Upload
cerise
View
37
Download
1
Tags:
Embed Size (px)
DESCRIPTION
Functional Linkages between Proteins. E. Coli. S. cerevisiae. Drosophila. Introduction. Piles of Information. Flakes of Knowledge. - PowerPoint PPT Presentation
Citation preview
Functional Linkages between Proteins
Introduction
Piles of Information Flakes of KnowledgeAGCATCCGACTAGCATCAGCTAGCAG
CAGACTCACGATGTGACTGCATGCGTCATTATCTAGTATGAAAAAAGCCATGCTAGGCTAGTCAGCGACATGAGCCATGACTAGCGCAGCATCAGTCATCAGTCAGCGGAGCGAGGAGAGAGAGACGACTGACTAGCATGCACACATGCATGACGTCATGACTGCATGACTGACTGACTGACTGCATGCATGATATTTTTTTTTTCATGCATGCAGCATGCTACCCAGCTACAGTGCACAGCAGGTACGACGCATCAGCATACGTACGGCATGACGACTCAGACTACGCATACGACTACGAC
E. Coli S. cerevisiaeDrosophila
Data Analysis Traditional Methods
(Experiments & Sequence Homology) The function of a protein
New Computational MethodsFunctional linkages between proteins
What does Functional Linkage mean ?
1) A common structural complex
2) A common metabolic pathway
3) A common biological process
4) All answers are correct
New Computational Methods
Phylogenetic Profile Method Rosetta Stone Method Chromosomal Proximity Method COG Database
11
Phylogenetic Profile Method
Phylogenetic Profile Method
Biologically: Simliar profile likelihood for common pathway or complex
Mathematically: N genomes 2N possible profiles A unique characterization
Why Should it Work ?
Rosetta Stone Method
Rosetta Stone Method (= Domain Fusion Analysis) Interacting proteins have
homologs in another organism fused into a single protein chain
Rosestta Stone Method
Rosestta Stone Method
Experimentally: E. coli ~4300 proteins ~6800 pairs similar to a single protein
Biologically:
Why Should it Work ?
Rosestta Stone MethodValidation Tests(E. coli):1) Annotation of proteins from the
SWISS-PROT database (68% vs. 15%)2) Database of Interacting Proteins
(6.4%)3) Phylogenetic Profile Method
(5% vs. 0.6%)
Models’ Success & Failure
+ -+ True
positiveFalse negative
- False positive
True negative
predicted
found
Rosestta Stone MethodFalse Negatives1) interactions that have evolved
through other mechanisms, i.e. there never was a fusion
2) The fused protein has disppeared during evolution
Rosestta Stone MethodFalse Positives1) Proteins have been fused to
regulate co-expression2) Can’t distinguish between binding
and non-binding homologs.3) Functional interaction rather than
a physical interaction
Rosestta Stone Method Reducing Errors
Rosestta Stone Method Reconstructio
n of metabolic pathways
Functional Protein Networks
Orthologs vs. Paralogs Orthologs: genes in different
species that evolved from a common ancestral gene by speciation
Paralogs: genes related by duplication within a genome
Chromosomal ProximityProximate Genes On the same strand Within 300 bp, or - Respective paralogs within 300 bp
Inferred link genes whose orthologs are close in
at least three phylogenetic groups
Chromosomal Proximity Direct Link two proximate genes that are also
proximate in at least two other phylogenetic groups
Indirect Linkgenes whose orthologs are close in at least three other phylogenetic groups
Chromosomal Proximity
Chromosomal Proximity
Biologically: Conservation of proximity across multiple genomes Linked function
Logically: How likely is it that two genes are randomly proximate ?
Why Should it Work ?
Chromosomal ProximityMethod’s Reliability:
Chromosomal Proximity
1586 links were detected between ortholog families
KEGG: 80% in the same biological pathway
COG: 67% in the same functional category
Validation:
Chromosomal Proximity
Total validated links per genome380 direct 352 inferred
Chromosomal Proximity
The COG Database Clusters of Orthologous Groups COGs creation Each COG contains proteins that
have evolved from an ancestral protein
The COG DatabaseCurrent Numbers (2004) 43 Complete genomes 30 phylogenetic groups 2223 phylogenetic patterns 17 functional categories 3307 COGS 74059 proteins, 71% of total
The COG Database
Direct Information Annotation of Proteins
(group and individual) Phylogenetic Patterns Multiple Alignment
How can we use it ?
The COG Database
Detecting Missed Genes Patterns that contain all but one Mostly small proteins
How can we use it ?
The COG Database Groups number
growth Are we
approaching saturation ?
COG on the WWW
Reliability of the Methods Major validation:
Experimentally known linkages
Validation by “keyword recovery” search
references1) Eisenberg D, Marcotte EM, Xenarios I, Yeates TO. Protein function in
the post-genomic era. Nature. 2000 405:823-826. Review2) Marcotte EM, Pellegrini M, Ng HL, Rice DW, Yeates TO, Eisenberg D.
Detecting protein function and proteing protein interactions from genome sequences. Science. 1999 285:751-753.
3) Yanai I, Mellor JC, DeLisi C. Identifying functional links between genes using conserved chromosomal proximity. Trends Genet. 2002 18:176-179.
4) Tatusov RL, Natale DA, Garkavtsev IV, Tatusova TA, Shankavaram UT, Rao BS, Kiryutin B, Galperin MY, Fedorove ND, Koonin EV. The COG database: new developments in phylogenetic classification of proteins from complete genomes. Nucleic Acids Res. 2001 29:22-28.
5) Tatusov,R.L., Koonin,E.V. and Lipman,D.J. (1997) A genomic perspective on protein families. Science, 278, 631–637.
6) http://www.ncbi.nlm.nih.gov/COG