1

Gene Expression http://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowTOC&rid=mboc4.TOC&depth=2

  Prokaryotic   Translation is concurrent with

transcription   No barrier restricts movement of

transcript to translation apparatus   Single RNA polymerase

synthesizes all RNA species

  Eukaryotic   Transcript must be processed

  Capping, splicing, polyA addition   mRNA is sequestered as RNP in

the nucleus, must be transported to cytoplasm

  Genes are often split - coding sequence is not contiguous

  3 different RNA polymerases required to synthesize RNA classes

Polycistronic Transcripts

DNA

mRNA Polycistronic transcript multiple genes

Operon - gene cluster

Proteins perform a coordinated function

Examples: Carbohydrate degradation Amino acid biosynthesis

2

Eukaryotic Transcripts

  5’ 7-methylgaunosine cap structure   Post-transcriptional modification - after ~ 25 nucleotides   Prevents degradation by 5’ exonucleases   Helps in the export from the nucleus

  Poly-adenylated tail   Post-transcriptional modification   Helps in stability of the mRNA

Mature transcript

Kinetoplastid Transcription

3

Alternative Splicing   Discovered by D. Baltimore - immunoglobin heavy chain   Increases the diversity of protein repertoire   Improper alternative splicing can lead to disease

Cis-Splicing Mechanism

4

• Several steps in the splicing reaction require ATP

Splicing is mediated by the Spliceosome

Splicesome mediated - simplified

  Composed of snRNPs   Small nuclear ribonucleoprotein

  Small nuclear U-rich RNA (snRNA)   Each complexed with ~ 7 proteins

1.  U1 base-pairs with the 5’ splice-site 2.  U2 binds/pairs with the branch point; also pairs

with U6 in the assembled spliceosome 3.  U4 pairs with U6 in snRNPs, but releases during

spliceosome assembly 4.  U5 interacts with both exons (only 1-2 nt adjacent

to intron); helps bring exons together 5.  U6 displaces U1 at the 5’ splice-site (pairs with nt

in the intron); it also pairs with U2 in the catalytic center of the spliceosome

Highly simplified version

5

Trans-splicing: 1st discovered in trypanosomes

Gene A Gene B Gene C Gene D Gene E

DNA

Polycistronic transcript

AAAA

AAAA AAAA

AAAA

AAAA

SL RNA

No evidence of operons

Trans-splicing Polyadenylation

Individual mRNAs each with a SL and poly A tail

To date: ALL but 2 coding sequences are trans-spliced!

Comparison of cis- and trans-splicing

Lariat intermediate

Y-branch intermediate

transesterification

transesterification

Intramolecular Intermolecular

6

Comparison of Spliceosomes

New Technology - SMaRT   Defects in alternative splicing can lead to human disease   Use of artificial trans-splicing to “repair” and give rise to a

functional mRNA

www.intronn.com

Correcting at the pre-mRNA level!

Spliceosome-mediated RNA Trans-splicing

7

kDNA - organized in a disk structure

Kinetoplast

Kinetoplast is always associated with the flagellar basal body

kDNA

Nucleus

Mitochondrion

kDNA components

Two types of catenated ring circles

1.  Maxicircle: ~23kb, 25

•  Encode electron transport subunits.

•  Require extensive posttranscriptional editing

3.  Minicircle: 1kb, 5000

•  Heterogeneous, 250 classes

•  Encode guide RNAs. 500nm

500nm

kDNA network

Minicircle Maxicircle

kDNA is essential for the parasite survival

8

kDNA Replication Model

SSE1

?

Primase

UMSBP

kDNA disk

DNA ligase kβ

Pol β -PAK DNA Ligase kα

Topo II

DNA Pol β

Pol IC

Pol IB

Pol IA

Pol ID

kDNA repair?

recruitment?

What are the specialized roles?

Minicircle Replication

+

UMS

UMS

Unknown replicase proteins

Singly and Multiply Gapped Progeny

Leading (L) strand

Lagging (H) strand

UMSBP

9

kDNA Replication Model

Trypanosomatid Mitochondrial RNA editing

  Single mitochondrion   Unique mitochondrial DNA

  Catenated structure composed of mini- and maxicircles

  Size of molecules varies with species (15-80 kb) (1 - 2.5 kb)

  50 maxicircles/network   5000-10,000 minicircles/network   Minicircles were initially thought

to be nonfunctional, just a structural component

Maxicircle 20 kb

Minicircle 1 kb

10

Maxicircle sequence   Initial sequencing of the T. brucei maxicircles demonstrated that it

encoded apocytochrome b, subunits 1 and 2 of cytochrome c oxidase (cox) and some unassigned reading frames (MURFs) (some later turned out to be subunits of NADH dehydrogenase).

 However some pseudogene features – e.g. cox2 had a –1 frameshift and this was conserved between kinetoplastid species.

  Sequence determination of cox2 cDNA in 1984 showed an insertion at the precise position of the frameshift converting GA to UUGUAU.

  This wasn’t accepted at first – there were 50 maxicircles and maybe one had the difference or the gene was encoded in the nucleus.

  Extensive analysis showed no conventional cox2 genes existed in the nucleus or mitochondrion but a mechanism of adding in U’s was way too outlandish to be accepted at that time.

Maxicircle Sequence

  Sequencing of other mitochondrial cDNAs and their comparison to the genomic sequence showed not only the addition of U’s but also their deletion.

  In 1986 the first CAUTIOUS paper on a “co- or post-transcriptional nucleotide insertion process” was published (Benne et al.,1986 Cell 46, 819-826 - 18 page paper).

  Although the data showed deletion of one U, the authors didn’t dare to conclude that this form of editing could also occur.

 Other groups of investigators found similar editing processes and the number of edited trypanosomatid RNAs expanded.

  The mystery of missing AUG translational start codons was solved as these are provided by RNA editing by both addition and deletion of U’s

11

Mitochondrial RNA editing

*

**

** ** ****

***

***

****

***

**

*

*

*

** ** **

**

*** **

*** *

***

***

**

***** *

*** *

*** ********

******

**

*

**

*

Cell

Edited T. brucei ND7 mRNA

  Cryptic mRNAs produced   mRNA sequence DOES NOT exactly

correspond with genomic DNA sequence   Requires insertion of uridine residues

(u) or deletion (*) to create a functional ORF

  Extreme example is ND7   >90% of mRNA is edited

  Process is more active in procyclic form parasites

  Minicircles encode gRNAs (guide RNAs) that act as templates for insertion and deletion (1991)

  Process is essential (2001)   Demonstrated by gene silencing in

bloodstream form parasites

Maxicircle Comparison   Ribosomal RNA sequences ARE NOT edited

12

Insertional RNA editing

GCGGAGAAAAAAUGAAAUGUGUUGUCUUUUAAUG ::|:||||||||||||||:|||||||||||||3'-UUUUUUUUUUUUUACUUUAUACAACAGAAAAUUACppp5'

(A)n 5'

Edited mRNA Editing

GCGGAGAAAAAAGAAAGGGUCUUUUAAUG ::|:|||| ||:||||||||3'-UUUUUUUUUU CAGAAAAUUACppp5'

(A)n 5'

U U U A C U U U A

U A C A

A Guide RNA

Anchor Poly(U) tail

Primary transcript (Maxicircle encoded)

(Minicircle encoded)

Pan-editing of the L. tarentolae A6 mRNA

Precursor mRNA

Precursor mRNA

Precursor mRNA

Precursor mRNA

Edited mRNA

Edited mRNA

Edited mRNA

Edited mRNA

13

Mechanism of RNA Editing Insertion Deletion

RNA Editing Proteins

14

Mediated by Protein Complex

T. brucei Life Cycle =

non-dividing fuel=glucose

VSG coat mito=“low”

Bloodstream form dividing

fuel=glucose VSG coat

mito=“off”

non-dividing fuel=?

mVSG coat mito=?

Procyclic form dividing

fuel=amino acids Procyclin coat mito=“on”

Metabolicadaptation

15

Trypanosomatid Metabolism

  Cooperation among organelles for central metabolism

  Important Players   Glycosomes   Mitochondrion   Cytoplasm   Acidocalicosomes

Abundant microbodies = glycosome

Bloodstream form metabolism

Glycosomes   What?

  Microbody - single membrane   Divergent peroxisomes

  Peroxisomal metabolic diversity   Contains most enzymes of

glycolysis - unique   Low permeability of membrane

  When?   Not found in closest relative -

Euglena sp.   Why?

  Metabolic flexibility   How?

  Complicated - multiple mechanisms likely Purine salvage

Glycolysis

Glycosomes are essential for both BSF and Procyclics

BSF - 90% of proteins content is glycolytic

16

Bloodstream Form Metabolism   Most simplified form of metabolism in

trypanosomes   Glucose (sugars) are main source of

energy   Consumption and production of ATP is

balanced INSIDE the glycosome   Net ATP production occurs outside of

the glycosome   Major end-product - pyruvate   Hexokinase (1), Phosphofructokinase (3)

steps ARE NOT regulated   Pyruvate kinase IS regulated (12)   GPO/GAPDH shuttle - maintains redox

balance   Alternative Oxidase (CN- insensitive) * Pyruvate excreted in

host bloodstream

Procyclic Form Metabolism

  Previously, thought there was complete TCA cycle function.

  Aconitase Knockout cell lines - aconitase is non-essential!!

  Glucose and amino acids (Pro, Thr) as energy source

  End products - Succinate, Acetate, Alanine

  Phosphoglycerate kinase is now cytosolic.

  Incomplete TCA cycle - no complete oxidation to CO2

  Branched electron transport - classical Cytochrome oxidase + alternative oxidase

17

Added complexity   Anabolic functions as well

  Fatty acid synthesis   Gluconeogenesis

  Branched electron transport   Cytochrome oxidase

  Cyanide sensitive   Alternative oxidase

  Cyanide insensitive gluco- neogenesis

Fatty Acid Synthesis - Primer   Iterative elongation of

acyl chains   Growth of chain by 2 C

  Type I (Eukaryotic)   Multiple enzymatic

activities on a single large multifunctional protein

  Type II (Prokaryotic)   Each activity is on a

separate polypeptide

Dr. Kim Paul

18

The Fatty Acid Dilemma   BSF cannot incorporate [14C]-

acetate in FA.

  Parasite salvages FA, however free FA are not abundant in serum.

  Also enormous requirement for myristate (C14) for VSG GPI anchor structure.

  More classical Type II - synthesis of lipoic acid (α-keto DH complexes)

Third Mechanism - Elongation

19

Acidocalcisomes   What?

  Membrane bound - acidic compartment   Calcium storage   Polyphosphate storage

  When?   Multiple lineages contain these organelles   Trypanosomatids, Apicomplexans, fungi,

algae, bacteria   Mammals lack these organelles!

  Why?   Potential role is for response to

environmental stress   Additional production of energy

Storage and Energy Generation?

20

RNAi in protist parasites   Comparative biology reveals RNAi machinery in only a subset of

protozoan parasites