From just £19 one way!!!!

High throughput genotyping

The first step

Published online: 5 May 2003, doi:10.1038/nbt821Nature Biotechnology: June 2003 Volume 21 Number 6 pp 673 - 678 

Multiplexed genotyping with sequence-tagged molecular inversion probesPaul Hardenbol1, 3, Johan Banér2, Maneesh Jain1, 3, Mats Nilsson2, Eugeni A Namsaraev1, 3, George A Karlin-Neumann1, 3, Hossein Fakhrai-Rad1, 3, Mostafa Ronaghi1, Thomas D Willis1, 3, Ulf Landegren2 & Ronald W Davis1

 

1. Stanford Genome Technology Center, Stanford University, 855 California Avenue, Palo Alto, California 94304, USA.2. The Beijer Laboratory, Department of Genetics and Pathology, Rudbeck Laboratory, Se-751 85 Uppsala, Sweden.3. Present address: ParAllele BioScience 384 Oyster Point Blvd Suite 8, S. San Francisco, California 94080, USA.

Parallel gene analysis with allele-specific padlock probes and tag microarrays

Johan Banér, Anders Isaksson, Erik Waldenström1, Jonas Jarvius, Ulf Landegren* and Mats Nilsson

The Beijer Laboratory, Department of Genetics and Pathology, Rudbeck Laboratory, SE-751 85 Uppsala, Sweden and Department of Medical Sciences, Uppsala University Hospital, SE-751 85 Uppsala, Sweden

Fig. 2. Consensus sequences for winter and spring genotypes of the region amplified by VRN-A1-specific primers (indicated in bold-italic letters at the beginning and end of the sequence). Dots in the sequence from the spring varieties indicate identical bases with the sequences from the winter varieties. The three differences found between the ‘s’ and ‘w’ haplotypes are indicated by bold letters. AciI restriction sites are underlined. The location of the allele specific primer 361W-F is indicated in underlined italic letters.

A PCR Marker for Growth Habit in Common Wheat Based on Allelic Variation at the VRN-A1 Gene J. D. Sherman, L. Yan, L.

Talbert and J. Dubcovsky

Line Array S/W Sequence

Scorpion SCadenza SRialto WXi19 SChinese Spring SMercia WMalacca W?Synthetic SHobbit WCap Desprez WThatcher SParagon S

Note Red: Spring allele (C), Green: Winter allele (T)

Rht 2: AGAAGCTGGAGCAGCTCGAGATGGCCATGGGGATGGGCGGCGTGGGCGCCGGCGCCGCCCCCGACGACMercia D: AGAAGCTGGAGCAGCTCGAGATGCCCATGGGGATGGCCGGCGTGGGCGCCGGCGCCGCCCCCGACGACMercia D isog: AGAAGCTGGAGCAGCTCGAGATGGCCATGGGGATGGGCGGCGTGGGCGCCGGCGCCGCCCCCGACGACMalacca D AGAAGCTGTAGCAGCTCGAGATGGCCATGGGGATGGGCGGCGTGGGCGCCGGCGCCGCCCCCGACAGCWizard D AGAAGCTGTAGCAGCTCGAGATGGCCATGGGGATGGGCGGCGTGGGCGCCGGCGCCGCCCCCGACAGC

Rht 1 * Mercia B: AGAAGCTGGAGCAGCTGGAGATGGCCATGGGGATGGCCGGCGTGGGCGCCGGCGCCGCGCCCGACGACMercia B isog: AGAAGCTGGAGTAGCTGGAGATGCCCATGGGGATGGTCGGCGTGGGCGCCGGCGCCGCGCCCGACGACStephen allele: AGAAGCTGGAGTAGCTGGAGATGGCCATGGGGATGGGCGGCGTT

Line Array

Scorpion Rht 2 Rht 1

Cadenza Rht 2

Rht 1

Rialto Rht 2

Rht 1

Xi19 Rht 2

Rht 1

Chinese Spring Rht 2

Rht 1

Rht2: Green is wild type

Rht1: Red is wild type

Pinb-D1a Phenotype, molecular changePinb-D1a Soft, wild-type

Pinb-D1a Hard, puroindoline a null

Pinb-D1b Hard, puroindoline b, GGC - › AGC, Gly-46 to Ser-46

Pinb-D1c Hard, puroindoline b, CTG - › CCG, Leu-60 to Pro-60

Pinb-D1d Hard, puroindoline b, TGG - › AGG, Trp-44 to Arg-44

Pinb-D1e Hard, puroindoline b null, TGG - › TGA, Trp-39 to stop codon

Pinb-D1f Hard, puroindoline b null, TGG - › TGA, Trp-44 to stop codon

Pinb-D1g Hard, puroindoline b null, TGC - › TGA, Cys-56 to stop codon

Number Made? Size Locus

ProbeSet01557A 1 y 109 GliadinProbeSet01557ProbeSet01196A 2 y 116 PinbProbeSet01196B 3 y 116 PinbProbeSet00177A 4 y 114 DyProbeSet00177B 5 y 114 DyProbeSet00361A 6 y 109 vrn-A1ProbeSet00361B 7 y 109 Vrn-A1ProbeSet00082A 8 y 117 DyProbeSet00082B 9 y 117 DyProbeSet00417A 10 y 103 rht1ProbeSet00417B 11 y 103 Rht1ProbeSet00424A 12 y 104 rht2ProbeSet00424B 13 y 104 Rht2ProbeSet01971A 14 y 109 PinbProbeSet01971B 15 y 109 PinbProbeSet00097A 16 y 111 PinbProbeSet00097B 17 y 111 PinbProbeSet01304A 18 y 115 PinbProbeSet01304B 19 y 115 PinbProbeSet00317A 20 y 109 PinbProbeSet00317B 21 y 109 PinbProbeSet00222A 22 y 111 PinbProbeSet00222B 23 y 111 Pinb

VrnA1 Pind-g Pinb-d Gliadin

+ con Pinb-f Pind-c -con

Dy - con Pinb-b Rht2

Dy Pinb-e –con Rht1

Mercia Scorpion Cadenza

Rialto X119 Andrew

Rht1: Red is wildRht2: Green is wildVrnA: Green is winter

Pinb: red is Pinb-D1a

Pinb-D1a Phenotype, molecular changePinb-D1a Soft, wild-type

Pinb-D1a Hard, puroindoline a null

Pinb-D1b Hard, puroindoline b, GGC - › AGC, Gly-46 to Ser-46

Pinb-D1c Hard, puroindoline b, CTG - › CCG, Leu-60 to Pro-60

Pinb-D1d Hard, puroindoline b, TGG - › AGG, Trp-44 to Arg-44

Pinb-D1e Hard, puroindoline b null, TGG - › TGA, Trp-39 to stop codon

Pinb-D1f Hard, puroindoline b null, TGG - › TGA, Trp-44 to stop codon

Pinb-D1g Hard, puroindoline b null, TGC - › TGA, Cys-56 to stop codon

Name locus Red mean PCR 2 Green mean PCR 2 Red mean PCR 3 Green mean PCR 3 Red mean PCR 4 green mean PCR 4G2 water control control 11 19 59 231.2 5.4 -5.6I1 water control control 2.6 20 8 16.4 173.8 4.2L1 water control control 3.8 9.8 2.8 17.2 -5.6 -3.2N4 water control control -0.8 4.4 16.8 10.2 4.8 6.8A4 hyb N hyb control 23480.6 24152.6 15763.8 12453.2 17738 16286.6C3 hyb N hyb control 13129 10614 9023.6 5776.4 2275.6 2617.6H2 hyb N hyb control 8002.6 5060 9399.8 5384.4 10173.2 7035.8E2 hyb control hyb control 12767.8 10061.8 16948 12980.6 16166.6 13784.2F4 hyb control hyb control 2821.8 2275.4 33198 29001 11061 12235.8O1 hyb control hyb control 6063.4 3997.8 9885.8 6229.8 3958.8 2997.4F2 hyb C aa hyb control 19999.8 18840.2 65201 65019.4 28906 32283.4G4 hyb C aa hyb control 22551.4 22205.8 47366.4 45185.4 42007.2 44959.6P1 hyb C aa hyb control 22889 20941.6 29198.2 21569.2 28507.6 28141A3 1216 N Gliadin 490 41018.4 364 26907.4 267.2 28008.6C2 1216 N Gliadin 125.4 16256.2 256.4 20299.6 124.6 16518.8L3 1216 N Gliadin 214.8 11316.4 611.6 41799.6 112.2 16121.6D3 PS01557 Gliadin 1073.8 21269 372.4 9560.4 548 17866F1 PS01557 Gliadin 357.4 10444.4 851.4 16170.2 594.4 19201.8M3 PS01557 Gliadin 1288.8 32853.8 1417.8 33564.4 261.4 12458.8B1 PS01196 Pinb 39 3968.2 555 4679.8 418.8 7118.4 144.2C4 PS01196 Pinb 39 5063.8 691.6 9410 698.6 5207.8 97H3 PS01196 Pinb 39 7171 783.8 12988.8 1068 9995.4 180.6D4 PS00177 Dy10 65383 5178.2 45759.2 1878.6 49445 2560F3 PS00177 Dy10 35302.4 2048.4 58386.8 5308.4 42938 2396.8M1 PS00177 Dy10 47172.8 3285.2 42770 2032.2 27788.4 1361.4B2 PS00361 Vrn-A1 1396.2 23681.6 559.2 9263.4 971.2 29964.4I3 PS00361 Vrn-A1 1866 31987.4 4008.6 53511 902.2 30574.2P2 PS00361 Vrn-A1 733.4 11642 1427 16614.6 403.4 10786.8J3 PS00082 Dy5 1389.4 10933 2788.4 10746 278.8 10089L2 PS00082 Dy5 1103.6 4750.6 782 3330.2 68 2671O4 PS00082 Dy5 1109.8 6171.8 1983.2 9280.4 142 8886.2E4 3207 N Rht1 62119.2 2239 39684.4 1073.4 20317.8 520.6N2 3207 N Rht1 43074 762.8 37244.4 886 43252.8 1055.4O3 3207 N Rht1 21343.8 371.8 39087 986.2 41637.4 900.4A2 PS00417 Rht1 24428.4 432.4 32190 651.2 23577.6 414.6D1 PS00417 Rht1 64666.2 1690.2 37006.8 698.2 35708.8 845.4K4 PS00417 Rht1 46592.8 1095.8 65364.8 2823.6 45701 1331.6B4 3317 N Rht2 617.4 9792.2 818.6 8735.4 441.4 11574K2 3317 N Rht2 693.2 8858.4 1323.8 16774.6 219.4 4767.6P3 3317 N Rht2 702.8 8430.8 881.4 9342.8 158.2 2942E3 PS00424 Rht2 836.4 13453.6 1083.8 15184.8 258.2 8056.8H1 PS00424 Rht2 1650.4 22056.2 2781.4 30919.2 507.4 15002.6N1 PS00424 Rht2 594 11189.2 1106.4 15313 311.2 9791.4B3 PS01971 Pinb1-d 6057.4 17152 4491.6 20037.4 1726.4 24763.4G1 PS01971 Pinb1-d 7652.6 26110.6 10764 41545.4 3913 48803.2P4 PS01971 Pinb1-d 11621.8 27636.2 10044.4 36541.4 2911.6 33620J1 PS00097 Pinb1-f 873.6 960.2 2954.4 2004.6 1781.4 814.4K3 PS00097 Pinb1-f 1244 1143.8 2312.2 1685.2 598.6 734.8M2 PS00097 Pinb1-f 2367.4 1240.8 4541 1881.2 1503 649.2D2 PS01304 Pinb1-g 1685.6 272.6 2027.4 323.2 2315 3.2G3 PS01304 Pinb1-g 3546.8 552.4 11790.6 1739.6 3754 97.8I4 PS01304 Pinb1-g 6287.2 1029.4 6333 1043.4 2189.6 52A1 PS00317 Pinb1-b 704.6 14909.6 537.6 7486.2 288.8 9767J4 PS00317 Pinb1-b 3683.8 710.8 12109.4 1614.4 8677.6 278.8O2 PS00317 Pinb1-b 5550 996.2 10553 1508.8 5651.6 170.4C1 PS00222 Pinb1-c 10902.6 207.2 28295.2 585 9328.4 202.2J2 PS00222 Pinb1-c 32571.2 643.8 39221.4 797.4 24687.6 444.8M4 PS00222 Pinb1-c 57798.8 2294.6 48170.2 1003 29089.6 648.4

We are currently testing a 140 loci MIPs chip consisting of :

Various HMW and LMW Glutenins, Pinb-Da-g, Rht 1 and 2, 2x vrn-A1, vrn-B1, various genes involved in starch syntheses, various disease resistance genes and a whole collection of random SNPs identified at Bristol and from various laboratories throughout the wheat community.

Dilution experiments suggest that there should be no reduction in signal at less than 5,000 multiplex. Single tube assays up to 10,000 could be acheivable! If we had the SNPs

If you any SNPs that you wish to include please do let us have them ASAP!!

 

University of Bristol: Alex Reid

Helen O’Sullivan

Gary Barker

Jane Coghill

Advanta: Simon Berry

And the various members of the wheat community for sharing their SNPs

Acknowledgements