Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
1
1
2
3
4
Functional characterization of SsaE, a novel chaperone protein of the 5
type III secretion system encoded by Salmonella pathogenicity island 2 6
7
Tsuyoshi Miki,1 Yoshio Shibagaki,2 Hirofumi Danbara,1 and Nobuhiko Okada1* 8
9
Department of Microbiology,1 and Department of Biochemistry,2 School of Pharmacy, 10
Kitasato University, Minato-ku, Tokyo 108-8641, Japan 11
12
Running title: Role of SsaE in SPI-2 secretion 13
14
*Corresponding author. Mailing address: Department of Microbiology, School of 15
Pharmacy, Kitasato University, Minato-ku, Tokyo 108-8641, Japan. Phone: 16
+81-3-5791-6256; Fax: +81-3-3444-4831; E-mail: [email protected] 17
18
Copyright © 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.00863-09 JB Accepts, published online ahead of print on 18 September 2009
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
2
ABSTRACT 19
20
The type III secretion system (T3SS) encoded by Salmonella pathogenicity island 2 21
(SPI-2) is involved in systemic infection and intracellular replication of Salmonella 22
enterica serovar Typhimurium. In this study, we investigated the function of SsaE, a 23
small cytoplasmic protein encoded within the SPI-2 locus, which shows structural 24
similarity to the T3SS class V chaperones. An S. enterica serovar Typhimurium ssaE 25
mutant failed to secrete SPI-2 translocator SseB and SPI-2 dependent effector PipB 26
proteins. Co-immunoprecipitation and mass spectrometry analyses using an 27
SsaE-FLAG fusion protein indicated that SsaE interacts with SseB and a putative 28
T3SS-associated ATPase, SsaN. A series of deleted and point-mutated SsaE-FLAG 29
fusion proteins revealed that the C-terminal coiled-coil domain of SsaE is critical for 30
protein-protein interactions. Although SseA was reported to be a chaperone for SseB 31
and to be required for its secretion and stability in the bacterial cytoplasm, an sseA 32
deletion mutant was able to secrete the SseB in vitro when plasmid-derived SseB was 33
overexpressed. In contrast, ssaE mutant strains could not transport SseB extracellularly 34
under the same assay conditions. In addition, an ssaEI55G point-mutated strain that 35
expresses the SsaE derivative lacking the ability to form a C-terminal coiled-coil 36
structure showed attenuated virulence comparable to that of a SPI-2 T3SS null mutant, 37
suggesting that the coiled-coil interaction of SsaE is absolutely essential for the 38
functional SPI-2 T3SS and Salmonella virulence. Based on these findings, we propose 39
that SsaE recognizes translocator SseB and controls its secretion via SPI-2 type III 40
secretion machinery. 41
42
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
3
INTRODUCTION 43
44
A number of Gram-negative pathogenic bacteria use a type III secretion system (T3SS) 45
to interact with eukaryotic host cells. T3SS delivers bacterial effectors through the 46
needle-like structure extending across the inner and outer membranes of the bacterium 47
and into the cytosol of eukaryotic cells (28). Salmonella enterica serovar Typhimurium 48
is an enteropathogenic bacterium that causes gastroenteritis in humans and typhoid-like 49
fever in mice. Salmonella possesses two different T3SSs encoded by Salmonella 50
pathogenicity island 1 (SPI-1) and Salmonella pathogenicity island 2 (SPI-2). Upon 51
entry into host cells, the S. enterica serovar Typhimurium resides in a special 52
membrane-bound compartment termed the Salmonella-containing vacuole (23). 53
Expression of SPI-2 is induced within the vacuole (8) and is essential for intracellular 54
replication and virulence of S. enterica serovar Typhimurium (26, 44). 55
56
Functional SPI-2 genes are clustered within six large transcriptional units. Thirty-one 57
potential open reading frames on the SPI-2 region encode proteins that are directly 58
involved in the assembly and regulation of the T3SS (50). The Ssa proteins are involved 59
in the assembly of the syringe-like type III secretion injectisome, the so-called 60
nanomachine (41). A set of nine Ssa proteins conserved among T3SSs forms the 61
injectisome core. Transport of some effectors through the injectisome is facilitated by 62
formation of a complex between an effector and a chaperone encoded in SPI-2. For 63
example, SscB, a protein encoded immediately upstream of sseF, acts as a chaperone 64
for SseF (14). In addition to effectors, the translocators SseB (a component of the 65
oligomeric filament structure of the type III secretion apparatus), SseC, and SseD (the 66
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
4
pore-forming translocator complex) are also secreted through the SPI-2 encoded type III 67
secretion machinery. Efficient secretion of SseC and SseD is required for the presence 68
of SseB, but SseB secretion is independent of these two translocators (31, 42). 69
Furthermore, stable expression of these translocators requires the chaperone SseA for 70
SseB and SseD and a putative chaperone SscA for SseC (49, 62, 63). 71
72
Several different types of chaperones have been classified on the basis of structural and 73
functional analyses (57). Class I chaperones are small, acidic (pI 4~5), usually dimeric 74
proteins that interact with a single T3SS effector or with two or three effectors and 75
mediate targeting of their cognate binding partners to the type III secretion apparatus 76
(35). Class II chaperones bind to translocator proteins of the T3SS. They possess in the 77
part of tetratricopeptide repeats, which form a curved layer of α-helices. These 78
chaperones play a regulatory role in type III secretion (6 , 20). Class III is represented 79
by flagellar chaperones (such as FliS), which have an entirely different structure. FliS 80
prevents polymerization of flagellin protein FliC in the cytoplasm prior to secretion (19). 81
The CesA of enteropathogenic Escherichia coli (EPEC), which acts as a chaperone for 82
EspA, is structurally different from other classes of chaperones. Therefore, it has been 83
designated as a class IV chaperone. The aggregation of EspA in the bacterial cytosol is 84
prevented through binding with CesA (59). Class V chaperones are a heterogeneous 85
group of proteins that interact with the needle subunit of the type III secretion apparatus. 86
These include Yersinia YscE and YscG, and Pseudomonas aeruginosa PscE and PscG. 87
Polymerization of needle components Yersinia YscF and P. aeruginosa PscF in the 88
bacterial cytoplasm is prevented by binding to these chaperones, YscE/YscG and 89
PscE/PscG, respectively (47). 90
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
5
91
To date, some proteins encoded within SPI-2 remain uncharacterized. One of these is 92
SsaE. The ssaE open reading frame of 243-bp is predicted to encode a protein of 80 93
amino acids containing three predicted α-helical regions. SsaE has homology to EscE 94
(Orf2) of EPEC and Citrobacter rodentium, YscE of Yersinia pestis, PscE of 95
Pseudomonas aeruginosa, and AscE of Aeromonas hydrophila. Yersinia yscE mutants 96
are unable to export their effectors (16). In P. aeruginosa, PscE is required for 97
functional T3SS and cytotoxicity by controlling the needle complex biogenesis of T3SS 98
(47). While the core type III components are generally conserved, allowing the function 99
and/or cellular locations of some of the proteins to be inferred (4, 28), these small 100
proteins are not broadly conserved among other T3SSs or flagellar export systems. For 101
example, no homologue of PscG is present in S. enterica serovar Typhimurium. 102
103
In this study, we have characterized the role of SsaE in the secretion and translocation 104
via SPI-2 T3SS. A Salmonella mutant that lacks SsaE failed to secrete SseB (a 105
translocator) and PipB (a SPI-2 effector). Using pull-down assays, we showed that SsaE 106
directly interacts with SseB and a putative ATPase, SsaN. Furthermore, deletion and 107
site-directed mutagenesis of SsaE identified a C-terminal coiled-coil domain involved in 108
protein-protein interactions of SseB. We finally found that Salmonella expressing the 109
point-mutated SsaEI55G, which is unable to form a C-terminal coiled-coil domain, has 110
dramatic defects in virulence comparable to those of the SPI-2 null mutant. These data 111
suggest that the chaperone-like small molecule SsaE plays a crucial role in the SPI-2 112
secretion by interacting with the SseB via the C-terminal coiled-coil domain. 113
114
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
6
MATERIALS AND METHODS 115
116
Bacterial strains, plasmids, and growth conditions. The Salmonella strains and 117
plasmids used in this study are listed in Table 1. In this study, S. enterica serovar 118
Typhimurium strain SL1344 was used as wild-type strain, and strains harboring ssaV 119
mutation and spiAC133S point-mutation were used as general SPI-2 T3SS component 120
mutants. Escherichia coli strains DH5α (Gibco BRL) and MC1061 (7) were used for 121
molecular cloning and expression of recombinant proteins. E. coli strain S17.1λpir (38) 122
was used for propagation of π-dependent plasmids and for conjugation. Bacteria were 123
routinely grown in LB broth (Sigma) at 37˚C overnight with aeration. Ampicillin (100 124
µg/ml), chloramphenicol (25 µg/ml), kanamycin (25 µg/ml), and streptomycin (25 125
µg/ml) were used when required. 126
127
Strain construction. Deletion mutants of strain SL1344 were constructed using the 128
λ Red disruption system (15). S. enterica serovar Typhimurium wild-type strain SL1344 129
derivatives with chromosomally encoded FLAG and tandem HA fusion proteins were 130
constructed using the integrational plasmid pLDΩKm2 by conjugation (37) and the 131
λ Red disruption system (15), respectively. Double mutant strains were created by 132
phage P22-mediated transduction. To consider the effect of dwonsteam gene expression, 133
a Salmonella strain containing an SsaE initiation codon mutation (ssaEmut) and a strain 134
expressing a point mutated SsaEI55G were constructed by allele exchange using the 135
temperature- and sucrose-sensitive suicide vector pCACTUS containing ssaEmut or 136
ssaEI55G as described previously (37). All constructs were verified by PCR and DNA 137
sequencing. 138
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
7
139
Plasmid construction. For construction of the complementing plasmids pSsaE and 140
pACYC-SseB, ssaE and sseB genes were amplified from the genomic DNA of strain 141
SL1344 with the primers ssaE-SacI-FW and ssaE-SphI-RV, and sseB-FW and sseB-RV, 142
and were ligated into pMW118 and pACYC184, respectively. 143
144
To construct the plasmid encoding the N-terminal GST-tagged SseB fusion protein, sseB 145
genes were amplified from the genomic DNA of strain SL1344 with the primers 146
sseB-FW-BamHI and sseB-XhoI-RV and cloned into pGEX-6P-1 (GE Healthcare). 147
148
To construct the plasmids encoding the C-terminal FLAG-tagged fusion proteins, the 149
DNA fragments containing the respective genes were amplified by PCR with specific 150
primers, and cloned into pFLAG-CTC (Sigma). To obtain the plasmids encoding 151
truncated SsaE proteins fused with FLAG, inverse PCRs were performed with the 152
primers ssaE-StuI-R3 and ssaE-StuI-R4 (for pSsaE∆1-FLAG), ssaE-StuI-R1 and 153
ssaE-StuI-R2 (for pSsaE∆2-FLAG), or ssaE-StuI-R7 and ssaE-StuI-R8 (for 154
pSsaE∆3-FLAG). The point mutation on pSsaE-FLAG was created by a QuickChange 155
Site-directed mutagenesis kit (Stratagene) using the primers sense-ssaEI55G and 156
antisense-ssaEI55G to replace isoleucine with glycine at position 55 in the SsaE. The 157
mutation was confirmed by DNA sequencing. 158
159
To construct the plasmids encoding the C-terminal 2HA-tagged fusion protein, plasmids 160
p2HA-CTC, pACHS-2HA and pACPJ-2HA were used. For construction of p2HA-CTC, 161
inverse PCR was performed using pFLAG-CTC circular DNA as the template with 162
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
8
primers 2HA-StuI-1 and 2HA-StuI-2. For construction of pACHS-2HA, the DNA 163
fragment containing a 2HA-tag sequence amplified from p2HA-CTC with primers 164
FLAG-SphI-FW and FLAG-BamHI-RV was cloned into pACYC184. To construct 165
pACPJ-2HA that contains the gene encoding the 2HA-tagged protein under control of 166
the sseJ promoter, DNA fragments containing the sseJ promoter region amplified from 167
the genomic DNA of the SL1344 strain with primers ProsseJ-SalI-FW and 168
ProsseJ-SphI-RV and a 2HA-tag sequence amplified from p2HA-CTC with primers 169
FLAG-SphI+ATG-FW and FLAG-BamHI-RV were cloned into pACYC184. To 170
generate the plasmids encoding the C-terminal CyaA-2HA fusion protein, a DNA 171
fragment encoding the catalytic domain of CyaA was amplified from pMS109 with 172
primers cyaA-BglII-FW and cyaA-XhoI-RV and cloned into pACPJ-2HA. The primers 173
used for the construction of all constructs are listed in Table 2. 174
175
Antibodies. Rabbit anti-Salmonella O4 polyclonal antibody (Denka Seiken) was used 176
at a dilution of 1:5000. Mouse polyclonal anti-SseB and rabbit polyclonal anti-PagC 177
antibodies were used as described previously (37, 43). The mouse monoclonal 178
antibodies, anti-FLAG (1:20000) (Sigma), anti-GST (1:2000) (Upstate, Lake Placid, 179
NY), and anti-DnaK (1:2000) (Calbiochem), were used as primary antibodies for 180
immunoblotting. The mouse monoclonal anti-HA epitope tag HA.11 was used at a 181
dilution of 1:2000 (Covance) for immunofluorescence microscopy and immunoblot 182
analysis. Alexa 488-conjugated goat anti-mouse IgG and Alexa 594-conjugated goat 183
anti-rabbit IgG secondary antibodies (dilution of 1:500) were obtained from Molecular 184
Probes. Alkaline phosphatase-conjugated goat anti-mouse and anti-rabbit IgG antibodies 185
were purchased from Sigma and were used at a dilution of 1:10000. 186
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
9
187
Cell culture, bacterial infection and immunofluorescence microscopy. HeLa cells 188
were grown in MEM (Sigma) supplemented with 10% FBS, and were cultured in the 189
presence of gentamicin (100 µg/ml) and kanamycin (60 µg/ml) at 37°C in a 5% CO2 190
atmosphere. Bacterial infections of HeLa cells were performed as described previously 191
(37). For immunofluorescence labelling, cells were fixed, permeabilized, and probed 192
with various antibodies as described previously (37). Labeled cells were analyzed by a 193
Zeiss confocal laser scanning microscope (LSM510 META). 194
195
Protein translocation assay. Translocation of a CyaA fusion protein by SPI-2 T3SS 196
into infected host cells was measured using a cAMP enzyme immunoassay system 197
(Amersham Biosciences) to quantify intracellular levels of cAMP. HeLa cells were 198
infected with Salmonella strains carrying the plasmids encoding CyaA fusion proteins 199
for 22 h. After infection, cells were lysed and processed according to the manufacturer’s 200
instructions. The data represent the mean ± S.D. of triplicate determinants. 201
202
Subcellular fractionation. Salmonella strains grown in LPM medium (pH 5.8) were 203
fractionated. The culture supernatant fraction was obtained as described previously (10). 204
Bacterial fractionation was based on the method of Gauthier et al. (24). Bacteria grown 205
in 100 ml of LPM medium (pH 5.8) for 16 h at 37°C were used for the isolation of 206
cytoplasmic, periplasmic and membrane fractions. Samples were run on 12% 207
SDS-PAGE and transferred to PVDF membranes (Imobilon; Millipore). The gels were 208
hybridized with various antibodies and developed using a Sigma Fast™ BCIP/NBT 209
detection system as described previously (37). 210
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
10
211
Immunoprecipitation. Immunoprecipitation of the FLAG-tagged protein complexes 212
from Salmonella and E. coli lysates was performed by using FLAG beads conjugated 213
with anti-FLAG M2 antibody (Sigma) as previously described (55). Lysates were 214
clarified by centrifugation and incubated with FLAG beads for 2 h at 4°C. Beads were 215
washed seven times with ice-cold PBS containing 1 mM PMSF (PBS-P), and bound 216
proteins were competitively eluted from the beads using FLAG peptide (Sigma) at a 217
final concentration of 90 µg/ml. The eluted protein fraction was then analyzed by 218
SDS-PAGE and Western blotting. 219
220
Pull-down assay. GST and GST-SseB fusion proteins were purified by affinity 221
chromatography on glutathione-Sepharose 4B beads according to the manufacturer’s 222
instructions (GE Healthcare). For GST pull-down assays, glutathione-Sepharose 4B 223
beads immobilized with GST or GST-SseB were incubated with cleared extracts from 224
the Salmonella ssaEmut mutant or E. coli DH5α strains expressing SsaE-FLAG for 2 h at 225
4°C. Beads were washed five times with ice-cold PBS-P and the bound proteins were 226
eluted from the beads using 10 mM glutathione. The eluted protein fraction was then 227
analyzed by SDS-PAGE and Western blotting. 228
229
Mass spectrometry analyses. The S. enterica serovar Typhimurium strain TM312 that 230
expresses SsaE-FLAG was resuspended in PBS containing lysozyme and protease 231
inhibitor cocktails (Roche), disrupted by sonication, and cleared by centrifugation. The 232
sample co-precipitated with SsaE-FLAG using FLAG beads was subjected to trypsin 233
digestion. The digested peptides were analyzed by nano-LC-ESI-MS/MS using a DiNa 234
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
11
nano-LC system (KYA Technologies) with a L-column 2 ODS 0.05 mm × 100 mm, 3 235
µm (CERI, Japan) coupled to a QSTAR Elite hybrid liquid chromatography tandem 236
mass spectrometry (LC/MS/MS) system (Applied Biosystems). Peptide and Protein 237
identification were performed using Protein Pilot version 2.0 software (Applied 238
Biosystems) with default parameters. Each MS/MS spectrum was searched for species 239
of S. enterica serovar Typhimurium against the NCBI-database. 240
241
Mouse mixed infections. Female BALB/c mice (5- to 6-week-old) were used for the 242
mixed infection assay and were housed at Kitasato University according to the standard 243
Laboratory Animal Care Advisory Committee guidelines. At least three mice were 244
inoculated intraperitoneally with a mixture of two strains comprising 5 x 104 cfu of each 245
strain in physiological saline, and the number of viable bacteria from infected spleens 246
was determined at 48 h after infection as described previously (37). The competitive 247
index (CI) was calculated by the formula CI = output (mutant strain/wild-type 248
strain)/inoculum (mutant strain/wild-type strain). In the case of tested two strains that 249
have same virulence, the CI indicates 1.0. In contrast, in the case of the mutated gene 250
that contribute to the virulence, the CI indicates < 1.0. Each CI value is the mean of at 251
least three independent infections ± SD. CI data were analyzed by Mann-Whitney U 252
test for statistical significance. p values of 0.05 or less were considered as significant. 253
254
RESULTS 255
256
SsaE has several features of a T3SS chaperone. In the SPI-2 region of S. enterica 257
serovar Typhimurium, ssaE is flanked by spiB (also referred to as ssaD) and sseA (Fig. 258
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
12
1A). SsaE shares some common characteristics with other type III chaperone proteins 259
(reviewed in (2, 11, 56)). SsaE has a predicted molecular mass of 9.4 kDa and a 260
predicted pI of 4.9, both of which characteristics are common in T3SS chaperones. In 261
addition, SsaE was predicted to have three α-helices by PSI-PRED (30). Among them, 262
α-3 could be predicted as a perfect amphipathic helix in the C-terminus. We searched 263
for similarities between SsaE and other T3SS chaperones using SKE-CHIMERA (54) 264
and the fold recognition algorithm SPARKS2 (61) (Fig. 1B). The model of the 265
three-dimensional structure of the SsaE was built with the FAMS program (45) on the 266
basis of this alignment using a Yersinia pestis T3SS-specific chaperone, YscE (PDB ID: 267
1ZW0), as template (Fig. 1C and D). These observations indicated that SsaE encodes a 268
protein as the T3SS-specific chaperone. 269
270
SsaE is a cytoplasmic protein, but not an effector. The subcellular localization of 271
SsaE was determined by fractionation of a Salmonella strain, followed by SDS-PAGE 272
and immunoblotting. An S. enterica serovar Typhimurium strain encoded 273
chromosomally by an ssaE-FLAG fusion gene was grown in LPM (pH 5.8), and the cell 274
components were separated into cytoplasm, periplasm, and membrane fractions. SsaE 275
(SsaE-FLAG) was not secreted and was localized to the cytoplasmic fraction (Fig. 2A 276
and B). We further attempted to detect translocation of SsaE into the host cell cytosol by 277
confocal immunofluorescence microscopy. As an HA epitope-tagged derivative of 278
effector proteins has been used to detect SPI-2-dependent translocation in host cells (29, 279
32), a plasmid (pSsaE-2HA) expressing SsaE-2HA was generated and transformed into 280
Salmonella wild-type SL1344. In HeLa cells infected with the wild-type strain 281
expressing the SsaE-2HA, SsaE was not detected in the host cell cytosol (data not 282
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
13
shown). Furthermore, a lack of SsaE translocation into host cells was confirmed 283
quantitatively by a cAMP assay using the wild-type strain expressing the 284
SsaE-CyaA-2HA fusion protein. While SsaE-CyaA-2HA was determined to be stable in 285
Salmonella (data not shown), background levels of cAMP were detected in cells 286
infected with the wild-type strain harboring either pACPJ-CyaA-2HA (15.6 ± 0.5 fmol 287
cAMP/µg protein) or harboring pSsaE-CyaA-2HA (15.5 ± 0.6 fmol cAMP/µg protein). 288
In the same assay, the SPI-2 effector SseF-CyaA-2HA fusion protein was used as a 289
positive control for SPI-2 T3SS translocation, and intracellular cAMP was clearly 290
elevated by SseF-CyaA-2HA of wild-type strain (335.8 ± 107.6 fmol cAMP/µg protein) 291
relative to that of SPI-2 T3SS component mutant (∆ssaV) harboring pSseF-CyaA-2HA 292
(10.9 ± 3.0 fmol cAMP/µg protein). These results suggest that SsaE is a cytoplasmic 293
protein, but not an effector translocated by SPI-2 T3SS. 294
295
A Salmonella ssaE mutant strain is deficient in secretion of the SPI-2 T3SS 296
translocator SseB and effector PipB. To investigate the role of SsaE in SPI-2 T3SS, 297
we constructed a site-directed mutation in the initiation codon of ssaE (ssaEmut; ATG to 298
CTT) and then examined the ability of the ssaEmut mutant strain to secrete the 299
translocator SseB into the culture supernatant. As shown in Fig. 3 A, SseB in the 300
Salmonella mutant strain carrying an ssaEmut mutation accumulated within bacterial 301
cells, but was not secreted into the supernatant, when bacteria were grown under 302
conditions that induced SseB expression and secretion. Complementation of the ssaEmut 303
mutant with a wild-type ssaE allele restored the secretion of SseB to a level comparable 304
to that in the wild-type strain. The mutation could be also complemented by ssaE-FALG 305
or ssaE-2HA introduced on a plasmid (data not shown). These results strongly suggest 306
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
14
that SsaE is required for secretion of SseB. In addition, Salmonella strains containing 307
sseAB::lacZ transcriptional fusion on the chromosome both in an ssaE+ and ssaE
- 308
(ssaEmut) background were grown under SPI-2-inducing conditions, and β-galactosidase 309
activity was measured. Consistent with the above results, transcription of sseAB was not 310
affected by loss of SsaE (data not shown). 311
312
Recently, it has been demonstrated that the SPI-2-encoded regulatory molecules SsaL, 313
SsaM, and SpiC, the latter two of which occur in complex, are required for the 314
translocator protein secretion (10, 60). However, mutations of ssaL and ssaM resulted in 315
enhanced secretion of SPI-2 effectors encoded outside of SPI-2 (10, 60). Therefore, to 316
further determine the role of SsaE in the secretion of SPI-2 effectors, we constructed 317
ssaL mutant with an ssaE+ and ssaE
- background, and tested the secretion of PipB. As 318
expected, no detectable SseB was secreted by any of the Salmonella mutants tested. In 319
contrast, the PipB-2HA fusion protein was detected in secreted protein fractions from 320
the ∆ssaL single mutant, but not the double mutants carrying mutations in ∆ssaL and 321
ssaEmut or ∆ssaL and spiAC133S, a point mutation in the outer membrane secretin SpiA 322
(37) (Fig. 3B), suggesting that SsaE is reqired for secretion of PipB in wild-type cells 323
and in cells lacking SsaL. Similar results were obtained from other SPI-2 effectors, 324
SopD2 (SopD2-2HA), and SspH2 (SspH2-2HA) or when the Salmonella ∆ssaM mutant 325
was used (data not shown). Thus, phenotypically, a mutant lacking SsaE is different 326
from a mutant lacking SsaL or SsaM. 327
328
Identification of SsaE-binding partners. Several physical features and predicted 329
structural characteristics of SsaE indicated that SsaE functions as a chaperone. 330
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
15
Therefore, to identify the SsaE partner proteins encoded by SPI-2 in Salmonella, we 331
next performed co-immunoprecipitation assays using lysates prepared from the 332
wild-type strain expressing SsaE-FLAG grown under SPI-2-inducing conditions. The 333
bound proteins were eluted and subjected to mass spectrometry analyses. Seven SPI-2 334
proteins, i.e., SsaH, SsaK, SsaN, SsaQ, SseA, SseB, and SseC, were identified as 335
SsaE-interacting proteins. In general, translocator proteins of T3SSs are known to 336
require chaperones before secretion by the T3SS pathway. Thus, we further 337
characterized the SsaE interaction with SPI-2 T3SS translocator proteins SseB and 338
SseC. 339
340
To examine the binding specificity of SsaE with SseB, we performed FLAG pull-down 341
assays using lysates prepared from the wild-type strain SL1344 carrying a plasmid 342
(pSsaE-FLAG) expressing SsaE-FLAG. The bound protein was analyzed by SDS-PAGE 343
and immunoblotting with mouse anti-SseB antibody. Controls for binding specificity 344
included binding to bacterial alkaline phosphatase (BAP)-FLAG and blotting with 345
anti-PagC antibody, as PagC is a SPI-2-unrelated outer membrane protein. The 346
wild-type strain harboring a plasmid (pSsaE) expressing untagged SsaE was also used 347
as a control for non-specific binding to anti-FLAG beads. The results showed that SseB 348
was co-precipitated by SsaE-FLAG but not BAP-FLAG or untagged SsaE (Fig. 4A, B 349
and data not shown). In contrast, PagC was co-precipitated by neither SsaE-FLAG, 350
untagged SsaE, or BAP-FLAG, suggesting that SsaE is capable of interacting with SseB 351
(Fig. 4A, B and data not shown). This interaction was also confirmed by reverse 352
experiments using Salmonella extracts from the wild-type strain expressing 353
SseB-FLAG and SsaE-2HA grown under the same conditions (data not shown). 354
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
16
355
Next, to clarify whether the interaction between SsaE and SseB is direct or requires 356
other SPI-2 proteins bridging two proteins, we performed GST pull-down assays using 357
SsaE-FLAG expressed in E. coli DH5α that does not encode the Salmonella SPI-2 358
proteins. Cell lysate was incubated with glutathione-Sepharose beads conjugated with 359
GST-SseB or GST, and the bound proteins were analyzed by SDS-PAGE and 360
immunoblotting with anti-FLAG antibody. SsaE-FLAG was co-eluted with GST-SseB, 361
whereas GST alone did not bind to the SsaE-FLAG (Fig. 4D). These results strongly 362
suggest that SsaE interacts with SseB and none of the additional proteins encoded by 363
SPI-2 are required for this interaction. 364
365
Under the same assay conditions, when SsaE-FLAG and SseC-2HA were co-expressed 366
from plasmids (pSsaE-FLAG and p2HA-SseC) in the S. enterica serovar Typhimurium, 367
SseC-2HA co-immunoprecipitated with SsaE-FLAG onto FLAG beads (data not 368
shown). However, SseC-2HA did not co-elute with SsaE-FLAG-containing beads when 369
SseC-2HA was expressed in E. coli (data not shown), indicating that the interaction 370
between SsaE and SseC is indirect binding. 371
372
The coiled-coil domain in the C-terminal region of SsaE is critical for interaction 373
with SseB. SsaE is predicted to have three α-helical regions (the amino acids spanning 374
regions 5 to 11, 24 to 32, and 52 to 68; Fig. 1B and C). Thus, to identify the SsaE 375
domain involved in interaction with partner proteins, we constructed a series of 376
SsaE-FLAG derivatives and subjected the resulting proteins, pSsaE∆1-FLAG 377
(SsaE21-80-FLAG), pSsaE∆2-FLAG (SsaE∆21-41-FLAG), and pSsaE∆3-FLAG 378
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
17
(SsaE∆52-68-FLAG), to FLAG pull-down assays using bacterial lysates prepared from the 379
Salmonella wild-type strain (Fig. 5 A). Similar to the full-length SsaE-FLAG, SseB was 380
precipitated with SsaE∆1-FLAG and SsaE∆2-FLAG, but not with SsaE∆3-FLAG (Fig. 381
5 A), showing that SseB interacts with the C-terminal portion of SsaE encompassing 382
amino acid residues 52 to 68. 383
384
Coiled-coil sequences in proteins consist of seven residues, termed the heptad repeat 385
(a-b-c-d-e-f-g)n, which include the non-polar hydrophobic residues at positions a and d 386
(25). Residues in positions a and d typically form a core in the center of the α-helical 387
bundle, providing the driving force for protein-protein interaction (25, 36). The Ile-55 of 388
the SsaE protein within the C-terminal coiled-coil sequence was determined to be a 389
non-polar hydrophobic residue at position a by the Coils program 390
(http://www.ch.embnet.org/software/COILS_form.html), which is a tool for predicting 391
coiled-coil domains (Fig. 5B). Thus, to further confirm the importance of the C-terminal 392
coiled-coil domain of SsaE for protein-protein interaction, site-directed mutagenesis 393
was performed by using the plasmid pSsaE-FLAG as a template and replacing the 394
Ile-55 with glycine. While the resulting SsaEI55G-FLAG protein lacking the C-terminal 395
coiled-coil structure was stable in Salmonella, a substitution of Ile-55 to glycine in SsaE 396
resulted in a loss of the ability to interact with SseB (Fig. 5A). 397
398
Binding of SseB to SsaE is required for secretion of SseB. Next, to investigate the 399
functional importance of the C-terminal coiled-coil domain of SsaE, we constructed a 400
Salmonella mutant strain expressing SsaEI55G (chromosome mutant) and examined its 401
SseB secretion. This mutant strain was unable to secrete SseB into the supernatant in 402
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
18
LPM medium at pH 5.8, and the SseB secretion could be restored by introduction of the 403
wild-type ssaE gene on the plasmid into the SsaEI55G-expressing Salmonella strain (Fig. 404
6A). These results suggest that the interaction between SseB and SsaE is essential for 405
SseB secretion. In addition, we further examined the secretion of SPI-2 effector PipB in 406
an ssaEI55G mutant strain. Similar to SseB, less PipB-2HA fusion protein was secreted 407
into the supernatant from ssaEI55G mutant strain (Fig. 6B), suggesting that the 408
C-terminal coiled-coil domain of SsaE is important for secretion of the SPI-2 effectors. 409
410
It has been reported that SseA functions as a chaperone for SseB and is required for 411
stabilization of SseB in the bacterial cytosol and for SseB export to the bacterial surface 412
(9, 49, 62, 63). Therefore, to demonstrate the presence of the SseA-SseB-SsaE protein 413
complex in the Salmonella cytoplasm, the immunoprecipitation by FLAG pull-down 414
assays using lysates from the Salmonella strain expressing SseA-2HA (chromosomal 415
mutation) harboring the plasmids either pSsaE-FLAG or pBAP-FLAG were carried out. 416
The pulled-down proteins were detected by immunoblotting with anti-FLAG (for 417
SsaE-FLAG and BAP-FLAG), anti-HA (for SseA-2HA) and anti-SseB antibodies. As 418
shown in Fig. 6C, SseA-2HA and SseB were co-precipitated by SsaE-FLAG, but not 419
BAP-FLAG (data not shown). Thus, both SseA and SsaE were able to associate with 420
SseB in the Salmonella cytoplasm. 421
422
We next confirmed that SseA plays a role in SseB secretion using a Salmonella sseA 423
mutant strain. As previously reported, the sseA mutant strain exhibited a dramatic 424
decrease in the intracellular accumulation of SseB compared to that of the wild-type 425
strain, and secreted SseB was not detectable in the supernatant fraction by Western blot 426
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
19
analysis (data not shown). To rule out the possibility that reduced intracellular 427
production of SseB responsible for the defective secretion in the sseA mutant, we 428
constructed a plasmid (pACYC-SseB) expressing SseB constitutively and introduced it 429
into the wild-type strain and mutant strains deficient in sseA and ssaE genes. In addition, 430
Salmonella strains that lack SseB and SsaV harboring pACYC-SseB were used as 431
positive and negative controls for the SseB secretion. SseB was found in the 432
cytoplasmic fraction at levels similar to those for the wild-type strain when mutant 433
strains harbored a plasmid expressing SseB constitutively (Fig. 6D). However, no 434
detectable SseB was found by Western blot analysis of the supernatant fraction in the 435
ssaEmut and ssaEI55G mutant strains harboring the plasmid pACYC-SseB (Fig. 6D and 436
data not shown). In contrast, unlike in a previously reported study (49), SseB was easily 437
detected in the supernatant of the sseA mutant strain harboring pACYC-SseB (Fig. 6D). 438
The same results were obtained when detached fractions containing bacterial surface 439
proteins from these strains were analyzed by Western blotting using anti-SseB antibody 440
(data not shown). Our results suggest that, in addition to SseA, SsaE plays an important 441
role in SseB secretion. 442
443
SsaE, but not SseA, interacts with the putative SPI-2 T3SS ATPase SsaN. The type 444
III secretion apparatus is associated with an ATPase that presumably provides the 445
energy for the secretion process. Interestingly, mass spectrometer analysis revealed that 446
SsaE co-eluted the predicted SPI-2 T3SS ATPase SsaN. We thus examined whether the 447
binding of SsaE to SsaN could be mediated by direct SsaE-SsaN interaction or bridging 448
interactions with other SPI-2 proteins. To confirm this, SsaE was expressed in E. coli as 449
a FLAG-tagged fusion protein, and SsaN was expressed as a 2HA-tagged fusion protein. 450
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
20
SsaE-FLAG-fusion protein prepared from E. coli lysate was immobilized on FLAG 451
beads and then the SsaN-2HA fusion protein prepared from E. coli lysate was incubated 452
with FLAG-fusion protein immobilized beads. While the BAP-FLAG control protein 453
did not interact with SsaN-2HA (data not shown), SsaE-FLAG precipitated the 454
SsaN-2HA (Fig. 7A). This binding required the C-terminal coiled-coil domain of SsaE, 455
since SsaEI55G-FLAG and SsaE∆3 did not pull-down SsaN-2HA (Fig. 7B and data not 456
shown). 457
458
Furthermore, we investigated whether the SPI-2 T3SS chaperone SseA interacts with 459
SsaN. To do this, we performed FLAG pull-down assays using the E. coli lysates 460
expressing SseA-FLAG and SsaN-2HA fusion proteins. As shown in Fig. 7C, there was 461
no detectable interaction between SsaN-2HA and SseA-FLAG. These results suggest 462
that SsaE, but not SseA, interacts directly with SsaN, and this interaction requires the 463
C-terminal coiled-coil domain of SsaE. 464
465
SsaE is required for virulence. Finally, to examine the virulence function of ssaE in 466
vivo, we performed mixed infections in mice. Control experiments with the wild-type 467
strain and the wild-type strain harboring pMW118 showed a competitive index (CI) of 468
1.13 ± 0.19. The CI of the wild-type strain versus the ssaEI55G mutant strain harboring 469
pMW118 was significantly decresed to 0.047 ± 0.013 (p<0.01), compared to the SPI-2 470
mutant strain (the CI of the wild-type strain versus the ∆ssaV mutant harboring 471
pMW118 was 0.017 ± 0.026). In addition, the CI of the wild-type strain versus the 472
ssaEI55G mutant strain expressing intact SsaE from a plasmid was 1.16 ± 0.21 (no 473
significant difference from the CI of the wild-type strain), showing that the replication 474
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
21
defect of the ssaE point-mutant strain was due to the loss of SsaE function. These 475
results clearly demonstrate that ssaE contributes to Salmonella virulence in the mouse 476
model of systemic infection. 477
478
DISCUSSION 479
480
Bacterial type III secretion machines are involved in the transport of virulence effectors 481
directly into the cytoplasm of target cells (22). In the initial stages of the assembly of 482
the type III secretion apparatus, the T3SS is involved in protein secretion into the 483
extracellular space, while efficient translocation of effectors to the host cells takes place 484
when the T3SS is completely developed. In this study, we have characterized SsaE, 485
which is encoded by an operon for components of the type III secretion apparatus 486
within the SPI-2 locus. We show that SsaE is localized in the bacterial cytoplasm, 487
indicating that SsaE functions as neither a SPI-2 T3SS core component nor an effector. 488
The structural model of SsaE indicates that it is a protein similar to class V chaperones 489
of YscE family. Similar to generalized SPI-2 core component mutants, the S. enterica 490
serovar Typhimurium strain lacking SsaE failed to secrete translocator and effector 491
proteins, suggesting that ssaE is required for the complete SPI-2 T3SS function. In 492
addition, we demonstrated that SsaE was involved in Salmonella pathogenesis in a 493
mouse model of infection. 494
495
Generally, five different classes of T3SS proteins - i.e., proteins for apparatus, 496
translocators, effectors, chaperones, and regulators - are encoded by pathogenicity 497
islands. In addition to these proteins, a new class of type III secretion proteins has 498
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
22
recently been identified. This class of proteins is intracellularly localized and is 499
necessary for the ordered secretion of translocator and effector proteins through the 500
T3SS pathway. In Salmonella, InvE of SPI-1 (34) and SsaL and SsaM/SpiC of SPI-2 501
(10, 60) are suggested to be involved in the recognition of translocator complexes and to 502
establish the ordered secretion. Since some studies suggest that chaperones play a role 503
in setting the secretion hierarchy (3, 5), it is possible to speculate that SsaE is a protein 504
that can distinguish translocator protein SseB from other secreted proteins, and enable 505
the export of SseB at the appropriate time. In this study, however, we showed that while 506
Salmonella mutant strains carrying either SsaE, SsaL or SsaM mutation could not 507
secrete SseB into the culture supernatant, SsaL and SsaM mutants, but not the SsaE 508
mutant, were able to transport the SPI-2-dependent effectors including PipB, SopD2 and 509
SspH2, extracellularly. Thus, SsaE is functionally different from SsaL and SsaM/SpiC. 510
From these results, although we could not provide evidence concerning the effect of 511
ssaE mutation on the SPI-2 type III secretion apparatus, it is possible to note that, like 512
other T3SS class V chaperones, the inability of ssaE mutant strains to secrete SPI-2 513
effectors is due to failure to assemble the needle complex. Further analyses of secretion 514
and/or translocation of SPI-2 effectors by ssaE-deficient mutant strains are needed to 515
clarify SsaE function on SPI-2 type III secretion apparatus assembly. 516
517
The homologues of SsaE are conserved in several bacterial pathogens, including PscE 518
of P. aeruginosa (16%), YscE of Y. pestis (25%), EscE of EPEC (27%), and AscE of A. 519
hydrophila (33%), which function as a T3SS chaperone (class V). While Salmonella 520
SsaE shares some common characteristics with these T3SS class V chaperones, the role 521
of SsaE as a chaperone for SseB appears to be unique. In P. aeruginosa, PscE forms a 522
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
23
1:1:1 ternary heteromolecular complex composed of a putative chaperone PscG and a 523
needle component protein PscF, which is necessary to maintain a monomeric state of 524
PscF (47). Recently, the crystal structures of the PscE/PscF55-85/PscG complex (48), the 525
YscE/YscF/YscG complex (53), and the AscE/AscF/AscG complex (39) have resolved 526
the detailed protein-protein interactions between the chaperone-needle subunit complex 527
of T3SS. However, Salmonella harbors none of the PscG/YscG/AscG homologues. In 528
addition, SsaE is not associated with the stability of binding partner SseB, since the 529
ssaE mutant strain could express SseB at the same level as the wild-type strain, and 530
SseA has been shown to be required for stable expression of SseB as a chaperone (49, 531
62). These findings provide evidence that Salmonella SsaE should be categorized 532
structurally as a class V chaperone, although it has a distinct function from other class V 533
chaperones. 534
535
Although SseA has previously been found to be essential for export of SseB to the 536
bacterial surface in addition its principal role in stabilization of SseB within the 537
bacterial cytoplasm (49), our results showed that SseA is dispensable for SseB secretion 538
into culture supernatant. This apparent inconsistency is probably due to the difference in 539
sample-preparation procedures between the present study and the previous ones. We 540
adopted the in vitro secretion assays established by Coombes et al. (2004) (10) to detect 541
SPI-2-dependent secreted proteins using minimal medium previously reported to induce 542
the expression of SPI-2 genes (42) and an antibody specific for SseB (37). This 543
procedure is optimized for isolation of SPI-2 translocator proteins without the need to 544
extract the bacterial surface with n-hexadecane (49) or mechanical shearing (42), which 545
had previously been required to detect sufficient levels of SPI-2 translocator proteins. 546
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
24
Under the same assay conditions, the ssaE mutant strain did not secrete SseB into the 547
supernatant, suggesting that SsaE, rather than SseA, is essential for export of SseB. 548
549
Multiple chaperones have been reported to act with T3SS translocators for their 550
complete secretion. For example, EspA of EPEC is one of the T3SS substrates that 551
forms a needle structure on the bacterial membrane surface, and efficient secretion of 552
EspA requires two distinct chaperones, CesAB and CesA2. These chaperones increase 553
the stability of EspA and show direct EspA-binding activity (12, 13, 52). Recently, in 554
addition to CesAB and CesA2, it has been reported that EscL interacts directly with 555
EspA and enhances the stability of intracellular EspA, and is also essential for the 556
complete secretion of EspA (33). Similarly, we found that two small T3SS molecules, 557
SsaE and SseA, function as chaperones for the Salmonella SPI-2 translocator SseB, an 558
EspA homologue. Both chaperones have some common chaperone properties, which 559
include a low molecular mass (>15 kDa), an acid pI, and a C-terminal amphipathic helix 560
(2, 11, 56). However, these chaperones are functionally different, since SsaE associates 561
with the putative T3SS-associated ATPase SsaN, while SseA does not. Recent evidence 562
strongly suggests that the T3SS-associated ATPase promotes the initial docking of T3SS 563
substrates to the secretion apparatus, and subsequent translocation of proteins via T3SS 564
dependents on the protein motive force (1, 39, 46, 58). Thus, it might be expected that 565
SseB is efficiently escorted by SsaE to the type III secretion apparatus via specific 566
binding to SsaN. 567
568
In conclusion, the SPI-2-encoded small protein SsaE was shown to interact with the 569
T3SS translocator SseB and the putative ATPase SsaN. The C-terminal coiled-coil 570
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
25
domain of SsaE is critical for these protein-protein interactions. Furthermore, a point 571
mutation of Ile55 to glycine in SsaE completely abolishes the function of SsaE, and a 572
Salmonella strain expressing the point-mutated SsaE exhibits attenuated virulence in 573
mice, much like the SPI-2 component null mutant, suggesting that the coiled-coil 574
mediated protein-protein interactions of SsaE are absolutely essential for the functional 575
expression of SPI-2 T3SS. Since no T3SS component has been found to have a function 576
identical to that of SsaE, further studies will be needed to identify T3SS proteins that 577
play a role equivalent to that of SsaE. 578
579
ACKNOWLEDGMENTS 580
581
We are grateful to Kazuhiko Kanou and Hideaki Umeyama for the protein modeling and 582
for their helpful input. We also thank Seisuke Hattori for advice on mass spectrometry 583
experiments. 584
585
This work was supported in part by a Grant-in-Aid for Young Scientists (B) (17790292) 586
from the Japanese Ministry of Education, Culture, Sports, Science, and Technology and 587
by a Grant-in-Aid for Scientific Research C (21590490) from the Japan Society for the 588
Promotion of Science. Support (to T. M.) was also received in the form of a Kitasato 589
University Research Grant for Young Researchers (2009). 590
591
REFERENCES 592
593
1. Akeda, Y., and J. E. Galan. 2005. Chaperone release and unfolding of 594 substrates in type III secretion. Nature 437:911-5. 595
2. Bennett, J. C., and C. Hughes. 2000. From flagellum assembly to virulence: 596 the extended family of type III export chaperones. Trends Microbiol 8:202-4. 597
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
26
3. Birtalan, S. C., R. M. Phillips, and P. Ghosh. 2002. Three-dimensional 598 secretion signals in chaperone-effector complexes of bacterial pathogens. Mol 599 Cell 9:971-80. 600
4. Blocker, A., K. Komoriya, and S. Aizawa. 2003. Type III secretion systems 601 and bacterial flagella: insights into their function from structural similarities. 602 Proc Natl Acad Sci U S A 100:3027-30. 603
5. Boyd, A. P., I. Lambermont, and G. R. Cornelis. 2000. Competition between 604 the Yops of Yersinia enterocolitica for delivery into eukaryotic cells: role of the 605 SycE chaperone binding domain of YopE. J Bacteriol 182:4811-21. 606
6. Broms, J. E., P. J. Edqvist, K. E. Carlsson, A. Forsberg, and M. S. Francis. 607 2005. Mapping of a YscY binding domain within the LcrH chaperone that is 608 required for regulation of Yersinia type III secretion. J Bacteriol 187:7738-52. 609
7. Casadaban, M. J., and S. N. Cohen. 1980. Analysis of gene control signals by 610 DNA fusion and cloning in Escherichia coli. J Mol Biol 138:179-207. 611
8. Cirillo, D. M., R. H. Valdivia, D. M. Monack, and S. Falkow. 1998. 612 Macrophage-dependent induction of the Salmonella pathogenicity island 2 type 613 III secretion system and its role in intracellular survival. Mol Microbiol 614 30:175-88. 615
9. Coombes, B. K., N. F. Brown, S. Kujat-Choy, B. A. Vallance, and B. B. 616 Finlay. 2003. SseA is required for translocation of Salmonella pathogenicity 617 island-2 effectors into host cells. Microbes Infect 5:561-70. 618
10. Coombes, B. K., N. F. Brown, Y. Valdez, J. H. Brumell, and B. B. Finlay. 619 2004. Expression and secretion of Salmonella pathogenicity island-2 virulence 620 genes in response to acidification exhibit differential requirements of a 621 functional type III secretion apparatus and SsaL. J Biol Chem 279:49804-15. 622
11. Cornelis, G. R., and F. Van Gijsegem. 2000. Assembly and function of type III 623 secretory systems. Annu Rev Microbiol 54:735-74. 624
12. Creasey, E. A., R. M. Delahay, S. J. Daniell, and G. Frankel. 2003. Yeast 625 two-hybrid system survey of interactions between LEE-encoded proteins of 626 enteropathogenic Escherichia coli. Microbiology 149:2093-106. 627
13. Creasey, E. A., D. Friedberg, R. K. Shaw, T. Umanski, S. Knutton, I. 628 Rosenshine, and G. Frankel. 2003. CesAB is an enteropathogenic Escherichia 629 coli chaperone for the type-III translocator proteins EspA and EspB. 630 Microbiology 149:3639-47. 631
14. Dai, S., and D. Zhou. 2004. Secretion and function of Salmonella SPI-2 632 effector SseF require its chaperone, SscB. J Bacteriol 186:5078-86. 633
15. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of 634 chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl 635 Acad Sci U S A 97:6640-5. 636
16. Day, J. B., I. Guller, and G. V. Plano. 2000. Yersinia pestis YscG protein is a 637 Syc-like chaperone that directly binds YscE. Infect Immun 68:6466-71. 638
17. DeLano, W. L. 2002. The PyMoL molecular graphics system. DeLAno 639 Scientific, Palo Alto, CA, USA. 640
18. DeLano, W. L. 2002. Unraveling hot spots in binding interfaces: progress and 641 challenges. Curr Opin Struct Biol 12:14-20. 642
19. Evdokimov, A. G., J. Phan, J. E. Tropea, K. M. Routzahn, H. K. Peters, M. 643 Pokross, and D. S. Waugh. 2003. Similar modes of polypeptide recognition by 644 export chaperones in flagellar biosynthesis and type III secretion. Nat Struct 645
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
27
Biol 10:789-93. 646 20. Francis, M. S., S. A. Lloyd, and H. Wolf-Watz. 2001. The type III secretion 647
chaperone LcrH co-operates with YopD to establish a negative, regulatory loop 648 for control of Yop synthesis in Yersinia pseudotuberculosis. Mol Microbiol 649 42:1075-93. 650
21. Frishman, D., and P. Argos. 1995. Knowledge-based protein secondary 651 structure assignment. Proteins 23:566-79. 652
22. Galan, J. E., and A. Collmer. 1999. Type III secretion machines: bacterial 653 devices for protein delivery into host cells. Science 284:1322-8. 654
23. Garcia-del Portillo, F., M. B. Zwick, K. Y. Leung, and B. B. Finlay. 1993. 655 Salmonella induces the formation of filamentous structures containing 656 lysosomal membrane glycoproteins in epithelial cells. Proc Natl Acad Sci U S A 657 90:10544-8. 658
24. Gauthier, A., J. L. Puente, and B. B. Finlay. 2003. Secretin of the 659 enteropathogenic Escherichia coli type III secretion system requires components 660 of the type III apparatus for assembly and localization. Infect Immun 71:3310-9. 661
25. Harbury, P. B., T. Zhang, P. S. Kim, and T. Alber. 1993. A switch between 662 two-, three-, and four-stranded coiled coils in GCN4 leucine zipper mutants. 663 Science 262:1401-7. 664
26. Hensel, M., J. E. Shea, S. R. Waterman, R. Mundy, T. Nikolaus, G. Banks, A. 665 Vazquez-Torres, C. Gleeson, F. C. Fang, and D. W. Holden. 1998. Genes 666 encoding putative effector proteins of the type III secretion system of 667 Salmonella pathogenicity island 2 are required for bacterial virulence and 668 proliferation in macrophages. Mol Microbiol 30:163-74. 669
27. Hoiseth, S. K., and B. A. Stocker. 1981. Aromatic-dependent Salmonella 670 typhimurium are non-virulent and effective as live vaccines. Nature 671 291:238-239. 672
28. Hueck, C. J. 1998. Type III protein secretion systems in bacterial pathogens of 673 animals and plants. Microbiol Mol Biol Rev 62:379-433. 674
29. Jantsch, J., C. Cheminay, D. Chakravortty, T. Lindig, J. Hein, and M. 675 Hensel. 2003. Intracellular activities of Salmonella enterica in murine dendritic 676 cells. Cell Microbiol 5:933-45. 677
30. Jones, D. T. 1999. Protein secondary structure prediction based on 678 position-specific scoring matrices. J Mol Biol 292:195-202. 679
31. Klein, J. R., and B. D. Jones. 2001. Salmonella pathogenicity island 2-encoded 680 proteins SseC and SseD are essential for virulence and are substrates of the type 681 III secretion system. Infect Immun 69:737-43. 682
32. Knodler, L. A., J. Celli, W. D. Hardt, B. A. Vallance, C. Yip, and B. B. Finlay. 683 2002. Salmonella effectors within a single pathogenicity island are differentially 684 expressed and translocated by separate type III secretion systems. Mol Microbiol 685 43:1089-103. 686
33. Ku, C. P., J. C. Lio, S. H. Wang, C. N. Lin, and W. J. Syu. 2009. 687 Identification of a third EspA-binding protein that forms part of the type III 688 secretion system of enterohemorrhagic Escherichia coli. J Biol Chem 689 284:1686-93. 690
34. Kubori, T., and J. E. Galan. 2002. Salmonella type III secretion-associated 691 protein InvE controls translocation of effector proteins into host cells. J 692 Bacteriol 184:4699-708. 693
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
28
35. Lee, S. H., and J. E. Galan. 2004. Salmonella type III secretion-associated 694 chaperones confer secretion-pathway specificity. Mol Microbiol 51:483-95. 695
36. Lupas, A. 1996. Coiled coils: new structures and new functions. Trends 696 Biochem Sci 21:375-82. 697
37. Miki, T., N. Okada, and H. Danbara. 2004. Two periplasmic disulfide 698 oxidoreductases, DsbA and SrgA, target outer membrane protein SpiA, a 699 component of the Salmonella pathogenicity island 2 type III secretion system. J 700 Biol Chem 279:34631-42. 701
38. Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use in 702 construction of insertion mutations: osmoregulation of outer membrane proteins 703 and virulence determinants in Vibrio cholerae requires toxR. J Bacteriol 704 170:2575-83. 705
39. Minamino, T., and K. Namba. 2008. Distinct roles of the FliI ATPase and 706 proton motive force in bacterial flagellar protein export. Nature 451:485-8. 707
40. Morona, R., L. van den Bosch, and P. A. Manning. 1995. Molecular, genetic, 708 and topological characterization of O-antigen chain length regulation in Shigella 709 flexneri. J Bacteriol 177:1059-68. 710
41. Mota, L. J., L. Journet, I. Sorg, C. Agrain, and G. R. Cornelis. 2005. 711 Bacterial injectisomes: needle length does matter. Science 307:1278. 712
42. Nikolaus, T., J. Deiwick, C. Rappl, J. A. Freeman, W. Schroder, S. I. Miller, 713 and M. Hensel. 2001. SseBCD proteins are secreted by the type III secretion 714 system of Salmonella pathogenicity island 2 and function as a translocon. J 715 Bacteriol 183:6036-45. 716
43. Nishio, M., N. Okada, T. Miki, T. Haneda, and H. Danbara. 2005. 717 Identification of the outer-membrane protein PagC required for the serum 718 resistance phenotype in Salmonella enterica serovar Choleraesuis. Microbiology 719 151:863-73. 720
44. Ochman, H., F. C. Soncini, F. Solomon, and E. A. Groisman. 1996. 721 Identification of a pathogenicity island required for Salmonella survival in host 722 cells. Proc Natl Acad Sci U S A 93:7800-4. 723
45. Ogata, K., and H. Umeyama. 2000. An automatic homology modeling method 724 consisting of database searches and simulated annealing. J Mol Graph Model 725 18:258-72, 305-6. 726
46. Paul, K., M. Erhardt, T. Hirano, D. F. Blair, and K. T. Hughes. 2008. Energy 727 source of flagellar type III secretion. Nature 451:489-92. 728
47. Quinaud, M., J. Chabert, E. Faudry, E. Neumann, D. Lemaire, A. Pastor, S. 729 Elsen, A. Dessen, and I. Attree. 2005. The PscE-PscF-PscG complex controls 730 type III secretion needle biogenesis in Pseudomonas aeruginosa. J Biol Chem 731 280:36293-300. 732
48. Quinaud, M., S. Ple, V. Job, C. Contreras-Martel, J. P. Simorre, I. Attree, 733 and A. Dessen. 2007. Structure of the heterotrimeric complex that regulates type 734 III secretion needle formation. Proc Natl Acad Sci U S A 104:7803-8. 735
49. Ruiz-Albert, J., R. Mundy, X. J. Yu, C. R. Beuzon, and D. W. Holden. 2003. 736 SseA is a chaperone for the SseB and SseD translocon components of the 737 Salmonella pathogenicity-island-2-encoded type III secretion system. 738 Microbiology 149:1103-11. 739
50. Shea, J. E., M. Hensel, C. Gleeson, and D. W. Holden. 1996. Identification of 740 a virulence locus encoding a second type III secretion system in Salmonella 741
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
29
typhimurium. Proc Natl Acad Sci U S A 93:2593-7. 742 51. Sory, M. P., and G. R. Cornelis. 1994. Translocation of a hybrid 743
YopE-adenylate cyclase from Yersinia enterocolitica into HeLa cells. Mol 744 Microbiol 14:583-94. 745
52. Su, M. S., H. C. Kao, C. N. Lin, and W. J. Syu. 2008. Gene l0017 encodes a 746 second chaperone for EspA of enterohaemorrhagic Escherichia coli O157 : H7. 747 Microbiology 154:1094-103. 748
53. Sun, P., J. E. Tropea, B. P. Austin, S. Cherry, and D. S. Waugh. 2008. 749 Structural characterization of the Yersinia pestis type III secretion system needle 750 protein YscF in complex with its heterodimeric chaperone YscE/YscG. J Mol 751 Biol 377:819-30. 752
54. Takeda-Shitaka, M., G. Terashi, D. Takaya, K. Kanou, M. Iwadate, and H. 753 Umeyama. 2005. Protein structure prediction in CASP6 using CHIMERA and 754 FAMS. Proteins 61 Suppl 7:122-7. 755
55. Thomas, N. A., W. Deng, J. L. Puente, E. A. Frey, C. K. Yip, N. C. 756 Strynadka, and B. B. Finlay. 2005. CesT is a multi-effector chaperone and 757 recruitment factor required for the efficient type III secretion of both LEE- and 758 non-LEE-encoded effectors of enteropathogenic Escherichia coli. Mol 759 Microbiol 57:1762-79. 760
56. Wattiau, P., B. Bernier, P. Deslee, T. Michiels, and G. R. Cornelis. 1994. 761 Individual chaperones required for Yop secretion by Yersinia. Proc Natl Acad 762 Sci U S A 91:10493-7. 763
57. Wilharm, G., S. Dittmann, A. Schmid, and J. Heesemann. 2007. On the role 764 of specific chaperones, the specific ATPase, and the proton motive force in type 765 III secretion. Int J Med Microbiol 297:27-36. 766
58. Wilharm, G., V. Lehmann, K. Krauss, B. Lehnert, S. Richter, K. 767 Ruckdeschel, J. Heesemann, and K. Trulzsch. 2004. Yersinia enterocolitica 768 type III secretion depends on the proton motive force but not on the flagellar 769 motor components MotA and MotB. Infect Immun 72:4004-9. 770
59. Yip, C. K., B. B. Finlay, and N. C. Strynadka. 2005. Structural 771 characterization of a type III secretion system filament protein in complex with 772 its chaperone. Nat Struct Mol Biol 12:75-81. 773
60. Yu, X. J., M. Liu, and D. W. Holden. 2004. SsaM and SpiC interact and 774 regulate secretion of Salmonella pathogenicity island 2 type III secretion system 775 effectors and translocators. Mol Microbiol 54:604-19. 776
61. Zhou, H., and Y. Zhou. 2004. Single-body residue-level knowledge-based 777 energy score combined with sequence-profile and secondary structure 778 information for fold recognition. Proteins 55:1005-13. 779
62. Zurawski, D. V., and M. A. Stein. 2003. SseA acts as the chaperone for the 780 SseB component of the Salmonella Pathogenicity Island 2 translocon. Mol 781 Microbiol 47:1341-51. 782
63. Zurawski, D. V., and M. A. Stein. 2004. The SPI2-encoded SseA chaperone has 783 discrete domains required for SseB stabilization and export, and binds within the 784 C-terminus of SseB and SseD. Microbiology 150:2055-68. 785
786 787
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
30
788 FIGURE LEGENDS 789
790
Figure 1. SsaE encodes a protein that represents structurally the characteristics of 791
class V chaperones. (A) Genetic organization of SPI-2 genes involved in the virulence 792
of S. enterica serovar Typhimurium. Six representative promoters (P) within SPI-2 are 793
indicated. Genes encoding proteins for apparatus (yellow), effectors and translocators 794
(red), chaperones (orange), and regulators (green) are colored. The ssaE gene is 795
indicated by blue. The genes spiBAC and spiR are also referred to as ssaDCB and ssrA, 796
respectively. (B) Sequence alignment between SsaE and its reference structure of Y. 797
pestis YscE (PDB ID: 1ZW0). The numbering of the SsaE primary sequence is 798
indicated above the sequences. The secondary structure elements are indicated under the 799
sequences. The regions of SsaE that were predicted to be α-helices by PSI-PRED (30) 800
are highlighted in red. The regions of YscE that were assigned as α-helices by STRIDE 801
(21) are highlighted in red. (C) Ribbon representation of SsaE predicted by the FAMS 802
program (45) in stereo view at two different angles. Images were prepared using the 803
program PyMol (17, 18). Three predicted α-helical regions, α1, α2 and α3, are 804
indicated. (D) Superposotion of the model of SsaE (green) and the structure of YscE 805
(yellow). The root mean square deviation of these structures is 0.26Å. 806
807
Figure 2. SsaE is a cytoplasmic protein. (A) The S. enterica serovar Typhimurium 808
wild-type strain expressing the SsaE-FLAG from the chromosome was grown in LPM 809
medium (pH 5.8). Bacterial cells were fractionated into periplasm, cytoplasm and 810
membrane fractions. The fractions were analyzed by Western blotting using anti-FLAG 811
antibody to detect SsaE-FLAG. DnaK and PagC were used as markers of the 812
cytoplasmic and membrane protein fractions, respectively. (B) Western blot analysis of 813
secreted proteins (Supernatant) and whole cell lysates (Cell lysate) prepared from the 814
wild-type, the spiAC133S mutant and the wild-type strain expressing SsaE-FLAG. Protein 815
fractions were blotted with anti-SseB (left) and anti-FLAG antibodies (right). 816
817
Figure 3. SsaE is required for Salmonella SPI-2 T3SS-dependent secretion. (A) S. 818
enterica serovar Typhimurium strains were grown in LPM medium (pH 5.8), and the 819
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
31
culture supernatants were collected by centrifugation. Secreted proteins were 820
precipitated by the addition of TCA. The protein samples from equal numbers of 821
bacteria were analyzed by Western blotting with anti-SseB antibody in the secreted 822
protein fraction (Supernatant) and the whole cell lysates (Cell lysate). (B) S. enterica 823
serovar Typhimurium wild-type and isogenic mutants harboring the plasmid 824
pPipB-2HA were grown in LPM medium (pH 5.8), and the protein samples from equal 825
numbers of bacteria were subjected to Western blot analysis to detect PipB-2HA and 826
SseB in secreted protein fractions (Supernatant) and the whole cell lysates (Cell lysate). 827
828
Figure 4. SsaE interacts with the SPI-2 T3SS translocator protein SseB. Interaction 829
of SsaE with SseB was analyzed by pull-down assay using bacterial lysates of 830
Salmonella wild-type strains harboring the plasmid pBAP-FLAG as a negative control 831
(A) or pSsaE-FLAG (B). Samples were taken before the binding of beads (Lysate), after 832
the final washing with beads (Final wash), and after the elution of fraction with FLAG 833
peptide (Elute). Equal amounts of samples were analyzed by SDS-PAGE and Western 834
blotting with anti-FLAG, anti-SseB, and anti-PagC antibodies. (C) GST pull-down assay 835
using GST or GST-SseB and probed for SsaE-FLAG. Bacterial lysate of E. coli strain 836
DH5α harboring pSsaE-FLAG was incubated with GST or GST-SseB immobilized 837
glutathione Sepharose beads. Samples from lysates before the addition of beads (Lysate), 838
and proteins retained on beads (Elute) were analyzed by SDS-PAGE and Western 839
blotting with anti-FLAG and anti-GST antibodies. A Silver-stained SDS-PAGE gell of 840
the elution fractions from pull-down experiments shows the proteins in each sample 841
(bottom). 842
843
Figure 5. The C-terminal coiled-coil domain of SsaE is required for protein-protein 844
interaction. (A) Predicted α-helical regions, α1, α2 and α3, in SsaE (grey) are 845
indicated (top). The full-length SsaE-FLAG fusion protein and a series of mutant 846
derivatives are represented by a solid bar with the corresponding results of the FLAG 847
pull-down assays (right). The region of the internal in-frame deletions in SsaE∆2-FLAG 848
and SsaE∆3-FLAG are indicated by a thin line. The signs + and – indicate binding and 849
no binding, respectively. Interactions of SsaE and its derivatives with SseB in the 850
pull-down assay were visualized by immunoblotting with anti-SseB antibody. (B) The 851
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
32
Helix Wheel model of the C-terminal coiled-coil motif of the SsaE α3 region spanning 852
amino acids 52 to 68. The hydrophobic amino acids within the amphipathic helix are 853
denoted by red. 854
855
Figure 6. SsaE, but not SseA, is required for SseB secretion in vitro when SseB is 856
overexpressed. (A) The expression and secretion of SseB in the whole cell lysate (Cell 857
lysate) and culture supernatant (Supernatant) from the S. enterica serovar Typhimurium 858
wild-type, ∆ssaV, ssaEI55G, and ssaEI55G harboring pSsaE were analyzed by Western 859
blotting with anti-SseB antibody. (B) The expression and secretion of PipB-2HA in the 860
whole cell lysate (Cell lysate) and culture supernatant (Supernatant) from the S. 861
enterica serovar Typhimurium wild-type, ssaEI55G, ∆ssaL, and ∆ssaLssaEI55G harboring 862
pPipB-2HA were analyzed by Western blotting with anti-HA antibody. (C) The 863
formation of SsaE-SseB-SseA ternary complex in the Salmonella cytoplasm was 864
analyzed by FLAG pull-down assays using bacterial lysates from Salmonella wild-type 865
strain expressing the SseA-2HA from the chromosome and harboring pSsaE-FLAG. 866
Equal amounts of samples (Lysate, Final wash, and Elute) were analyzed by 867
SDS-PAGE and Western blotting with anti-HA (for SseA-2HA), anti-FLAG (for 868
SsaE-FLAG), and anti-SseB antibodies. (D) The S. enterica serovar Typhimurium 869
wild-type strain and isogenic mutants harboring the plasmid pACYC-SseB were grown 870
in LPM medium (pH 5.8), and secreted proteins were precipitated by the addition of 871
TCA. Samples from secreted protein fraction (Supernatant) and whole cell lysates (Cell 872
lysate) were analyzed by Western blotting with anti-SseB antibody. 873
874
Figure 7. SsaE interacts with a putative SPI-2 T3SS ATPase SsaN by C-terminal 875
coiled-coil binding. E. coli strain MC1061 harboring the plasmids expressing 876
SsaE-FLAG (A), SsaEI55G-FLAG (B), and SseA-FLAG (C) was grown in LB medium. 877
FLAG-fusion proteins from lysates were immobilized on the anti-FLAG M2 affinity 878
beads. Bacterial lysate prepared from E. coli strain MC1061 harboring the plasmid 879
expressing SsaN-2HA was then incubated with FLAG-fusion protein-immobilized 880
beads. After the final washing with beads (Final wash), FLAG fusion proteins binding 881
to the affinity beads were eluted by adding FLAG peptide (Elute). Samples from 882
bacterial lysates before the addition of beads, and coprecipitated proteins were analyzed 883
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
33
by Western blotting with anti-FLAG and anti-HA antibodies. 884
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
34
885
TABLE 1. Salmonella strains and plasmids used in this study Strain or plasmid Description Reference Salmonella strains SL1344 serovar Typhimurium, rpsL, hisG (27) TM312 SL1344 derivative expresses SsaE-FLAG This study TM133 SL1344 derivative containing spiAC133S (37) TM131 Non-polar deletion of ssaV (∆ssaV) This study
TM323 SL1344 derivative containing ssaEmut This study TM198 Non-polar ssaL::kan mutant This study
TM203 Double mutant, ∆ssaL::kan, spiAC133S This study
TM204 Double mutant, ∆ssaL::kan, ssaEmut This study
TM205 Double mutant, ∆ssaL::kan, ssaEI55G This study
TM325 SL1344 derivative expresses SsaEI55G This study TM192 Non-polar deletion of sseA (∆sseA) This study TM194 Non-polar deletion of sseB (∆sseB) This study TM254 SL1344 derivative expesses SseA-2HA This study Plasmids pMW118 Low-copy-number expression vector Nippon Gene pFLAG-CTC FLAG fusion vector Sigma pBAP-FLAG pFLAG-CTC expressing BAP-FLAG Sigma pGEX-6P-1 GST fusion vector GE Healthcare pACYC184 Middle-copy-number expression vector New England Biolabs
pCACTUS Suicide vector, sucrose-sensitive, repts (40) pMS109 Plasmid containing cyaA (51) pLDΩKm2 pLD54 derived suicide plasmid This study pACPJ-2HA pACYC184 derivative contains 2HA with sseJ promoter This study pACPJ-CyaA-2HA pACPJ-2HA contains cyaA This study pACHS-2HA pACYC184 contains 2HA This study p2HA-CTC pFLAG-CTC derivative contains 2HA instead of FLAG This study pLD-SsaE-FLAG ssaE-FLAG in pLDΩKm2 This study pSsaE-2HA pACPJ-2HA expressing SsaE-2HA This study pSseF-2HA pACPJ-2HA expressing SseF-2HA This study pSsaE-CyaA-2HA pACPJ-CyaA-2HA expressing SsaE-CyaA-2HA This study pSseF-CyaA-2HA pACPJ-CyaA-2HA expressing SseF-CyaA-2HA This study
pCACTUS-ssaEmut ssaEmut in pCACTUS This study
pCACTUS-ssaEI55G ssaEI55G in pCACTUS This study pSsaE ssaE in pMW118 This study pPipB-2HA pACHS-2HA expressing PipB-2HA from pipB promoter This study pSsaE-FLAG pFLAG-CTC expressing SsaE-FLAG This study
pSsaE∆1-FLAG pFLAG-CTC expressing SsaE21-80-FLAG This study
pSsaE∆2-FLAG pFLAG-CTC expressing SsaE∆21-41-FLAG This study
pSsaE∆3-FLAG pFLAG-CTC expressing SsaE∆52-68-FLAG This study
pSsaEI55G-FLAG pFLAG-CTC expressing SsaEI55G-FLAG This study pSseA-FLAG pFLAG-CTC expressing SseA-FLAG This study pGEX-SseB pGEX-6P-1 expressing GST-SseB This study
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
35
pACYC-SseB sseB in pACYC184 This study pSsaN-2HA p2HA-CTC expressing SsaN-2HA This study
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
36
886 TABLE 2. Primers used in this study Primer Sequence (restriction site) ssaV-red-FW 5'-ATTATATCGTTTGTCACTCACAATCAGCACATCACGG CTGGTGTAGGCTGGAGCTGCTTC-3' ssaV-red-RV 5'-TCTGCGTCTTATGACGAGACGACAGCGCAGTATAGG TCCCCATATGAATATCCTCCTTAG-3' ssaL-red-FW 5'-GAAGATAAAAGAGGTAGCGATGAATATTAAAATTAA TGAGGTGTAGGCTGGAGCTGCTTC-3' ssaL-red-RV 5'-AAAGCCAATTTACCTAAATATTGAAAGCCAGGTATC AGAACATATGAATATCCTCCTTAG-3' sseB-red-FW 5'-GGGAAGTCAAAACCCTATTGTGTTTAAAAATAGCTT CGGCGTGTAGGCTGGAGCTGCTTC-3' sseB-red-RV 5'-TCTGCGCTATCATACTGGAAATTTCCCCCCACTTACT GATCATATGAATATCCTCCTTAG-3' sseA-red-FW 5'-TAGTTAGCACGTTAATTATCTATCGTGTATATGGAGG GGAGTGTAGGCTGGAGCTGCTTC-3' sseA-red-RV 5'-TTCCCCATAAGATGTTTCCTGAAGACATTATGCTTTA CCTCATATGAATATCCTCCTTAG-3' sseA-2HA-red-FW 5'-TCAAGCCCCGGTGGAGATACCGTCAGGAAAAACAAA AAGGTATCCGTATGATGTGCCGGA-3’ sseA-2HA-red-RV 5'-CAATAGGGTTTTGACTTCCCCATAAGATGTTTCCTGA AGACATATGAATATCCTCCTTAG-3’ ssaE-SacI-FW 5'-CCAGAGCTCCCGATGTGGTAACGATTAAAC-3' (SacI) ssaE-SphI-RV 5'-AAAGCATGCAAGAGCCTATCCCATTAGGGC-3' (SphI) sseB-FW 5'-ACGACTGAAACAACTTAATGCTCAAGCCCC-3' sseB-RV 5'-AACCGCATCGTGTCATGTGCCTGTTGTAGG-3' sseB-FW-BamHI 5'-CCCGGATCCTCTTCAGGAAACATCTTATGG-3' (BamHI) sseB-XhoI-RV 5'-AAGCTCGAGTCATGAGTACGTTTTCTGCGC-3' (XhoI) ssaE-XhoI-FW 5'-GGGCTCGAGACTTTGACCCGGTTAGAAGAT-3' (XhoI) ssaE-BglII-RV 5'-GGGAGATCTCTCTTGCTCACTCACTACAAG-3' (BglII) sseF-FW-XhoI 5'-AAACTCGAGATTCATATTCCGTCAGCGGCA-3' (XhoI) sseF-RV-BamHI 5'-AAAGGATCCTGGTTCTCCCCGAGATGTATG-3' (BamHI) sseA-XhoI-FW 5'-GGGCTCGAGATAAAGAAAAAGGCTGCGTTT-3' (XhoI) sseA-BamHI-RV 5'-CCCGGATCCCCTTTTTGTTTTTCCTGACGG-3' (BamHI) PropipB-XhoI-FW 5'-AAACTCGAGTACGTCTGAACTACACCAGCG-3' (XhoI) pipB-BglII-RV 5'-CCCAGATCTAAATATCGGATGGGGGAAAAG-3' (BglII) ssaE-StuI-R3 5'-CCCAGGCCTCTCGAGAAGCTTCATATGATA-3' (StuI) ssaE-StuI-R4 5'-CCCAGGCCTATAATTTTACAATTAAGGGCT-3' (StuI) ssaE-StuI-R1 5'-TTTAGGCCTGCCTTTGGCCTCTTCACGCGA-3' (StuI) ssaE-StuI-R2 5'-TTTAGGCCTCCGCAGCAATATCAGCAAAAC-3' (StuI) ssaE-StuI-R7 5'-CCCAGGCCTCAATAAGGTGTTTTGCTGATA-3' (StuI) ssaE-StuI-R8 5'-ACCAGGCCTTACCATACCAGCGCACTTGTA-3' (StuI) sense-ssaEATGmut 5'-TAGATTTTAAGTGAGTGGAAGCTTACAACTTTGACCCGGTTAGAA-3' (HindIII) antisense-ssaEATGmut 5'-TTCTAACCGGGTCAAAGTTGTAAGCTTCCACTCACTTAAAATCTA-3' (HindIII) sense-ssaEI55G 5'-AACACCTTATTGCTTGAAGCCGGCGAGCAGGCCGAAAATATC-3' (NaeI) antisense-ssaEI55G 5'-GATATTTTCGGCCTGCTCGCCGGCTTCAAGCAATAAGGTGTT-3' (NaeI) 2HA-StuI-1 5'-GGGAGGCCTTATCCGTATGATGTGCCGGATTATGCGTATCCGTATGATGTGCC GGATTATGCGTAGGACTACAAGGACGACGATGACAAG-3' (StuI) 2HA-StuI-2 5'-TTTAGGCCTGTCGACAGATCTGGTACCCGGGAATTC-3' (StuI) FLAG-SphI-FW 5'-CCTGCATGCTCACACAGGAGATATCATCTG-3' (SphI)
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
37
FLAG-BamHI-RV 5'-CCCGGATCCTATTGTCTCATGAGCGGATAC-3' (BamHI) ProsseJ-SalI-FW 5'-GGGGTCGACTCACATAAAACACTAGCACTT-3' (SalI) ProsseJ-SphI-RV 5'-CCCGCATGCAGTGTCCTCCTTACTTTATTA-3' (SphI) FLAG-SphI+ATG-FW 5'-CCTGCATGCTCACACAGGAGATATCATATG-3' (SphI) cyaA-BglII-FW 5'-AAAAGATCTCAGCAATCGCATCAGGCTGGT-3' (BglII) cyaA-XhoI-RV 5'-AAACTCGAGGTCATAGCCGGAATCCTGGCG-3' (XhoI) ssaN-XhoI-FW 5'-GGGCTCGAGAATGAATTGATGCAACGTCTG-3' (XhoI) ssaN-BamHI-RV 5'-CCCGGATCCCTCGGTGAGTATTTGGTGTAA-3' (BamHI)
887 888
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
a3
Na1
C
a2
PssaM
ssaU T S R Q P O N V M L K J IHG sscB sscA ssaE D C B ssrA B
sseG F E D C BA spiB A C R
PssaG PsseA PspiC PssrA PssrB
Figure 1
1 10 20 30 40 MTTLTRLEDLLLHSREEAKGIILQLRAARKQLEENNGKLQ
---MTQLEEQLHN-VETVRSITMQLEMALTKLKKDMMRGG
a1
a3
a2
41 50 60 70 80
DPQQYQQNTLLLEAIEQAENIINIIYYRYHNSALVVSEQE
DAKQYQVWQRESKALESAIAIIH-----YVAGDL
SsaE
YscE
SsaE
YscE
A
B
C
a3
N
a1
C
a2
D
N C
a1a2
a3
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
Figure 2
DnaK
PagC
SsaE-FLAG
Perip
lasm
Cyt
opla
sm
Mem
bran
e
A
Supernatant
Cell lysate
blot: anti-SseB
wt sp
iA C13
3S
wt (
SsaE-F
LAG
)
blot: anti-FLAG
B
wt sp
iA C13
3S
wt (
SsaE-F
LAG
)
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
Figure 3
Cell lysate
Supernatant
wt ss
aV
ssaE
mut
ssaE
mut
/pM
W11
8
ssaE
mut
/pSsa
E
blot: anti-SseB
A
ssaL
ssaL
ssaE
mut
Supernatant
Cell lysate
ssaL
spiA
C13
3S
Supernatant
Cell lysate
PipB-2HA
SseB
B
wt/p
ACH
S-2H
A
wt
spiA
C13
3S
ssaE
mut
+ pPipB-2HA
blot: anti-SseB
blot: anti-HA
SseB
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
A
Lysat
e
Final
was
h
Elute
SL1344/
pBAP-FLAG
IP: FLAG
BAP-FLAG
SseB
PagC
Lysat
e
Final
was
h
Elute
SL1344/
pSsaE-FLAG
IP: FLAG
SseB
PagC
SsaE-FLAG
B
Figure 4
SsaE-FLAG
GST-SseB
GST
SsaE-FLAG
GST
GST-SseB
Lysat
e
a-FLAG
a-GST
PD: GST
- + -
- - +
Elute
Silver stain
28
19
16
10
37435570
(kDa)
GST-SseB
GST
SsaE-FLAG
C
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
a1
SsaE-FLAG
SsaE
SsaE
SsaE
SsaEI55G-FLAG
801
1 20 42 80
21 80
1 80
SseB
binding
51 80691
SsaE N C
a2 a3
Lysat
e (S
seB)
Final
was
h
Elute
blot:anti-SseB
Lysat
e (F
LAG
)
+
+
+ - -
I55G
IP: FLAG
blot:anti-FLAG
SseB
Figure 5
B
e
f
g
a
b
d
c
N48
I55
I62
T49
E56
N63
L50
Q57
I64
L51
A58
I65
L52
E59
Y66
E53
N60
Y67
A54
I61
R68
SsaE a3
A
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
A
wt ss
aV
ssaE
I55G
ssaE
I55G /p
SsaE
Supernatant
Cell lysate
blot: anti-SseB
SseB
Figure 6
Supernatant
wt ss
aV
ssaE
mut
wt ss
eBss
eA
blot: anti-SseB
Cell lysate
+pACYC-SseB
SseB
B
Supernatant
Cell lysate
wt
ssaE
I55G
ssaL
ssaLss
aE
I55G
blot: anti-HA
+pPipB-2HA
PipB-2HA
C
a-SseB
Elute
Lysat
e
Final
was
h
a-FLAG
a-HA
pSsaE-FLAG
SL1344 sseA-2HA/
IP: FLAG
D
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from
Figure 7
SsaE-F
LAG
SsaN
-2H
A
Final
was
h
SsaE-FLAG
SsaN-2HA
Elute
SsaN-2HA
SseA-FLAG
SseA
-FLA
G
SsaN
-2H
A
Final
was
h
IP: FLAG
Elute
A B
C
SsaEI55G-FLAG
SsaN-2HA
SsaEI5
5G-F
LAG
SsaN
-2H
A
Final
was
h
IP: FLAG
Elute
IP: FLAG
on January 12, 2019 by guesthttp://jb.asm
.org/D
ownloaded from