General enquiries on this form should be made to:Defra, Science Directorate, Management Support and Finance Team,Telephone No. 020 7238 1612E-mail: research.competitions@defra.gsi.gov.uk

SID 5 Research Project Final Report

SID 5 (2/05) Page 1 of 19

NoteIn line with the Freedom of Information Act 2000, Defra aims to place the results of its completed research projects in the public domain wherever possible. The SID 5 (Research Project Final Report) is designed to capture the information on the results and outputs of Defra-funded research in a format that is easily publishable through the Defra website. A SID 5 must be completed for all projects.

A SID 5A form must be completed where a project is paid on a monthly basis or against quarterly invoices. No SID 5A is required where payments are made at milestone points. When a SID 5A is required, no SID 5 form will be accepted without the accompanying SID 5A.

This form is in Word format and the boxes may be expanded or reduced, as appropriate.

ACCESS TO INFORMATIONThe information collected on this form will be stored electronically and may be sent to any part of Defra, or to individual researchers or organisations outside Defra for the purposes of reviewing the project. Defra may also disclose the information to any outside organisation acting as an agent authorised by Defra to process final research reports on its behalf. Defra intends to publish this form on its website, unless there are strong reasons not to, which fully comply with exemptions under the Environmental Information Regulations or the Freedom of Information Act 2000.Defra may be required to release information, including personal data and commercial information, on request under the Environmental Information Regulations or the Freedom of Information Act 2000. However, Defra will not permit any unwarranted breach of confidentiality or act in contravention of its obligations under the Data Protection Act 1998. Defra or its appointed agents may use the name, address or other details on your form to contact you in connection with occasional customer research aimed at improving the processes through which Defra works with its contractors.

Project identification

1. Defra Project code SE0520

2. Project title

The role of Mycoplasma ovipneumoniae in respiratory disease in pasteurella vaccinated sheep flocks

3. Contractororganisation(s)

Veterinary Laboratories Agency Woodham LaneAddlestoneSurreyKT15 3NB     

54. Total Defra project costs £ 145,005.00

5. Project: start date................ 01 October 2003

end date................. 30 September 2005

SID 5 (2/05) Page 2 of 19

6. It is Defra’s intention to publish this form. Please confirm your agreement to do so...................................................................................YES NO (a) When preparing SID 5s contractors should bear in mind that Defra intends that they be made public. They

should be written in a clear and concise manner and represent a full account of the research project which someone not closely associated with the project can follow.Defra recognises that in a small minority of cases there may be information, such as intellectual property or commercially confidential data, used in or generated by the research project, which should not be disclosed. In these cases, such information should be detailed in a separate annex (not to be published) so that the SID 5 can be placed in the public domain. Where it is impossible to complete the Final Report without including references to any sensitive or confidential data, the information should be included and section (b) completed. NB: only in exceptional circumstances will Defra expect contractors to give a "No" answer.In all cases, reasons for withholding information must be fully in line with exemptions under the Environmental Information Regulations or the Freedom of Information Act 2000.

(b) If you have answered NO, please explain why the Final report should not be released into public domain

Executive Summary7. The executive summary must not exceed 2 sides in total of A4 and should be understandable to the

intelligent non-scientist. It should cover the main objectives, methods and findings of the research, together with any other significant events and options for new work.

The diagnosis, detection and identification of Mycoplasma species by the Veterinary Laboratories Agency provides Defra with a passive surveillance system for detecting new and emerging mycoplasma diseases. It was as a result of this system, a marked increase in the number of Mycoplasma ovipneumoniae (MO) isolates was noted in 2002 which continued to increase into 2003. As a result, this project was designed to investigate and provide preliminary data on three main aspects of disease diagnosis and control. Initial work was aimed at improving the available diagnostic tools; further work aimed to improve the scientific understanding of the causative organism; and finally to investigate methods of disease control.

This project has established and applied new and improved diagnostic tests for disease caused by MO and also the detection of MO. These tests are an ELISA; an immunoblot method; immunocytohistochemistry (ICC); PCR; and the PCR/DGGE method. In addition an improved media for isolating and giving increased yields of MO has been established using a ruminant protein free formulation which will be beneficial in producing vaccines. Methods have been applied to MO that demonstrate the organisms enormous molecular and protein variability. In addition, the variability in substrate utilisation between strains has been ascertained with major variations being in ethanol, lactate, 2-oxybutyrate and glycerol utilisation. The results show that all strains have a capsule and most strains produce a relatively high level of hydrogen peroxide production following a comparatively low rate of NADH oxidation. This suggests hydrogen peroxide may play an important role in causing respiratory disease.

Specific ICC for MO demonstrated the damage caused to the lung by an MO infection. Field studies, particularly in sheep vaccinated against Mannheimia haemolytica show that MO is a major cause of respiratory disease in sheep. In vitro antimicrobial studies show that the newer fluoroquinolones (enrofloxacin and danofloxacin) and oxytetracycline are most effective, but antimicrobial resistance has developed to the antimicrobials: tylosin, tilmicosin, chloramphenicol and spectinomycin. In vivo treatment with danofloxacin on two farms appeared to reduce respiratory disease in these sheep flocks. Two formulations of an MO vaccine were developed and tested for safety and efficacy against a natural MO exposure to infection. Both vaccines were safe and illicited an immune response, the second preparation

It is apparent that respiratory disease in sheep is a frequent occurrence. It is also complex, and can be caused by many organisms. Use of a single disease vaccine, may well leave the animal susceptible to other ‘opportunist’ diseases, which may include disease caused by MO which appears to be present in many sheep as shown by the abattoir investigation. Undoubtedly, MO is a complex organism, with variable molecular and protein composition, and variable substrate utilisation, but it may be hypothesised that the disease caused by MO may be due to the concentration of MO organisms present in the lung as

SID 5 (2/05) Page 3 of 19

well as host related factors such as stress and concurrent disease. Further fundamental understanding of MO and the processes on how it causes disease would be beneficial not only in controlling the disease but also in developing future control methods. Reduction in disease caused by MO may be achieved by strategic culling, and antimicrobial use. The best treatment regimes for antimicrobial use need establishing. However, the further development of a vaccine for MO and ideally a multiple vaccine could offer real benefits in reducing respiratory disease and related economic losses in the sheep industry.

Project Report to Defra8. As a guide this report should be no longer than 20 sides of A4. This report is to provide Defra with

details of the outputs of the research project for internal purposes; to meet the terms of the contract; and to allow Defra to publish details of the outputs to meet Environmental Information Regulation or Freedom of Information obligations. This short report to Defra does not preclude contractors from also seeking to publish a full, formal scientific report/paper in an appropriate scientific or other journal/publication. Indeed, Defra actively encourages such publications as part of the contract terms. The report to Defra should include: the scientific objectives as set out in the contract; the extent to which the objectives set out in the contract have been met; details of methods used and the results obtained, including statistical analysis (if appropriate); a discussion of the results and their reliability; the main implications of the findings; possible future work; and any action resulting from the research (e.g. IP, Knowledge Transfer).

Scientific Objectives1. Develop serological test for monitoring infection of M. ovipneumoniae2. Optimise growth medium3. Develop immunocytochemistry (ICC) test for the detection of M. ovipneumoniae in affected tissue4. Determine antibiotic sensitivity of M. ovipneumoniae strains5. Biochemical analysis of strains to determine relative production of hydrogen and capsular antigen production,

potential virulence factors6. Make appropriate field visits7. Assess molecular and immunological variability of UK strains8. Attempt one autogenous vaccine trial on affected flockAll objectives have been met fully.

SID 5 (2/05) Page 4 of 19

The diagnosis, detection and identification of Mycoplasma species by the Veterinary Laboratories Agency provides Defra with a passive surveillance system for detecting new and emerging mycoplasma diseases. It was as a result of this system, a marked increase in the number of Mycoplasma ovipneumoniae (MO) isolates was noted in 2002 which continued to increase into 2003. As a result, this project was designed, to investigate and provide preliminary data on three main aspects of disease diagnosis and control. Initial work was aimed at improving the available diagnostic tools; further work aimed to improve the scientific understanding of the causative organism; and finally to investigate methods of disease control.

Isolates of MO used in this study were obtained from normal surveillance, on farm investigations following information obtained by this surveillance and during one visit to an abattoir. The number of MO isolations from normal surveillance is given below.

Cases Isolates1998 4 41999 0 02000 4 52001 1 12002 15 812003 45 822004 45 95

2005 (9 months) 30 40

Table shows incidence of Mycoplasma ovipneumoniae from 1998 to 2005. Cases is the number of farms where samples came from, and in some cases more than one sample was submitted leading to the recovery and identification of a number of isolates.

DIAGNOSIS

ELISA

Disease diagnosis in living animals can either be by detection of an antibody response to an antigen (disease causing organism) or by detecting the organism directly. An effective serological test using an ELISA to detect antibodies to MO has been developed and is in routine use. Five different antigen extracts were compared with a whole cell indirect ELISA. Formalised cells and whole cells gave the best results, so whole cell antigen has been used, preserved with proclin. MO is known to be variable but no variation in titres was detected using different isolates as antigens in the ELISA. More than 300 serum samples have been tested demonstrating clear differences between infected and uninfected animals. The mean of the negative samples was 0.13 with a standard deviation of 0.09. Positive samples gave OD’s up to 1.75 although the positive control used is 1.0. Interpretation of heavy infection and disease is clear with OD’s above 0.49 (mean negative plus 4 SD’s), however testing of paired sera gave improved indication of active disease.

Molecular Methods

Detection of the causative organism MO, indicates the potential for disease, although it does not indicate active disease, which may best be detected by serological tests and the detection of a specific antibody response. Molecular methods include the developments of a specific MO PCR method (McAuliffe et al., 2003) which offers a rapid method for screening samples specifically for MO and also for confirming the identification of culture isolates. Details of the PCR using the 16S rDNA gene are:

Primers: LMF1 TGAACGGAATATGTTAGCTTLMR1 GACTTCATCCTGCACTCTGT

PCR cycles: Denature at 94ºC for 5 mins, followed by 30 cycles of 94ºC for 30 secs, 55ºC for 30 secs and 72ºC for 30 secs, followed by a final extension of 72ºC for 7 mins. This yielded a 361 base pair amplicon. However, independent of this project, the Mycoplasma Group (VLA Weybridge) have developed a molecular detection and identification method for Mycoplasma species using a PCR method where resulting PCR amplicons are separated by denaturing gradient gel electrophoresis (PCR/DGGE) (McAuliffe et al., 2003 & 2005). This method is slower than using a specific PCR, but offers the advantage of identifying any Mycoplasma species including mixed infections. Both of these methods have been used successfully following farm and abattoir visits undertaken as part of this project. During the project it was recorded that Mycoplasma arginini was sometimes present with MO in sheep with lung disease. Nasal swabs taken from sheep are the usual sample tested for MO, however we also found that MO was often isolated from the ears. Samples submitted to VLA (Weybridge) where MO has been detected include udder ulcers and milk samples, an indication of the diverse habitat of the organism. In addition to molecular detection and identification methods it is still required to grow MO for several reasons, which includes further analysis of isolates for molecular typing, antimicrobial testing, autogenous vaccine

SID 5 (2/05) Page 5 of 19

production, or research into virulence / pathogenicity factors. Development of a specific medium for growing MO, giving increased yields of organism, free of animal proteins, for use in a vaccine is described later.

Immunocytohistochemistry

Once an animal has died, then other diagnostic methods including gross pathology, histology and immunocytohistochemistry (ICC) can be used. The gross pathology of disease caused by MO is well described as causing ‘typical’ enzootic pneumonia, with regions of consolidation and lung collapse.

Lung showing dorsal and ventral lobes severely affected by Mycoplasma ovipneumoniae with areas of red consolidation and collapse.

Picture courtesy of H. Thompson, Glasgow University Veterinary School

However the exact role of MO in disease, its location in the lung is not well defined, hence this projects development of ICC to specifically detect MO in the lungs. This work was carried out by a collaborator at VSD, Stormont, Northern Ireland. Several rabbit antisera against MO have been tested on sections of lung from which MO had been isolated. After initial screening one of the antiserum was selected for further work as it demonstrated clear staining on the surface of the bronchioles. However, this serum also showed some cytoplasmic staining of the neutrophils which may be non-specific. Various modifications in the staining procedures have been examined to establish this. MO antiserum using a Triton X-114 extract of MO cells which consists largely of the hydrophobic membrane proteins was prepared as this has previously been demonstrated to give more specific staining with other mycoplasma species. In addition a monoclonal antibody was tested. The optimised method is as follows: Sections (4µm) were cut from the paraffin wax blocks and placed on silane-coated slides. The sections were heated at 60oC for 1 hour, deparaffinised in xylene and taken to alcohol. Endogenous peroxidase activity was blocked with hydrogen peroxide (0.5%) in methanol for 30 minutes. The sections were then treated for 5 minutes with 0.1% Protease type XIV (Sigma) in TBS (5mM Tris buffered saline; pH 7.6). After washing in TBS, the sections were mounted in a Sequenza Immunostaining Centre (Shandon Scientific Ltd., Cheshire, UK) for the incubation steps that were done at 37oC. A blocking step, using 2% normal goat serum diluted in TBS for 30minutes, was followed by overnight incubation with the primary antibody diluted in TBS. (rabbit polyclonal antiserum 774; 1: 100 dilution). Sections were then washed in TBS and incubated for 30 minutes with a biotinylated goat anti-rabbit immunoglobulin solution (Vectastain ABC Rabbit kit, Vector Laboratories Ltd., Peterborough, UK.) diluted 0.5% in TBS with added 2% normal goat serum. After a further wash in TBS, the sections were incubated for 30 minutes with avidin-biotin-peroxidase complex (Vectastain ABC kit) diluted in 0.1M carbonate buffer (pH 9.4). The slides were finally washed with TBS, removed from the Sequenza system and the reaction was developed with 3’,3-diaminobenzidine substrate (DAB Substrate kit, Vector Laboratories Ltd.). The sections were then counterstained with Harris’s haematoxylin (Clintech), dehydrated in alcohol, cleared in xylene and mounted with DPX mounting medium. Immunolabelling was also carried out using the ChemMate Dako Envision™ detection kit (DakoCytomation Ltd., Bucks, UK). This procedure was carried out in accordance with the manufacturer’s directions. Use of this method usually resulted in slightly more intense labelling than that utilising the Vectastain ABC kit, although there was a slightly higher level of non-specific background labelling. Replacement of primary antibody by TBS, normal rabbit serum or inappropriate antibodies constituted negative control procedures. Pneumonic bovine lungs naturally infected with Mycoplasma bovis, sheep lungs infected with Mannheimia haemolytica, normal lung tissue and mammary gland tissue infected with Histophilus somnus were used as negative control material.

SID 5 (2/05) Page 6 of 19

Immunocytohistochemistry for Mycoplasma ovipneumoniae showing the brown stained in the bronchiole airways of lung tissue.

The ICC, using a specific stain clearly shows MO antigen in the bronchioles of the lung, indicating that an MO infection causes substantial damage to the lungs. In addition to the MO work an M. arginini specific polyclonal rabbit antiserum was used for ICC and showed similar specific results for M. arginini indicating its role as a pathogen, whereas it was previously thought to be a commensal. This method was used on a number of lung samples from the field but specifically on samples from an abattoir and a vaccine trial, the specific results are given later.

Media development

This work was carried out by collaborators at Kingston University. MO is difficult to culture and grow in the shortest time span in vitro. Mycoplasmas are generally grown in complex media containing high concentrations of serum and energy sources. Even in such complex media, growth rates and yields are typically low and broth cultures of many mycoplasmas do not reach visible turbidity. In this study we considered adaptations to Eaton’s medium, which is routinely used by the VLA to grow MO for routine detection. Eaton’s medium contains PPLO broth base (ruminant protein source), glucose, horse serum, fresh yeast extract, DNA and a source of antibiotics. The aim was to facilitate increased growth yields in the shortest amount of time and to remove the ruminant protein source (PPLO broth base) and replace it with a vegetable peptone source to allow future investigation into vaccine production.

Initial studies involved production of over 60 different media formulations based upon supplementation and/or replacement of components of Eaton’s medium. The initial studies showed that 6 different peptone sources supported the growth of MO to levels comparable to those seen with other Mycoplasma species. The 6 peptone sources were subsequently incorporated into new media formulations and used for the studies in order to characterise a growth medium and were tested against each other using strain 222SR03. Further studies replaced glucose in Eaton’s medium with 5 different sugars, fructose, sucrose, mannose, maltose and lactose at both 10g/L and 5g/L and then comparing growth of strain 222SR03 in media with different sugars, to determine which sugar would act as best energy source in a growth medium. A final primary screen compared horse serum and porcine serum at 20% v/v concentration.

The results indicated that, all 7 peptone sources including PPLO broth supported the growth of MO, lactose at 10g/L provided a slightly better energy source than the other sugars. Porcine serum supported a higher growth yield than horse serum. Thus a media comprising of the best peptone source, tryptone soya broth, lactose, porcine serum and fresh yeast extract (TSB-1) was included in these studies. A combination of 2 sugars, glucose and lactose at 5g/L was also included into the studies and referred to as TSB B. All 9 media formulations were compared using 17 different field strains. Growth was measured by determination of viable counts (cfu/ml) every 24 hours over a 72 hour period. The formulations of the media to be characterised are detailed in the table below.

SID 5 (2/05) Page 7 of 19

Media Name

Peptone Source(g/L) Sugar (g/L) Serum (ml/L) Fresh Yeast Extract (ml/L)

Eaton’s PPLO Broth (21) Glucose (10) Horse (200) 100VP-1 Vegetable Peptone 1 (20) Glucose (10) Horse (200) 100SL72 Special Peptone L-72 (30) Glucose (10) Horse (200) 100TSB Tryptone Soya Broth (30) Glucose (10) Horse (200) 100BP Bacteriological Peptone (30) Glucose (10) Horse (200) 100

NSP Neutralised Soya Peptone (21) Glucose (10) Horse (200) 100Tryp. Tryptose (25) Glucose (10) Horse (200) 100

TSB-1 Tryptone Soya Broth (30) Lactose (10) Porcine (200) 100TSB-B Tryptone Soya Broth (30) Glucose (5)

Lactose (5)Porcine (200) 100

Results of studies on media formulations

After 24 hours incubation the mean cfu/ml showed a substantial increase with all 17 strains. At this stage the mean cfu/ml ranged from 3 x 108 – 2 x 109 cfu/ml. It is clear that the novel media formulation TSB-1 media supported the growth of all the strains to a level in excess of 1x109 cfu/ml. This represents a significant increase in cell number in a 24 hour time period compared with the other media variations tested. A further point of interest and note is that the TSB-1 media is devoid of ruminant protein, containing tryptone soya broth as a peptone source and porcine sera as a serum source. This therefore represents the potential for the media to be employed as a potential ‘safe’ vaccine strain growth media.

It is notable that the cell yield observed at 24 hours decreases at 48 and 72 hours. Comparatively poor yields were observed with TSBB which contained the two sugar sources. Further studies compared the six sugars glucose, fructose, sucrose, mannose, maltose and lactose at 10g/L in TSB-1. These results showed that 2 sugars, glucose and lactose were comparable to each other. With glucose the average yield for all 17 strains after 72 hours was 1.4 x 109 cfu/ml whilst lactose yielded an average of 1.5 x 109 cfu/ml. On the basis of these observations TSBB was formulated, containing both lactose and glucose as carbon sources. Despite earlier observations indicating a slight increase in cell yield with either lactose or glucose, subsequent studies incorporating both carbon sources showed somewhat unexpected results. Rather than the increase in cell number or possible synergistic increase in cell number that might be expected there was a definite decrease in cell number.

The growth yield data indicates that TSB-1 medium represents an improved medium for the detection, isolation and maintenance of M. ovipneumoniae. However, it was observed that the 17 strains tended to grow at different rates which varied with the different media, suggesting that there may be some degree of variability within strains of MO. The removal of ruminant protein from the media formulation represents an important stage in the development of a safe and efficacious vaccine production media.

FUNDAMENTAL RESEARCH

In this aspect of work factors such as protein variation, molecular variation, substrate utilisation were studied.

Immunoblotting

Immunoblotting (IBT) methods are frequently used for confirmation of disease diagnosis, when a less specific test has been used for preliminary diagnosis, such as with contagious bovine pleuropneumonia caused by Mycoplasma mycoides subsp. mycoides SC (MmmSC) where the detection of five key proteins by IBT is essential for diagnosis. Here we investigated a range of serum and strains by IBT. Immediately apparent is the variation in proteins expressed by MO and the different antigens recognised by the host’s immune system. The presence of variable surface proteins (vsp’s) has not previously been described for MO but they are recognised in many Mycoplasma species. Vsp’s have raised much debate about how they help the organism evade the host’s immune system and how detection methods and vaccines will require multiple strains to be effective. However, as shown with the ELISA method developed above, little variation was seen in titres when different strains were tested in by the ELISA method, perhaps indicating the significance of other stable proteins in causing disease. An IBT is shown demonstrating the presence of variable surface proteins.

SID 5 (2/05) Page 8 of 19

Immunoblot, using NCTC type strain Mycoplasma ovipneumoniae as antigen and tested against 11 different serum samples obtained from the field. Although many variations in proteins can be observed the arrow highlights an area where proteins are clearly variable.

Molecular Typing

Molecular typing methods used by the Mycoplasma Group (VLA) were applied to the isolates of MO. These methods included pulsed field gel electrophoresis (PFGE), random amplified polymorphism DNA (RAPD) using two different primers. Details of methods used are in McAuliffe et al. (2004). These results are shown on the next page, comparing the three methods used and showing a composite dendrogram. This clearly demonstrates the enormous diversity in the molecular composition of MO. Duplicate tests gave almost identical results and often isolates from the same farm gave similar, if not identical molecular profiles. It is clear that the molecular composition of MO is very diverse with differences at the 40% level on the dendogram. The isolates all originated from cases where MO was a disease problem, so the mechanisms for MO causing disease could also be very varied, or alternatively not related to this diverse molecular variation

SID 5 (2/05) Page 9 of 19

Composite figure showing molecular typing of Mycoplasma ovipneumoniae using two RAPD methods and PFGE.

SID 5 (2/05) Page 10 of 19

100

959085807570656055504540RAPD RAPD hum1 PFGE

23 SR 0438 SR 0235 SR 04237 SR 03105 SR 01223 SR 03158 SR 0312 SR 029 SR 02221 SR 0342 SR 04225 SR 0311 SR 028 SR 02220 SR 03145 SR 0361 SR 02109 SR 0259 SR 027 SR 021 SR 0224 SR 02178 SR 04186 SR 04177 SR 04180 SR 04181 SR 04187 SR 04156 SR 03157 SR 0329 SR 04139 SR 03147 SR 03135 SR 0314 SR 04203 SR 03231 SR 0342 SR 0244 SR 02NCTC 1175 SR 04182 SR 04159 SR 03

Substrate utilisation

The range of substrates metabolised by the fermentative mycoplasmas is restricted and species dependent (Miles, 1992). This suggests that within the fermentative group of mycoplasmas there may a degree of variability in regards to substrate utilisation and particularly with sugar metabolism. Substrate utilisation studies were carried out on a range of MO isolates using the method described by Miles and Agbanyim (1998). The substrates tested included the sugars: glucose, fructose, mannose, maltose, sucrose, lactose, fucose and N-acetyl-glucosamine; the alcohols isopropanol, propanol and ethanol and the organic acids pyruvate, lactate and 2-oxybutyrate were also tested. The main results are represented by four isolates and the results are summarised in the table below.

Isolate reference numbers6SR05 NCTC

10151222SR03 14SR05

Glucose 24.8 20.5 15.7 24.2Fructose 29.7 18.8 4.7 19.7Sucrose nd nd nd ndMaltose nd 7.5 nd ndMannose 37.4 11.0 6.9 25.6Lactose nd nd nd ndFucose nd nd nd ndN-acetylglucosamine 34.6 24.2 20.3 18.6Glycerol 25.8 21.2 21.4 42.8Isopropanol 7.9 12.1 12.6 6.7Propanol nd nd nd ndEthanol nd nd 5.7 ndPyruvate 17.2 15.0 12.0 23.1Lactate 36.7 nd 33.0 31.52 -oxybutyrate 5.7 nd 7.7 nd

Representative data detailing the substrate utilisations rates (Δ DOT/unit time) of strains of Mycoplasma ovipneumoniae. (nd= not detected)

These studies have shown that MO is able to utilise substrate concentrations as low as 0.1% effectively. It is noticeable the variation in substrate utilisation, for example, ethanol (0.1%) is only metabolised by 222SR03, and then at quite a low rate. Conversely, lactate is utilised at a similar rate by the field strains but not the NCTC 10151 strain. A similar observations can also be made with 2-oxybutyrate with NCTC 10151 and 15SR05 showing no utilisation of the substrate. Even when all strains utilise the presented substrate variation in levels of use can be readily observed. Using the example of the glycerol substrate, three strains 6SR05, NCTC10151 and 222SR03 all utilise this substrate at a similar rate (mean Δ DOT/unit time of 22.8). This is in contrast to 14SR05 which shows an increased mean Δ DOT/unit time of 42.8. These observations highlight the variability that exists in this species group.

From the examination of the sugar metabolism, it can be observed that lactose is not used at the 0.1% level and incremental increases in concentration up to 10% also yielded no apparent metabolism. This is in contrast to the media formulation studies which clearly indicate that lactose is a preferable carbon source for the growth of MO strains. MO also metabolises some surprising substrates such as isopropanol, with all strains in this study metabolising isopropanol at the 0.1% level, but this was not the case for all the alcohols included in the study. It is well known that mycoplasmas are minimalists and nutritionally exacting, it would therefore be expected that the majority of their metabolic processes would lead to the production of ATP or at least play a role in energy production. The role of isopropanol is not clear, however it may be speculated that the metabolism of these alcohol substrates may have more to do with downstream lipid production / metabolism for incorporation into cellular structures such as membranes. Lipid metabolism may of course be especially important to Mycoplasma species in relation to the maintenance of cellular integrity.

Hydrogen peroxide production

It has been shown that some Mycoplasma species produce hydrogen peroxide during glucose or glycerol oxidation. The production of hydrogen peroxide in vitro by M. pneumoniae and MmmSC has led to speculation concerning the role of oxidative damage in pathogenesis. No previous studies have investigated the production of hydrogen peroxide by MO. The relative rates of oxygen uptake and amounts of hydrogen peroxide produced by lysed MO cells was determined by measuring dissolved oxygen tension (DOT) following the addition of catalase.

The method used for growth and preparation of cell suspensions was adapted from that described by Miles et al, (1998). The TSB-1 media, developed for this project was dispensed into 10ml aliquots and inoculated with 1ml of organisms and incubated at 37ºC for 24-72 hours. 7ml of grown culture was transferred to 70ml of fresh warm media and incubated as before. All broth cultures were then harvested by centrifugation at 4000 g for

SID 5 (2/05) Page 11 of 19

10 minutes and then washed in 5ml Ringer HEPES buffer, this was repeated twice and the pelleted cells were then resuspended in 1-5ml of the same buffer. Aliquots of cell suspension (1ml) with optical density reading of 0.8-1.0 OD units and corresponding to 100-300μg of cell protein, were added to the electrode vessel. Oxidation of NADH (2Mm) and GP (2.5Mm) was determined in cells lysed with Triton X-100 (5 μl/ml of cell suspension) immediately before the addition of substrate. Rates of oxygen uptake were determined from the gradients of Dissolved Oxygen Tension (DOT) versus time. Catalase (400 U in 5μl) was added after substrate oxidation was complete. Hydrogen peroxide concentration was determined from an increase in DOT, following the addition of catalase. The results are given in the table below.

Determination of hydrogen peroxide production by strains of M. ovipneumoniae following either NADH or GP oxidation (ND – Not Detected).

STRAIN Avg. H2O2 Productionof O2 uptake (mol/Mol)

Avg. NADH Oxidation

(nmol/min/mg of protein)

Avg. α-GP Oxidation

(nmol/min/mg of protein)

41F04 4.81 0.85 ND73SR05 6.6 0.78 ND175SR04 3.60 0.99 ND140SR04 3.71 2.42 NDNCTC 10151 3.49 2.83 ND133SR04 4.54 2.10 ND220SR03 5.0 1.12 ND14SR05 4.5 1.79 ND6SR05 5.11 1.83 ND60SR04 5.60 0.95 ND177SR04 4.92 2.48 ND215SR03 4.21 2.23 NDKU3 5.01 0.92 ND182SR04 4.39 1.20 ND186SR04 4.73 1.43 NDKU5 5.71 1.65 ND222SR03 1.89 1.72 1.312L 1.27 2.73 1.683L 4.04 2.07 ND

The results show that most strains produce a relatively high level of hydrogen peroxide production following a comparatively low rate of NADH oxidation. It is notable that only two strains (222SR03 and 2L) showed low levels of hydrogen peroxide production. The abattoir strain, 2L showed only 1.27 mol/Mol, whilst the second abattoir strain, 3L showed much higher levels of hydrogen peroxide production 4.04mol/Mol. It was initially hypothesised that as hydrogen peroxide is reported as a putative virulence factor and that the abattoir strains were recovered from apparently disease free animals the levels of virulence factors detected would be low. However, the data shows variance in the levels observed. This data suggests that hydrogen peroxide may play an important role in causing respiratory disease in sheep and goats. The amount of hydrogen peroxide produced will not only contribute to the pathology commensurate with this infection (lung consolidation and tissue damage) but may also predispose the animal to invasion by other pathogens.

Detection of Capsular Material

Capsular material is well known to be an important factor in both immunogenicity and binding. Niang et al., (1998), have already established the presence of capsular material on strains of MO and describe its possible role in attachment.

SID 5 (2/05) Page 12 of 19

DISEASE INVESTIGATIONS AND CONTROL

Abattoir Investigation

An abattoir in the Oxford area was visited to investigate the occurrence of MO. During the investigation 25 sheep had nasal swabs and lung samples taken for culture, PCR, and PCR/DGGE and ICC testing. The testing was carried out anonymously, so the source of sheep was not known, but 4 or 5 sheep were tested in a batch, so the sheep probably came from 5 or 6 different farms. Of the 25 sheep tested only one lung sample showed typical gross pathology consistent with MO (see picture below).

Lung showing gross pathology, on right ventral lobe consistent with Mycoplasma ovipneumoniae infection

However, MO was recovered from all the nasal swabs and lung tissue taken. ICC results were positive for this sample (number 16) and just one other (number 3) where a small number of organisms were labelled in the airway. Lungworm lesions were present in one sample (1) and sample 7 had histology typical of bronchopneumonia, but with no labelling for MO. Six samples had a parasite like structure in the alveoli.

Farm visits

Several farms where MO had been reported were visited, mainly with the aim to find a suitable farm where an antimicrobial or vaccine trial could be undertaken. Many farms were either too large, or too small, or had expensive pure bred sheep or even rare breeds. However, two farms, (1 ADAS farm) were selected for treatment with antimicrobials and the ADAS farm was also used to test a vaccine. Details are given later.

SID 5 (2/05) Page 13 of 19

In vitro antimicrobial susceptibilities.

The minimum inhibition concentration values for 27 MO isolates were determined against 20 different antimicrobials using the methods described by Ayling et al. (2000). The MIC50, MIC min and max results are given in the table below.

In vitro the most effective antimicrobials are the newer fluoroquinolones; enrofloxacin and danofloxacin. The more widely used oxytetracycline also appears effective, although the maximum MIC was 8µg/ml, possibly indicating the development of antimicrobial resistance by some isolates. Although no breakpoints are described for mycoplasmas against these antimicrobials, it is apparent that some isolates have developed antimicrobial resistance to tylosin, norfloxacin, tilmicosin, chloramphenicol, spectiniomycin, gentamycin and tobramycin. Other antimicrobials such as erythromycin, naladixic acid, rifampin, amikacin, streptomycin and cephalothin are clearly not effective in vitro and are therefore unlikely to be effective in vivo.

Antimicrobial use in vivo

Danofloxacin (marketed as Advocin, Pfizer Ltd) was selected as the antimicrobial most likely to be effective based on the in vitro susceptibility test results. This is a newer fluoroquinolone and was not licensed for use against mycoplasma in sheep and therefore had to be given under veterinary instruction.

Farm 1.

This farm (near Shaftesbury) had a large organic milking flock and had a problem with MO infections spanning a few years. Whilst it had organic status, the farmer considered the problem serious enough to use antimicrobials. The use of danofloxacin, combined with selective culling has reduced the MO problem to a manageable level. However, useful scientific data from this investigation is sparse.

Farm 2 (ADAS Farm).

This farm is a high health status sheep flock having bought in sheep from New Zealand that are free of scrapie. However, this high health status does not extend to several other diseases and MO is one of the disease problems in the flock. The flock has been regularly vaccinated against Mannheimia haemolytica since its formation in 1998. In the first few years several cheviots died of unilateral pleurisy / pneumoinia. The incidence of respiratory disease in 2000 was relatively low, possibly due to a move to a more spacious site, but any clinical cases were treated with oxytetracycline. In July 2000 a second import of sheep bought in numerous diseases including caseous lymphadenitis, border disease, Chabertia, nasal bot flies and probably the MO infection. This introduction of sheep also resulted in overcrowding and an increase in respiratory cases, disproportionately higher in cheviots, with nearly a 25% infection rate. Treatment with a potentiated sulphonamide gave poor results. MO was isolated from these cases. Mannheimia vaccination was increased to 3 treatments in 2002, and clinical cases were treated with clamoxyl RTU. The cheviot infections and losses were high.

SID 5 (2/05) Page 14 of 19

The use of Advocin 180 (danofloxacin) in 2003 reduced the number of clinical cases and the response to treatment improved (as measured by deaths). The same procedure was used in 2004, but the clinical results appeared less effective, but deaths following treatment were proportionally lower. Interestingly if the Suffolk breed of sheep became clinically ill their response was poor, but few ever showed clinical signs.

To try and eliminate MO at an early age, groups were blanket treated with Advocin A180 at 7 days at the same time as the 1st Mannheimia vaccination was administered. Results suggested there were less clinical cases, but still a fairly high level of euthanasis or death due to pneumonia. The shepherd’s comments are that they believe Advocin 180 gives the best results and even quite severely compromised lambs make a good clinical recovery. One unsubstantiated comment of interest from the shepherd is that the Dorset and Suffolk breeds appear less susceptible to MO than the Cheviots. However, from the data in the table below it could be interpreted that cheviots respond better to treatment than Suffolks. However many variables exist and this may be related to how the disease presents itself in the different breeds, it is possible that clinical signs are clearer in Cheviots and they therefore get treated at an earlier stage and therefore appear to respond to treatment better.

Summary of deaths due to respiratory stress in lambing groups (ADAS farm).Year Breed Numbers

of lambsNumber treated for respiratory stress

Number died or euthanased due to respiratory distress

1999 Dorset 22 2 (9.1%) 1 (4.5%)Suffolk 12 2 (16.6%) 0 (0.0%)Cheviot 37 4 (10.8%) 1 (2.7%)

2000 Dorset 83 4 (4.8%) 1 (1.2%)Suffolk 0 0 0Cheviot 6 0 (0.0%) 0 (0.0%)

2001 Dorset 56 2 (3.6%) 0 (0.0%)Suffolk 49 1 (2.0%) 1 (2.0%)Cheviot 39 10 (25.6%) 3 (7.7%)

2002 Dorset 2 1 (50.0%) 1 (50.0%)Suffolk 0 0 0Cheviot 106 16 (15.1%) 6 (5.7%)

2003* Dorset 12 3 (25%) 0 (0.0%0Suffolk 0 0 0Cheviot 106 10 (9.4%) 2 (1.9%)

2004* Dorset 12 2 (16.7%) 0 (0.0%)Suffolk 16 5 (31.3%) 5 (31.3%)Cheviot 111 23 (20.7%) 5 (4.5%)

2005** Dorset 9 0 (0.0%) 0 (0.0%)Suffolk 31 1 (3.2%) 1 (3.2%)Cheviot 90 15 (16.7%) 4 (4.4%)

*Advocin used to treat respiratory distress** Advocin given as a blanket treatment then used as required.

Vaccine

When this project was designed, the Mycoplasma Group (VLA) had developed a vaccine for Mycoplasma bovis (Nicholas et al., 2000) based on an inactivated whole cell. It was believed a similar approach for MO could be used. Indeed the experience of the M. bovis vaccine and autogenous vaccine trial was beneficial to the work done in this project. Following vaccine safety tests and inspection of the vaccine production facilities the Veterinary Medicines Directorate approved the use of an autogenous vaccine in a herd of beef cattle with M. bovis respiratory problems. The beef herd had previously resorted to using in feed antimicrobials to reduce respiratory disease and deaths. Withdrawal of in feed antibiotics and a single treatment with M. bovis vaccine appeared to control the mycoplasma infection. However, the animals required more specific antimicrobial treatment for other infections. The M. bovis vaccine is undoubtedly successful. In contrast a similar preparation was made for MmmSC and tested in Namibia, where CBPP is a problem and this preparation along with others being trialled at the same time exacerbated the disease (Nicholas et al., 2004). One possible explanation for this exacerbation of disease is that the carbohydrate capsule of MmmSC mimics the glycogen of the bovine lung causing an autoimmune response. M. bovis does not have a capsule layer, however a capsule on MO has recently been described (Niang et al., 1998) which means a similar exacerbation effect may occur. An experiment was therefore designed using two vaccine preparations. MO vaccine A was a whole cell preparation treated with saponin, which makes small holes in the organism’s cell membrane effectively killing it, but leaving the membrane virtually intact. The saponin also acts as an adjuvant. The second preparation (MO vaccine B) was whole cells treated with tween 20, which removes some of the surface and capsule layer, followed by saponin treatment.

The experiment was designed so that safety information, antibody response and possible effect of a natural infection could be observed. Two six week old Suffolk sheep were vaccinated with 1ml of vaccine A, two

SID 5 (2/05) Page 15 of 19

with 1ml of vaccine B and two left as untreated controls. The work was carried out at the ADAS farm where MO respiratory infections occur, giving the possibility of a natural MO challenge.

No adverse reaction to the inoculation was observed immediately or by day 1. At day 3, three of the vaccinated lambs had small swellings of less than 5mm at the site of inoculation and the fourth lamb a very small raised area was observed at day 7, which increased to 5mm by day 9 post inoculation. These minor reactions were not significant and soon disappeared. Antibody responses were measured by ELISA and by Immunoblot. The ELISA titres were generally low, but differences between vaccinated and unvaccinated animals were distinct. See table below.

  Day 0 Week 1 Week 2 Week 3 Week 4 Week 5 Week 8 Week 12285 control 0.15 0.04 0.04 0.05 0.06 0.04 0.04 0.02297 control 0.15 0.03 0.05 0.04 0.05 0.05 0.12 0.21286 A 0.14 0.11 0.11 0.11 0.10 0.11 0.14 0.05293 A 0.17 0.07 0.44 0.47 0.44 0.35 0.34 0.21318 B 0.13 0.04 0.12 0.27 0.46 0.78 0.63 0.27281 B 0.11 0.02 0.10 0.17 0.29 0.29 0.43 0.22

Vaccine B, appeared to give a stronger and prolonged ELISA titre than vaccine A. One of the control

animals (297) also showed an increase in titre at week 12, which may have been due to a natural MO infection challenge. Immunoblot results supported this observation.

Immunoblots for vaccinated animals against time, showing more intensity of staining for vaccine B and also prolonged antibody response for vaccine B in comparison with vaccine A.

At post-mortem, MO was detected in all animals. Gross lung pathology showed one control animal with typical MO lesions and the other control with normal healthy lung pathology. Vaccine A, both animals had very small areas of consolidation 3mm x 1mm and 30mm x 10mm respectively. Enterococcus species was isolated from one and Mannheimia haemolytica from the other. Vaccine B, one animal’s lung had pleural adhesions and a mottled granular lung that was not typical of an MO infection and Arcanobacterium pyogenes was isolated from this lung. The other vaccine B animal had a very small dark red spot on the right lobe of the lung. ICC results showed that the control animal (297) was MO positive with organism labelled in the airways and some intracytoplasmic labelled particles.

Both vaccines produced an immune response in sheep, although vaccine A appeared to give a weaker response, especially in one animal. The sheep appear to have had a natural exposure to infection as one of the control animals was affected by MO. It is apparent that neither vaccine exacerbated infection. Although numbers

SID 5 (2/05) Page 16 of 19

281B 318B 286A 293A

are small, it also shows that the vaccines, particularly vaccine B has the potential to protect sheep against disease caused by MO. However, it is also apparent that a number of organisms are associated with respiratory disease and even though these sheep were vaccinated against Mannheimia haemolytica one sheep was affected by that organism.

Future Work

Knowledge of the occurrence of MO and MO disease, and the related economic losses in the UK would be beneficial in establishing the requirements for its control. It is clear that affected farms face serious economic losses. Developing methods of control are therefore important. It has been demonstrated in this study that treatment with danofloxacin does improve disease control; however the cost of this treatment would prevent its routine use on many farms. Early detection of clinical disease, and therefore early treatment would improve the effectiveness of antimicrobial treatment. However the use of fluoroquinolones and the risk of developing antimicrobial resistance make their widespread and long term use inadvisable. Therefore strategic and effective treatment regimes need developing. However this does mean development of a vaccine is an essential requirement to control MO disease. This study has shown that a ‘relatively crude’ vaccine is safe and may offer some protection. However further work is required before it would be of commercial interest.

An improved understanding of the evasive and disease causing mechanisms used by MO would help in not only understanding the disease but also in targeting areas for generating future MO vaccines. NMR spectroscopy could be employed to give a more detailed analysis of the processes underway during metabolism and the lipid and protein profiles of the individual strains could be determined providing valuable information not only from a substrate utilisation standpoint but also the biochemical composition of these diverse organisms.

SID 5 (2/05) Page 17 of 19

References to published material9. This section should be used to record links (hypertext links where possible) or references to other

published material generated by, or relating to this project.Publication resulting from this project.1. McAuliffe, L., Hatchell, F., Ayling, R. D., King, A., Nicholas, R. A. J. (2003). The detection of

Mycoplasma ovipneumoniae in vaccinated sheep flocks with respiratory disease in England. Veterinary Record. 153: 687-688.

2. Ayling, R. D. McAuliffe, L., Bisgaard-Frantzen, S., Bashiruddin, S., Miles, K., Nicholas, R. A. J. (2005). Mycoplasma ovipneumoniae: recent developments in diagnosis and the in vitro susceptibility to antimicrobials. Proceedings of 6th International Sheep Congress, Crete, 17-21st June 2005 p134-135.

3. Nicholas, R. A. J., Al-Momani, W., McAuliffe, L., Ayling, R. D., Abo-Shehada, M. N. (2005). A re-assessment of the mycoplasma flora of sheep. Proceedings of 6th International Sheep Congress, Crete, 17-21st June 2005 p258-259.

4. Patel, H., Mackintosh, D., Ayling, R., Nicholas, R. A. J., Fielder, M. D. (2005).The characterisation of a high yielding growth medium for Mycoplasma ovipneumoniae, a cause of atypical pneumonia in sheep and goats. Proceedings of 6th International Sheep Congress, Crete, 17-21st June 2005 p263-264.

5. Ball, H. J. Finlay, D., Brooks, C., Blackburn, Markey, B. (2005). The development of a capture / enrichment sandwich ELISA for the detection of Mycoplamsa ovipneumoniae in sheep pneumonia. Proceedings of 6th International Sheep Congress, Crete, 17-21st June 2005 p339-340.

References

Ayling, R. D., Baker, S. E., Peek, M. L., Simon, A. J., Nicholas, R. A. J. (2000). Comparison of in vitro activity of danofloxacin, florfenicol, oxytetracycline, spectinomycin and tilmicosin against recent field isolates of Mycoplasma bovis. Veterinary Record.146: 745-747.

McAuliffe, L., Ellis, R. J., Lawes, J. R., Ayling, R. D., Nicholas, R. A. J. (2005). 16S rDNA PCR and DGGE, a single generic test for detecting and differentiating Mycoplasma species. Journal of Medical Microbiology. 54: 1-9.

McAuliffe, L., Kokotovic, B., Ayling, R. D., Nicholas, R. A. J. (2004). Molecular epidemiological analysis of Mycoplasma bovis isolates from the UK shows two genetically distinct clusters. Journal of Clinical Microbiology. 42: 10. 4556-4565.

McAuliffe, L., Ellis, R. J., Ayling, R. D., Nicholas, R. A. J. (2003) Differentiation of Mycoplasma species by 16S rDNA PCR and DGGE fingerprinting. Journal of Clinical Microbiology. 41:10, 4844-4847.

McAuliffe, L., Hatchell, F., Ayling, R. D., King, A., Nicholas, R. A. J. (2003). The detection of Mycoplasma ovipneumoniae in vaccinated sheep flocks with respiratory disease in England. Veterinary Record. 153: 687-688.

Miles, R. J. (1992). Catabolism in mollicutes. Journal General Microbiology. 138: 1773-1783. Miles, R. J., Agbanyim, C. (1998). Determination of substrate utilization rates by mycoplasmas.

Methods in Molecular Biology. 104: 95-103. Niang, M., Rosenbusch, R. F., Andrews, J. J., Kaeberle, M. L. (1998). Demonstration of a capsule

on Mycoplasma ovipneumoniae. American Journal of Veterinary Research. 59: 557-562. Nicholas, R. A. J., Ayling, R. D., Stipkovits, L. P. (2002). An experimental vaccine for calf

pneumonia caused by Mycoplasma bovis: clinical, cultural, serological and pathological findings. Vaccine. 20: 3569-3575.

Nicholas, R. A. J., Tjipura-Zaire, G., Mbulu, R. S., Scacchia, M., Mettler, F., Frey, J., Abusugra, I., Huebschle, O. J. B. (2004). An inactivated whole cell vaccine and LppQ subunit vaccine appear to exacerbate the effects of CBPP in adult cattle. In: Towards sustainable CBPP control programmes for Africa., Third meeting, Rome 12-14 November 2003. FAO Rome 2004. pp91-97.

SID 5 (2/05) Page 18 of 19

SID 5 (2/05) Page 19 of 19