Fraga2005_EpigeneticTwinStudy

8/3/2019 Fraga2005_EpigeneticTwinStudy

1/12

Epigenetic differences arise during the lifetimeof monozygotic twinsMario F. Fraga*, Esteban Ballestar*, Maria F. Paz*, Santiago Ropero*, Fernando Setien*, Maria L. Ballestar,Damia Heine-Suner, Juan C. Cigudosa, Miguel Urioste, Javier Benitez, Manuel Boix-Chornet,Abel Sanchez-Aguilera, Charlotte Ling, Emma Carlsson, Pernille Poulsen**, Allan Vaag**,Zarko Stephan, Tim D. Spector, Yue-Zhong Wu, Christoph Plass, and Manel Esteller*

*Epigenetics, Cytogenetics, and Genetic Laboratories, Spanish National Cancer Centre (CNIO), Melchor Fernandez Almagro 3, 28029 Madrid, Spain;Department of Behavioral Science, University of Valencia, 46010 Valencia, Spain; Molecular Genetics Laboratory, Genetics Department, Son DuretaHospital, 07014 Palma de Mallorca, Spain; Department of Clinical Sciences, University Hospital Malmo, Lund University, S-205 02 Malmo, Sweden; **StenoDiabetes Center, 2820 Gentofte, Denmark; Twin Research and Genetic Epidemiology Unit, St. Thomas Hospital, London SE1 7EH, United Kingdom; andHuman Cancer Genetics Program, Department of Molecular Virology, Immunology, and Medical Genetics, Ohio State University, Columbus, OH 43210

Edited by Stanley M. Gartler, University of Washington, Seattle, WA, and approved May 23, 2005 (received for review January 17, 2005)

Monozygous twins share a common genotype. However, most

monozygotic twin pairs are not identical; several types of pheno-

typic discordance may be observed, such as differences in suscep-

tibilities to disease anda wide range of anthropomorphic features.

There are several possible explanations for these observations, but

one is the existenceof epigenetic differences.To address this issue,

we examined the global and locus-specific differences in DNA

methylation and histone acetylation of a large cohort of monozy-

gotic twins. We found that, although twins are epigenetically

indistinguishable during the early years of life, older monozygous

twins exhibited remarkable differences in their overall content and

genomic distribution of 5-methylcytosine DNA and histone acety-

lation, affecting their gene-expression portrait. These findings

indicate how an appreciation of epigenetics is missing from our

understanding of how different phenotypes can be originated

from the same genotype.

DNA methylation epigenetics histones

Human monozygotic (MZ) twins account for 1 in 250 live births(1). The origin of MZ twins is attributed to two or moredaughter cells of a single zygote undergoing independent mitoticdivisions, leading to independent development and births. They areconsidered genetically identical, but significant phenotypic discor-dance between them may exist. This quality is particularly notice-able for psychiatric diseases, such as schizophrenia and bipolardisorder (2). MZ twins have been used to demonstrate the role ofenvironmental factors in determining complex diseases and phe-

notypes, but the true nature of the phenotypic discordance never-theless remains extremely poorly understood. In this context,differences in the placenta, amniotic sac, and vascularization of theseparate cell masses or even mosaicism in genetic and cytogeneticmarkers in MZ may exist (3), although the published studies are

very few in number. Thus, the real causes for MZ twin discordancefor common diseases and traits remainto be established. Epigeneticdifferences may be an important part of the solution to this puzzle.

Materials and Methods

Subjects. Eighty volunteer Caucasian twins from Spain were re-cruited in thestudy, including 30 male and 50 female subjects. Theirmean (SD) age was 30.6 (14.2) years (range, 374 years). Twinsstudied included monochorionic and dichorionic. All subjects, or inthe case of children, the parents, gave their informed writtenconsent to be included in the study. Lymphocyte cells were purifiedby standard procedures and stored at 80C. In eight cases,

epithelial skin cells were obtained from buccal smears. Musclebiopsy tissues (n 14) from the vastus lateralis muscle and s.c.abdominal tissue (n 4) were obtained by needle suction underlocal anesthesia from volunteer MZ twins from Denmark and theUnited Kingdom, respectively. Homozygosity was determined byusing highly polymorphic short tandem-repeat loci. With fivemarkers, the probability that any twin pair was MZ if all markers

were concordant was 99% (5).

X-Inactivation Analysis. Androgen receptor locus methylation anal-ysis was performed based on PCR on genomic DNA digested withthe methylation-sensitive restriction enzyme HpaII where only theandrogen receptor gene residing on the inactivated X chromosomeis amplified (6, 7).

High-Performance Capillary Electrophoresis Quantification of Global

Histone H3 and H4 Acetylation. Global histone H4 acetylation(AcH4) and histone H3 acetylation (AcH3) were quantified asdescribed in ref. 8. In brief, individual histone H3 and histone H4fractions were prepared from cell nuclei and further purified byreversed-phase high-performance liquid chromatography (HPLC)

on a Jupiter C18 column (Phenomenex, Torrance, CA). Histoneswere eluted with an acetonitrile gradient (2060%) in 0.3% trif-luoroacetic acid using an HPLC gradient system (BeckmanCoulter). Nonacetylated, monoacetylated, and diacetylated histoneH3 and H4 derivatives were resolved by high-performance capillaryelectrophoresis. All samples were analyzed in duplicate, and threemeasurements were made per replicate.


2/12

boiled, treated with nuclease P1 for 16 h at 37C, and treated withalkaline phosphatase (Sigma) for an additional 2 h at 37C. Afterhydrolysis, total cytosine and 5mC content was measured bycapillary electrophoresis using a PACE MDQ system (BeckmanCoulter). Relative 5mC content was expressed as a percentage with

respect to the total cytosine content.

Amplification of Intermethylated Sites (AIMS). AIMS was developedas described in ref. 9. The nonmethylated sites were cut in an initialdigestion using the methylation-sensitive endonuclease SmaI (Am-ersham Pharmacia Biotech, Buckinghamshire, U.K.), which leavesblunt ends. A second digestion was performed using the isoschi-zomer PspAI (Stratagene), which leaves a CCGG overhang. DNAfragments flanked by two ligated adaptors were amplified by PCRusing specific primers that hybridize to the adaptor sequence and

the restriction site and one or more additional, arbitrarily chosennucleotides. The PCR products were run on polyacrylamide ureasequencing gels. Bands appearing differentially methylated wereexcised from dried polyacrylamide gels and cloned into plasmid

vectors. Automatic sequencing of multiple colonies was performedto ascertain the unique identity of the isolated band.

Analysis of Sequence-Specific DNA Methylation. The methylationstatus of specific genomic DNA sequences was established bybisulfite genomic sequencing (9). Automatic sequencing of 12

colonies for each sequence was performed to obtain data on themethylation status of every single CpG dinucleotide for statisticalanalysis. Primer sequences are available in Table 2, which ispublished as supporting information on the PNAS web site.

Real-Time Quantitative RT-PCR Expression Analyses. QuantitativeRT-PCRs were performed in 96-well optical plates, in a volume of20 l per well. Each reaction mixture contained 1 l of theappropriate dilution of the experimental cDNA (1:10 to 1:100), 5pmol of each primer, and 10 l of 2 SYBRGreen PCR Master

Mix (Applied Biosystems). All measurements were performed intriplicate. Expression values were normalized against the expressionof GAPDH as an endogenous control. PCRreactions were run andanalyzed by using the Prism 7700 Sequence Detection System(Applied Biosystems).

Competitive Hybridization of AIMS Products to Metaphase Chromo-

somes. To study the distribution of the AIMS-amplified DNAwithin the chromosomes, we hybridized equimolecular quantitiesfrom both members of the twin pair. The AIMS product from one

of the twins was labeled with Spectrum Red dUTP using acomparative genomic hybridizationnick-translation kit (Vysis), andthe AIMS products of the other twin was labeled with SpectrumGreen. The mixture was then hybridized onto normal metaphasechromosome spreads, following the comparative genomic hybrid-ization protocol described in ref. 9. All experiments were carriedout twice.

Affymetrix GeneChip. Biotinylated target RNA was prepared from5 g of total RNA by following the Affymetrix protocol and washybridized on the Human U133 Plus 2.0 array GeneChips (Af-fymetrix, Santa Clara, CA). The hybridization reactions wereprocessed and scanned according to the standard Affymetrix

protocols. To select genes that were differently expressed in twinsiblings, ANOVA P values were adjusted by using multiple com-parison procedures. The expression profiles of twins were com-pared in scatter plots.

Questionnaires. All subjects were interviewed by properly trainedpersonnel to complete the questionnaire about their health, nutri-tional habits, physical activities, pharmacological treatments, andtobacco, alcohol, and drug consumption. Weight and height weremeasured, and a family tree of genetic history was drawn up by the

interviewer. The data collected in the questionnaires were enteredinto a database as nominal (natural health history), ordinal (per-centage of lifetime shared, nutritional habits, physical activity, andconsumption of folates, alcohol,tobacco,and drugs), andnumerical(age, weight, and height) variables, which were subsequently usedto estimate the phenotypicenvironmental distance between twinpairs.

Statistics. First, a descriptive value was obtained for each individualcorresponding to each epigenetic variable (5mC, AcH4, andAcH3).The similarity between twin pairs for each variable was estimated

as the Euclidean squared distance (ESD) by subtracting theirrespective descriptive values. By using these distances, the relation-ships between the phenotypic-environmental data and the epige-netic variables were examined by categorical principal componentanalysis, using SPSS software (Version 11.5; SPSS, Chicago). Cat-egorical principal component analysis reduced all of the original

variables from the questionnaire to two new uncorrelated compo-nents or variables (aging and health). The aging principalcomponent included the variables of age, weight, and height and isan indicator of the ontogenic development of the twins. The health

principal component grouped the variables of diseases and phar-macological treatments. To identify mixed-effects models and toestimate the contribution of each random effect to the variance ofthe dependent variable, the variance component procedure wasassessed by ANOVA. The relationship between all of the singlequestionnaire variables and the new phenotypic-environmental

variables (aging and health) vs. the epigenetic data was evaluated bythe Pearson test.

Results

Inclusion of Cases and Zygosity Typing. The starting biological

material studied was DNA and RNA from peripheral lymphocytes.In all cases, the true MZ twin status was confirmed by microsatelliteanalysis (Fig. 1A) (7).

Comparison of X Chromosome Inactivation Patterns in MZ Twins. Oneof the most obvious epigenetic layers where MZ twins may differis X chromosome inactivation in females, where discordant skewingof X chromosome inactivation has been observed for specific

MEDICALSCIENCES

SEE

COMMENTARY


3/12

Comparison of 5mC DNA Content and Histone H3 and H4 Acetylation

Levels in MZ Twin Pairs. The epigenetic circumstances of the MZtwins proved to be more remarkable when we took a more global

approach to the comparison of the DNA methylation and histoneacetylation content of the MZ twins. For each pair, we determinedthe 5mC genomic content and the acetylation levels of histones H3and H4 by HPLC and high-performance capillary electrophoresis(8) (see Table 3, which is published as supporting information onthe PNAS web site). Replicate samples at time-points 0, 2, 4, 6, and12 weeks for eight MZ tw in pairs were assessed to determineshort-time fluctuations in the described epigenetic parameters, andno significant changes were observed (Pearson test, P 0.05) (seeFig. 5, which is published as supporting information on the PNAS

web site). Illustrative examples of the three different analyses areshown in Fig. 1C. We found that 65% (26 of 40) of MZ twins hadalmost identical 5mC genomic content andoverall acetylation levels

of histones H3 and H4 in each sibling pair. However, in 35% (14 of40) of the twin pairs all three different epigenetic characters weresignificantly different in each twin (Pearson test, P 0.05) (Fig. 1).Most importantly, we found a direct association between theremarkable epigenetic differences observed and the age of the MZtwins: the youngest pairs were epigenetically similar, whereas theoldest pairs were clearly distinct (Pearson test, P 0.05) (Fig. 1C).

To discard the possibility that the observed age-dependentepigenetic differences in the MZ twin pairs were simply due to ageneral increase in the epigenetic variability in an older population,

Fig. 1. Epigenetic differences arise in MZ twins. (A) Two representative examples of the determination of monozygosity using microsatellite markers. ( B)

Quantification of X chromosome inactivation by PCR amplification of the androgen receptor locus after digestion with the DNA methylation-sensitive and

-insensitive restriction enzymes HpaIIand MSp I, respectively. Twoexamplesof a differentpattern of X inactivation between MZ twinpairs are shown. (C Upper)

Quantification of global 5mC DNA content (Left), histone H4 acetylation (Center), and histone H3 acetylation (Right) by HPLC and high-performance capillary

electrophoresis. (C Lower) Comparison of epigenetic values between the siblings of each 3- and 50-year-old twin pair. Results are expressed as mean SD.


4/12

we performed ANOVA (see Table 4, which is published as sup-

porting information on the PNAS web site). ANOVA was used tocompare two parameters: individual epigenetic values, to compareepigenetic variability in the entire population, and ESD betweentwins, as a measure of variability between twin pairs. First, weanalyzed the descriptive epigenetic values for each individual andcompared it with the rest of the population, organized into young(28 years old) vs. old (28 years old) age-groups. Statisticalanalysis of individual descriptive parameters provides informationabout variability within the whole population and in the two agegroups. Second, we used the ESD to test whether older vs. youngerMZ twins are significantly more different within their pairs. Wefound that the epigenetic variability among individuals is high andsimilar (see Table 5, which is published as supporting informationon the PNAS web site), regardless of the age group to whichindividuals belong(Pearson test,P0.05). In contrast, the variancecorresponding to the ESD in the older MZ twin group is signifi-cantly higher than that obtained for the younger group (Pearsontest, P 0.05). These results suggest that older twins are epige-netically more different between pairs than younger twins, and thisdifference is not associated with an increased variance in thedescriptive epigenetic parameters of the older population.

Finally, we also found that those twin pairs who, according to thequestionnaire, had spent less of their lifetime together andor hada more different natural healthmedical history were those whoalso showed the greatest differences in levels of 5mC DNA andacetylation of histones H3 and H4 levels (Pearson test, P 0.05).

Genomic Screening and Loci Identification of DNA Methylation Dif-

ferences in MZ Twin Pairs. We next examined where in the MZ twingenomes these epigenetic differences arose by using a globalmethylation DNA fingerprinting technique, A IMS (9). The A IMS

approach provides a methylation fingerprintconstitutedby multipleanonymous bands or tags, representing DNA sequences flanked bytwo methylated sites, which can be isolated. An illustrative AIMSresult in a MZ twin pair is shown in Fig. 2A. Approximately 600

AIMS bands were resolved in the gels, and we found that between0.5% and 35% of the bands were different (on the basis of theirpresence or absence) within MZ twin pairs. Those MZ twins withthe most differential AIMS bands were those with the greatest

single-copy genes. To confirm that these sequences featured DNA

methylation differences in the twins, we carried out bisulfitegenomic sequencing of multiple clones. The analysis of four dif-ferent Alu sequences and two single-copy genes demonstrated thatin those MZ twin pairs from which they were isolated, one siblinghad dense CpG hypermethylation, whereas the other was predom-inantly hypomethylated at that particular sequence (Fig. 2B). Mostimportantly, for both Alus and single-copy genes, differentialmethylation was associated with a different expression of thatparticular sequence in the MZ twin pair, the presence of DNAmethylation being associated with silencing or reduced expression.Table 1 summarizes the results.

Table 1. Summary of DNA sequences with methylation changes identified by AIMS in MZ twin pairs

Locus Accession Function Chr. loc.

No.

CpGs

CpG methylation,* %

Twin A Twin B Change

Alu-Sx AC006271 19p13.2 30 72.1 55.3 16.8

Alu-Sp U14572 19p133 17 68.1 29.9 38.2

Alu-E2F3 AF547386 6p22 2 81.8 100 18.2

PKD1P2 NG002795 Polycystic kidney disease 1 16p13 7 90.9 83.5 7.4

Alu-Sc U14571 8p111 4 66.6 63.3 3.3

GUK1 BC006249 Guanylate kinase 1 1q42 18 2.8 9.7 6.9

Chr. loc., chromosome location; , unknown.

*Twelve clones per locus.

MEDICALSCIENCES

SEE

COMMENTARY


5/12

Identification of Chromosomal Regions with DNA Methylation Differ-

ences in MZ Twin Pairs. We also investigated the geographical

distribution of DNA methylation differences within the chro-mosomes of MZ twin pairs by competitively hybridizing the

AIMS PCR products to metaphases to determine the differen-tially methylated DNA regions (9). The AIMS products fromeach component of one individual of an MZ twin pair werecompetitively hybridized with those of his or her sibling. Thedata obtained demonstrated that the twin pairs with similar 5mCDNA content, acetylation levels of H3 and H4, and A IMS DNA

distributed DNA methylation events (hypermethylation andhypomethylation) throughout the chromosomes described

above.

Global CpG Island Methylation Differences in MZ Twin Pairs Charac-

terized by RLGS. Twins differentially methylated sequences ob-tained by the AIMS approach also included CpG islands located inthe promoter regions of single-copy genes. We implemented aspecific strategy for further characterizing global genomic methyl-

i diff i h i DNA i W bj d

Fig. 4. Differences in promoterCpG island DNAmethylation andexpression profiles in MZ twins areassociated withaging. (A) Example ofan RLGS profilefrom

a 50-year-old twinpair showingthe presenceof an RLGSfragment C14orf162 in TwinA, indicated by thearrow, in whose sister (TwinB) it is significantlyreduced.(B) Southernblot analysis confirms the CpG island methylation difference in C14orf162betweentwins. All linescontainDNA digestedwith EcoRV. The DNA was

alsodigested withNotI, as indicatedby. (C) Bisulfitegenomicsequencing of 12 clones of the C14orf162promoter CpGisland in the 50-year-old twinpair. Black

and white dots indicate methylated and unmethylated CpGs, respectively. Below the sequences are two representative electropherograms showing sequence-

specific DNA methylation changes at the C14orf162 promoter in the 50-year-old twin pair. (D) The older MZ twins display the greatest differences in gene

expression profiles between siblings. (Left) Scatter plots showing expression profiles of 3- and 50-year-old twin pairs. ( Right) Number of overexpressed and

repressed genes obtained by DNA array analyses in the 3-year-old compared with the 50-year-old twin pair.


6/12

Portraits of Gene Expression in MZ Twin Pairs. Finally, we addressedthe ultimate goal of allmajor epigenetic modification: global changein gene expression. We examined whether older twin pairs whodiffered most with respect to DNA methylation and histone acet-

ylation levels in general and at specific loci also displayed the most

different gene expression profiles. To this end, we extracted RNAfrom the two most distinct pairs of twins (the 3- and 50-year-oldpairs) and performed gene expression microarray analysis. Theresults obtained when each twin expression portrait was confronted

with its own sibling demonstrated that although the expressionpatterns of the 3-year-olds were almost identical, the 50-year-oldtwins had extremely different expression profiles (Fishers exact test,P 0.029) (Fig. 4D). From a quantitative standpoint, there werefour times as many differentially expressed genes in the older twinpair as in theyounger twin pair. Furthermore, theolder twin sibling

with themostsevere DNA hypomethylation and histone H3 and H4hyperacetylation (the epigenetic changes usually associated withtranscriptional activation) was that with the highest number ofoverexpressed genes (Fig. 4D). Most importantly, and internallycorroborating our data, all of the aforementioned single-copy genesidentified by AIMS or RLGS as being differentially methylated inthe twin pairs also showed different gene expression in our mi-croarray analysis.

Epigenetic Differences in MZ Twin Pairs Occur Across Different Tissue

Types. Although our study had focused on the DNA methylation

andhistoneacetylation changes observed in the lymphocytes of MZtwins, we thought that it would be extremely interesting to analyzethe existence of epigenetic differences among other cell types,especially because the described discordances between MZ twinsare also present across different organs and cellular functions. Tothis end, we studied the 5mC DNA content, the acetylation statusof histone H3 and H4, and the patterns of loci-specific DNAmethylation by the AIMS approach, methyl-specific comparativegenomic hybridization, and bisulfite genomic sequencing in MZtwins couples by using epithelial mouth cells, intraabdominal fat,

and skeletal muscle biopsies. We found that in these three newtissues, in the same manner that we had observed in lymphocytes,marked epigenetic differences were present in older MZ twins withdifferent lifestyles and that had spent less of their lives together(Pearson test,P 0.05) (see Fig. 6, which is published as supportinginformation on the PNAS web site). Thus, distinct profiles of DNAmethylation and histone acetylation patterns among many differenttissues arise during the lifetime of MZ twins that may contribute tothe explanation of some of their phenotypic discordances andunderlie their differential frequencyonset of common diseases.

DiscussionAlthough genomic information is uniform among the different cellsof a complex organism, the epigenome varies from tissue to tissue,controlling the differential expression of genes and providingspecific identity to each cell type. DNA methylation and histonemodifications store epigenetic information that mainly controlsheritable states of gene expression (12, 13), and it is now well estab-lishedthatboth epigenetic layers are mechanistically linked(12 13)

Our study reveals that the patterns of epigenetic modifications inMZ twin pairs diverge as they become older. Differences inepigenetic patterns in genetically identical individuals could beexplained by the influence of both external and internal factors.Smokinghabits, physical activity, or diet, among others, areexternal

factors that have been proposed to have a long-term influence onepigenetic modifications (12, 13). However, it is possible that smalldefects in transmitting epigenetic information through successivecell divisions, or maintaining it in differentiated cells, accumulate ina process that could be considered as an epigenetic drift associ-ated with the aging process (14, 15). Identification of proteins thatmediate these effects has provided an insightful view into thiscomplex process and in the diseases that occur when it is perturbed(12, 13). Accumulation of epigenetic defects would probably occurat a faster rate than that corresponding to genetic mutationsbecause their consequences in survival are probably less dramatic

and cells have not developed a comparable amount of mechanismsto correct them.

MZ twins constitute an excellent example of how geneticallyidentical individuals can exhibit differences and therefore providea unique model to study the contributionrole of epigenetic mod-ifications in the establishment of the phenotype (2, 1618). Whatdoes make MZ twins differ? By using whole-genome and locus-specific approaches, we found that approximately one-third of MZtwins harbored epigenetic differences in DNA methylation andhistone modification. These differential markers between twins are

distributed throughout their genomes, affecting repeat DNA se-quences and single-copy genes, and have an important impact ongene expression. We also established that these epigenetic markers

were more distinct in MZ twins who were older, had differentlifestyles, and had spent less of their lives together, underlining thesignificant role of environmental factors in translating a commongenotype into a different phenotype. Our findings also support therole of epigenetic differences in the discordant frequencyonset ofdiseases in MZ twins (2, 1618).

Other evidence indicates that relatively small differences inepigenetic patterns can have a large impact in phenotype, for

instance in cloned animals (4), with MZ twins representing naturalhuman clones. Another powerful example is provided by the agoutimouse (19). In this model, diet affects the methylation status of aninserted intracisternal A particle element that changes the animalscoat color: an environmental factor interacting with a single geno-type, mediated by an epigenetic change, to produce a differentphenotype. In humans, the investigation of how assisted reproduc-tive technology that uses media with undisclosed concentrations ofmethyl-donors associates with epigenetic errors such as imprintingdefects and cancer has been proposed (20). Our comparison of MZ

twins suggests that external andor internal factors can have animpact in the phenotype by altering the pattern of epigeneticmodifications and thus modulating the genetic information. Futurestudies should now address the specific mechanisms responsible forthe observed epigenetic drift of MZ twins.

We thank all our volunteer twins and Sara Casado, Lidia Lopez-Serra,Miguel Alaminos, and Alicia Barroso from the Spanish National CancerCentre. M.F.F. is funded by the Foundation of the Spanish AssociationA i t C (AECC)

MEDIC

ALSCIENCES

SEE

COMMENTARY


7/12

Table 2. Primer sequences and annealing temperatures (Tm) for bisulfitesequencing and quantitative RT-PCR reactions

Locus 5 Primer 3 Primer Tm,C

Bisulfite sequencingAlu-Sx ggtgggaggtttaggtatgg acacttaaaaaacccttcaacccac 60Alu-Sp tttggtgattaggaaggygggta aaactaatctcaaactccctacctc 60Alu-E2F3 ggtaataattttaaaatttgggggt attaaaaaaaccaatcaacccrtaa 60PKD1P2 ggggaaattgaggtatagagag ataaaaaactctacccttaacctatc 58Alu-Sc tttaggttggagtgtagaggta aactaaacaatacacacrcctc 56GUK1 ggttagygaggtattgaggtaagt ccrttctcaaaacccacaattaaatac 60

C14ORF162 gtttgtatgaggtttaygagg caacraataactcttcctacctattc 58

Quantitative RT-PCRAlu-Sx gctgcaggtcccaagcc tttctcaccgggccttagc 60Alu-Sp tctcagcgttttgggaggtc ctcgctatgttgcccaggat 60Alu-E2F3 cgacttgtctcccagaagcc accagtcagcccgtgagaag 60PKD1P2 gtatcccttctgccctccca gtgaactgcccccaggatct 60Alu-Sc ggccaggctggtctcttaaa gtacacacgcctcaatccca 60

y stands for c or t; r stands for g or a.


8/12

Table 3. Epigenetic and epidemiological values in monozygotic twins

Sex: M, male; F, female. Monozygosity, probability of monozygosity using five highly polymorphic short tandem repeat loci. ESD, Euclidean squared distance. AIMS, Amplification of Inter-Methylated Sites; the number of differentially methylated bands

within pairs are shown. Xi, X-chromosome inactivation pattern; NA, not applicable; NI, not informative; B-Xi, balanced pattern of X-chromosome inactivation; C-S-Xi, concordant-skewed pattern of X-chromosome inactivation; D-S-Xi discordant-skewedpattern of X-chromosome inactivation. % 5mC, relative 5-methylcytosine DNA levels. Ac(0-4)-H4, relative non-, mono-, di-, tri-, and tetraacetylated histone H4 levels. Ac(0-4)-H3, non-, mono-, di-, tri- and tetraacetylated histone H3 levels.


9/12

Table 4. Analysis of variance (ANOVA)

Descriptive values (DV) Twins distance (ESD)

Variable Group of Age SS DF MS F S (p) SS DF MS F S (p)

5mC Between age groups 0.120 1 0.120 0.641 0.426 0.447 1 0.447 4.821 0.034

Within age groups 14.182 76 0.187 3.428 37 0.093Total 14.302 77 3.875 38

AcH4 Between age groups 911.892 1 911.892 0.777

0.381

1.164 1 1.164 4.130

0.050Within age groups 89198.819 76 1173.669

10.145 36 0.282

Total 90110.711 77 11.308 37

AcH3 Between age groups 1138.774 1 1138.774 0.246

0.621

1.347 1 1.347 6.080

0.019Within age groups 352085.09 76 4632.699

7.975 36 0.222

Total 353223.87 77 9.322 37

AIMS Between age groups - - - - - 956.922 1 956.922 3.986 0.050Within age groups - - - - - 8641.630 37 240.045Total 9598.553 38

DV, Descriptive values of the individuals; ESD, Euclidean Squared Distance for each twin pair; 5mC, 5-methyl-cytosine; AcH4, histone H4 acetylation;AcH3, histone H3 acetylation; AIMS, amplification of intermethylated sites; SS, sum of squares; Df, degrees of freedom; MS, mean of squares; F,

Fisher-Snedecor test; S, significance: when p


10/12

Table 5. Descriptive Statistics

Descriptive values (DV) Twins distance (ESD)

Variable Group of Age N Mean Variance N Mean Variance5mC Under 28-year-old 38 3.68 0.229 19 0.377 0.079

Over 28-year-old 42 3.56 0.309 21 0.755 0.335

AcH4 Under 28-year-old 38 36.69 28.35 19 0.305 0.062Over 28-year-old 42 34.74 21.21 21 0.656 0.456

AcH3 Under 28-year-old 38 57.24 69.01 19 0.237 0.066Over 28-year-old 42 61.19 60.87 21 0.451 0.116

AIMS Under 28-year-old - - - 19 7.765 38.691Over 28-year-old - - - 21 17.857 401.128

DV, Descriptive values of the individuals; ESD, Euclidean Squared Distance for each twin pair; 5mC, 5-

methyl-cytosine; AcH4, histone H4 acetylation; AcH3, histone H3 acetylation; AIMS, amplification of

intermethylated sites.


11/12

Skeletal muscle Epithelial mouth cells


12/12

Skeletal muscle Epithelial mouth cells

206 bp

T

winA

TwinB

28-year-old

TwinA

Tw

inB

64-year-old

64-year-old

73.8%

79.2%

90.4%

52.4%

PKD1P2

64-year-old19-year-old

Twin

A

Twin

B

Twin

A

Twin

B

64-year-old19-year-old

Twin

A

Twin

B

Twin

A

Twin

B

0,00

1,00

2,00

3,00

4,00

%5mC

Tw in A Tw in B

0,00

20,00

40,0060,00

80,00

100,00

%AcH4

0,00

20,00

40,00

60,00

80,00

%A

cH3

0,00

20,00

40,00

60,00

80,00

100,00

19-yea

r-old

23-yea

r-old

30-yea

r-old

44-yea

r-old

%m

ethylationAlu-Sp

AB

C

TwinA

Tw

inB

Documents

Fraga2005_EpigeneticTwinStudy