Functional polymorphism in the EpCAM gene is associatedwith occurrence and advanced disease status of cervical cancerin Chinese population

Min Hu • Lan Jian • Liyuan Zhang •

Jiang Zheng • Yonghe You • Jieqiong Deng •

Hua Li • Yifeng Zhou

Received: 23 June 2011 / Accepted: 24 January 2012 / Published online: 10 February 2012

� Springer Science+Business Media B.V. 2012

Abstract The epithelial cell adhesion molecule (EpCAM)

was originally identified as a tumor associated antigen,

attributable to its high expression on rapidly proliferating

tumors of epithelial origin. EpCAM plays vital roles in car-

cinogenesis, tumor progression and metastasis in most

tumors. A non-synonymous polymorphism (rs1126497 C/T)

was found in exon 3 of EpCAM, which cause a transition from

115 Met to 115 Thr. Another polymorphism (rs1421 A/G) in

the 30UTR causes loss of has-miR-1183 binding. We per-

formed a multiple independent case–control analysis to assess

the association between EpCAM genotypes and cervical

cancer risk. Genotyping a total of 518 patients with cervical

cancer and 723 control subjects in a Chinese population, we

observed that the variant EpCAM genotypes (rs1126497 CT,

and TT) were associated with substantially increased risk of

cervical cancer. Compared with the rs1126497 CC genotype,

CT genotype had a significantly increased risk of cervical

cancer (Crude OR = 1.70; 95% CI = 1.33–2.20; adjusted

OR = 1.72; 95% CI = 1.33–2.22), the TT carriers had a

further increased risk of cervical cancer (Crude OR = 1.94;

95% CI = 1.01–3.72; adjusted OR = 1.96; 95%CI =

1.01–3.81), and there was a trend for an allele dose effect on

risk of cervical cancer (P \ 0.001). Moreover, the allele T

increases the risk for invasive disease or metastatic disease,

compared with C allele. However, there exists no significant

difference in genotype frequencies of rs1421 A/G site

between cases and controls (P = 0.798). These findings

suggest that rs1126497 C/T polymorphism in EpCAM may be

a genetic modifier for developing cervical cancer.

Keywords Cervical cancer � Molecular epidemiology �EpCAM � Polymorphism

Abbreviations

CI Confidence interval

OR Odds ratio

EpCAM Epithelial cell adhesion molecule

MAF Minor allele frequency

SNP Single nucleotide polymorphism

Introduction

In worldwide, about 20 million women die from cervical

cancer every year, making it the top one gynecological

cancer. Some etiological factors have been established for

cervical cancer. Human papilloma virus (HPV) infection

Min Hu, Lan Jiang and Liyuan Zhang have contributed equally to this

work.

M. Hu

Department of Obstetrics and Gynecology, The Second

Affiliated Hospital of Soochow University, San Xiang Road

No. 1055, Suzhou 215004, People’s Republic of China

L. Jian � J. Zheng � Y. You � J. Deng � Y. Zhou (&)

Soochow University Laboratory of Cancer Molecular Genetics,

Medical College of Soochow University, Suzhou 215123,

People’s Republic of China

e-mail: zhouyifeng@suda.edu.cn

L. Zhang

Department of Radiotherapy and Oncology, The Second

Affiliated Hospital of Soochow University, San Xiang Road

No. 1055, Suzhou 215004, People’s Republic of China

H. Li (&)

Department of Obstetrics and Gynecology, Third Hospital,

Peking University, Beijing 100191, People’s Republic of China

e-mail: hua.li75@gmail.com

123

Mol Biol Rep (2012) 39:7303–7309

DOI 10.1007/s11033-012-1560-9

has been shown to be a necessary factor in the development

of cervical cancer [1, 2]. HPV DNA can be detected in

virtually all cases of cervical cancer [3]. Besides, several

other contributing factors have been implicated including

smoking, HIV infection, chlamydia infection, stress and

stress-related disorders, dietary factors, hormonal contra-

ception, multiple pregnancies, exposure to the hormonal

drug diethylstilbestrol, and family history of cervical can-

cer (America Cancer Society, 2007). Early age at first

intercourse and first pregnancy are also considered as risk

factors, magnified by early use of oral contraceptives[4].

EpCAM, also known as EGP40 and CD326, has been

mapped to chromosome 2p21, coding a glycosylated,

30–40 kDa type I membrane protein of 314 amino acids [5].

It is reported to be highly expressed in most tumors to

varying degrees [6]. Besides cell adhesion, EpCAM is also

involved in other biological functions including signal

transduction, cell proliferation, differentiation and tissue

regeneration [7]. Munz et al. [8] reported that overexpres-

sion of EpCAM up-regulated c-myc and cyclin A, acceler-

ated cell cycle and promoted cell proliferation. Osta et al.

[9]. and Yanamoto et al. [10] proved that tumor cells with

high expression of EpCAM possessed high proliferation and

invasive activity. Conversely, reduced EpCAM expression

by RNA interference significantly inhibits tumor cell pro-

liferation and invasiveness. Also, Trzpis et al. [11] found

that EpCAM expression was significantly increased in the

regeneration of ischemic renal injury. Litvinov et al. [12]

established a role of EpCAM in women cervical cancer;

they found that increased expression of EpCAM correlates

with progressive transformation in intraepithelial neoplasia.

As we know, cancers always arise from a series of

sequential mutations that occur as a result of genetic

instabilities and/or environmental factors [13, 14], since

EpCAM plays such a pivotal role in tumorigenesis

including cervical cancer development, so we hypothesize

that polymorphisms of EpCAM gene may be associated

with varying risk of cervical cancer.

In our present study, two functional polymorphisms of

EpCAM with suitable frequency in Asian population were

selected from the NCBI SNP database to evaluate their

contribution to the risk of developing cervical cancer. One

of them is a non-synonymous polymorphism (rs1126497

C/T) in exon 3 of EpCAM gene, leading to a transition from

115 Met to 115 Thr which may induce alteration of Ep-

CAM structure and consequently function of the protein.

The other is an A/G polymorphism (rs1421) in the 30UTR

of EpCAM. The conversion from A to G of rs1421 poly-

morphism may cause loss of a has-miR-1183 binding site

and cause new combination of micro-RNA has-miR-370

and has-miR-517a, which may affect the translation of

EpCAM mRNA and possibly be influential to function of

EpCAM. To our best knowledge, no published research

article has investigated the association between these two

polymorphisms and cervical cancer risk. Since, neverthe-

less, these polymorphisms may theoretically affect the

function of EpCAM and this gene plays an important role

in cervical cancer development, the rs1126497C/T and

rs1421A/G polymorphisms might impact individual sus-

ceptibility to cervical cancer. Based on this hypothesis, we

carried out a hospital-based, case–control study to inves-

tigate the relation between polymorphisms in EpCAM and

risk of cervical cancer in a Chinese population.

Materials and methods

Study subjects

All the subjects in this study were ethnically homogenous

Han Chinese, patients with newly diagnosed cervical can-

cer (n = 518) were consecutively recruited from June 2005

to March 2009 at urban hospitals [i.e., The First Affiliated

Hospital of Soochow University (Suzhou), The Second

Affiliated Hospital of Soochow University (Suzhou) and

The No. 4 Hospital of Wuxi]. All the eligible patients

diagnosed at the hospital during the study period were

recruited, with a response rate of 92%. Patients were from

Suzhou city and its surrounding regions, and there were no

age, stage, and histology restrictions. The tumor grade and

clinical stage were evaluated according to the WHO clas-

sification and the International Federation of Gynecology

and Obstetrics classification (1995), respectively. The

clinical features of the patients are summarized in Table 1.

Population controls were cancer-free people living in

Suzhou region; they were selected from a nutritional sur-

vey conducted in the same period as the cases were col-

lected [15, 16]. The selection criteria included no history of

cancer and frequency matched to cases on age. Mean age

was 44 years for case patients, and 45 years for control

subjects (P = 0.65). At recruitment, informed consent was

obtained from each subject. This study was approved by

the Medical Ethics Committee of Soochow University.

Genotyping analysis

Genomic DNA was isolated from the peripheral blood

lymphocytes of the study subjects. MassArray (Sequenom,

SanDiego, CA) was used for genotyping all markers using

allele specific MALDI-TOF mass spectrometry. Primers

and multiplex reactions were designed using the RealS-

NP.com Website. 1st-PCRP: ACGTTGGATGTTAAGGC

CAAGCAGTGCAAC; ACGTTGGATGGAAGGTCATG

AGTTTGTTAG and 2nd-PCRP: ACGTTGGATGCCTTG

TCTGTTCTTCTGACC; ACGTTGGATGTGGTAAAGC

7304 Mol Biol Rep (2012) 39:7303–7309

123

CAGTTTCAAGC for rs1126497 and rs1421, respectively.

All cervical cancer patients and healthy controls were

genotyped for rs1126497 and rs1421 polymorphisms [15].

Statistical analysis

Two-sided v2 tests were used to assess differences in the

distributions of age and family history of cancer between

cases and controls as well as the genotypes. The Hardy–

Weinberg equilibrium (HWE) was tested by a goodness-of-

fit v2 test to compare the expected genotype frequencies

with observed genotype frequencies (p2 ? 2pq ? q2 = 1)

in cancer-free controls. The association between case–

control status and each SNP, measured by the OR and its

corresponding 95% CI, was estimated using an uncondi-

tional logistic regression model, with adjustment for age

and family history of cancer. Logistic regression modeling

was also used for the trend test. The data were further

stratified by age, family history, clinical stage, tumor grade

and histological type of cervical cancer to evaluate the

stratum variable-related ORs among the EpCAM geno-

types. We applied the PROC ALLELE statistical procedure

in SAS/Genetics (SAS Institute Inc., Cary, NC) software

were used to detect the LD of the two SNPs, and used the

PROC HAPLOTYPE procedure to infer haplotype fre-

quencies between the two SNPs based on their observed

genotypes [17, 18]. The statistical power was calculated by

using the PS Software (http://biostat.mc.vanderbilt.edu/

twiki/bin/view/Main/PowerSampleSize). The tests were all

two-sided and analyzed using the SAS software (version

9.1; SAS Institute, Cary, NC, USA). P \ 0.05 was con-

sidered statistically significant.

Results

The genotype results are shown in Table 2. The allele fre-

quencies for rs1126497 T and rs1421 G were respectively

0.136 and 0.187 in controls, and 0.201 and 0.183 in cases.

The observed genotype frequencies of rs1126497 and

rs1421 polymorphisms in healthy controls did not deviated

from those expected from the HWE (Chi-square = 1.550,

DF = 1, P = 0.213 for rs1126497; and Chi-square =

0.602, DF = 1, P = 0.438 for rs1421, respectively). The

frequencies for the rs1126497 CC, CT and TT genotypes in

the cases differed significantly from those in controls

(P \ 0.001). Compared with the rs1126497 CC genotype,

CT genotype had a significantly increased risk of cervical

cancer (Crude OR = 1.70; 95% CI = 1.33–2.20; adjusted

OR = 1.72; 95% CI = 1.33–2.22), the TT carriers had a

further increased risk of cervical cancer (Crude OR = 1.94;

95% CI = 1.01–3.72; adjusted OR = 1.96; 95% CI =

1.01–3.81). However, the difference in genotype frequen-

cies at the rs1421 A/G site between cases and controls was

not significant (P = 0.798).

The LD analyses in controls showed that two locus in

moderate linkage equilibrium (D’ = 0.992, r2 = 0.07,

P \ 0.001) and we founded that compared with the most

common haplotype C-A, the haplotype T-A was signifi-

cantly associated an increased risk of cancer (adjusted

OR = 1.61, 95% CI = 1.23-2.89, P = 0.0002).

The risk of cervical cancer related to EpCAM

rs1126497C/T genotypes were further examined with

stratification by age at diagnosis, family history, clinical

stage, tumor grade and histological type of cervical cancer.

As shown in Table 3, we observed a significant difference in

the genotype frequency between stage 0 ? I patients and

patients with advanced i.e., stage II ? III ? IV

(P = 0.0008). Compared with the CC genotype, the T allele

carriers (CT ? TT) had 2.40-fold increased risk for devel-

oping advanced cervical cancer. However, there were no

Table 1 Characteristics of cervical cancer patients and controls in

Chinese populations used for the association study

Characteristics Patients

(n = 518)

Controls

(n = 723)

No. (%) No. (%)

Age at diagnosis, year

\38 121 23.4 216 29.9

38–44 145 28.0 133 18.4

45–51 124 23.9 150 20.7

C52 128 24.7 224 31.0

Family history of cancer

Positive 39 7.5 65 9.0

Negative 479 92.5 658 91.0

Stage

0 81 15.6

I 156 30.1

II 204 39.4

III 72 13.9

IV 5 1.0

Tumor grade

Low 85 16.4

Intermediate 243 46.9

High 143 27.6

Unknown 47 9.1

Histological type

Squamous cell carcinoma 397 76.6

Adenocarcinoma 28 5.4

Adenosquamous carcinoma 7 1.4

Carcinoma in situ 86 16.6

HPV status

Positive 435 84.0

Negative 83 16.0

Mol Biol Rep (2012) 39:7303–7309 7305

123

differences in risk among family history of cervical cancer,

age, tumor grade or histological type.

Discussion

Association between cervical cancer and EpCAM poly-

morphisms have not been investigated in any population

using cases–controls study. In this molecular epidemio-

logical study we sought to identify genetic factors that

confer individual susceptibility to cervical cancer. Our

results obtained by analyzing 518 cervical cancer patients

and 723 healthy controls showed that the functional poly-

morphism rs1126497C/T in the EpCAM was associated

with increased risk for developing cervical cancer in an

allele-dose response manner. However, there exists no

significant difference in the susceptibility to cervical cancer

between different genotypes of the loci rs1421. Although it

is not fully understood how primary tumor involves to

invasive or metastatic disease, it is generally believed that

EpCAM plays a critical in tumor aggressive course. It is in

line with our stratified result that high risk effect of

rs1126497 was more pronounced in advanced cervical

cancer patients, demonstrating a possible role of this

polymorphism as a relevant genetic factor in the major

cause of death in cervical cancer patients.

The fact that the genotype frequencies among controls

could fit the Hardy–Weinberg disequilibrium law sug-

gested the randomness of subject selection; we have

achieved a more than 90% study power (two-sided test,

a = 0.05) to detect an OR of 1.40 for the rs1126497

TT ? CT genotypes (which occurred at a frequency of

24.8% in the controls) compared with the rs1126497 CC

genotype, suggesting that this finding is noteworthy.

EpCAM is a great player in carcinogenesis. As a cell

adhesion molecule (CAM), EpCAM mediates homophilic

adhesion interactions which in turn may prevent metastasis

[7, 19]. However, EpCAM mediated cell–cell adhesion can

be influenced by the complex formation of EpCAM,

claudin-7, CD44v6 and the tetraspanin CO-029. The

complex can be recruited into tetraspanin-enriched mem-

brane microdomains and has been proved to facilitate

metastasis formation [20]. Besides, EpCAM can also pro-

mote tumor formation and metastasis either by disrupting

the link between a-catenin and F-actin [21] or acting as a

signal transducer after sequential cleavage of by tumor-

necrosis-factor alpha-converting enzyme (TACE/

ADAM17) and a gamma-secretase complex containing

presenilin 2 (PS-2) [22, 23]. EpCAM can also contribute to

tumorigenesis by facilitating the immune escape of tumor

cells [24]. What’s more, EpCAM has been recently iden-

tified to be a common surface marker of cancer stem cells.

Cancer stems cells (CSCs) refer to a subset of phenotypi-

cally distinct cells which account for tumor growth and

heterogeneity maintenance [25, 26]. CSCs are mostly

identified by the surface expression of particular molecules

called CIC markers which are involved in CSC mainte-

nance and activity [27]. It is found that although both

Table 2 Genotype frequencies of the two SNPs in EpCAM in patients and controls and their associations with cervical cancer

Controls (n = 723) Cervical cancer patients (n = 518) Crude OR (95% CI) Adjusted ORa (95% CI) P valueb

No. (%) No. (%)

rs1126497 (C/T)

Genotype

CC 544 75.2 330 63.7 1.00 (Reference) 1.00 (Reference)

CT 162 22.4 168 32.4 1.70 (1.33–2.20) 1.72 (1.33–2.22)

TT 17 2.4 20 3.9 1.94 (1.01–3.72) 1.96 (1.01–3.81) \0.001

rs1421 (A/G)

Genotype

AA 474 65.6 345 66.6 1.00 (Reference) 1.00 (Reference)

AG 227 31.4 156 30.1 0.94 (0.73–1.21) 0.94 (0.74–1.20)

GG 22 3.0 17 3.3 1.05 (0.56–2.05) 1.06 (0.55–2.03) 0.798

Haplotypec

C–A 979 67.7 646 62.3 1.00 (Reference) 1.00 (Reference)

C–G 271 18.7 176 17.0 0.98 (0.79–1.22) 1.00 (0.64–1.57) 0.9966

T–A 196 13.6 205 19.7 1.59 (1.27–1.97) 1.61(1.23–2.89) 0.0002

T–G 0 0 9 0.9 – –

a Data were calculated by unconditional logistic regression and adjusted for age and family history of cancerb P value for Chi-square analysis or Fisher’s exact testc Haplotypes were constructed by rs1126497-rs1421

7306 Mol Biol Rep (2012) 39:7303–7309

123

EpCAM-positive and EpCAM-negative cancer stem cells

can form tumors in vivo, at least tenfold less EpCAM-

positive cells than EpCAM-negative cells were able to

induce tumors [28].

In line with these seemingly controversial roles, EpCAM

may act either as a tumor suppressor gene, an oncogene or

both. It has been reported that EpCAM overexpression

plays an oncogenic role in more tumors including carci-

nomas of the bladder [29], breast [30], prostrate [31], lung

[32] and gall bladder [33]. However, high expression of

EpCAM was found to be consistently with improved sur-

vival in renal clear cell and thyroid carcinoma patients [34–

37]. For several other cancer types including colorectal

cancer, head and neck squamous cell carcinoma and gastric

cancer, the reported role of EpCAM seems contradictory

[28] .

It is suggested that the TY domains of EpCAM can

effectively inhibit some cysteine proteases; possibly

removing the obstruction generated by tumor cells secreted

cathepsins during metastasis [38, 39]. The rs1126497 C/T

polymorphism lies in the TY domains of EpCAM [38];

thus, it may affect the function of EpCAM and finally the

development of cancer. Our present case–control study

confirms this hypothesis to a certain extent. From results of

the study, we can see that frequencies of rs1126497 TT and

CT genotype in controls, as opposed to CC genotype, were

remarkably lower than that in cases (P \ 0.001).

To our best knowledge, only two studies including our

present study have investigated association between the

EpCAM rs1126497C/T polymorphism and cancer risk,

which cannot provide a comparison for the tested frequen-

cies of the allele and genotypes. In one of our previous study

of breast cancer, the frequencies of the CC, CT and TT were

74.8, 22.9 and 2.3%, respectively, in 1818 Chinese control

subjects [15]. They are similar to 75.2, 22.4, and 2.4%,

respectively, in the 723 control subject in the present study.

The corresponding figures for these genotypes in the Hap-

Map database are 70.1, 27.7 and 2.2% in 137 Chinese, 60.2,

37.2 and 2.7% in 113 Japanese, 22.1, 54.9 and 23.0% in 113

European descendents, and 59.6, 36.8 and 3.6% in 57

Africans (http://hapmap.ncbi.nlm.nih.gov/: HapMap Gen-

ome Browser (Phase 1, 2 and 3—merged genotypes and

Table 3 Stratification analysis of the EpCAM gene rs1126497 genotypes by selected variables in cervical cancer patients and controls

Patients (n = 518) Controls (n = 723) Adjusted OR (95% CI)a P valueb

CC

N (%)

CT ? TT

N (%)

CC

N (%)

CT ? TT

N (%)

CT ? TT vs. CC

Age (years)

B 48 229 (44.2) 118 (22.8) 323 (44.7) 110 (15.2) 1.51 (1.11–2.06)

[ 48 101 (19.5) 70 (13.5) 221 (30.6) 69 (9.5) 2.22 (1.48–3.34) 0.14

Family history of cancer

Positive 21 (4.1) 18 (3.5) 46 (6.4) 19 (2.6) 2.08 (0.91–4.74)

Negative 309 (59.6) 170 (32.8) 498 (68.9) 160 (22.1) 1.71 (1.32–2.22) 0.66

Clinical stage

0 ? I 173 (33.4) 64 (12.4) 544 (75.2) 179 (24.8) 1.12 (0.81–1.57)

II ? III ? IV 157 (30.3) 124(23.9) 544 (75.2) 179 (24.8) 2.40 (1.80–3.21) 0.0008

Tumor grade

Low 36 (7.0) 11 (2.1) 544 (75.2) 179 (24.8) 0.93 (0.46–1.86)

Intermediate 153 (29.5) 90 (17.4) 544 (75.2) 179 (24.8) 1.79 (1.31–2.44)

High 85 (16.4) 58 (11.2) 544 (75.2) 179 (24.8) 2.07 (1.43–3.01)

Unknown 56(10.8) 29(5.6) 544 (75.2) 179 (24.8) 1.57 (0.97–2.54) 0.24

Histological type

Squamous cell carcinoma 253 (48.8) 144 (27.8) 544 (75.2) 179 (24.8) 1.73 (1.33–2.26)

Adenocarcinoma 18 (3.5) 10 (1.9) 544 (75.2) 179 (24.8) 1.69 (0.77–3.72)

Adenosquamous carcinoma 4 (0.8) 3 (0.6) 544 (75.2) 179 (24.8) 2.28 (0.51–10.28)

Carcinoma in situ 55(10.6) 31(6.0) 544 (75.2) 179 (24.8) 1.71 (1.07–2.74) 0.99

HPV status

Positive 279 (53.9) 156 (30.1) 544 (75.2) 179 (24.8) 1.70 (1.31–2.20)

Negative 51 (9.8) 32 (6.2) 544 (75.2) 179 (24.8) 1.91 (1.19–3.06) 0.68

a ORs were adjusted for age and age and family history of cancer in a logistic regression modelb P value of the test for homogeneity between stratum-related ORs for EpCAM gene (rs1126497 CT ? TT vs. CC genotypes)

Mol Biol Rep (2012) 39:7303–7309 7307

123

frequencies). These data suggest that the role of EpCAM

rs1126497C/T polymorphism in cancer risk may vary in

different ethnicity, so further investigations are warranted.

In conclusion, our study indicated that compared with

carriers of EpCAM rs1126497 CC genotype, the carriers of

rs1127497 TT ? CT genotypes were associated with

increased risk of cervical cancer in a Chinese population.

To our best knowledge, our study is the first report dem-

onstrating the significant association between the EpCAM

rs1126497 C/T polymorphism and risk of cervical cancer.

EpCAM is a common surface marker of cancer stem cells,

besides cervical cancer, it is also expressed in several other

cancers including lung, prostate, renal cell, and colorectal

and cetaceous squamous cell carcinoma, but also myeloma,

the malignant counterpart to plasma cells [6, 12, 40–43].

Therefore, the EpCAM rs1126497 C/T polymorphism may

not be a specific but common susceptibility factor of can-

cer. Additional studies on other cancers and different eth-

nicities are warranted. Moreover, the possible role of these

polymorphisms in cancer invasiveness and metastasis

should also be addressed.

Acknowledgments This study was supported by the National Nat-

ural Scientific Foundation of China grants 81001278, 81072366 and

81171895; the Suzhou Science and Technology Agency grant

SYS201052; the Scientific Research Foundation for the Returned

Overseas Chinese Scholars, State Education Ministry (No.20101561);

A Project Funded by the Priority Academic Program Development of

Jiangsu Higher Education Institutions; Jiangsu Provincial Natural

Science Foundation of China (No. BK2011297 Dr. Y. Zhou); Jiangsu

Province’s Key Medical Department in 2011 (Dr. L. Zhang) and

Beijing Nova Program (No.2009B03 Dr. H. Li).

Conflicts of interest The authors declare no competing interests.

References

1. Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer

JA et al (1999) Human papillomavirus is a necessary cause of

invasive cervical cancer worldwide. J Pathol 189:12–19

2. Chen X, Li H, Qiao Y, Yu D, Guo H et al (2011) Association of

CD28 gene polymorphism with cervical cancer risk in a Chinese

population. Int J Immunogenet 38:51–54

3. Parkin DM (2006) The global health burden of infection-associ-

ated cancers in the year 2002. Int J Cancer 118:3030–3044

4. Louie KS, de Sanjose S, Diaz M, Castellsague X, Herrero R et al

(2009) Early age at first sexual intercourse and early pregnancy

are risk factors for cervical cancer in developing countries. Br J

Cancer 100:1191–1197

5. Chong JM, Speicher DW (2001) Determination of disulfide bond

assignments and N-glycosylation sites of the human gastrointes-

tinal carcinoma antigen GA733-2 (CO17-1A, EGP, KS1-4, KSA,

and Ep-CAM). J Biol Chem 276:5804–5813

6. Went PT, Lugli A, Meier S, Bundi M, Mirlacher M et al (2004)

Frequent EpCam protein expression in human carcinomas. Hum

Pathol 35:122–128

7. Litvinov SV, Velders MP, Bakker HA, Fleuren GJ, Warnaar SO

(1994) Ep-CAM: a human epithelial antigen is a homophilic cell–

cell adhesion molecule. J Cell Biol 125:437–446

8. Munz M, Kieu C, Mack B, Schmitt B, Zeidler R et al (2004) The

carcinoma-associated antigen EpCAM upregulates The carci-

noma-associated antigen EpCAM upregulates c-myc and induces

cell proliferation and induces cell proliferation. Oncogene 23:

5748–5758

9. Osta WA, Chen Y, Mikhitarian K, Mitas M, Salem M et al (2004)

EpCAM is overexpressed in breast cancer and is a potential target

for breast cancer gene therapy. Cancer Res 64:5818–5824

10. Yanamoto S, Kawasaki G, Yoshitomi I, Iwamoto T, Hirata K et al

(2007) Clinicopathologic significance of EpCAM expression in

squamous cell carcinoma of the tongue and its possibility as a

potential target for tongue cancer gene therapy. Oral Oncol 43:

869–877

11. Trzpis M, McLaughlin PM, van Goor H, Brinker MG, van Dam

GM et al (2008) Expression of EpCAM is up-regulated during

regeneration of renal epithelia. J Pathol 216:201–208

12. Litvinov SV, van Driel W, van Rhijn CM, Bakker HA, van

Krieken H et al (1996) Expression of Ep-CAM in cervical

squamous epithelia correlates with an increased proliferation and

the disappearance of markers for terminal differentiation. Am J

Pathol 148:865–875

13. Aubele M, Werner M (1999) Heterogeneity in breast cancer and

the problem of relevance of findings. Anal Cell Pathol 19:53–58

14. Golub TR (2001) Genome-wide views of cancer. N Engl J Med

344:601–602

15. Jiang L, Zhang C, Li Y, Yu X, Zheng J et al (2011) A non-

synonymous polymorphism Thr115Met in the EpCAM gene is

associated with an increased risk of breast cancer in Chinese

population. Breast Cancer Res Treat 126:487–495

16. Jiang L, Liang J, Jiang M, Yu X, Zheng J et al (2011) Functional

polymorphisms in the NBS1 gene and acute lymphoblastic leu-

kemia susceptibility in a Chinese population. Eur J Haematol

86:199–205

17. Lu J, Yang L, Zhao H, Liu B, Li Y, et al. (2011) The polymor-

phism and haplotypes of PIN1 gene are associated with the risk of

lung cancer in southern and eastern chinese populations. Hum

Mutat 32(11): 1299–308

18. Liu B, Chen D, Yang L, Li Y, Ling X et al (2010) A functional

variant (–1304T [ G) in the MKK4 promoter contributes to a

decreased risk of lung cancer by increasing the promoter activity.

Carcinogenesis 31:1405–1411

19. Basak S, Speicher D, Eck S, Wunner W, Maul G et al (1998)

Colorectal carcinoma invasion inhibition by CO17-1A/GA733

antigen and its murine homologue. J Natl Cancer Inst 90:691–697

20. Kuhn S, Koch M, Nubel T, Ladwein M, Antolovic D et al (2007)

A complex of EpCAM, claudin-7, CD44 variant isoforms, and

tetraspanins promotes colorectal cancer progression. Mol Cancer

Res 5:553–567

21. Winter MJ, Nagelkerken B, Mertens AE, Rees-Bakker HA, Bri-

aire-de Bruijn IH et al (2003) Expression of Ep-CAM shifts the

state of cadherin-mediated adhesions from strong to weak. Exp

Cell Res 285:50–58

22. Maetzel D, Denzel S, Mack B, Canis M, Went P et al (2009)

Nuclear signalling by tumour-associated antigen EpCAM. Nat

Cell Biol 11:162–171

23. Munz M, Baeuerle PA, Gires O (2009) The emerging role of

EpCAM in cancer and stem cell signaling. Cancer Res 69:

5627–5629

24. Gutzmer R, Li W, Sutterwala S, Lemos MP, Elizalde JI et al

(2004) A tumor-associated glycoprotein that blocks MHC class

II-dependent antigen presentation by dendritic cells. J Immunol

173:1023–1032

7308 Mol Biol Rep (2012) 39:7303–7309

123

25. Reya T, Morrison SJ, Clarke MF, Weissman IL (2001) Stem

cells, cancer, and cancer stem cells. Nature 414:105–111

26. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke

MF (2003) Prospective identification of tumorigenic breast can-

cer cells. Proc Natl Acad Sci U S A 100:3983–3988

27. Marhaba R, Klingbeil P, Nuebel T, Nazarenko I, Buechler MW

et al (2008) CD44 and EpCAM: cancer-initiating cell markers.

Curr Mol Med 8:784–804

28. van der Gun BT, Melchers LJ, Ruiters MH, de Leij LF,

McLaughlin PM et al (2010) EpCAM in carcinogenesis: the

good, the bad or the ugly. Carcinogenesis 31:1913–1921

29. Brunner A, Prelog M, Verdorfer I, Tzankov A, Mikuz G et al

(2008) EpCAM is predominantly expressed in high grade and

advanced stage urothelial carcinoma of the bladder. J Clin Pathol

61:307–310

30. Schmidt M, Hasenclever D, Schaeffer M, Boehm D, Cotarelo C

et al (2008) Prognostic effect of epithelial cell adhesion molecule

overexpression in untreated node-negative breast cancer. Clin

Cancer Res 14:5849–5855

31. Poczatek RB, Myers RB, Manne U, Oelschlager DK, Weiss HL

et al (1999) Ep-Cam levels in prostatic adenocarcinoma and

prostatic intraepithelial neoplasia. J Urol 162:1462–1466

32. Piyathilake CJ, Frost AR, Weiss H, Manne U, Heimburger DC

et al (2000) The expression of Ep-CAM (17–1A) in squamous

cell cancers of the lung. Hum Pathol 31:482–487

33. Varga M, Obrist P, Schneeberger S, Muhlmann G, Felgel-Farn-

holz C et al (2004) Overexpression of epithelial cell adhesion

molecule antigen in gallbladder carcinoma is an independent

marker for poor survival. Clin Cancer Res 10:3131–3136

34. Seligson DB, Pantuck AJ, Liu X, Huang Y, Horvath S et al

(2004) Epithelial cell adhesion molecule (KSA) expression:

pathobiology and its role as an independent predictor of survival

in renal cell carcinoma. Clin Cancer Res 10:2659–2669

35. Klatte T, Pantuck AJ, Said JW, Seligson DB, Rao NP et al (2009)

Cytogenetic and molecular tumor profiling for type 1 and type 2

papillary renal cell carcinoma. Clin Cancer Res 15:1162–1169

36. Ensinger C, Kremser R, Prommegger R, Spizzo G, Schmid KW

(2006) EpCAM overexpression in thyroid carcinomas: a histo-

pathological study of 121 cases. J Immunother 29:569–573

37. Ralhan R, Cao J, Lim T, Macmillan C, Freeman JL et al (2010)

EpCAM nuclear localization identifies aggressive thyroid cancer

and is a marker for poor prognosis. BMC Cancer 10:331

38. Baeuerle PA, Gires O (2007) EpCAM (CD326) finding its role in

cancer. Br J Cancer 96:417–423

39. Armstrong A, Eck SL (2003) EpCAM: A new therapeutic target

for an old cancer antigen. Cancer Biol Ther 2:320–326

40. Balzar M, Winter MJ, de Boer CJ, Litvinov SV (1999) The

biology of the 17–1A antigen (Ep-CAM). J Mol Med 77:699–712

41. Braun S, Pantel K (1998) Prognostic significance of micrometa-

static bone marrow involvement. Breast Cancer Res Treat 52:

201–216

42. Momburg F, Moldenhauer G, Hammerling GJ, Moller P (1987)

Immunohistochemical study of the expression of a Mr 34,000

human epithelium-specific surface glycoprotein in normal and

malignant tissues. Cancer Res 47:2883–2891

43. Bergsagel PL, Victor-Kobrin C, Brents LA, Mushinski JF, Kuehl

WM (1992) Genes expressed selectively in plasmacytomas:

markers of differentiation and transformation. Curr Top Micro-

biol Immunol 182:223–228

Mol Biol Rep (2012) 39:7303–7309 7309

123