized using GeneMapper Software version
4.0 (Applied Biosystems).
Gene(s) CFA Microsatellite # Alleles Observed
CHRNA1 36 REN179H15 2
FH3865 3
CHRNB1, CHRNE 5
REN285I23 2
FH3702 2
DTR05.8 2
CHRNG, CHRND 25
FH2141 2
FH3627 3
FH4027 2
Table 1. Microsatellite markers flanking candidate genes.
Sequencing of CHRNB1 and CHRNE
Primers were designed to amplify the splice sites and coding regions of CHRNB1
and CHRNE (Table 2). PCR amplification of one of the affected puppies and the dam of
the products was performed with ReddyMix Master Mix (Thermo Scientific) using
primers at a concentration of 0.4µM and 50ng of DNA. ExoSAP-IT (Affymetrix) was
used according to the manufacturer’s instructions to purify the products. Sequencing
products were run on an ABI 3730XL DNA Analyzer (Applied Biosystems).
58
Gene Exon(s) Forward Primer
Sequence (5ʹ-3ʹ)
Reverse Primer
Sequence (5ʹ-3ʹ)
CHRNB1
1 CAGGAGACCATAAAGGGAAGG CTTTACTGGTTGCTCTTCTCCTC
2 TCACTGAGCAACCAACCG CATCGGGTCGGGAAATAACG
3 TGAGATAGAGGTGGGGCTTACA CCCTCCTCGTTTTTAGACCCAA
4&5 GCCGTAATCAGAACTCCGAC CTTCTCTGTCCACTGTCACTG
6 CCTCTCCTGAAACACTGACTCC GGTGGGCAAGATGAGTGAGAAT
7 CAAGTTCACCAGAGATGGGCTA TACTGCCCTCTTCTCTCCATCC
8 CACTGATTGTGCCACGAAAA GTCAGGTTCTATCAGGGTGG
9 TTCTTCGTCCATACTGCCCATTCT GCAGAGGCAGGCGGCTTA
10 GCAGAGGCAGGCGGCTTA GCCCCTGTCTTCCGACTGG
11 GTAGGAGGACGAGGGCAAG CCTCTCACACCATTGCCTTG
CHRNE
1&2 TAGATGACAGTCCCCTAACCCG TGGAATCGTGAGTGAGAGCC
3&4 CAGACACACGGAGCAGCG AACTGCTCGCTGGTCTTCCG
5&6 TGTGCTGGAGAACAAGTGAGG CATCATCTACACGCTCATCATCC*
7 GGCGAGACCATCAGCAAAATC CCGTCTTCCTGTTCCTGA
8 TGCTGCTCGCCTACTTCCTGC TGGAGGCGGAGTCAGGAGCAC
9&10 GAAGAGGGAGCACCGAGC CTCCCTCTCTCCCTCGCTC
11&12 CTGGACTGGTGAGCCGAGGG AGTTGCGTGTGCGTGCGG
Table 2. Primers (5'-3') for amplification of CHRNB1 and CHRNE. Primers were
designed to amplify the splice sites and coding regions of CHRNB1 and CHRNE.
*A separate reverse primer was designed to sequence exon 6 of CHRNE:
5'- CCGTCCCTCCCACCCCTT -3'
cDNA Synthesis and PCR Amplification
cDNA was synthesized using the SensiFAST cDNA Synthesis kit (Bioline) as per
the manufacturer’s instructions. Primers were designed to capture the insertion in exon 7
of CHRNE (forward primer: 5’- CAATGCCGAGGAGGTGGA -3’ and reverse primer:
5’- CTGTGTCATCGTGCTCAACG -3’) and products were amplified using ReddyMix
PCR Mastermix (Thermo Scientific). PCR products were run on a ~1.3% agarose gel.
ExoSAP-IT (Affymetrix) was used according to the manufacturer’s instructions to purify
the products. Sequencing products were run on an ABI 3730XL DNA Analyzer (Applied
Biosystems).
59
Results
Clinical Description
Affected JRT puppies showed an onset of generalized muscle weakness at 7
weeks of age and could walk only briefly for 10-15 short-strided steps before having to
sit or lay down. After a brief rest, both puppies would rise and resume activity.
Regurgitation was not noted by the caregivers and lateral thoracic radiographs of both
puppies did not show a dilated esophagus. Based on results of physical and neurological
examinations, the cause of the muscle weakness was localized to the neuromuscular
junction.
An edrophonium chloride challenge (short acting anticholinesterase drug, 0.1-
0.2mg/kg IV) was performed as a presumptive test for myasthenia gravis and results
recorded (see video). Both puppies responded immediately with a return to almost normal
activity levels for approximately 3-5 minutes. The long-acting anticholinesterase drug
pyridostigmine bromide (12mg/ml, compounded by the OVC Pharmacy) was prescribed
at 1 mg/kg orally every 12 hours. Both puppies responded with improvement within an
hour to almost normal activity levels. Over the following month, the dosage of
pyridostigmine and the frequency of dosing had to be incrementally increased to maintain
normal activity. By 6 weeks following initiation of treatment and with a pyridostigmine
dosage of 1.5 mg/kg PO every 6 hours, the pups could only walk a dozen steps before
sitting down to rest. Increasing the dose to 2mg/kg resulted in adverse effects including
vomiting without improvement in exercise tolerance. Due to the poor prognosis for
60
recovery and lack of other specific treatment options, both pups were anesthetized for
electrodiagnostic studies followed by humane euthanasia and tissue collection.
Electrophysiology
Electromyography and measurement of motor nerve conduction velocities
performed under general anesthesia in both puppies were normal. For puppy 1,
measurement of the compound muscle action potentials following repetitive nerve
stimulation was performed after having discontinued pyridostigmine overnight.
Recordings showed 36.9% decrement between the first and fifth stimulation.
Neostigmine (0.05 mg/kg IV) was administered and RNS recorded 2, 4, 6, 8, and 10
minutes afterwards. Decrements were recorded to be 62.2%, 29.1%, 23.5%, 42.2%, and
66% respectively. For puppy 2, recordings showed a 48.2% decrement between the first
and fifth response. Five minutes after 0.05mg/kg neostigmine IV, there was improvement
to 41.1% decrement between first and fifth responses. Ten minutes after the neostigmine
was administered, the decrement was recorded to be 63.4%. Both puppies were
humanely euthanized following examinations and post-mortem examinations and tissue
collections performed.
AChR quantification
The concentration of AChR was determined from external intercostal muscle
samples collected origin to insertion following euthanasia of both affected JRT puppies.
The AChR concentration was decreased in both puppies (0.03pmol/gm and 0.04 pmol/gm
61
tissue, reference 0.2pmol/gm to 0.4pmol/gm tissue). AChR antibodies were not detected
bound to muscle AChRs or in the serum.
Post-Mortem Examination, Histopathology and Histochemistry
No indication of a primary nervous system or muscle disorder was found on post-
mortem examination. Occasional groups of atrophic fibers of both fiber types was noted
in frozen muscle sections that were considered consistent with functional denervation
caused by the deficits in neuromuscular transmission in chronic myasthenia gravis.
Microsatellite Analysis
Because of the documented deficiency of AChRs by immunoprecipitation
radioimmunoassay in the affected JRTs in this family as well as in other cases of CMS in
Jack Russell Terriers [14], the genes encoding the 5 subunits of the AChR were identified
as functional candidates: CHRNA1, CHRNB1, CHRNG, CHRND, and CHRNE. CHRNA1
is located on canine chromosome (CFA) 36, CHRNB1 and CHRNE on CFA 5, and
CHRNG and CHRND on CFA 25.
All markers were polymorphic in the JRT family, with 2-3 alleles. While
haplotypes surrounding CHRNA1 segregate with an autosomal recessive inheritance,
heterozygosity in the affected dogs does not support identity by descent (IBD). The
haplotypes encompassing CHRNB1 and CHRNE were homozygous in affected
individuals, consistent with IBD (Figure 1). Haplotypes surrounding CHRNG and
CHRND do not segregate with an autosomal recessive inheritance.
62
Figure 1. Microsatellite haplotypes flanking the AChR subunit genes. Microsatellite
markers flanking the AChR subunit genes CHRNB1 and CHRNE were amplified. The
alleles were compiled into haplotypes for each member of the pedigree with the
exception of the sire, whose alleles were extrapolated based on the alleles of the other
members of the pedigree as no DNA sample was available. Colored bars represent
haplotypes.
Sequencing of CHRNB1 and CHRNE
One exonic and 3 intronic variants were identified in CHRNB1, but none
segregated with a simple recessive mode of inheritance (homozygous in the affected dog
and heterozygous in the dam). Five exonic variants were identified in 3 exons of CHRNE,
but only 1 fit the expected pattern of inheritance. Further investigation of this mutation
revealed that the other affected puppy was homozygous for the mutation and the
unaffected sibling did not possess it. The variant is an inserted C in exon 7 after position
63
576 of CHRNE (ε576insC) (Figure 2). Both affected dogs were homozygous for this
insertion, the dam was heterozygous, and the unaffected sibling did not harbor the
insertion. Four affected JRTs from the 1970s and 1980s studies as well as the affected
dog from Florida were homozygous for the insertion. One obligate carrier was
heterozygous. An additional 245 unaffected JRTs were screened, and none of them
harbored the mutation (Table 3).
Figure 2. Direct sequences from unaffected, carrier, and affected Jack Russell Terriers.
(A) Wild-type sequence (B) Carriers of the G193RfsX272 allele have an extra C on only
one chromosome, causing sequences to be offset by one base. (C) Affected dogs are
homozygous for G193RfsX272 (boxed).
64
Disease Status (n) Homozygous
Wild-Type Heterozygous
Homozygous
G193RfsX272
Affected (7) 0 0 7
Obligate Carrier (2) 0 2 0
Unaffected (246) 246 0 0
Table 3. Jack Russell Terriers genotyped for G193RfsX272. Of the two carriers, one is
the dam of the two affected puppies discussed above, and the other is a known carrier
from studies by the Mayo Clinic [14,16].
cDNA Amplification
The cDNA PCR products were run on a gel to determine whether the cDNA of
the affected dog could be amplified. Both the unaffected and affected dogs’ cDNA PCR
produced a 470bp band on the gel (data not shown). An affected dog’s sequence showed
that the insertion is included in the cDNA.
Discussion
The CMS phenotype affecting JRTs is recessive, as neither of the parents was
affected and there have been previous studies indicating that CMS is inherited as a
recessive trait in JRTs [15]. Further, the parents of the affected puppies are cousins,
indicating that the affected puppies are the result of linebreeding. In addition, because
dog breeds are essentially closed populations, and because this disease appears to have
been in this breed for some time [7,13-15], we believe that the variant of interest has been
inherited IBD. Therefore, CHRNB1 and CHRNE were chosen as candidate genes for
further analysis as the microsatellite allele haplotypes appeared to segregate with the
65
CMS phenotype in our JRT family and because the haplotypes indicated homozygosity
(as opposed to compound heterozygosity) in the affected dogs.
Sequencing of the splice sites and coding regions of CHRNB1 and CHRNE
revealed a homozygous C insertion in exon 7 of CHRNE (G193RfsX272) in both affected
dogs. The dam was heterozygous, and the unaffected sibling did not harbor
G193RfsX272. The insertion predicts a frameshift beginning at residue 213, with a
premature stop codon after residue 485 (G193RfsX272) (Figure 3).
Figure 3. Amino acid alignment of wild-type dog CHRNE and sequence with
G193RfsX272. Amino acid residue corresponding to the insertion location is highlighted.
66
The AChR is composed of 5 subunits: the alpha (α; CHRNA1), beta (β;
CHRNB1), gamma (γ; CHRNG), delta (δ; CHRND), and epsilon (ε; CHRNE) subunits.
Fetal AChR in muscle is comprised of 2 α subunits, 1 β subunit, 1 δ subunit, and 1 γ
subunit. After week 31 of development, the γ subunit is replaced with an ε subunit,
forming the adult AChR. At the NMJ, ACh is released from the motor neuron and travels
to the muscle cell, where it binds to the AChR at the α/δ and the α/ε interfaces [2]. The
AChR then undergoes a conformational change involving all 5 subunits that begins the
triggering of muscle contraction [2]. A mutation in any of the genes encoding these
subunits can result in either the inability of the AChR to bind ACh, incomplete AChR
pentamers, or the inability of the AChR to insert into the muscle cell. In humans,
approximately 50% of all CMSs are the result of mutations in CHRNE [2].
Several human studies have identified frameshift mutations in the N-terminal of
CHRNE [6,20]. One of these mutations, ε127ins5, predicts the conversion of codon 45 to
a stop codon, resulting in truncation in the N-terminal domain [20]. Expression studies
were performed that measured the amount of AChR expression as well as the number of
α-bungarotoxin binding sites for both of these mutations [20]. The frameshift mutation
had a reduced level of binding, similar to those of α2βδ2, the AChR pentamer that forms
when the ε subunit is not incorporated into the pentamer [20]. The amount of ACh
binding to the AChRs with ε subunits harboring the mutations was also measured, and
again the results for the frameshift mutations were similar to that of the α2βδ2 pentamer
[20]. Both showed a biphasic ACh-binding profile that has been credited to a lack of
interaction that exists in the wild-type penatmer between the sites where ACh binds [20-
67
22]. These results indicated that the ε127ins5 and ε553del7 mutations inhibit the
incorporation of the ε subunit into the pentamer [20].
A later study found that the ε553del7 mutation causes the skipping of exon 6 [23].
In addition, they found that weak splicing signals at exon 6 were the cause of exon
skipping in the normal transcripts they tested and that normally spliced mRNAs from the
ε553del7 transcript as well as the skipped exon 6 mRNAs from the normal transcript
were most likely being eradicated by nonsense-mediated mRNA decay [23]. It is likely
that G193RfsX272 results in either the inability of the ε subunit to incorporate into the
AChR pentamer [20] or causes the skipping of an exon [23]; however, further tests would
be required to produce support for either possibility.
Due to the similarities between the phenotypes of the recent affected JRTs and
those from the 1980s studies [14,16] and because CMSs are rare, we hypothesized that
the affected dogs from the previous studies shared G193RfsX272 identified in our family.
JRTs are not recognized as a breed by the AKC, so the breed standards are not as strict,
resulting in more diversity in the JRT than in AKC-recognized breeds. As this mutation
has been segregating in the breed for about 40 years, it is likely that the CMS phenotype
only appears as a result of linebreeding.
In the future, the test described here can be used by those who use linebreeding to
screen other JRTs in order to determine whether they carry G193RfsX272. Breeders can
then make informed decisions, mainly avoiding the breeding of 2 carriers. Screening and
careful breeding practices should result in a lower incidence of this disease in this breed
in future generations of JRTs.
68
Acknowledgements
The authors are grateful to the dog owners, breeders, and veterinarians who
participated in this study.
References
1. Katz B, Miledi R (1973) The Binding of Acetylcholine to Receptors and its Removal
from the Synaptic Cleft. J Physiol 231: 549-574.
2. Abicht A, Müller JS, Lochmüller H (2012) Congenital Myasthenic Syndromes.
GeneReviews Available: http://www.ncbi.nlm.nih.gov/books/NBK1168/. Accessed 27
February 2014.
3. Ohno K, Brengman J, Tsujino A, Engel AG (1998) Human endplate
acetylcholinesterase deficiency caused by mutations in the collagen-like tail subunit
(ColQ) of the asymmetric enzyme. Proc Natl Acad Sci U S A 95: 9654–9659.
4. Ishigaki K, Nicolle D, Krejci E, Leroy J-P, Koenig J, et al. (2003) Two novel
mutations in the COLQ gene cause endplate acetylcholinesterase deficiency.
Neuromuscul Disord 13: 236–244.
5. Mihaylova V, Müller JS, Vilchez JJ, Salih MA, Kabiraj MM, et al. (2008) Clinical and
molecular genetic findings in COLQ-mutant congenital myasthenic syndromes. Brain
131: 747-759.
6. Kraner S, Sieb JP, Thompson PN, Steinlein OK (2002) Congenital myasthenia in
Brahman calves caused by homozygosity for a CHRNE truncating mutation.
Neurogenetics 4: 87-91.
7. Palmer AC, Barker J (1974) Myasthenia in the dog. Vet Rec 95: 452-454.
8. Johnson RP, Watson AD, Smith J, Cooper BJ (1975) Myasthenia in Springer Spaniel
littermates. J Small Anim Pract 16: 641-647.
9. Miller LM, Lennon VA, Lambert EH, Reed SM, Hegreberg GA, et al. (1983)
Congenital myasthenia in 13 smooth fox terriers. J Am Vet Med Assoc 182: 694-697.
10. Flagstad A, Trojaborg W, Gammeltoft S (1989) Congenital myasthenic syndrome in
the dog breed Gammel Dansk Hønsehund: clinical, electrophysiological, pharmacological
and immunological comparison with acquired myasthenia gravis. Acta Vet Scand 30: 89-
102.
69
11. Dickinson PJ, Sturges BK, Shelton GD, LeCouteur RA (2005) Congenital
Myasthenia Gravis in Smooth-Haired Miniature Dachshund Dogs. J Vet Intern Med 19:
920–923.
12. Rinz CJ, Levine J, Minor KM, Humphries HD, Lara R, et al. (2014) A COLQ
Missense Mutation in Labrador Retrievers Having Congenital Myasthenic Syndrome.
PLoS ONE 9(8):e106425. doi:10.1371/journal.pone.0106425.
13. Palmer AC, Goodyear JV (1978) Congenital myasthenia in the Jack Russell Terrier.
The Veterinary Record 103:433-4.
14. Oda K, Lambert EH, Lennon VA, Palmer AC (1984) Congenital canine myasthenia
gravis: I. Deficient junctional acetylcholine receptors. Muscle Nerve 7: 705-716.
15. Wallace ME, Palmer AC (1984) Recessive mode of inheritance in myasthenia gravis
in the Jack Russell Terrier. Veterinary Record 114:350.
16. Palmer AC, Lennon VA, Beadle C, Goodyear JV (1980) Autoimmune form of
myasthenia gravis in a juvenile Yorkshire Terrier x Jack Russell Terrier hybrid contrasted
with congenital (non-autoimmune) myasthenia gravis of the Jack Russell. J Small Anim
Pract 21:359-364.
17. Lindstrom JM, Lambert EH (1978) Content of acetylcholine receptor and antibodies
bound to receptor in myasthenia gravis, experimental autoimmune myasthenia gravis, and
Eaton-Lambert syndrome. Neurology 28: 130-138.
18. Lindstrom J, Shelton D, Fujii Y (1988) Myasthenia gravis. Adv Immunol 42: 233-
284.
19. Clark LA, Tsai KL, Steiner JM, Williams DA, Guerra T, et al. (2004) Chromosome-
specific microsatellite multiplex sets for linkage studies in the domestic dog. Genomics
84: 550-554.
20. Ohno K, Quiram PA, Milone M, Wang H-L, Harper MC, et al. (1997) Congenital
myasthenic syndromes due to heteroallelic nonsense/missense mutations in the
acetylcholine receptor ε subunit gene: identification and functional characterization of six
new mutations. Human Molecular Genetics 6(5):753–766.
21. Ohno K, Wang H-L, Milone M, Bren N, Brengman JM, et al. (1996) Congenital
myasthenic syndrome caused by decreased agonist binding affinity due to a mutation in
the acetylcholine receptor e subunit. Neuron 17:157–170.
70
22. Sine SM, Claudio T (1991) Gamma and delta subunits regulate the affinity and the
cooperativity of ligand binding to the acetylcholine receptor. J Biol Chem 266:19369–
19377.
23. Ohno K, Milone M, Shen X-M, Engel AG (2003) A frameshifting mutation in
CHRNE unmasks skipping of the preceding exon. Human Molecular Genetics
12(23):3055–3066.
71
CHAPTER FOUR
GENOME-WIDE ASSOCIATION STUDIES FOR MULTIPLE DISEASES
OF THE GERMAN SHEPHERD DOG
Kate L. Tsai1, Rooksana E. Noorai
1, Alison N. Starr-Moss
1, Pascale Quignon
2,3, Caitlin J.
Rinz1, Elaine A. Ostrander
2, Jörg M. Steiner
4, Keith E. Murphy
1, Leigh Anne Clark
1
Author Affiliations
1Department of Genetics and Biochemistry, College of Agriculture, Forestry and Life
Sciences, Clemson University, Clemson, SC 29634, USA 2Cancer Genetics Branch, National Human Genome Research Institute, National
Institutes of Health, Bethesda, MD 20892, USA 3Institut de Génétique et Développement de Rennes, CNRS-UMR6061, Université de
Rennes 1, F-35000 Rennes, France 4Department of Small Animal Clinical Sciences, College of Veterinary Medicine and
Biomedical Sciences, Texas A&M University, College Station, TX 77843, USA
Short title
GWAS for multiple diseases of the GSD
Corresponding author
Dr. Leigh Anne Clark
Phone: (864) 656-4696
Fax: (864) 656-0393
Email: [email protected]
Author Contributions
LAC, KLT, KEM, EAO designed the project. LAC, KTL, CJR recruited participants,
isolated DNA. JMS confirmed phenotypes. KLT, REN, ANSM, PQ generated and
analyzed whole genome SNP data. CJR generated and analyzed data for SNP
12.60274687. All authors contributed to manuscript preparation.
Citation
Tsai KL, Noorai RE, Starr-Moss AN, Quignon P, Rinz CJ, Ostrander EA, Steiner JM,
Murphy KE, and Clark LA (2012) Genome-wide association studies for multiple diseases
of the German Shepherd Dog. Mammalian Genome 23:203–211.
72
Copyright Permission
73
74
75
Abstract
The German Shepherd Dog (GSD) is a popular working and companion breed for
which over 50 hereditary diseases have been documented. Herein, SNP profiles for 197
GSDs were generated using the Affymetrix v2 canine SNP array for a genome-wide
association study to identify loci associated with four diseases: pituitary dwarfism,
degenerative myelopathy (DM), congenital megaesophagus (ME), and pancreatic acinar
atrophy (PAA). A locus on Chr 9 is strongly associated with pituitary dwarfism, and is
proximal to a plausible candidate gene, LHX3. Results for DM confirm a major locus
encompassing SOD1, in which an associated point mutation was previously identified,
but do not suggest modifier loci. Several SNPs on Chr 12 are associated with ME and a
4.7 Mb haplotype block is present in affected dogs. Analysis of additional ME cases for a
SNP within the haplotype provides further support for this association. Results for PAA
indicate more complex genetic underpinnings. Several regions on multiple chromosomes
reach genome-wide significance. However, no major locus is apparent and only two
associated haplotype blocks, on Chrs 7 and 12, are observed. These data suggest that
PAA may be governed by multiple loci with small effects, or may be a heterogeneous
disorder.
Introduction
Shepherds and hounds were the first dog breeds developed to serve in specialized
roles [1]. The German Shepherd Dog (GSD), for which a breed standard was originally
developed in 1899, was bred for utility and intelligence and to be a multi-purpose servant
76
of humans [1]. Aptitude, temperament, structural efficiency, and other natural skills were
deemed more important than aesthetic traits. Today, the GSD is among the most common
breeds trained by the military, law enforcement, and service/assistance programs [2]. The
GSD is also an extremely popular companion dog breed, ranking second in breed
registration statistics reported by the American Kennel Club in 2010. Unfortunately,
despite a large population size, more than 50 hereditary diseases have been described for
the GSD [3].
Pituitary dwarfism is a rare disease of the GSD and is characterized by an
abnormally small body stature because of a deficiency in pituitary growth hormone. Dogs
appear to be normal at birth, but signs of stunted growth are usually evident by two to
three months of age. There are no treatments available and lifespan is usually
significantly shortened. Pituitary dwarfism in the GSD is inherited in an autosomal
recessive fashion [4]. Combined pituitary hormone deficiency (CPHD) in humans is a
type of growth hormone deficiency that results from a decrease in several hormones
necessary for pituitary development. Mutations that cause congenital CPHD in humans
have been identified in genes encoding several transcription factors important for
pituitary development. These include PIT1, PROP1, LHX3, LHX4, and HESX1 [5]. In
contrast, sequencing in affected GSDs of PIT1 [6], PROP1 [7], LHX4 [8], and LIFR [9],
did not reveal any causative variants.
Degenerative myelopathy (DM) is a late-onset neurodegenerative disease
characterized by ataxia and weakness in the hind limbs. Symptoms of DM worsen over
time, either steadily or in phases, and eventually result in complete paraplegia. In some
77
cases, DM may progress up the spinal cord and cause forelimb weakness or even
respiratory difficulties [10]. The age of onset of DM is generally between 5 and 14 years,
with a mean age of onset of 9 years [11]. The clinical signs observed in DM are general
indicators of spinal cord disorders, but a definitive diagnosis for DM can only be made by
histopathological examination of spinal cord tissue postmortem [12]. Most owners of
affected dogs elect euthanasia within several months of symptom onset [13]. DM is most
prevalent in the GSD [12]. A recessive missense mutation in SOD1 is associated with
DM in several breeds, including the GSD [14]. DM has been proposed to be an animal
model for amyotrophic lateral sclerosis (ALS). Approximately 20% of hereditary ALS
cases are attributed to mutation of SOD1 [15].
Congenital idiopathic megaesophagus (ME) is characterized by dilation and
hypomotility of the esophagus. The result of these abnormalities is regurgitation several
minutes to hours after eating. Regurgitation episodes may occur as often as several times
a day or as infrequently as once every few days. Symptoms for congenital ME typically
begin around five weeks of age after weaning onto solid food. Affected puppies are
malnourished, show a general failure to thrive, and are at risk for aspiration pneumonia.
Diagnosis of ME is achieved by standard thoracic radiographs and/or fluoroscopy
(barium swallow) [16]. ME is typically treated by feeding a high calorie, liquid diet from
a raised dish [16]. Mortality is high in affected neonates. Many survivors require lifelong
management of the disorder, but other cases resolve by four to six months of age [17].
ME is prevalent in the GSD, Great Dane, Miniature Schnauzer, Rhodesian Ridgeback,
Dachshund, and Wire Fox Terrier, and is also reported to occur at lower frequencies in
78
many other breeds [18]. Several loci are thought to be responsible for ME in the dog [17].
The mode of inheritance in the GSD has not been investigated.
Pancreatic acinar atrophy (PAA) is an autoimmune disease characterized by the
selective atrophy of the acinar cells of the exocrine pancreas, which synthesize and
secrete pancreatic digestive enzymes under physiologic conditions [19]. PAA is the most
common cause of exocrine pancreatic insufficiency (EPI) in the dog [20] and is
diagnosed through histopathologic examination [21]. EPI is diagnosed through the
measurement of serum canine trypsin-like immunoreactivity (cTLI), with concentrations
≤ 2.5 g/L considered as diagnostic [22]. By five years of age, 96% of affected dogs
present with clinical signs of EPI, which include weight loss, increased appetite, and soft
stools [20,23]. Affected dogs can be treated with pancreatic enzyme supplements,
although dogs with EPI are sometimes euthanized because of the expense associated with
treatment or a poor response to treatment [24-25]. PAA is widespread in the GSD
population, and affects other breeds including the Collie and Eurasian [26-27]. A recent
test mating in the GSD shows that EPI is likely a polygenic disorder [28].
The development of high-throughput genotyping technologies has facilitated the
discovery of genes responsible for simple and complex phenotypes of the dog [29-30].
The population structure of the dog is particularly well-suited for association mapping
techniques because genetic bottlenecks during breed formation created large blocks of
linkage disequilibrium within breeds [29]. Reported here is the use of a large cohort of
GSDs to investigate the aforementioned four diseases that segregate in the population.
Genetic profiles for 197 GSDs were generated using the Affymetrix v2 canine SNP array.
79
Using a single data set, we carry out genome wide association studies (GWAS) to
identify risk loci for four diseases of the GSD.
Materials and Methods
Sample Collection
Samples were recruited from individual owners from purebred GSDs that were
diagnosed with EPI, DM, or ME through standard veterinary diagnostic practices. DM
cases were diagnosed by veterinary neurologists. Dogs were considered to have
congenital, idiopathic ME if they did not have conditions that can cause secondary ME,
such as a persistent right aortic arch, myasthenia gravis, or hypoadrenocorticism.
Purebred GSDs collected as healthy controls were ≥ 6 yrs and, to the owners’ knowledge,
had no immediate family members affected with EPI, DM, or ME. Owners were asked to
report all known hereditary conditions, as well as coat color phenotypes. Participants
were recruited through breed clubs and listservs.
Whole blood or buccal swabs were submitted by dog owners. Blood samples were
collected by the primary care veterinarian of the dog. All samples were collected in
accordance with protocols approved by the Clinical Research Review Committee (CRRC
No. 07-04) at Texas A&M University and the Clemson University Institutional Review
Board (IBC2008-17). Genomic DNA was isolated using the Gentra Puregene Blood Kit
(Qiagen, Valencia, CA, USA). Serum samples were collected from all EPI cases and
healthy controls and submitted to the Gastrointestinal Laboratory at Texas A&M
University for measurement of serum cTLI concentration to confirm clinical status.
80
Concentrations ≤ 2.5 g/L were considered diagnostic for EPI. Control dogs had
concentrations ≥ 5.7 g/L. All EPI cases were assumed to result from PAA, but tissue
samples were not available to differentiate EPI due to PAA or another cause of EPI.
GWAS
SNP genotypes were generated using the Affymetrix v2 canine SNP array
(http://www.broadinstitute.org/mammals/dog/caninearrayfaq.html). Arrays were
processed at the National Human Genome Research Institute (NHGRI) or Clemson
University Genomics Institute using the GeneChip human mapping 250K Sty assay kit
(Affymetrix, Santa Clara, USA). All associated protocols were approved by the NHGRI
Animal Care and Use Committee. The GeneChip human mapping 500K assay protocol
was followed with a hybridization volume of 125 μl [29]. Raw CEL files were analyzed
with the Affymetrix Power Tools software to obtain genotypes. SNPs having >10%
missing data and ≥60% heterozygosity were removed from the dataset. Case/control
analyses were performed on the 48,415 SNPs from the “platinum” set using PLINK [31],
with Praw <0.0001 considered significant. To determine Pgenome values (EMP2),
permutation testing (100,000) was performed for PAA, DM, and ME analyses using
PLINK. A less conservative correction, Benjamini-Hochberg, was also performed [32].
Analysis of population stratification in 197 GSDs was conducted using identity-by-state
clustering and multidimensional scaling in PLINK. The data, in a reduced representation,
were plotted in two dimensions, principal components 1 and 2.
81
Genotyping of SNP 12.60274687
Primers flanking the SNP 12.60274687 were designed: forward: 5'-
TGAGCACACAGAGGTGAGACAT-3' and reverse: 5'-
CAGTGGGAGGGTTTAGGAAGAGAT-3'. SNP 12.60274687 was amplified for 35
additional ME dogs using Thermo ReddyMix (Thermo Fisher Scientific, Waltham, MA,
USA) following the recommended protocol. Thermal cycling conditions were as follows:
95°C for 15 min; 14 cycles of 95°C for 30 sec, 62°C for 1 min (decreasing 0.5°C each
cycle), 72°C for 1 min; 20 cycles of 95°C for 30 sec, 55°C for 1 min, 72°C for 1 min;
72°C for 10 min. PCR amplicons were analyzed by electrophoresis on agarose gels.
Products were purified by adding 0.5 units Exonuclease I (New England Biolabs, Itswich,
MA, USA) and 0.25 units of shrimp alkaline phosphatase (Promega, Madison, WI, USA)
and incubating for 30 min at 37°C followed by 20 min at 80°C. Nucleotide sequencing
was accomplished using the Big Dye Terminator version 3.1 Cycle Sequencing kit
(Applied Biosystems, Carlsbad, CA, USA). Products were purified using Spin-50 mini-
columns with water (BioMax, Inc., Arnold, MD, USA) and resolved on an ABI Prism
3730 Genetic Analyzer (Applied Biosystems). Sequences were analyzed to determine
SNP genotypes. Odds ratios (OR), critical intervals and Chi-square tests were calculated
to assess the differences in genotype frequencies between the two populations using 2x2
contingency tables.
82
Results
Validation of methodology
In total, 197 GSD samples were acquired from the United States, Canada,
Germany, and the Netherlands. Two GSDs were affected with EPI and DM. One GSD
was affected with EPI and ME. Principal component analysis using PLINK shows no
evidence for population stratification within our GSD cohort (n=197), using all
“platinum” SNPs (Fig. 1). To validate both our genotype data and statistical approach, we
first mapped a positive control trait. Ten dogs in the study cohort had white coats, a
recessive trait caused by the e allele of MC1R in the GSD [33]. GWAS using 197 GSDs
(10 cases, 187 controls) reveals a strongly associated region encompassing MC1R on Chr
5 (Fig. 2a). SNP 5.66900853, the most significant result (Praw = 3.61 10-22
), is located
approximately 208 kb adjacent to the E locus. The lack of subpopulations, combined with
our ability to accurately map a known locus, indicate the utility of this data set.
83
Figure 1. Principal component analysis of the GSD cohort shows all 197 dogs clustering
together. The x-axis is principal component 1 and the y-axis is principal component 2.
Two individuals that appear apart from the main grouping have the largest proportion of
missing data (22.7% and 22.4% overall, compared to the average missing data rate of
12.6%.)
Pituitary dwarfism
Four dogs in the control population had pituitary dwarfism. GWAS for these four
cases versus 193 normal-sized controls shows a major region of association on Chr 9
(Fig. 2b). Within this region, all four pituitary dwarfs are homozygous for a haplotype
extending from SNP 9.52031784 to SNP 9.54102643. The haplotype is not observed in
the homozygous state among the control dogs, however 15 control dogs were
heterozygotes. The most significant association is for SNP 9.53350831 (Praw = 2.04 10-
10), which is located approximately 764 kb from a candidate gene, LHX3.
84
Figure 2. Manhattan plots showing the results for GWAS using 48,415 SNPs. The
genome-wide P values (-log10 P) for each SNP are plotted against position on each
chromosome. (a) Ten white GSDs versus 187 non-white GSDs show a strong association
on Chr 5. (b) Four pituitary dwarf GSDs versus 193 normal-sized GSDs show a strong
association on Chr 9.
85
Degenerative myelopathy
GWAS with 100,000 permutations for DM was carried out using all cases
collected (n = 15) versus control dogs that were at least eight years of age and did not
exhibit any clinical signs of DM (n = 69). The two strongest associations are with SNPs
31.28909487 (Praw = 8.51 10-06
, Pgenome = 0.1461) and 31.30528862 (Praw = 5.59 10-05
,
Pgenome = 0.5771) (Fig. 3a). These SNPs on Chr 31 are located 650 kb upstream and 965
kb downstream of SOD1, respectively. Evaluation of individual genotypes in this region
reveals that only four of the 15 cases are homozygous for both SNPs. Five cases are
homozygous for the associated allele of SNP 31.30528862, while nine cases are
homozygous for the associated allele of SNP 31.28909487. In the control population, six
of 69 GSDs are also homozygous for the same allele of SNP 31.28909487. A third
noteworthy result is on Chr 10 for SNP 10.64801770 (Praw = 6.06 10-05
, Pgenome =
0.6066).
Megaesophagus
GWAS with 100,000 permutations was carried out using 19 cases and 177 control
dogs. Fourteen SNPs with significant Praw values are located on eight different
chromosomes (Fig. 3b). Of these, three are within an eight Mb region on Chr 12. Five
other SNPs within this region are approaching significance (Praw). Further analyses of
genotypes on Chr 12 reveal a haplotype block extending 4.7 Mb that is present in all
affected dogs. The strongest associated of these is SNP 12.60274687 (Praw = 1.49 10-5
,
Pgenome = 0.3099). Analysis of genotypes for this SNP reveal a common allele that is
86
present in all affected dogs (frequency = 0.83) and is less prevalent among control dogs
(frequency = 0.46). To further investigate this finding, 35 additional GSDs with ME were
collected and genotyped for the SNP. Genotype frequencies and odds ratios for SNP
12.60274687 are shown in Table 1.
G/G (%) G/A (%) A/A (%)
ME array (n=19) 12 (63)
7 (37) 0 (0)
ME all (n=54) 33 (61)a 20 (37) 1 (2)
Control (n=172*) 36 (21) 84 (49) 52 (30)
* Four control dogs were N/N for SNP 12.60274687 on the array and were excluded from this analysis. aGenotype (G/G): P=6.84x10
-8, OR=5.937 (95% CI=3.071-11.475)
Allele (G): P=2.77x10-10
, OR=4.711 (95% CI=2.817-7.878)
Table 1. Frequency data for SNP 12.60274687 in GSDs with and without ME. Observed
genotypes and genotypic frequencies are presented for affected and control dogs. MEarray:
genotype frequencies of the 19 ME dogs run on Affymetrix SNP arrays; MEall: all ME
dogs collected.
Pancreatic acinar atrophy
GWAS with 100,000 permutations was carried out using 100 dogs with PAA and
79 control dogs (Fig. 3c). Significant Praw values are present for 50 SNPs on 23
chromosomes (Supplementary Table 1). Chr 12 harbors seven of these SNPs, three of
which are found in a cluster: 12.3781476, 12.3845215, and 12.4698937. Chr 7 harbors
six SNPs, four are found in a cluster: 7.11222056, 7.12305239, 7.12310223, and
7.12424701. On ten of the chromosomes, only one SNP each is strongly linked with
PAA. On the remaining 11 chromosomes, no two strongly associated SNPs are located
87
within five Mb of each other and no common haplotypes are detected. Six SNPs had
minor allele frequencies (MAF) < 15%.
Figure 3. GWAS using 48,415 SNPs with 100,000 permutations. The genome-wide
adjusted P values (-log10 P) for each SNP are plotted by chromosome. (a) Fifteen GSDs
with DM versus 69 healthy control GSDs. (b) Nineteen GSDs with ME versus 177
healthy control GSDs. (c) One-hundred GSDs with PAA versus 79 healthy control GSDs.
88
Discussion
Pituitary dwarfism
Autosomal recessive traits of the dog can be mapped using remarkably small
numbers of cases [34-35]. In this study, a mere four cases were sufficient to detect a
strong linkage to Chr 9 and define a two Mb pituitary dwarfism haplotype. While the
critical interval harbors more than 40 genes, one is an intriguing candidate: LHX3, a LIM
homeodomain transcription factor vital for pituitary and motor neuron development [36].
Genetic variations within LHX3 cause CPHD in humans [37-38]. Mutations in LHX3 in
humans are associated with a rigid cervical spine, and occasionally mental retardation,
and deafness [37,39-40]. The GSD pituitary dwarfs do not have clinical signs that
indicate nervous system involvement [41]. In the mouse, complete loss of LHX3 is lethal
[42], but mutations within the gene cause a dwarfism phenotype [43,44]44].
Voorbij et al. announced the availability of a genetic test for pituitary dwarfism in
the GSD [45], but information regarding the gene or mutation has not been published to
date. Dwarfism in the GSD is rare, so utilization of a definitive genetic test could
facilitate rapid elimination of the phenotype. Data presented here are surprising because
the frequency of the two Mb haplotype in control dogs is 4%, suggesting a roughly 8%
carrier frequency in the general population. Moreover, this estimate is likely low because
only dogs having the complete two Mb haplotype were considered to be carriers, thereby
excluding dogs with partial overlapping haplotypes that may include the causative
mutation.
89
Degenerative Myelopathy
DM is a devastating disorder of GDSs that has been difficult to eradicate from the
breed, in part because of a late age of onset and poor diagnostic tools. We identified two
SNPs on Chr 31 that are strongly associated with the DM phenotype. The SNPs flank
SOD1, the gene in which Awano et al. identified an E40K missense mutation in DM-
affected dogs from several breeds [14]. Based on genotype frequencies, the authors
propose that the mutation causes DM in an autosomal recessive fashion with incomplete
penetrance [14]. In the study reported here, only nine of 15 cases are homozygous for the
most tightly linked SNP, suggesting that either the relaxed diagnostic criteria used here
(dogs were not diagnosed postmortem) led to the inclusion of dogs that were
misdiagnosed, or that heterozygosity for the mutation can produce an affected phenotype.
Recombination between the SNP and SOD1 exon two mutation (located 652 kb apart)
may also be a factor (five cases are heterozygous). Six of 69 dogs in the control
population are homozygous for the SNP, corresponding to approximately 9%
undiagnosed controls. Similarly, Awano et al. reported that 6% of GSD breed controls
were homozygous for the SOD1 mutation [14]. The high frequency of clinically normal,
aged controls that are homozygous for the mutation is consistent with reduced penetrance
and suggests the involvement of modifier loci and/or environmental factors. In this
analysis, a second locus is detected on Chr 10 and is supported by six proximal SNPs
with Praw values approaching significance (< 0.00086). Awano et al. detected weaker
signals of association on Chrs 6, 18, 20, and 35 [14]. Data herein do not support regions
of association on Chrs 18 and 35, but do show modest signals on Chrs 6 and 20.
90
Megaesophagus
The mode of inheritance of ME has not been previously investigated in the GSD,
but it has been suggested that the frequent occurrence of affected puppies born to
clinically normal parents serves as evidence for a recessive mutation. In this work we
successfully map two simple autosomal recessive traits with 10 and four cases, and a
complex recessive trait with 15 cases. GWAS using 19 dogs with ME, however, does not
yield a single, strong region of association. Rather, minor associations are detected on
eight different chromosomes. It is, therefore, unlikely that ME is inherited in an
autosomal recessive fashion in the GSD. Similarly, evaluation of inheritance patterns of
ME in the Miniature Schnauzer did not suggest a simple recessive mode of inheritance
[17].
A locus on Chr 12 is the only one to reach genome-wide significance and have
supporting proximal SNPs (eight SNPs having Praw values < 0.00014). To verify an
association, 35 additional ME GSDs were collected and genotyped for the most strongly
associated SNP in this region. In total, 53 of 54 ME cases are heterozygous or
homozygous for the associated allele, which occurs at a significantly lower frequency in
the control population. These data are consistent with an autosomal dominant mode of
inheritance, with incomplete penetrance and/or modifying loci. On the other hand, it is
also conceivable that the allele is fully penetrant, but that the control population includes
dogs with undetected ME. ME varies in severity and can resolve completely after a few
months, making detection of mild cases difficult.
91
The dilation and lack of muscle contraction in the esophagus is thought to be a
neurological defect, rather than a muscular defect [16]. The associated haplotype on Chr
12 harbors approximately 12 genes, several of which are expressed in the nervous
system. Additional genome-wide SNP analysis in ME GSDs are necessary to confirm this
association.
Pancreatic acinar atrophy
Fifty SNPs, representing 45 loci, exceed genome-wide significance thresholds for
association with PAA. Many of these map to Chr 12, although only three SNPs on the
chromosome support the same locus. These SNPs map to the dog leukocyte antigen
(DLA) complex in the centromeric region of the chromosome. The association of this
region with PAA is consistent with the autoimmune component of the disease. Previous
work showed that pancreases from GSDs with PAA show an increased expression of
DLA-88 [46]. DLA-88 is the most highly polymorphic class I locus of the DLA complex.
DLA class II loci are associated with several immune-related disorders including:
diabetes mellitus, anal furunculosis, hypoadrenocorticism, and necrotizing
meningoencephalitis [47-50]. Canine systemic lupus erythematosus, a classic
autoimmune disease, is also reported to be associated with alleles of the DLA class II
loci, and GWAS revealed five additional associated loci [51-52]. The current SNP data,
together with previous expression data, suggests the DLA region may harbor a genetic
risk factor for the development of PAA. Further investigation of the DLA loci is planned.
A second region of interest is located on Chr 7, which has four strongly associated SNPs
92
located within a 1.2 Mb region having 11 genes. None of these genes is known to be
involved in autoimmune disorders, although several are expressed in acinar cells.
The data reported here suggest that PAA may be governed by multiple loci with
small effects, or may be a heterogeneous disorder. Although PAA was thought to be a
simple autosomal recessive disorder [53-54], the results of a recent test mating between
two GSDs with PAA indicate more complex genetic underpinnings [28]. The study
monitored the cTLI scores for the resulting litter of six over the course of the dogs’ lives
(8-13 years) and the pancreas for each dog was examined at necropsy. Only two of the
six dogs in the litter were diagnosed with PAA [28]. Similarly, the clinical presentation of
PAA is inconsistent. The age of onset is variable within families, with diagnoses made in
puppies and adult dogs alike. The severity of clinical signs also varies, with some dogs
responding better to traditional treatment regimens than others. To further complicate the
matter, some GSDs never exhibit clinical signs, despite serum cTLI concentrations that
are diagnostic for EPI. Variability in age of onset and clinical signs may be indicators of
genetic heterogeneity. Although PAA is the predominant cause of EPI in dogs, chronic
pancreatitis, pancreatic cancer, and other underlying medical conditions may also cause
EPI.
Variation between processed arrays, a so-called “batch effect,” can cause spurious
associations [55]. The abundance of isolated SNPs detected in our GWAS for PAA is
suggestive of such artifacts. However, principal component analysis does not reveal
subpopulations that indicate a batch effect. Furthermore, no population stratification is
detected between PAA cases and controls (Supplementary Fig. 1). In addition, we
93
included only the robust “platinum” SNPs in our analysis to minimize artifacts from
incorrect genotype calls.
In this study, we used data from a single cohort of GSDs to identify major loci
associated with pituitary dwarfism, DM, and ME. Our data also reveal that the genetics
underlying PAA are highly complex. Candidate loci identified herein provide immediate
targets for future work.
Acknowledgements
We thank the American Kennel Club Canine Health Foundation for supporting
this work and the Intramural Program of the National Human Genome Research Institute.
We are grateful to the numerous dog owners and veterinarians who provided samples.
References
1. Goldbecker WM, Hart EH (1967) This is the German Shepherd. Jersey City, NJ:
T.F.H. Publications, Inc.
2. Moody JA, Clark LA, Murphy KE (2006) Working Dogs: History and Applications.
In: The Dog and Its Genome. Ed: E.A. Ostrander, U. Giger, K. Lindblad-Toh. Woodbury,
New York. Cold Spring Harbor Laboratory Press: 1-18.
3. Wahl JM, Clark LA, Skalli O, Ambrus A, Rees CA, et al. (2008) Analysis of gene
transcript profiling and immunobiology in Shetland sheepdogs with dermatomyositis. Vet
Dermatol 19: 52-58.
4. Andresen E, Willeberg P (1976) Pituitary dwarfism in German shepherd dogs:
additional evidence of simple, autosomal recessive inheritance. Nord Vet Med 28: 481-
486.
5. Reynaud R, Saveanu A, Barlier A, Enjalbert A, Brue T (2004) Pituitary hormone
deficiencies due to transcription factor gene alterations. Growth Horm IGF Res 14: 442-
448.
94
6. Lantinga-van Leeuwen IS, Mol JA, Kooistra HS, Rijnberk A, Breen M, et al. (2000b)
Cloning of the canine gene encoding transcription factor Pit-1 and its exclusion as a
candidate gene in a canine model of pituitary dwarfism. Mamm Genome 11: 31-36.
7. Lantinga-van Leeuwen IS, Kooistra HS, Mol JA, Renier C, Breen M, et al. (2000a)
Cloning, characterization, and physical mapping of the canine Prop-1 gene (PROP1):
exclusion as a candidate gene for combined pituitary hormone deficiency in German
shepherd dogs. Cytogenet Cell Genet 88: 140-144.
8. van Oost BA, Versteeg SA, Imholz S, Kooistra HS (2002) Exclusion of the lim
homeodomain gene LHX4 as a candidate gene for pituitary dwarfism in German
shepherd dogs. Mol Cell Endocrinol 197: 57-62.
9. Hanson JM, Mol JA, Leegwater PA, Kooistra HS, Meji BP (2006) The leukemia
inhibitory factor receptor gene is not involved in the etiology of pituitary dwarfism in
German shepherd dogs. Res Vet Sci 81: 316-320.
10. Barclay KB, Haines DM (1994) Immunohistochemical evidence for immunoglobulin
and complement deposition in spinal cord lesions in degenerative myelopathy in German
shepherd dogs. Can J Vet Res 58: 20-24.
11. Averill DR Jr. (1973) Degenerative myelopathy in the aging German Shepherd dog:
clinical and pathologic findings. J Am Vet Med Assoc 162: 1045-51.
12. Coates JR, March PA, Oglesbee M, Ruaux CG, Olby NJ, et al. (2007) Clinical
characterization of a familial degenerative myelopathy in Pembroke Welsh Corgi dogs. J
Vet Intern Med 21: 1323-1331.
13. Johnston PE, Barrie JA, McCulloch MC, Anderson TJ, Griffiths IR (2000) Central
nervous system pathology in 25 dogs with chronic degenerative radiculomyelopathy. Vet
Rec 146: 629-633.
14. Awano T, Johnson GS, Wade CM, Katz ML, Johnson GC, et al. (2009) Genome-
wide association analysis reveals a SOD1 mutation in canine degenerative myelopathy
that resembles amyotrophic lateral sclerosis. Proc Natl Acad Sci U S A 106: 2794-2799.
15. Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, et al. (1993) Mutations in
Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral
sclerosis. Nature 362: 59-62.
16. Guilford WG (1990) Megaesophagus in the dog and cat. Semin Vet Med Surg (Small
Anim) 5:37-45.
95
17. Cox VS, Wallace LJ, Anderson VE, Rushmer RA (1980) Hereditary esophageal
dysfunction in the Miniature Schnauzer dog. Am J Vet Res 41: 326-330.
18. Osborne CA, Clifford DH, Jessen C (1967) Hereditary esophageal achalasia in dogs.
J Am Vet Med Assoc 151: 572-581.
19. Wiberg ME, Saari SA, Westermarck E (1999) Exocrine pancreatic atrophy in German
Shepherd dogs and rough coated collies: an end result of lymphocytic pancreatitis. Vet
Pathol 36: 530-541.
20. Westermarck E, Batt RM, Valliant C, Wiberg M (1993) Sequential study of
pancreatic structure and function during development of pancreatic acinar atrophy in a
German shepherd dog. Am J Vet Res 54: 1088-1094.
21. Pfister K, Rossi GL, Freudiger U, Bigler B (1980) Morphological studies in dogs with
chronic pancreatic insufficiency. Virchows Arch A 386: 91-105.
22. Williams DA, Batt RM (1988) Sensitivity and specificity of radioimmunoassay of
serum trypsin-like immunoreactivity for the diagnosis of canine exocrine pancreatic
insufficiency. J Am Vet Med Assoc 192: 195-201.
23. Räihä M, Westermarck E (1989) The signs of pancreatic degenerative atrophy in dogs
and the role of external factors in the ethiology of the disease. Acta Vet Scand 30: 447-
452.
24. Hall EJ, Bond PM, McLean C, Batt RM, McLean L (1991) A survey of the diagnosis
and treatment of canine exocrine pancreatic insufficiency. J Small Anim Pract 32: 613-
619.
25. Wiberg ME, Westermarck E (2002) Subclinical exocrine pancreatic insufficiency in
dogs. J Am Vet Med Assoc 220: 1183-1187.
26. Proschowsky HF, Fredholm M (2007) Exocrine pancreatic insufficiency in the
Eurasian dog breed - inheritance and exclusion of two candidate genes. Anim Genet 38:
171-173.
27. Wiberg ME (2004) Pancreatic acinar atrophy in German shepherd dogs and rough-
coated collies. Etiopathogenesis, diagnosis and treatment. A review. Vet Q 26: 61-75.
28. Westermarck E, Saari SA, Wiberg ME (2010) Heritability of exocrine pancreatic
insufficiency in German Shepherd dogs. J Vet Intern Med 24: 450-452.
96
29. Karlsson EK, Baranowska I, Wade CM, Salmon Hillbertz NH, Zody MC, et al.
(2007) Efficient mapping of Mendelian traits in dogs through genome-wide association.
Nat Genet 39: 1321-1328.
30. Sutter NB, Bustamante CD, Chase K, Gray MM, Zhao K, et al. (2007) A single IGF1
allele is a major determinant of small size in dogs. Science 316: 112-115.
31. Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA, et al. (2007) PLINK: a
tool set for whole-genome association and population-based linkage analyses. Am J Hum
Genet 81: 559-575.
32. Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate: A practical and
powerful approach to multiple testing. J Roy Stat Soc B 57: 289-300.
33. Schmutz SM, Berryere TG (2007) The genetics of cream coat color in dogs. J Hered
98: 544-548.
34. Drögemüller C, Becker D, Brunner A, Haase B, Kircher P, et al. (2009) A missense
mutation in the SERPINH1 gene in Dachshunds with osteogenesis imperfecta. PLoS
Genet 5: e1000579.
35. Gill JL, Tsai KL, Krey C, Noorai RE, Vanbellinghen JF, et al. (2011) A canine
BCAN microdeletion associated with episodic falling syndrome. Neurobiol Dis
doi:10.1016/j.nbd.2011.07.014.
36. Bach I, Rhodes SJ, Pearse II RV, Heinzel T, Gloss B, et al. (1995) P-Lim, a LIM
homeodomain factor, is expressed during pituitary organ and cell commitment and
synergizes with Pit-1. Proc Natl Acad Sci USA 92: 2720-2724.
37. Netchine I, Sobrier ML, Krude H, Schnabel D, Maghnie M, et al. (2000) Mutations in
LHX3 result in a new syndrome revealed by combined pituitary hormone deficiency. Nat
Genet 25: 182-186.
38. Pfaeffle RW, Savage JJ, Hunter CS, Palme C, Ahlmann M, et al. (2007) Four novel
mutations of the LHX3 gene cause combined pituitary hormone deficiencies with or
without limited neck rotation. J Clin Endocrinol Metab 92: 1909-1919.
39. Bhangoo APS, Hunter CS, Savage JJ, Anhalt H, Pavlakis S, et al. (2006) Clinical case
seminar: A novel LHX3 mutation presenting as combined pituitary hormonal deficiency.
J Clin Endocr Metab 91: 747-753.
40. Rajab A, Kelberman D, de Castro SC, Biebermann H, Shaikh H, et al. (2008) Novel
mutations in LHX3 are associated with hypopituitarism and sensorineural hearing loss.
Hum Mol Genet 17: 2150-2159.
97
41. Kooistra HS, Voorhout G, Mol JA, Rijnberk A (2000) Combined pituitary hormone
deficiency in German shepherd dogs with dwarfism. Domest Anim Endocrin 19: 177-
190.
42. Sheng HZ, Zhadanov AB, Mosinger B Jr, Fujii T, Bertuzzi S, et al. (1996)
Specification of pituitary cell lineages by the LIM homeobox gene LHX3. Science 272:
1004-1007.
43. Colvin SC, Malik RE, Showalter AD, Sloop KW, Rhodes SJ (2011) Model of
pediatric pituitary hormone deficiency separates the endocrine and neural functions of the
LHX3 transcription factor in vivo. Proc Natl Acad Sci U S A 108: 173-178.
44. Lane PW, Dickie MM (1968) Three recessive mutations producing disproportionate
dwarfing in mice: achondroplasia, brachymorphic, and stubby. J Hered 59: 300-308.
45. Voorbij AM, Leegwater PA, Kooistra HS (2010) [Hypopituitarism associated
dwarfism in German Shepherds, saarloos wolf dogs and Czechoslovakian wolf dogs.
Access to genetic testing]. Tijdschr Diergeneeskd 135: 950-954.
46. Clark LA, Wahl JM, Steiner JM, Zhou W, Ji W, et al. (2005) Linkage analysis and
gene expression profile of pancreatic acinar atrophy in the German Shepherd Dog.
Mamm Genome 16: 955-962.
47. Barnes A, O’Neill T, Kennedy LJ, Short AD, Catchpole B, et al. (2009) Association
of canine anal furunculosis with TNFA is secondary to linkage disequilibrium with DLA-
DRB1*. Tissue Antigens 73: 218-224.
48. Greer KA, Wong AK, Liu H, Famula TR, Pedersen NC, et al. (2010) Necrotizing
meningoencephalitis of Pug dogs associates with dog leukocyte antigen class II and
resembles acute variant forms of multiple sclerosis. Tissue Antigens 76: 110-118.
49. Hughes AM, Jokinen P, Bannasch DL, Lohi H, Oberbauer AM (2010) Association of
a dog leukocyte antigen class II haplotype with hypoadrenocorticism in Nova Scotia
Duck Tolling Retrievers. Tissue Antigens 75: 684-690.
50. Kennedy LJ, Davison LJ, Barnes A, Short AD, Fretwell N, et al. (2006) Identification
of susceptibility and protective major histocomplatibility complex haplotypes in canine
diabetes mellitus. Tissue Antigens 68: 467-476.
51. Wilbe M, Jokinen P, Hermanrud C, Kennedy LJ, Strandberg E, et al. (2009) MHC
class II polymorphism is associated with a canine SLE-related disease complex.
Immunogenetics 61: 557-564.
98
52. Wilbe M, Jokinen P, Truvé K, Seppala EH, Karlsson EK, et al. (2010) Genome-wide
association mapping identifies multiple loci for a canine SLE-related disease complex.
Nat Genet 42: 250-254.
53. Moeller EM, Steiner JM, Clark LA, Murphy KE, Famula TR, et al. (2002)
Inheritance of pancreatic acinar atrophy in German Shepherd Dogs. Am J Vet Res
63:1429-34.
54. Westermarck E (1980) The hereditary nature of canine pancreatic degenerative
atrophy in the German shepherd dog. Acta vet scand 21: 389-394.
55. Hong H, Su Z, Ge W, Shi L, Perkins R, et al. (2008) Assessing batch effects of
genotype calling algorithm BRLMM for the Affymetrix GeneChip Human Mapping 500
K array set using 270 HapMap samples. BMC Bioinformatics 9: S17.
99
CHAPTER FIVE
CONCLUSIONS, FUTURE DIRECTIONS, AND APPLICATIONS
A COLQ Missense Mutation in Labrador Retrievers Having Congenital Myasthenic
Syndrome
In chapter two, a homozygous missense mutation in exon 14 of COLQ
(c.1010T>C) predicting an amino acid change (I337T) was identified in two Labrador
Retrievers with endplate acetylcholinesterase (AChE) deficiency (EAD) congenital
myasthenic syndrome (CMS) through the manual interrogation of SNP array data, and
the use of microsatellite analysis and sequencing [1]. Analysis of the pedigree as well as
the absence of this mutation in unaffected, unrelated Labrador Retrievers suggested that
this mutation recently arose de novo and was transmitted identical by descent through
shared common ancestors of the two affected puppies [1].
Because we did not have enough affected dogs to utilize the traditional genome-
wide association study (GWAS) approach, we developed a new technique for identifying
candidate genes in dogs that involves manually interrogating SNP array data for regions
that fit the simple recessive mode of inheritance pattern expected for EAD CMS [1]. This
procedure allows for the identification of candidate regions in studies with small sample
sizes, provided the subjects in question are related. In a similar study by Roach and
colleagues, the authors investigated a nuclear human family that included both parents
and their offspring, who both had the same two recessive diseases [2]. By sequencing the
genomes of these four individuals, compiling SNP haplotypes, and identifying those
haplotypes that fit a recessive mode of inheritance, these authors were able to identify
four candidate genes for the two recessive diseases in question [2].
100
In the future, manually interrogating SNP array data can be used to identify the
causative mutations for other recessive diseases and traits, especially those that have been
observed only in a specific family [1,2]. This method should prove particularly useful in
canine genetics, where breeding practices in dogs often lead to the appearance of novel
recessive, and sometimes detrimental, traits.
Furthermore, a study in humans was published at the same time as our Labrador
Retriever study in which the authors identified the same mutation as the one identified in
the Labrador Retrievers in cases of EAD CMS in a Syrian family [3]. This mutation was
the same as the one identified in affected Labrador Retrievers at both the nucleotide
(c.1010T>C) level and the amino acid (I337T) level [1,3]. Not only does this further
support c.1010T>C (I337T) as a causative mutation in the Labrador Retriever, but it also
reinforces the dog as a good model system for human CMS cases [1,3]. That is, these
studies provide examples of the phenotype as well as the genotype being the same in
humans and dogs for CMS [1,3]. This exact parallel between dog and human disease
happens rarely; another instance is the identification of the same mutation in cases of
retinal degeneration diseases in the dog (progressive rod-cone degeneration) and the
human (retinitis pigmentosa) [4]. Over 200 naturally occurring diseases in dogs have a
comparable disease in humans [5], and while the mutation underlying the diseases may
not be the same, the same gene is often implicated, including mutations in SOD1 causing
amyotrophic lateral sclerosis in humans [6] and degenerative myelopathy in dogs [7].
These parallels between dog and human diseases best support the dog as a model for
human disease.
101
A CHRNE Frameshift Mutation Causes Congenital Myasthenic Syndrome in Jack Russell
Terriers
In chapter three, I genotyped microsatellite markers flanking the five genes
encoding the subunits of the acetylcholine receptor (AChR) and evaluated the resulting
haplotypes for the pattern expected of a simple recessive disease. Through these analyses,
the candidate genes were narrowed to CHRNB1 and CHRNE, which encode the beta and
epsilon subunits of the AChR, respectively. Sequencing of the splice sites and coding
regions of both of these genes revealed an insertion in exon 7 of CHRNE (G193RfsX272)
that segregates as a simple recessive trait. This mutation was identified using only two
affected Jack Russell Terrier puppies, their dam, and an unaffected sibling, illustrating
the utility of pedigree members for the identification of private mutations in simple
recessive diseases. Future studies of such mutations and potential candidate genes can
therefore make use of families to identify causative mutations.
The results of my two CMS studies [1] and the CHAT mutation identified by
Proschowsky and colleagues in Old Danish Pointing Dogs [8] suggest that different dog
breeds exhibit different types of CMS and harbor different causative mutations. Because
the types of CMS respond differently to the various treatments available, veterinarians
should be made aware that dogs affected with CMS will need to be treated based on the
type of CMS that affects their breed (e.g., [1,8]). Knowing the molecular cause of each
CMS case will determine the most beneficial treatment regimen for affected dogs.
102
Genome-wide association studies for multiple diseases of the German Shepherd Dog
In chapter four, we mapped congenital megaesophagus (ME) in German Shepherd
Dogs to chromosome (CFA) 12 through the use of a GWAS evaluating dogs affected
with congenital ME as cases and dogs affected with three other diseases and healthy dogs
as controls [9]. As can be observed by comparing Figure 3 from chapter four [9] and the
new Manhattan plot in Appendix Three (Figure 4), using dogs affected with other
diseases as controls in our original analysis skewed our original results to include SNPs
associated with those other diseases. Ideally, more ME-affected German Shepherd Dogs
should be collected along with healthy, unrelated German Shepherd Dogs and the GWAS
performed again. This more balanced population, along with the longer LD within the
breed [10], should result in a more strongly associated region, most likely including at
least part of the currently associated segment on CFA 12. If this analysis yields a region
with more candidate genes than is feasible for sequencing, this chromosomal segment can
be evaluated in another closely related breed (or breeds) affected by congenital ME. As
the LD between breeds is shorter, the addition of these closely related breeds to the
analysis should decrease the size of the associated chromosomal segment, resulting in
fewer candidate genes. These candidate genes can then be further evaluated, perhaps
resulting in the identification of the causative mutation(s) and/or a major locus
contributing to ME.
103
Final Thoughts
Dogs are a good model system for congenital neuromuscular disorders, as
evidenced in the previous chapters [1,9]. Dogs have clinical signs similar to those of
humans for many neuromuscular disorders. When developing studies for these
neuromuscular diseases, there is a potential for larger sample sizes with dogs, as they
have more offspring per birth compared to humans. In addition, experimental pedigrees
can be established to study the inheritance and progress of these diseases in dogs [e.g.,
11,12], while this approach is unethical in human studies. Pet dogs also live in the same
environments as their human owners, which can reduce the environmental differences
between the human and animal model so that the research can focus on the genetic
factors. The dog as a model system for neuromuscular diseases is especially evident in
my study of CMS in Labrador Retrievers, as the exact same mutation was identified in a
human case of CMS [1,3].
To date, three genes have been shown to harbor mutations associated with CMS
in dog breeds: CHAT in Old Danish Pointing Dogs [8], COLQ in Labrador Retrievers [1],
and CHRNE in Jack Russell Terriers. In the future, the mutations identified in these three
papers can be used to screen for carriers in each of these breeds to potentially eliminate
CMS from these breeds [1,8]. Other breeds with cases of CMS were studied in the 1970s
and 1980s including Springer Spaniels and Smooth Fox Terriers [13,14]. Because the
CMS phenotypes are similar to that of CMS in Jack Russell Terriers, it is likely that the
causative mutations for these CMSs are located in one of the AChR subunit genes [13-
15]. Sequencing these genes in the affected dogs may result in the identification of the
104
causative mutation; therefore, subsequent screening can be implemented in these breeds
to ensure that this disease does not become pervasive. In addition, if the causative
mutation is not found in the genes encoding the AChR subunits, other candidate genes
are known from human studies [16] that can be evaluated as well. As of this writing,
there are eighteen genes known to harbor mutations causative for CMS in humans [16]. A
screen for all eighteen candidate genes would greatly aid in this identification. This
screen could be developed in one of two ways. First, a set of microsatellite markers
flanking each of the eighteen genes could be determined and primers encompassing the
coding regions and splice sites of all eighteen genes could be designed. The genes
screened in each dog breed could then be selected based on the results of the
microsatellite analysis as well as the specific clinical signs of the affected dogs (i.e.,
response to anticholinesterase medication). Second, a custom SNP array could be
designed that included SNPs that are polymorphic across all dog breeds and flanking
each of the eighteen candidate genes, which could be used in a smaller-scale GWAS
approach. The first method would be more practical in cases of families with known
pedigree information. The second method, in turn, would be more practical in cases in
which the CMS phenotype is seen across the breed and many unrelated dogs are affected.
In addition, this second method would simultaneously yield data for all eighteen genes,
while the first would take much longer to yield similar, yet less comprehensive, data.
In conclusion, the causative mutations identified in two distinct types of CMS can
help to identify carriers and cases of CMS [1]. These screens will add to the breeders’
knowledge and help them to make more informed breeding decisions that can eventually
105
lead to the decrease and/or elimination of diseases in these dog breeds. In addition, the
creation of a screen for all eighteen genes known to harbor CMS mutations [16] can lead
to the identification of causative CMS mutations in other dog breeds in a more efficient
manner. Further investigation into the region of interest for congenital ME may one day
yield candidate genes and causative mutations for this debilitating disease as well.
References
1. Rinz CJ, Levine J, Minor KM, Humphries HD, Lara R, et al. (2014) A COLQ
Missense Mutation in Labrador Retrievers Having Congenital Myasthenic Syndrome.
PLoS ONE 9: e106425.
2. Roach JC, Glusman G, Smit AFA, Huff CD, Hubley R, et al. (2010) Analysis of
Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing. Science 328:
636-639.
3. Matlik HN, Milhem RM, Saadeldin IY, Al-Jaibeji HS, Al-Gazali L, and Ali BR (2014)
Clinical and Molecular Analysis of a Novel COLQ Missense Mutation Causing
Congenital Myasthenic Syndrome in a Syrian Family. Pediatr Neurol 51: 165–169.
4. Zangerl B, Goldstein O, Philp AR, Lindauer SJP, Pearce-Kelling SE, et al. (2006)
Identical mutation in a novel retinal gene causes progressive rod-cone degeneration in
dogs and retinitis pigmentosa in humans. Genomics 88:551–563.
5. The University of Sydney (2014) OMIA - Online Mendelian Inheritance in Animals.
Accessed 17 November 2014. Available: http://omia.angis.org.au/home/.
6. Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, et al. (1993) Mutations in
Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral
sclerosis. Nature 362: 59-62.
Erratum in Rosen DR (1993) Mutations in Cu/Zn superoxide dismutase gene are
associated with familial amyotrophic lateral sclerosis. Nature 364: 362.
7. Awano T, Johnson GS, Wade CM, Katz ML, Johnson GC, et al. (2009) Genome-wide
association analysis reveals a SOD1 mutation in canine degenerative myelopathy that
resembles amyotrophic lateral sclerosis. Proc Natl Acad Sci U S A. 106(8):2794-9.
106
8. Proschowsky HF, Flagstad A, Cirera S, Joergensen CB, and Fredholm M. (2007)
Identification of a Mutation in the CHAT Gene of Old Danish Pointing Dogs Affected
with Congenital Myasthenic Syndrome. J Herod 98(5):539–543.
9. Tsai KL, Noorai RE, Starr-Moss AN, Quignon P, Rinz CJ, et al. (2012) Genome-wide
association studies for multiple diseases of the German Shepherd Dog. Mamm Genome.
23: 203-11.
10. Lindblad-Toh K, Wade CM, Mikkelsen TS, Karlsson EK, Jaffe DB, et al. (2005)
Genome sequence, comparative analysis and haplotype structure of the domestic dog.
Nature 438: 803-819.
11. Cox ML, Lees GE, Kashtan CE, Murphy KE (2003) Genetic cause of X-linked Alport
syndrome in a family of domestic dogs. Mamm Genome 14: 396-403.
12. Tsai KL, Murphy KE (2006) Clinical and genetic assessments of hip joint laxity in
the Boykin spaniel. Can J Vet Res 70: 148-50.
13. Johnson RP, Watson AD, Smith J, Cooper BJ (1975) Myasthenia in Springer Spaniel
littermates. J Small Anim Pract 16: 641-647.
14. Miller LM, Lennon VA, Lambert EH, Reed SM, Hegreberg GA, et al. (1983)
Congenital myasthenia in 13 smooth fox terriers. J Am Vet Med Assoc 182: 694–697.
15. Palmer AC, Barker J (1974) Myasthenia in the dog. Vet Rec 95: 452-454.
16. Hantaï D, Nicole S, and Eymard B (2013) Congenital myasthenic syndromes: an
update. Curr Opin Neurol 26: 561-8.
106
APPENDICES
107
APPENDIX ONE:
SUPPLEMENTARY MATERIAL FOR CHAPTER TWO
(A COLQ Missense Mutation in Labrador Retrievers Having Congenital Myasthenic Syndrome)
Copyright Permission
“PLOS applies the Creative Commons Attribution (CC BY) license to all works we publish (read
the human-readable summary or the full license legal code). Under the CC BY license, authors
retain ownership of the copyright for their article, but authors allow anyone to download, reuse,
reprint, modify, distribute, and/or copy articles in PLOS journals, so long as the original authors
and source are cited. No permission is required from the authors or the publishers.”
(http://www.plosone.org/static/license)
108
Table S1. Primers (5'-3') for amplification of CHRNG, CHRND, and COLQ
Gene Exon(s)
Forward Primer
Sequence (5ʹ-3ʹ)
Reverse Primer
Sequence (5ʹ-3ʹ)
Cleanup
Protocol
CHRNG
1 CCTGGCATTTTGTCCATCTT TCAGGGGACAGAGGGTCT ExoSAP
2 GTTGTCCCACCCGTCACT AAGAAGGGGCTGGCTCTA ExoSAP
3 GACAGTGGGGGACACAGAG GTGCTAAGGGTGCCGTCC ExoSAP
4 CCCTCCCTGCCTCTTCTG GGAAAAGGGACAAGTGGACA ExoSAP
5 GCAGGTGGGGAGTAGCG TCCTTCCCTGCCTCAGTTTC ExoSAP
6 GGCAGCAGAGGGGAGGAA CCTCCCTGTGCCCACCCT Gel X
7 GTCAGGCATCCAGTCTCC CACACACGAGACCACCTG Gel X
8 GGGCATCACACACGAGAC CTACCCTCCTGCCACTCC ExoSAP
9 CACTACCCTCCTGCCACTC TGTGGCAGGTGTATTATGC ExoSAP
10 CAACCTTCACCTTCTGCTCT CAGGTTGAGGAGAGAGAAGC ExoSAP
11 CTTCTTCTCCACTCTATCCCCA TGAGAAGGACCGAAGGAC ExoSAP
12 GAGAAGGACCGAAGGACAC TGAGTGTGCTCTTTGGGAA ExoSAP
CHRND
1 TACTGGTCGTGTGTGGTAAGAG CTTCCCCTCCAGCCTCAGTT ExoSAP
2 TTCCCCTCCAGCCTCAGT CTGGTAGATTGGGATTCTTCATC ExoSAP
3&4 ATAGGCTCCCTTGGTTGTG CTGAAGCAGGAGGAAGAAG ExoSAP
5 CCCCTGCTCTGTCCTGTTTAG GGACATACCTACCGACACAAATCT ExoSAP
6 GGAGACACCCACAAACAGAA CCTCTCCTCACTTCCTCCTG Gel X
7&8 ACTCACTCTCTCACTTGGTCCTCA CCAGGCACAAATGAGCAGAAG ExoSAP
9 AATAGGGGAGAGTTGGAAGCA GACCAGAACGATTACAACGAGG ExoSAP
10 CTGTAAAATAGCCTCCTTGTGTCC GGAGACACACACCCACTTAGATG ExoSAP
11 TTACCCTCCTTAGACCCCT GAGAGGAAGGGAGAAACC ExoSAP
COLQ
1 GGGAAAGGAGAGAGAGAGACA TTCACCATTCTGCTCTCCG Gel X
2 CTGGGGGAAGGTTACATCAAG TGTGTCTGTTCTTCCACTGTC Gel X
3 TCCATTCAAGCCAAGTATGTCTC GCTGCTGCCTAGATGGGTG Gel X
4&5 AGTCCTGCCTTCCTCACCA GTTGGGGGAGGGATGTGTAT Gel X
6 TGAACCCCCAAAACAAACC CTTTCTCCTTCGGTTGGACTAC Gel X
7 TGTCCCTGGTTCATCCTAATCT ATTGAAAGCCCAGTGCCG Gel X
8 TTACAGCCCCCACTAAAACTTG CAATGGTGAGCAGAAGACA Gel X
9&10 TGGGCAAGTCCCTAATCTCTG TTGATGAGAGGGTTCCAGCA Gel X
11 CAGTTGGAAAAAGTCTGGAATGAT GTGTAGGTGGGTGGTGTAGA Gel X
12 GGCTCCTGCTCCAAAGTG GGAGAGGGCACAGGAGATG Gel X
13 CGTGGACTTTGACCTTCTTTCT CGCAAAATCAGCCATCCAAC Gel X
14 CTTCAGGAGGGATGACAGAGTG GAACCTCCTCTTTGAGCC Gel X
15 AGAAGGTAGCCCCCACAGAC CCTGTCCCTCCCTTTTCCT Gel X
16 GGCAGTCCCTGGATACAT TTTCTTAGTGCTCCTTATGTTCC Gel X
17a AGTGGCTGGTGTCTGATG CCAAATAGCCAACCTTCAGT Gel X
17b GTCCAGTTTCTACCACCTTCATA TGGGTAGGCTTTTGGTGTTC Gel X
Table S1. Primers (5'-3') for amplification of CHRNG, CHRND, and COLQ. Primers were
designed to amplify exons and splice sites. ExoSAP indicates the use of the ExoSAP protocol
and Gel X indicates the use of the gel extraction protocol for post-PCR clean-up. (PDF)
109
Table S2. Candidate regions based on allele frequencies. Genomic regions known to harbor
CMS candidate genes were screened for case allele frequencies of 1.0 and control allele
frequencies of between 0.14 and 0.50. CHR = chromosome number; SNP = SNP name; BP =
chromosome position; A1 = allele 1; F_A = frequency of allele 1 in affected dogs (cases); F_U =
frequency of allele 1 in unaffected dogs (controls); A2 = allele 2. (PDF available at
http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0106425#s5)
110
Table S3. Dogs screened for the COLQ 14 Variant
COLQ Exon 14
Variant Genotype
Breed Sample Number (n) T/T T/C C/C
Labrador Retriever (related) 58 40 16 2
Labrador Retriever (unrelated) 288 288
Afghan Hound 1 1
Airedale Terrier 2 2
Akita 3 3
American Eskimo Dog 2 2
Australian Shepherd 2 2
Basenji 2 2
Bichon Frise 1 1
Blue Tick Hound 1 1
Border Collie 2 2
Boston Terrier 2 2
Boxer 2 2
Briard 2 2
Bull Terrier 1 1
Cairn Terrier 2 2
Cardigan Welsh Corgi 2 2
Catahoula Leopard Dog 2 2
Cavalier King Charles Spaniel 2 2
Chihuahua 2 2
Chinese Shar-Pei 1 1
Chow Chow 1 1
Cocker Spaniel 2 2
Collie 3 3
Dachshund 2 2
Doberman Pinscher 1 1
English Bulldog 2 2
English Setter 2 2
English Springer Spaniel 2 2
Flat-Coated Retriever 1 1
German Shepherd Dog 2 2
Golden Retriever 3 3
Great Dane 2 2
Havanese 1 1
Irish Setter 2 2
Lhasa Apso 1 1
Maltese 1 1
111
Miniature Poodle 2 2
Miniature Schnauzer 2 2
New Guinea Singing Dog 2 2
Newfoundland 2 2
Norwegian Elkhound 2 2
Papillon 1 1
Pekingese 1 1
Pembroke Welsh Corgi 2 2
Petit Basset Griffon Vendéen 2 2
Podengo 1 1
Polish Lowland Sheepdog 1 1
Portuguese Water Dog 1 1
Pyrenean Shepherd 2 2
Rhodesian Ridgeback 2 2
Rottweiler 1 1
Saint Bernard 2 2
Shetland Sheepdog 2 2
Shih Tzu 1 1
Shiloh Shepherd 1 1
Siberian Husky 2 2
Silken Windhound 2 2
Silky Terrier 1 1
Swedish Vallhund 2 2
Tibetan Terrier 2 2
Vizsla 1 1
Weimaraner 2 2
Welsh Fox Terrier 2 2
West Highland White Terrier 2 2
Wire Fox Terrier 2 2
Yorkshire Terrier 2 2
Table S3. Dogs screened for the COLQ 14 variant. Digestion with Bts1 was used to genotype the
2 affected dogs, 56 other members of the Labrador Retriever pedigree, 288 unrelated Labrador
Retrievers, and 112 dogs representing 65 other breeds. (PDF)
Reference
Rinz CJ, Levine J, Minor KM, Humphries HD, Lara R, et al. (2014) A COLQ Missense Mutation
in Labrador Retrievers Having Congenital Myasthenic Syndrome. PLoS ONE 9: e106425.
112
APPENDIX TWO:
SUPPLEMENTARY MATERIAL FOR CHAPTER FOUR
(Genome-wide association studies for multiple diseases of the German Shepherd Dog)
113
Copyright Permission
114
115
116
Supplementary Figure 1. Principal component analysis of 98 GSDs with PAA versus 79 healthy control
GSDs. The x-axis is principal component 1 and the y-axis is principal component 2. Both populations
appear to be evenly distributed throughout the cluster and no significant stratification was observed.
117
SNP Praw EMP2 FDR_BH
chr35.4925078 1.59E-11 2.00E-05 6.43E-07
chr12.58146406 9.28E-11 2.00E-05 1.30E-06
chr28.32676786 9.59E-11 2.00E-05 1.30E-06
chr12.23177472 1.48E-10 2.00E-05 1.50E-06
chr33.30105637 1.85E-10 2.00E-05 1.50E-06
chr15.40294695 3.03E-10 2.00E-05 2.05E-06
chr7.82831339 2.43E-09 0.00026 1.40E-05
chr5.51353689 3.44E-09 0.00035 1.73E-05
chr3.76398656 3.85E-09 0.00039 1.73E-05
chr33.25987767 5.02E-09 0.00043 2.03E-05
chr1.9328042 1.18E-08 0.00083 4.36E-05
chr24.31358922 1.77E-08 0.00115 5.97E-05
chr37.12660891 3.69E-08 0.00225 0.0001149
chr9.10239350 4.07E-08 0.00244 0.0001177
chr6.39598998 2.80E-07 0.01431 0.0007564
chr13.30418286 3.16E-07 0.01574 0.0007722
chr10.13435580 3.24E-07 0.01598 0.0007722
chr35.19780099 3.67E-07 0.01791 0.0008268
chr28.13143663 4.73E-07 0.02195 0.001009
chr4.13107661 7.54E-07 0.03298 0.001527
chr4.4080795 8.72E-07 0.03707 0.001675
chr14.54484895 9.10E-07 0.03814 0.001675
chr23.14905565 9.67E-07 0.04017 0.001703
chr17.44088133 1.47E-06 0.05733 0.002474
chr5.68085129 1.94E-06 0.0711 0.003082
chr2.86073514 1.98E-06 0.07227 0.003082
chr12.12567352 4.83E-06 0.1536 0.007242
chr10.68614890 5.75E-06 0.1737 0.008223
chr3.93468384 5.89E-06 0.1771 0.008223
chr12.27205596 6.76E-06 0.1981 0.009124
chr12.3781476 8.88E-06 0.2478 0.01161
chr7.12305239 1.16E-05 0.2998 0.01469
chr28.38709005 1.41E-05 0.3461 0.01731
chr26.20243802 1.49E-05 0.3599 0.01778
chr12.4698937 1.73E-05 0.3985 0.01999
chr9.54243104 1.86E-05 0.4241 0.02098
chr7.5792722 2.79E-05 0.5349 0.03059
chr2.18072233 3.26E-05 0.5823 0.03474
chr3.29459535 3.47E-05 0.6062 0.03574
chr7.11222056 3.53E-05 0.6125 0.03574
118
chr6.33280800 4.06E-05 0.655 0.04011
chr12.3845215 4.72E-05 0.7004 0.04552
chr7.12424701 4.92E-05 0.7151 0.046
chrX.87975142 5.00E-05 0.7203 0.046
chr6.18214638 5.42E-05 0.7426 0.04881
chr17.5088861 6.64E-05 0.8006 0.0582
chr7.12310223 6.75E-05 0.808 0.0582
chr31.36637612 8.75E-05 0.8689 0.07383
chr17.52274900 9.12E-05 0.8774 0.07542
chr5.3236960 9.98E-05 0.898 0.08084
Supplementary Table 1: Uncorrected and corrected P values (PAA) are shown for the 50 SNPs
with significant Praw values (P<0.0001). Corrected P values are from 100,000 permutations
(EMP2 or Pgenome) and the Benjamini-Hochberg test (FDR_BH).
119
APPENDIX THREE:
ADDENDUM TO CHAPTER FOUR
(Genome-wide association studies for multiple diseases of the German Shepherd Dog)
120
Addendum to Chapter Four
(Genome-wide association studies for multiple diseases of the German Shepherd Dog)
Since Tsai, et al.’s “Genome-wide association studies for multiple diseases of the German
Shepherd Dog” was published in 2012 [1], we have performed the GWAS analysis using
different poulation parameters for the congenital megaesophagus (ME) affected German
Shepherd Dogs (GSDs). For this analysis, we used the 19 affected GSDs and only those controls
(67 dogs) that were healthy (i.e., were not diagnosed with any of the other diseases) from the
original paper. This analysis yielded a significant association on CFA12 (Figure 4).
Figure 4. GWAS using 48,415 SNPs with 100,000 permutations. Nineteen cases (GSDs affected
with congenital ME) and 67 healthy controls (healthy GSDs) were run through PLINK. The
-log10(P) for every SNP was plotted by chromosome and a significant association identified on
CFA12.
In our previous study, SNP 12.60274687 was most strongly associated with congenital
ME (Praw = 1.49x10-5
Tsai, et al. 2012). In our new analysis, the same SNP was again most
strongly associated, with Praw = 4.01x10-6
. Therefore, I genotyped a total of 74 affected GSDs
(including the 35 genotyped for Tsai, et al. 2012) as well as 63 dogs from an additional 33 breeds
for the 12.60274687 SNP (Table 2). As discussed in Tsai, et al. 2012 [1], the G allele of
121
12.60274687 is most likely associated with ME in GSDs as approximately 96% of affected dogs
in that study were either homozygous G or heterozygous. However, this G allele it is not likely
associated with ME in the other breeds as many affected dogs were homozygous A (see Table 2).
In addition, many of the dogs harbored an indel associated with the G allele (Table 2) that
involves the deletion of 5’-CTAACT-3’ at position 12.60274679-12.60274684 and an insertion
of 5’-GATAGACTC-3’ beginning at position 12.60274679 (positions based on canFam2). This
indel was only observed with the G allele and was not present in sequences with the A allele. As
this indel was not present with every G allele in every affected dog, it is uncertain whether it
plays a role in ME.
12.60274687 Genotypes
Breed (n) G/G G/A A/A
American Bulldog (1) 1
Australian Shepherd (1) 1
Boston Terrier (1) 1
Boxer (1) 1*
Chihuahua (1) 1
Dachshund (5) 4* 1
English Bulldog (1) 1*
French Bulldog (1) 1
German Shepherd Dog (74) 43 28 3
Golden Doodle (1) 1
Great Dane (10) 4 5 1
Irish Setter (1) 1
Jack Russell Terrier (1) 1
Labrador Retriever (1) 1*
Lhasa Apso (3) 2* 1*
Miniature Schnauzer (4) 3* 1*
Mixed Breed (6) 5 1
Newfoundland (2) 2
Papillon (1) 1
Pembroke Welsh Corgi (1) 1
Portuguese Water Dog (1) 1
Rat Terrier (1) 1
Rhodesian Ridgeback (1) 1
Saint Bernard (1) 1
Shiloh Shepherd (1) 1
122
Silken Windhound (3) 2 1
Soft Coated Wheaten Terrier (1) 1
Standard Poodle (2) 1* 1
Vizla (1) 1
Weimaraner (4) 4
Welsh Terrier (2) 1 1
Wire-Haired Fox Terrier (1) 1
Yorshire Terrier (1) 1
Table 2. All dogs screened for 12.60274687 SNP. Sanger sequencing was used to genotype a
total of 137 affected (congenital ME) dogs representing 33 breeds for the 12.60274687 SNP.
Breeds in which the indel was observed in at least one dog are denoted by *.
References
1. Tsai KL, Noorai RE, Starr-Moss AN, Quignon P, Rinz CJ, et al. (2012) Genome-wide
association studies for multiple diseases of the German Shepherd Dog. Mamm Genome. 23: 203-
211.
