www.elsevier.com/locate/yviro

Virology 322 (2004) 69–81

Focal glomerulosclerosis in proviral and c-fms transgenic mice links

Vpr expression to HIV-associated nephropathy

Peter Dickie,a,* Amanda Roberts,a Richard Uwiera,b Jennifer Witmer,b

Kirti Sharma,c and Jeffrey B. Koppc

aDepartment of Medical Microbiology and Immunology, University of Alberta, Edmonton, Alberta, Canada T6G 2S2bHealth Sciences Laboratory of Animal Services, University of Alberta, Edmonton, Alberta, Canada T6G 2S2

cKidney Disease Section, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892, USA

Received 22 October 2003; returned to author for revision 16 December 2003; accepted 14 January 2004

Abstract

Clinical and morphologic features of human immunodeficiency virus (HIV)-associated nephropathy (HIVAN), such as proteinuria,

sclerosing glomerulopathy, tubular degeneration, and interstitial disease, have been modeled in mice bearing an HIV proviral transgene

rendered noninfectious through a deletion in gag/pol. Exploring the genetic basis of HIVAN, HIV transgenic mice bearing mutations in either

or both of the accessory genes nef and vpr were created. Proteinuria and focal glomerulosclerosis (FGS) only developed in mice with an intact

vpr gene. Transgenic mice bearing a simplified proviral DNA (encoding only Tat and Vpr) developed renal disease characterized by FGS in

which Vpr protein was localized to glomerular and tubular epithelia by immunohistochemistry. The dual transgenic progeny of HIV[Tat/Vpr]

mice bred to HIV[DVpr] proviral transgenic mice displayed a more severe nephropathy with no apparent increase in Vpr expression,

implying that multiple viral genes contribute to HIVAN. However, the unique contribution of macrophage-specific Vpr expression in the

development of glomerular disease was underscored by the induction of FGS in multiple murine lines bearing a c-fms/vpr transgene.

Crown Copyright D 2004 Published by Elsevier Inc. All rights reserved.

Keywords: AIDS; Retrovirus; Nef; Kidney; Macrophage

Introduction

Vpr protein is an accessory gene product of human

immunodeficiency virus type 1 (HIV-1) exhibiting pleiotro-

pic roles in the replicative cycle of the virus and on host

gene expression. Vpr is packaged in the virion particle (Lu

et al., 1993) and has an early role in the infection of

nondividing cells by facilitating the nuclear transport of

the virion core (Heinzinger et al., 1994; Hrimech et al.,

1999). Vpr is synthesized late in the replication cycle and

can induce terminal differentiation in producing cells (Levy

et al., 1993), cell death (Planelles et al., 1995; Stewart et al.,

1997), alterations in host cell activation (Kino et al., 1999;

Kulkosky et al., 1999), and viral transcription (Bukrinsky

and Adzhubei, 1999; Gummuluru and Emerman, 1999). A

0042-6822/$ - see front matter. Crown Copyright D 2004 Published by Elsevier

doi:10.1016/j.virol.2004.01.026

* Corresponding author. Department of Medical Microbiology and

Immunology, University of Alberta, Room 1-40, HMRC Building,

Edmonton, Alberta, Canada T6G 2S2. Fax: +1-780-492-9828.

E-mail address: peter.dickie@ualberta.ca (P. Dickie).

late function may be to boost virus production and trans-

mission through the induction of G2 arrest (Jowett et al.,

1995; Trono, 1995; Yao et al., 1998). The latter effect may

be mediated by interactions with the transcriptional factor

TFIIB (Agostini et al., 1999) or changes in the cytoskeletal

structure of the host cell (Gu et al., 1997; Matarrese et al.,

2000). Despite diverse cellular effects, there has been

surprisingly little evidence of Vpr-related cytotoxicity in

vivo. Dispensible in vitro for virus replication and cytopa-

thicity in T cells (Trono, 1995), it is also dispensible for T

cell loss in a model of HIV infection (Aldrovandi and Zack,

1996) and AIDS in a model of SIV infection (Baba et al.,

1999; Gibbs et al., 1995). Alternatively, Vpr may have a

unique function in cells of the macrophage lineage where a

positive effect on virus replication has been demonstrated

(Balliet et al., 1994; Connor et al., 1995; Sherman et al.,

2003).

Models of chronic HIV-1 infection exist in mice trans-

genic for proviral sequences. These have been useful for

studying proviral gene activation in macrophages (Dickie et

al., 2001; Gazzinelli et al., 1996; Schito et al., 2001).

Inc. All rights reserved.

P. Dickie et al. / Virology 322 (2004) 69–8170

Reactivation of virus in long-lived macrophages may be an

important factor contributing to the persistent infection of

humans (Crowe, 1995). We have assessed the toxicity of

Vpr in transgenic animals carrying noninfectious HIV

proviral DNA (gag and pol sequences were deleted). The

vpr gene was genetically manipulated and its toxicity

evaluated in the context of a nephropathy previously de-

scribed in HIVDGag/Pol mice (Dickie et al., 1991). These

mice model a disease remarkably similar to HIV-associated

nephropathy (HIVAN) in humans (Barisoni et al., 2000;

Bruggeman et al., 1997; Dickie et al., 1991). Exploring a

role for macrophages (or macrophage-like cells) in the

etiology of HIVAN, Vpr expression was also linked to the

macrophage-specific murine exon 2 c-fms promoter in novel

transgenic mouse lines.

Renal disease has been associated with other immuno-

deficiency viruses such as the feline- (Poli et al., 1993) and

simian-associated (Alpers et al., 1997) viruses. In humans,

nephropathy of diverse forms has been described, including

sclerosing and immune-complex mediated forms of glomer-

ulopathy and tubulointerstitial diseases. On the basis of the

appearance of unique clinical features, HIV-associated ne-

phropathy was recognized as the most prevalent form of

kidney disease in HIV-infected populations (D’Agati and

Appel, 1998). It affects a significant proportion of seropos-

itive individuals (up to 10% of infected individuals, depend-

ing on the study), most notably amongst African-Americans

and cases of pediatric AIDS. The principle histopathological

lesion in humans is collapsing focal glomerulosclerosis

(FGS) associated with podocyte hypertrophy, diffuse

mesangial hyperplasia, and extracellular matrix deposition

(D’Agati and Appel, 1998). Tubulointerstitial disease is also

prevalent, marked by tubular epithelial cell simplification,

tubular atrophy, microcystic dilatation, and inflammation.

Despite the episodic detection of viral DNA and antigen in

renal biopsies (Cohen et al., 1989; Green et al., 1992;

Kimmel et al., 1993), and the in vitro infection of various

renal cell types (Green et al., 1992; Ray et al., 1997), it

remains unclear what renal cell types are permissive for

HIV-1 replication in vivo. Coreceptor expression on both

mesangial and tubular epithelial cell types has been pro-

posed (Conaldi et al., 1998; Eitner et al., 1998) and tissue

macrophages are likely to reside in the glomerular space

(Sasmono et al., 2003). Cytopathic viral proteins may act

directly on one or more of these glomerulus-associated cells

(Bodi et al., 1995; Conaldi, 1998), or they may act by

disrupting the cytokine milieu of the kidney (Rappaport et

al., 1994).

HIVAN in transgenic mice (Dickie et al., 1991) featured

glomerular and tubular defects in common with human

HIVAN. Transplantation experiments implicated renal pro-

duction of HIV gene products (Bruggeman et al., 1997) in

the disease. Inactivation of nef did not prevent glomerular

disease in one proviral transgenic line studied (Kajiyama et

al., 2000). Genetic complementation with Nef, however, did

substantiate its contribution in renal interstitial inflammation

(Kajiyama et al., 2000), an observation independently made

in transgenic mice expressing Nef under the transcriptional

control of the human CD4 promoter (Hanna et al., 1998).

We reported herein, on a similar approach, to evaluate the

toxicity of HIV-1 Vpr on renal epithelia.

Results

Derivation and characterization of HIV proviral transgenic

lines

The prototype HIV-1 transgenic mouse line (line T26)

that developed HIVAN bore a DGag/Pol HIV-1 proviral

DNA (pEVd1443 sequences originally derived from clone

pNL4-3) (Dickie et al., 1991). Inactivation of the nef gene

in an independent HIVd1443 transgenic line (X5 mice)

mitigated but did not prevent the development of murine

HIVAN (Dickie, 2000; Kajiyama et al., 2000). A patho-

logic role for HIV-1 Vpr was explored through the

creation of novel HIV transgenic lines in which the vpr

gene of pEVd1443 and its DNef counterpart pX5 was

mutated by frameshifting at the unique EcoRI restriction

site (base position 5743; Fig. 1). Two new HIV-1 trans-

genic lines were produced: V13 (DVpr) and VN15

(DVprDNef). For the purpose of complementing these

lines with vpr, pEVd1443 was modified by sequential

deletion of vif, vpu, env, nef, and rev, leaving only the

genes for Tat and Vpr intact (HIV[Tat/Vpr] transgene;

Fig. 1). A second vpr orf was inserted in the 3V positiononce occupied by nef to enhance the likelihood of Vpr

expression.

Line V13 was one of six HIVd1443[DVpr] lines

screened for viral gene expression by Northern analysis.

V13 mice produced HIV transcripts in the skin, eye, and

muscle with much reduced levels appearing in the kidney

and lymphoid tissues (Fig. 2). V13 transgenic mice dis-

played perinatal, nuclear cataracts (absent the microphthal-

mia characteristic of T26 wild-type mice; Dickie, 1996) and,

unique to our hemizygous HIV lines, were runted relative to

nontransgenic littermates. Viral gene expression was not

detected in tissues of the remaining five HIVd1443[DVpr]

lines, and all were phenotypically normal. Line VN15 was

one of eight HIVd1443[DVprDNef] lines analyzed. Viral

gene transcription was observed in four of the derived lines,

predominantly in the skin. The highest level of expression

was observed in line VN15. VN15 animals also expressed

HIV RNA in the eye (Fig. 2). Hemizygous VN15 mice were

visibly normal but homozygous offspring of this line (>30

observed) developed hyperkeratosis and necrotic lesions on

the tail as did homozygous T26 mice (Santoro et al., 1994)

and infectious proviral HIV-1 transgenic mice (Leonard et

al., 1988).

Seven HIV[Tat/Vpr] mouse lines were analyzed. HIV

transcripts were detected by Northern analysis in only one

(line TV2). TV2 transgenic mice expressed viral RNA in the

Fig. 1. HIV transgenes. The subgenomic HIV proviral transgene

HIV[DGag/Pol], derived from pEVd1443, was mutated in vpr and nef by

frameshifting at EcoRI or XhoI sites, respectively. After linearization by

codigestion with FspI and NaeI, mutated constructs were microinjected to

create X5 (DNef), V13 (DVpr), and VN15 (DVprDNef) transgenic mice.

The HIV[Tat/Vpr] transgene was excised from pTV2 DNA that was

constructed through sequential deletion of pEVd1443. The two exons of tat

remain intact (stippled boxes) and an additional vpr gene (hatched box) was

inserted adjacent to the 3V long terminal repeat (LTR). The c-fms/vpr

transgene was derived from p7.2fms-EGFP by replacing the EGFP gene

with a viral RsaI vpr fragment (hatched box) between the c-fms promoter

and SV40 termination signals (gray box).

Fig. 2. Proviral gene expression. Tissue expression profiles for HIV proviral

transgenic mouse lines were produced by Northern blot analysis. Total

RNA was fractionated in 1.25% denaturing agarose and blotted onto

nitrocellulose membranes. HIV RNA was detected using a radiolabeled

probe complementary to the 3V end of viral transcripts. Blotting for h-actinRNA controlled for sample loading. Animals were hemizygous for their

respective transgenes, female, and between 24 and 35 days old. L. Nodes:

lymph nodes.

P. Dickie et al. / Virology 322 (2004) 69–81 71

eye (Fig. 2) in this limited screen. These mice developed

normally to adulthood and were visibly indistinguishable

from nontransgenic littermates. However, nursing TV2

mothers (2–3 months of age) became moribund (13/13

mice, mean of 12 days post-partum) with signs of severe

subcutaneous edema typical of wild-type HIVd1443 trans-

genic (T26) mice with renal failure. Homozygous offspring

of TV2 crosses (male or female) became moribund around 3

months of age also with signs of subcutaneous edema (8/8;

mean age of 105 days). In contrast, the incidence of

morbidity in hemizygous TV2 mice (males and virgin

females) was around 5% (3/59) for animals under 6 months

of age.

HIV gene expression in HIV[Tat/Vpr] kidneys

Failing to detect Vpr protein in TV2 renal tissue by

Western analysis, RT-PCR was performed on kidney RNA

using the primer pair 045/RV1 (see Materials and methods)

to detect spliced transcripts for Tat (338 and 411 bp), Vpr

(725 bp), and full-length transcripts (at 1272 bp). The sizes

of amplified cDNA sequences were predicted from splic-

ing reactions for the parental NL4-3 virus (Purcell and

Martin, 1993). Viral transcripts were detected in kidneys of

1- and 3-month-old hemizygous TV2 mice (Fig. 3). An

Fig. 3. Viral gene expression in HIV[Tat/Vpr] (TV2) kidneys. To detect vpr

and tat transcripts, RT-PCR using a primer pair that spanned major 5V splicejunctions in HIV-1 (045/RV1) was used. Panel A: HIV transgene expression

was detected in renal tissue of a TV2 hemizygous female (lane 2) and a 3-

month-old nursing female sibling (lane 3), a young TV2 hemizygous

female (5-week-old, lane 5), and a homozygous TV2 female sibling (lane

6). RT-minus samples (left lane of each set) were amplified to control for

DNA contamination. Amplified products were separated in 2% agarose,

stained with ethidium bromide, and identified based on predicted sizes for

HIV mRNA spliced transcripts. Four HIV-specific amplification products

were detected with sizes near 1272, 725, 411, and 338 bp, corresponding to

full-length Vpr and two Tat transcripts (the larger of which is identified by

the labeled arrow), respectively. Nontransgenic kidneys (lanes 1 and 4)

lacked virus-specific bands but were positive for a nonspecific product near

500 bp. Panel B: Levels of transcription were computed from digital images

of agarose gels in which three sibling pairs of homozygous/hemizygous

female TV2 mice, as well as four sibling pairs of nursing/virgin TV2

females, were assayed in triplicate. Values were normalized to the amount

of GAPDH cDNA as determined by RT-PCR. Full-length (fl) transcript: o;

vpr: 4; tat: 5. TV2* mice were hemizygous and 3 months old; TV2 mice

were 5-week-old hemizygous (�/+), or homozygous (+/+). Error bars

represent one standard deviation.

P. Dickie et al. / Virology 322 (2004) 69–8172

increase in HIV mRNA expression was observed in

homozygous TV2 progeny relative to hemizygous sibling

mice. This increase was apparent for putative vpr tran-

scripts and the putative tat transcripts but not full-length

HIV transcripts. Full-length transcripts were increased in

nursing females relative to age-matched, virgin sibling

mice, concurrent with modest increases in transcripts

related to vpr and tat genes based on predicted product

sizes. Neither gene dosage nor the physiologic conditions

peculiar to nursing mice appeared to alter the ratio of the

two small transcripts.

Ultrastructural changes and Vpr deposition in TV2 renal

tissue

Characteristic features of HIV-associated nephropathy

were observed by electron microscopy in sections of 6-

month-old TV2 kidneys: podocytes displayed foot process

effacement, capillary lumen were collapsed, basement mem-

branes were focally thickened and wrinkled, and there was

microvillous transformation (Figs. 4A, B). Previously, HIV-

related protein was detected immunologically in glomeruli

and tubular epithelia of T26 and X5 transgenic mice (Dickie

et al., 1991; Kajiyama et al., 2000). Similarly, TV2 kidney

sections were screened with a polyclonal antibody raised

against a peptide fragment of Vpr (residues 1–46). Though

Vpr was not detectable in kidneys of virgin hemizygous

TV2 animals, it was detected in kidneys of lactating

hemizygous TV2 females (Figs. 4C, D). Vpr was localized

to the renal cortex, near apical regions or brush borders of

the occasional proximal tubular epithelial cell. Staining of

the occasional glomeruli for Vpr protein followed a seg-

mental pattern. This tissue localization was consistent with

endogenous expression in glomerular epithelia, the trapping

of Vpr within sclerotic glomeruli, or its reabsorption by

tubular epithelial cells.

Vpr gene expression in kidneys of HIVd1443 mice

By RT-PCR, levels of vpr expression were compared in

wild-type HIVd1443 (T26) mice, DNef and DVpr counter-

parts (X5, V13, and VN15), and TV2 mice (Fig. 5). Mutant

transcripts of vpr were distinguished from wild-type tran-

scripts based on the susceptibility of amplified cDNA

products to EcoRI cleavage. Vpr sequences (633 bp product

amplified with primer pair L2/VH2) were prominent in T26

mice, less so in X5 mice and TV2 mice. Wild-type vpr

transcript was not observed in either V13 or VN15 mice

(Fig. 5B). When these latter lines were crossed with TV2

mice, the observed level of native vpr transcript was similar

to that observed in TV2 mice alone (Fig. 5B). Likewise, no

significant change was observed in the expression of the 3Vvpr gene of TV2 (screened using primer pair LV1/R3, Fig.

5C) in TV2-complemented HIVd1443 mice.

The apparent decrease in vpr expression in X5 (DNef)

mice relative to wild-type T26 mice, when total HIV gene

Fig. 4. Ultrastructural changes and localization of Vpr. Glomerular epithelia of a wild-type mouse (A) is compared to that of a hemizygous TV2 mouse (B) by

transmission electron microscopy (original magnification 7400�). Glomerular epithelial cells (EC) and their characteristic foot processes (arrow heads, upper

left, panel A) are evident adjacent to patent capillaries in the normal animal. CL: capillary lumen. In the TV2 animal (panel B), capillary lumen are collapsed

(CL, upper left), foot processes are effaced, the basement membrane is wrinkled and thickened (white arrow heads), and there is microvillous transformation

(star, left of panel). EN: endothelial cell. Scale bar is equivalent to 2 AM. In panels C and D, renal tissue from a lactating TV2 female was immunostained with

control rabbit serum (C) or anti-Vpr antiserum (D). Vpr protein was detected in proximal tubular epithelial cells (brush borders or apical cytoplasmic domains)

and glomeruli (right side of panel). Original magnification was 80� (scale bar equivalent to 60 AM).

P. Dickie et al. / Virology 322 (2004) 69–81 73

expression was elevated (Fig. 2), suggested that viral gene

splicing was different in X5 mice. Splicing differences

were probed by screening for Rev-encoded products at

136, 142, and 160 bp; Env at 120 and 136 bp; Tat at 319

bp; and Nef at 120 bp, the sizes of which were predicted

from known viral splicing products (Purcell and Martin,

1993). HIVd1443 (T26) kidney RNA yielded predominant

fragments of 120 bp (corresponding to putative Env or Nef

transcripts) and 633 bp (for Vpr) (Fig. 5D). By compari-

son, X5(DNef) RNA yielded less vpr-specific transcript,

consistent with experiments shown in Fig. 5C. The inac-

tivation of vpr (in V13 mice) was associated with reduced

levels of 120–140 base pair products, consistent with

either nef or env transcripts (Fig. 5D). The most striking

difference in VN15 (DNefDVpr) mice was an enhanced

level of RT-PCR product near 320 base pairs (the putative

tat product) that was absent in animals inheriting the TV2

transgene.

Characterization of c-fms/vpr transgenic mice

Given the propensity of HIV-1 provirus transgenic mice

to express viral genes in macrophages and the presence of

macrophages in renal glomeruli and tubules (Sasmono et al.,

2003), we assessed the renal toxicity of Vpr in mice

transgenic for a c-fms/vpr gene. The exon-2 c-fms promoter

is specific for macrophages (Himes et al., 2001). The M-

CSF receptor may also be expressed in mesangial cells of

renal glomeruli, a cell type with macrophage-like character-

istics (Watanabe et al., 2001). Founder mice and heterozy-

gous offspring bearing the c-fms/vpr transgene (Fig. 1) were

visibly normal. In two of three lines analyzed (MeRV4 and

MeRV21), transgenic mothers displayed a transient edema

between 12 and 15 days of lactation. Unlike TV2 mothers,

however, MeRV females survived to produce multiple

litters. Females in the third MeRV line (MeRV8) nursed

without complication.

Fig. 5. Kidney-associated viral gene expression in HIVd1443 transgenic lines. Levels of HIV transcript in kidneys were detected by RT-PCR using the primer

pairs shown in A. The primer pair L2/VH2 detected cDNAs encoding vpr in the native position (shaded box; nef is shown as the hatched box) of both

HIVd1443 and TV2 transgenes. The LV1/R3 primer pair was used to detect cDNA products specific for the 3V vpr of the TV2 transgene. The L2/VH2 primer

pair amplified a 633 bp DNA product corresponding to vpr-containing cDNAs, visualized by ethidium bromide staining (B). Mutant vpr was verified by the

insensitivity of cDNAs to EcoRI cleavage (in V13 and VN15 samples). Measurement of GAPDH-related product controlled for cDNA synthesis. Mice were

approximately 4 weeks old. Shown is one of duplicate experiments. M: DNA ladder; RT: reverse transcriptase. Similarly, the LV1/R3 primer pair was used to

amplify a 381 bp product of cDNAs bearing the 3V vpr gene in TV2, as a measure of 3V vpr expression in the kidney (C). Shown is one of triplicate assays. In

panel D, RT-PCR was repeated using the L2/VH2 primer pair, labeling PCR products with 32P-dCTP. Products were fractionated in 5% acrylamide and exposed

to X-ray film. Native vpr transcripts produced an amplified DNA of 633 bp (B). Differentially spliced transcripts produced a variety of smaller amplified DNA

products in animals of different transgenotypes. Shown is one of duplicate experiments using different groups of animals from those tested in B. Lanes

identified by two transgenes denote dual transgenic animals.

P. Dickie et al. / Virology 322 (2004) 69–8174

Renal expression of vpr in MeRV mice was screened by

RT-PCR using a primer pair nested in the vpr gene (LV1/

RV1). Heterozygous female mice from the three MeRV lines

were compared to TV2 mice (Fig. 6). Each of the three

MeRV lines expressed the vpr gene in the kidney, the

highest levels appearing in MeRV21 animals. The level of

vpr expression in each was consistently less than that

observed in TV2 mice.

Renal dysfunction in association with the vpr gene

Renal disease in HIVd1443 wild-type transgenic mice is

marked by a transient proteinuria between 3 and 5 weeks of

age (Dickie et al., 1991). In X5 (HIVd1443[DNef]) mice,

proteinuria is less severe (Kajiyama et al., 2000; Table 1).

Proteinuria was not observed in HIVd1443 DVpr lines

(screening twice weekly between 3 and 10 weeks of age).

Urine protein levels in V13 mice were actually subnormal,

perhaps reflecting the poor growth characteristics of these

mice. Amongst the HIV[Tat/Vpr] lines, only the TV2 line

displayed elevated protein excretion. Hemizygous TV2

mice at 5–8 weeks of age displayed modestly elevated

levels of urine protein (Fig. 7A), but changes did not match

the significance of T26 or X5 animals (Table 1). By

comparison, high urine protein levels distinguished homo-

zygous TV2 mice (3� control values). Lactating female

TV2 mice at 10 days post-partum displayed urine protein

levels well above normal (1220 F 230 vs. 260 F 140 mg/dl

for nontransgenic nursing mice; n = 7). Thus, increased

levels of proteinuria mirrored the increased morbidity in

TV2 mice.

The development of proteinuria and morbidity in TV2

hemi- and homozygous mice, coupled with the absence of

renal disease in the Tat-positive, Vpr-deficient HIVd1443

Fig. 6. Vpr expression in c-fms/vpr (MeRV) mice. By RT-PCR, renal vpr

expression in MeRV transgenic mice was compared to vpr expression in

HIV[Tat/Vpr] mice (HIV/TV2). The primer pair LV1/RV1 was used (Table

2). GAPDH expression controlled for cDNA synthesis, and values used for

normalization. Amplification products were separated in agarose, stained

with ethidium bromide, and quantitated by densitometry. Mean results from

three mice each (2-month-old females) are shown in the histogram. RT+:

plus reverse transcriptase; RT�: less reverse transcriptase.

Fig. 7. Proteinuria in HIV proviral transgenic mice. Urine protein levels (A)

in hemizygous TV2 mice (n = 12) are compared to nontransgenic siblings

(FVB/N, n = 12) and mice homozygous for the transgene (TV2/TV2, n =

4). In B, the hemizygous offspring of V13 � TV2 breeding pairs were

analyzed for urine protein (TV2, n = 2; V13, n = 3; V13/TV2 dual

transgenic offspring, n = 3). Eight hemizygous T26 mice (.) and five

VN15/TV2 mice (4) are included for comparison. Average urine protein

values for transgenic mice are presented, after normalization to urine

protein levels in nontransgenic siblings (for example, T26 mice had urine

protein levels 4-fold greater than nontransgenic siblings at 21 days of age).

P. Dickie et al. / Virology 322 (2004) 69–81 75

transgenic lines, implicated Vpr in the induction of murine

HIVAN. Exploring a role for secondary viral factors, and in

particular Nef, Vpr-deficient V13 and VN15 mice were

complemented with vpr through breeding with TV2 mice.

Table 1

Hemizygous HIV transgenic lines and their susceptibility to HIV-associated

nephropathy (HIVAN)

Transgenotype

(encoded genes)

Lines

expressing

HIV

Established

line

Urine

protein (mg/dl)

HIVd1443

(vpu, vpr, vif, tat, nef, env)

4/8 T26 2155 F 250

HIVd1443[DNef]

(vpu, vpr, vif, tat, env)

1/7 X5 1370 F 514

HIVd1443[DVpr]

(vpu, vif, tat, nef, env)

1/6 V13 150 F 40

HIVd1443[DVprDNef]

(vpu, vif, tat, env)

4/8 VN15 265 F 65

HIV[Tat/Vpr] (tat, vpr) 1/7 TV2 390 F 120

HIV genes present in each line are shown in italics. The fraction of founder

lines that expressed viral genes as detected by Northern analysis is shown.

Urine protein levels are presented for HIV transgenic females at 35 days of

age (n = 12). Control FVB/N mice had a urine protein level of 310 F 100

mg/dl at this age. Variability is given as one standard deviation. The

elevation in TV2 urine protein (relative to nontransgenic controls) was not

significant (to P < 0.01).

Error bars have been omitted for clarity (see Table 1 for typical error

values). TV2 (E); V13 (n); TV2/V13 (o).

VN15/TV2 dual transgenic mice were indistinguishable

from sibling mice bearing only the TV2 transgene in that

they developed a mild proteinuria (Fig. 7B) with no asso-

ciated morbidity. In contrast, urine protein levels in V13/

TV2 mice were elevated almost threefold relative to non-

transgenic sibling mice (Fig. 7B) and 6 times that of their

runted V13 transgenic siblings. V13/TV2 mice died at the

mean age of 40 days (5/5 mice).

C-fms/vpr (MeRV) mice displayed no proteinuria up to 6

months of age. Renal function in MeRV mice was assessed

from urine protein-to-creatinine (P/C) ratios (Fig. 8). Lower

creatinine concentrations were observed in urine, contribut-

ing to elevated urine P/C ratios in the three MeRV transgenic

lines. This indication of renal dysfunction in 2- to 4-month-

old females was surprisingly consistent for all Vpr-positive

transgenic lines. The exception was T26 mice. Moribund

T26 mice had P/C ratios near 100, whereas surviving females

had a mean P/C of 20 (n = 12).

ology 322 (2004) 69–81

Focal glomerulosclerosis as a defining feature of

Vpr-related renal disease

The primary histopathological lesion observed in young

TV2 hemizygous animals was solidification of glomerular

tufts in a focal and segmental distribution (Fig. 9). In

nursing TV2 mice, disease was marked by glomerular

epithelial cell hyperplasia, adhesions to Bowman’s capsule,

diffuse glomerulosclerosis, marked thickening of Bowman’s

capsule, and periglomerular fibrosis (TV2*, Fig. 9). The

tubular compartment contained atrophied cells and cells

containing protein reabsorption droplets. Tubules were di-

lated and, in some cases, proteinaceous casts were present.

The interstitium contained the occasional perivascular

mononuclear infiltrate. Neither hemizygous V13 (DVpr)

kidneys nor VN15 (DVprDNef) kidneys displayed these or

other signs of renal disease (not shown). The kidneys of 1-

month-old V13/TV2 double-transgenic mice displayed

widespread microcystic dilatation and FGS (Fig. 9) quite

distinct from the subtle changes observed in TV2 mice of

the same age. The histopathological condition of VN15/

TV2 kidneys was indistinguishable from TV2 kidneys of

age-matched siblings (not shown).

Consistent in the histopathological analyses of MeRV

kidneys was the appearance of focal glomerulosclerosis

(FGS) in both lactating and nonlactating females (Fig. 9)

in the absence of tubular changes. All three MeRV lines

displayed FGS with evidence of epithelial cell proliferation,

reduced urinary space, and adhesions between glomerular

tufts and Bowman’s capsule. The most severely affected

animals were lactating females (MeRV21*, Fig. 9) where

P. Dickie et al. / Vir76

Fig. 8. Urine protein/creatinine ratios for transgenic mice. Urine was

collected from groups of female mice (2–4 months old) and assayed for

protein and creatinine content on three successive days as a measure of

renal function. Mean ratios are plotted. The asterisk denotes groups of

animals significantly different ( P < 0.01) from nontransgenic controls

(FVB/N). Numbers of mice per group: FVB/N, 14; HIVDNef, 5; HIV/TV2,

8; MeRV4, 5; MeRV8, 5; MeRV21, 9; HIVDVpr, 8; HIVDVprDNef, 10.

Fig. 9. Kidney histopathology. Kidneys were fixed in 10% buffered

formalin, sectioned and stained with hematoxylin and eosin. A hemizygous

TV2 female and a nursing TV2* female are compared to a nontransgenic

female (FVB/N) to demonstrate varying degrees of histopathology.

Glomerular condensation (obscuring capillary lumen) is visible in both

TV2 mice but tubular anomalies (acid-staining protein casts and fibrotic

lesions) are present predominantly in the nursing mouse (TV2*). Dual

transgenic TV2/V13 mice displayed focal glomerulosclerosis (FGS) and

tubular atrophy more severe than TV2 mice. MeRV (c-fms/vpr) mice from

three independent lines (4, 8, and 21) displayed FGS absent signs of tubular

histopathology. Mice were 5 to 10 weeks old. Original magnification was

400�. The magnification scale bar in top left panel is equivalent to 30 Am.

glomeruli appeared hypocellular and solidification was

more global.

Discussion

A genetic analysis of HIVd1443 proviral transgenic mice

was undertaken to explore the role of HIV-1 Vpr in the

development of HIV-associated nephropathy (HIVAN). Two

HIVd1443 transgenes were associated with the development

of HIVAN (wild-type T26 and DNef X5 lines). In contrast,

two DVpr transgenes (in V13 and VN15 mice) failed to

induce HIVAN. A novel line bearing functional tat and vpr

P. Dickie et al. / Virology 322 (2004) 69–81 77

genes (HIV[Tat/Vpr] mice) developed focal glomeruloscle-

rosis (FGS) further implicating Vpr in HIV-1 provirus-

induced FGS development. When vpr alone was transcribed

from the murine c-fms promoter in transgenic mice, FGS

was the principal histopathological lesion associated with

the development of renal insufficiency. Both the HIV-1 LTR

and the murine c-fms promoter are transcriptionally active in

murine macrophages. Thus, in addition to demonstrating the

ability of Vpr to induce FGS, the common features of the

two model systems suggest that HIVAN modeled in trans-

genic mice is related to viral gene expression in macro-

phages, or macrophage-like cells.

The full extent of renal disease in wild-type HIVd1443

transgenic mice may require viral genes other than vpr. A

transgene containing only the vpr gene (c-fms linked) is

sufficient to induce the fundamental glomerulopathic lesion,

but there is reason to suspect that tat and nef gene products

contribute to HIVAN. Renal disease, both in terms of FGS

and tubular degeneration, was enhanced in dual transgenic

progeny of TV2 by HIVd1443[DVpr] crosses compared to

TV2 animals alone. In contrast, the complementation of

HIVd1443[DVprDNef] transgenic mice with vpr (by TV2

crosses) did not exacerbate disease beyond that character-

izing TV2 mice. These observations implicate HIV-1 Nef in

disease progression. Earlier Nef-complementation experi-

ments (Kajiyama et al., 2000), and the incidence of inter-

stitial inflammation in CD4/HIV transgenic models (Hanna

et al., 1998), are consistent with this interpretation. Tat may

have contributed directly to FGS in HIV[Tat/Vpr] mice

because these animals were more compromised than c-

fms/vpr transgenic animals. Alternatively, any Tat effect

could have been indirect. The expression of vpr was higher

in the kidneys of TV2 mice than in c-fms/vpr mice, perhaps

because Tat transactivation of the viral LTR can occur in

murine cells (Murphy et al., 1993). Likewise, posttranscrip-

tional phenomena may explain the reduced expression of

vpr in HIVd1443[DNef] mice (relative to wild-type T26

mice) suggestive of an indirect effect of Nef. Importantly,

the presence or absence of secondary HIV genes may have

influenced spicing patterns, altering viral transgene expres-

sion in HIV transgenic mice (Fig. 5) in ways unrelated to

transgene position effects. Whether viral gene products such

as Tat and Nef contribute directly to renal disease remains a

matter requiring clarification.

Pathologic changes in human HIVAN occur in the

glomerular epithelia, notably podocytes, and the central

lesion in HIVAN is focal glomerulosclerosis (FGS)

(D’Agati and Appel, 1998). A direct effect of HIV-1 on

glomerular podocyte proliferation has been proposed both

for HIV-1-infected human podocytes and podocytes in

HIVd1443 transgenic animals (Barisoni et al., 1999; Nelson

et al., 2002). The development of FGS in c-fms/vpr trans-

genic animals strongly suggests that glomerular macro-

phages play a role in HIVAN. In exon 2 c-fms/EGFP

transgenic mice, c-fms promoter activity was restricted to

macrophages in the renal epithelia (Sasmono et al., 2003).

There is evidence however that human and murine mesan-

gial cells express c-fms (Mori et al., 1990; Watanabe et al.,

2001). If mesangial cell expression of c-fms is much less

than that in macrophages, it is possible that c-fms expression

in mesangia of c-fms/EGFP transgenic mice (Sasmono et al.,

2003) escaped detection. Anomalies have been attributed to

murine mesangial cells in HIVd1443 mice (Singhal et al.,

1998), thus mesangium remain a potential source and target

of toxic viral gene products in humans as well as our murine

models. Whatever the cell type expressing Vpr (glomerular

epithelia or macrophages), pathologic effects could be

exerted on proximal bystander cells. This could be due to

the action of extracellular Vpr (Azad, 2000) or alterations in

the local production of host cell factors (cytokines, growth

factors). It seems clear however that endogenous renal

expression of HIV-1 products is necessary for glomerulop-

athy to develop (Bruggeman et al., 1997).

Viral gene expression in kidneys of HIVd1443 trans-

genic mice was first observed just before weaning age

(Dickie et al., 1991). The factors inducing viral gene

expression at this time are unknown. Considering the

transient nature of proteinuria in HIVd1443 mice, and the

edema peculiar to nursing transgenic mice, it is reasonable

to invoke a role for host factors in disease development.

The enhanced morbidity in nursing mice may be related

not so much to increased Vpr expression, but to the

sensitivity of glucocorticoid responsive genes to modula-

tion by Vpr (Kino et al., 1999). One possibility is that Vpr

expressed in a critical subset of kidney cells induces renal

damage by augmenting glucocorticoid responsiveness. This

hypothesis is credible given the renal toxicity of dexameth-

asone (Chen et al., 1998) and the capacity of glucocorti-

coids to modulate the turnover of extracellular matrix by

glomerular mesangium (Eberhardt et al., 2002; Kuroda et

al., 2002). In view of its well-documented effects on cell-

cycle control (Trono, 1995), Vpr toxicity may prove to be

multifactorial.

The HIV LTR is responsive to glucocorticoid action and

inflammatory stimuli. Were Vpr to enhance glucocorticoid

action in the context of glomerular disease, an augmenting

effect on HIV gene expression might have been observed.

This interplay may explain, in part, why HIV-linked trans-

genes were associated with higher levels of vpr expression

than was the c-fms-linked transgene. The exon-2 c-fms

promoter contains no glucocorticoid response element

(Sasmono et al., 2003). The combined effects of Vpr

action and disease development could elevate HIV LTR-

linked expression to levels not attained by the c-fms/vpr

transgene.

In addition to clarifying the involvement of HIV-1 gene

products in HIVAN, HIV transgenic model systems should

be useful in understanding and targeting infected macro-

phages in counteracting HIV-1 persistence. It is important in

the application of sustaining antiretroviral therapy to under-

stand the concerted impact of viral gene products on

proviral activity and immune dysfunction in tissue macro-

P. Dickie et al. / Virology 322 (2004) 69–8178

phages. Illuminating the unique characteristics of HIV-

positive macrophages should lead to the conception of novel

approaches to augment normal cellular immune responses

and, better, to effect the removal of persistently infected

cells from HIV-infected individuals.

Table 2

PCR primers

Name Primer sequence (5V–3V) Position

PDN3 GGTGGGAGCAGTATCGAGACCT 8873–8896

PDN2 CCAGAGAGCTCCCAGGCTCAGATCTGG 9546–9572

LV1 GAGGACAGATGGAACAAGCC 5551–5570

RV1 CTAGGATCTACTGGCTCC 5832–5849

L2 GGACGTATAGTTAGTCCTAGGTGTGA 5416–5441

VH2 CTTACTGCTTTGATAGAGAAGCTT 6026–6049

045 CTGAGCCTGGGAGCTCTCTGGC 477–498

R3 TACAGCTGCCTTGTAAGTCAT 9021–9041

5FMS CCCAGGACTTGGCCATCTGTTTCT 6857–6880*

5GAPDH AATGCATCCTGCACCACCAA

3GAPDH GTAGCCATATTCATTGTCATA

The primers used for PCR genotyping of HIV-1 transgenic mice and for RT-

PCR analysis of tissue RNA are listed. HIV-specific sequences and base

positions were derived from the sequence of HIV-1 proviral DNA in

pEVd1443 (Felser et al., 1989). Asterisk (*) denotes base position of primer

in p7.2fms-EGFP.

Materials and methods

Transgene construction and animals

To create DGag/Pol proviral HIV transgenic mouse lines

deficient in Vpr, or Vpr and Nef, frameshift mutations were

introduced into pEVd1443 HIV DNA (Felser et al., 1989)

and pEVd1443[DNef] DNA (Kajiyama et al., 2000) by

cleavage at an EcoRI restriction enzyme site in the vpr gene

(Fig. 1). DNA ends were blunt-ended with DNA polymer-

ase I and rejoined with DNA ligase. In preparation of

pTV2, the source of HIV[Tat/Vpr] transgene DNA, nef was

deleted from pEVd1443 by excising the sequence between

the unique BamHI site (position 8465) and KpnI at position

9005 and replacing it with the vpr open reading frame

between positions 5480 and 5895 (RsaI sites) by blunt-end

ligation. The sequence between NsiI and SspI sites of this

plasmid (base 1247 to base 6153) was removed and

replaced with a 395 bp (5348–5743) fragment produced

by PCR amplification of the vpr gene (digested with PstI

and EcoRI) and a 410 bp EcoRI/SspI fragment (5347–

6153) by three-fragment ligation. The end-product, plasmid

pTV2, contained a proviral derivative in which vpr genes

flanked tat in its native position. MeRV mice carried a c-

fms/vpr transgene derived from p7.2fms-EGFP (Sasmono et

al., 2003) in which the RsaI vpr fragment replaced EGFP.

For embryo microinjection, plasmid DNAs were digested

with FspI and NaeI (HIV), or PvuI (c-fms/vpr), and purified

from agarose. Microinjection of fertilized FVB/N � FVB/N

embryos followed standard procedures (Hogan et al.,

1986).

FVB/N mice were purchased from Taconic Farms Inc.

(Germantown, NY). Transgenic mouse lines were main-

tained in the hemizygous state through backcrosses with

FVB/N mice. Transgenic offspring were identified either by

the presence of HIV-induced perinatal cataracts (Dickie,

1996) or PCR analysis of mouse genomic DNA. They were

housed in a conventional breeding facility, fed standard

chow, and handled according to CCAC guidelines.

Northern blot analyses

Total RNA (40 Ag for kidney, 20 Ag for other tissues),

extracted using an acid-guanidinium procedure (Chomc-

zynski and Sacchi, 1987), was fractionated in 1.25%

denaturing (2.2 M formaldehyde) agarose and blotted onto

Nytran membranes (Schleicher and Schuell Inc., Keene,

NH). UV cross-linked membranes (Stratagene, La Jolla,

CA) were hybridized with a 32P-dCTP-labeled probe

derived from a Nef cDNA for the detection of HIV-

specific transcripts (Dickie et al., 1991). An RNA molec-

ular weight ladder was obtained from Life Technologies

(Bethesda, MD). Membranes were stripped and rehybri-

dized with a 32P-dCTP-labeled probe for human h-actin(Clontech, Palo Alto, CA) to control for loading discrep-

ancies. The animals represented were between 24 and 35

days old.

Urine analyses

Spontaneously released urine samples were collected and

analyzed immediately for protein and creatinine content.

Protein (mg/dl) was determined using Bradford reagent

(Bio-Rad Lab., Hercules, CA). Urine creatinine levels were

measured using a commercially available kit (Sigma Corp.,

St. Louis, MO). Individual animals were tested on three

successive days and mean values computed.

Histochemistry and electron microscopy

For histochemical analysis, kidneys from 1- to 2-month-

old female mice were halved by a longitudinal midline cut

and fixed in 10% buffered formalin. Five-micrometer

sections were stained with hematoxylin and eosin. A

pathologist (RU) blinded to the animal genotype performed

the histological evaluation of c-fms/vpr transgenic tissue.

Frozen sections (4 Am) of kidneys (in OCT) were immu-

nostained with rabbit polyclonal antiserum raised against a

peptide of Vpr (residues 1–46; AIDS Reagent and Refer-

ence Depository, Rockville, MD). After washing, the

sections were incubated with Alex-488 conjugated goat

anti-rabbit IgG (Molecular Probes, Oregon). For electron

microscopy, renal tissue from 25-week-old mice was fixed

in 2.5% glutaraldehyde in 0.1 M cacodylate buffer and

embedded in glycolmethacrylate. Thin sections were

stained with osmium tetroxide and examined by transmis-

sion electron microscopy.

ology 322 (2004) 69–81 79

PCR primer pairs and semiquantitative RT-PCR

Transgenes were routinely detected in mouse genomic

DNA by PCR using the primer pairs listed in Table 2. For

the detection of HIVd1443 sequences: PDN3/PDN2; for

TV2 sequences: LV1/PDN2; and for c-fms/vpr sequences:

5FMS/RV1. For RT-PCR detection of native vpr transcripts,

the primer pair L2/VH2 was used with HIV transgenic

lysates and LV1/RV1 was used for c-fms/vpr transgenic

lysates. Alternative spliced products in HIVd1443 lysates

were analyzed using the 045/RV1 primer pair. The 3V vprgene transcript of the TV2 transgene was detected with LV1/

R3. GAPDH primers are also listed in Table 2. Semiquan-

titative RT-PCR was performed on total RNA or mRNA

partially purified by a single selection on oligo-dT cellulose.

RNA (2 Ag total or 0.5 Ag mRNA) was reverse transcribed

with Superscript II (Life Technologies). Undiluted, two- and

tenfold serial dilutions of cDNA were subjected to PCR

amplification in triplicate. PCR cycles were determined

empirically to yield linear results. Standard amplification

conditions were 94 jC for 2 min, 60 jC for 1 min, 75 jC for

1.5 min, 94 jC for 30 s. For the labeling of PCR products,32P-dCTP (0.13 AM) replaced cold dCTP in the reaction

mix. Unlabeled products were visualized in 1% agarose gels

stained with ethidium bromide. Labeled products were

fractionated in 5% acrylamide and exposed to X-ray film.

The DNA ladder was obtained from Life Technologies.

Computational analyses

Individual values were computed as the average of

triplicate experiments. Group means were subjected to

statistical analyses (t test) using SigmaPlot8.0 graphics

software (SSPS Science). Error bars denote single standard

deviations.

P. Dickie et al. / Vir

Acknowledgments

The authors acknowledge the assistance of Richard

Sherburne in preparation of the figures, Dr. Nick Nation for

his histopathological analyses, Jennie Owens for her

assistance with electron microscopy, and Hideko Mobaraki

for contributions with immunohistostaining. We are very

grateful to Dr. Roy Himes and Dr. David Hume for

supplying the p7.2fms-EGFP plasmid DNA. This work was

supported by the Medical Research Council of Canada (MT-

14135). Animals were housed and cared for in accordance

with CCAC guidelines.

References

Agostini, I., Navarro, J.M., Bouhamdan, M., Willetts, K., Rey, F., Spire, B.,

Vigne, R., Pomerantz, R., Sire, J., 1999. The HIV-1 Vpr co-activator

induces a conformational change in TFIIB. FEBS Lett. 450, 235–239.

Aldrovandi, G.M., Zack, J.A., 1996. Replication and pathogenicity of hu-

man immunodeficiency virus type 1 accessory gene mutants in SCID-

hu mice. J. Virol. 70, 1505–1511.

Alpers, C.E., Tsai, C.C., Hudkins, K.L., Cui, Y., Kuller, L., Benveniste,

R.E., Ward, J.M., Morton, W.R., 1997. Focal segmental glomeruloscle-

rosis in primates infected with a simian immunodeficiency virus. AIDS

Res. Hum. Retroviruses 13, 413–424.

Azad, A.A., 2000. Could Nef and Vpr proteins contribute to disease

progression by promoting depletion of bystander cells and prolonged

survival of HIV-infected cells? Biochem. Biophys. Res. Comm. 267,

677–685.

Baba, T.W., Liska, V., Khimani, A.H., Ray, N.B., Dailey, P.J., Penninck,

D., Bronson, R., Greene, M.F., McClure, H.M., Martin, L.N.,

Ruprecht, R.M., 1999. Live attenuated, multiply deleted simian im-

munodeficiency virus causes AIDS in infant and adult macaques.

Nat. Med. 5, 194–203.

Balliet, J.W., Kolson, D.L., Eiger, G., Kim, F.M., McGann, K.A., Sriniva-

san, A., Collman, R., 1994. Distinct effects in primary macrophages and

lymphocytes of the human immunodeficiency virus type 1 accessory

genes vpr, vpu, and nef: mutational analysis of a primary HIV-1 isolate.

Virology 200, 623–631.

Barisoni, L., Kriz, W., Mundel, P., D’Agati, V., 1999. The dysregulated

podocyte phenotype: a novel concept in the pathogenesis of collapsing

idiopathic focal segmental glomerulosclerosis and HIV-associated ne-

phropathy. J. Am. Soc. Nephrol. 10, 51–61.

Barisoni, L., Bruggeman, L.A., Mundel, P., D’Agati, V.D., Klotman, P.E.,

2000. HIV-1 induces renal epithelial dedifferentiation in a transgenic

model of HIV-associated nephropathy. Kidney Int. 58, 173–181.

Bodi, I., Andrew, A., Kimmel, P.L., 1995. Apoptosis in human immu-

nodeficiency virus-associated nephropathy. Am. J. Kidney Dis. 26,

286–291.

Bruggeman, L.A., Dikman, S., Meng, C., Quaggin, S.E., Coffman, T.M.,

Klotman, P.E., 1997. Nephropathy in human immunodeficiency virus-1

transgenic mice is due to renal transgene expression. J. Clin. Invest.

100, 84–92.

Bukrinsky, M., Adzhubei, A., 1999. Viral protein R of HIV-1. Rev. Med.

Virol. 9, 39–49.

Chen, A., Sheu, L.F., Ho, Y.S., Chou, W.Y., Wang, J.Y., Lee, W.H., 1998.

Administration of dexamethasone induces proteinuria of glomerular

origin in mice. Am. J. Kidney Dis. 31, 443–452.

Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation

by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal.

Biochem. 162, 156–159.

Cohen, A.H., Sun, N.C.J., Shapshak, P., Imagawa, D.T., 1989. Demonstra-

tion of human immunodeficiency virus in renal epithelium in HIV-as-

sociated nephropathy. Mod. Pathol. 2, 125–128.

Conaldi, P.G., Biancone, L., Bottelli, A., Wade-Evans, A., Racusen, L.C.,

Boccellino, M., Orlandi, V., Serra, C., Camussi, C., Toniolo, A., 1998.

HIV-1 kills renal tubular epithelial cells in vitro by triggering an

apoptotic pathway involving caspase activation and Fas upregulation.

J. Clin. Invest. 102, 2041–2049.

Connor, R.I., Chen, B.K., Choe, S., Landau, N.R., 1995. Vpr is required for

efficient replication of human immunodeficiency virus type-1 in mono-

nuclear phagocytes. Virology 206, 935–944.

Crowe, S.M., 1995. Role of macrophages in the pathogenesis of human

immunodeficiency virus (HIV) infection. Aust. N. Z. J. Med. 25,

777–783.

D’Agati, V., Appel, G.B., 1998. Renal pathology of human immunodefi-

ciency virus infection. Semin. Nephrol. 18, 406–421.

Dickie, P., 1996. HIV-1 Nef perturbs eye lens development in transgenic

mice. AIDS Res. Hum. Retroviruses 12, 177–189.

Dickie, P., 2000. Nef modulation of HIV Type 1 gene expression and

cytopathicity in tissues of HIV transgenic mice. AIDS Res. Hum. Ret-

roviruses 16, 777–790.

Dickie, P., Felser, J., Eckhaus, M., Bryant, J., Silver, J., Marinos, N.,

Notkins, A.L., 1991. HIV-associated nephropathy in transgenic mice

expressing HIV-1 genes. Virology 185, 829–839.

P. Dickie et al. / Virology 322 (2004) 69–8180

Dickie, P., Roberts, A., Lee, R., 2001. A defect in HIV-1 transgenic murine

macrophages results in deficient nitric oxide production. J. Leukocyte

Biol. 70, 592–600.

Eberhardt, W., Engels, C., Muller, R., Pfeilschifter, J., 2002. Mechanisms

of dexamethasone-mediated inhibition of cAMP-induced tPA expres-

sion in rat mesangial cells. Kidney Int. 62, 809–821.

Eitner, F., Cui, Y., Hudkins, K.L., Anderson, D.M., Schmidt, A., Mor-

ton, W.R., Alpers, C.E., 1998. Chemokine receptor (CCR5) expres-

sion in human kidneys and in the HIV infected macaque. Kidney Int.

54, 1945–1954.

Felser, J.M., Klimkait, T., Silver, J., 1989. A syncytia assay for human

immunodeficiency virus type 1 (HIV-1) envelope protein and its use

in studying HIV-1 mutations. Virology 170, 566–570.

Gazzinelli, R., Sher, A., Cheever, A., Gerstberger, S., Martin, M.A., Dickie,

P., 1996. Infection of HIV transgenic mice with Toxoplasma gondii

stimulates proviral transcription in macrophages in vivo. J. Exp. Med.

183, 1645–1655.

Gibbs, J.S., Lackner, A.A., Lang, S.M., Simon, M.A., Sehgal, P.K., Daniel,

M.D., Desrosiers, R.C., 1995. Progression to AIDS in the absence of a

gene for vpr or vpx. J. Virol. 69, 2378–2383.

Green, D.F., Resnick, L., Bourgoignie, J.J., 1992. HIV infects glomerular

endothelial and mesangial but not epithelial cells in vitro. Kidney Int.

14, 956–960.

Gu, J., Emerman, M., Sandmeyer, S., 1997. Small heat shock protein

suppression of Vpr-induced cytoskeletal defects in budding yeast.

Mol. Cell. Biol. 17, 4033–4042.

Gummuluru, S., Emerman, M., 1999. Cell cycle- and Vpr-mediated regu-

lation of human immunodeficiency virus type 1 expression in primary

and transformed T-cell lines. J. Virol. 73, 5422–5430.

Hanna, Z., Kay, D.G., Rebai, N., Guimond, A., Jothy, S., Jolicoeur, P.,

1998. Nef harbors a major determinant of pathogenicity for an

AIDS-like disease induced by HIV-1 in transgenic mice. Cell 95,

163–175.

Heinzinger, N.K., Bukinsky, M.I., Haggarty, S.A., Ragland, A.M.,

Kewalramani, V., Lee, M.A., Gendelman, H.E., Ratner, L., Steven-

son, M., Emerman, M., 1994. The Vpr protein of human immuno-

deficiency virus type 1 influences nuclear localization of viral nucleic

acids in nondividing host cells. Proc. Natl. Acad. Sci. U.S.A. 91,

7311–7315.

Himes, S.R., Tagoh, H., Goonetilleke, N., Sasmono, T., Oceandy, D.,

Clark, R., Bonifer, C., Hume, D.A., 2001. A highly conserved c-fms

gene intronic element controls macrophage-specific and regulated ex-

pression. J. Leukocyte Biol. 70, 812–820.

Hogan, B., Costantini, F., Lacy, E., 1986. Manipulating the Mouse Embryo.

Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Hrimech, M., Yao, X.J., Bachand, F., Rougeau, N., Cohen, E.A., 1999.

Human immunodeficiency virus type 1 (HIV-1) Vpr functions as

an immediate-early protein during HIV-1 infection. J. Virol. 73,

4101–4109.

Jowett, J.B.M., Planelles, V., Poon, B., Shah, N.P., Chen, M.-L., Chen,

I.S.Y., 1995. The human immunodeficiency virus type 1 vpr gene

arrests infected T cells in the G2 + M phase of the cell cycle. J. Virol.

69, 6304–6313.

Kajiyama, W., Kopp, J.B., Marinos, N.J., Klotman, P.E., Dickie, P., 2000.

HIV-transgenic mice lacking gag-pol-nef develop glomerulosclerosis

and express viral RNA and protein in glomerular epithelial and tubular

cells. Kidney Int. 58, 1148–1159.

Kimmel, P.L., Ferriera-Centeno, A., Farkas-Szallasi, T., Abraham, A.A.,

Garrett, C.T., 1993. Viral DNA in microdissected renal biopsy tissue

from HIV infected patients with nephrotic syndrome. Kidney Int. 43,

1347–1352.

Kino, T., Gragerov, A., Kopp, J.B., Stauber, R.H., Pavlakis, G.N., Chrou-

sos, G.P., 1999. The HIV-1 virion-associated protein vpr is a coactivator

of the human glucocorticoid receptor. J. Exp. Med. 189, 51–62.

Kulkosky, J., Laptev, A., Shetty, S., Srinivasan, A., BouHamdan, M.,

Prockop, D.J., Pomerantz, R.J., 1999. Human immunodeficiency virus

type 1 Vpr alters bone marrow cell function. Blood 93, 1906–1915.

Kuroda, M., Sasamura, H., Shimizu-Hirota, R., Mifune, M., Nakaya, H.,

Kobayashi, E., Hayashi, M., Saruta, T., 2002. Glucocorticoid regulation

of proteoglycan synthesis in mesangial cells. Kidney Int. 62, 780–789.

Leonard, J.M., Abramczuk, J.W., Pezen, D.S., Rutledge, R., Belcher, J.H.,

Hakim, F., Shearer, G., Lamperth, L., Travis, W., Fredrickson, T., Not-

kins, A.L., Martin, M.A., 1988. Development of disease and virus

recovery in transgenic mice containing HIV proviral DNA. Science

242, 1665–1670.

Levy, D.N., Fernandes, L.S., Williams, W.V., Weiner, D.B., 1993. Induc-

tion of cell differentiation by human immunodeficiency virus 1 vpr. Cell

72, 541–550.

Lu, Y.-L., Spearman, P., Ratner, L., 1993. Human immunodeficiency virus

type 1 viral protein R localization in infected cells and virions. J. Virol.

67, 6542–6550.

Matarrese, P., Conti, L., Varano, B., Gauzzi, M.C., Belardelli, F., Gessani,

S., Malorni, W., 2000. The HIV-1 vpr protein induces anoikis-resistance

by modulating cell adhesion process and microfilament system assem-

bly. Cell Death Differ. 7, 25–36.

Mori, T., Bartocci, A., Satriano, J., Zuckerman, A., Stanley, R., Santiago,

A., Schlondorff, D., 1990. Mouse mesangial cells produce colony-stim-

ulating factor-1 (CSF-1) and express the CSF-1 receptor. J. Immunol.

144, 4697–4702.

Murphy, K.A., Sweet, M.J., Ross, I.L., Hume, D.A., 1993. Effects of tat and

nef gene products of human immunodeficiency virus type 1 (HIV-1) on

transcription controlled by the HIV-1 long terminal repeat and on cell

growth in macrophages. J. Virol. 67, 6956–6964.

Nelson, P.J., Sunamoto, M., Husain, M., Gelman, I.H., 2002. HIV-1

expression induces cyclin D1 expression and pRb phosphorylation

in infected podocytes: cell-cycle mechanisms contributing to the pro-

liferative phenotype in HIV-associated nephropathy. BMC Microbiol.

2, 26.

Planelles, V., Bachelerie, F., Jowett, J.B., Haislip, A., Xie, Y., Banooni, P.,

Masuda, T., Chen, I.S., 1995. Fate of the human immunodeficiency

virus type 1 provirus in infected cells: a role for vpr. J. Virol. 69,

5883–5889.

Poli, A., Abramo, F., Taccini, E., Guidi, G., Barsotti, P., Bendinelli, M.,

Malvaldi, G., 1993. Renal involvement in feline immunodeficiency

virus infection: a clinicopathological study. Nephron 64, 282–288.

Purcell, D.F.J., Martin, M.A., 1993. Alternative splicing of human immu-

nodeficiency virus type 1 mRNA modulates viral protein expression,

replication, and infectivity. J. Virol. 67, 6365–6378.

Rappaport, J., Kopp, J.B., Klotman, P.E., 1994. Host virus interactions and

the molecular regulation of HIV-1: role in the pathogenesis of HIV-

associated nephropathy. Kidney Int. 46, 16–27.

Ray, P.E., Liu, X.-H., Henry, D., Xu, L., Dye, L., Orenstein, J.M., Schutz-

bank, T.E., 1997. Infection of primary renal epithelial cells with HIV-1

from children with HIV-associated nephropathy. Kidney Int. 53,

1217–1229.

Santoro, T.J., Bryant, J.L., Pellicoro, J., Klotman, M.E., Kopp, J.B., Brug-

geman, L.A., Franks, R.R., Notkins, A.L., Klotman, A.L., 1994.

Growth failure and AIDS-like cachexia syndrome in HIV-1 transgenic

mice. Virology 201, 147–151.

Sasmono, R.T., Oceandy, D., Pollard, J.W., Tong, W., Pavli, P., Wain-

wright, B.J., Ostrowski, M.C., Himes, S.R., Hume, D.A., 2003. A

macrophage colony-stimulating receptor-green fluorescent protein

transgene is expressed throughout the monophagocyte system of the

mouse. Blood 101, 1155–1163.

Schito, M.L., Kennedy, P.E., Kowal, R.P., Berger, E.A., Sher, A., 2001.

A human immunodeficiency virus-transgenic mouse model for assess-

ing interventions that block microbial-induced proviral gene expres-

sion. J. Infect. Dis. 183, 1592–1600.

Sherman, M.P., de Noronha, C.M., Eckstein, L.A., Hataye, J., Mundt, P.,

Williams, S.A., Neidleman, J.A., Goldsmith, M.A., Greene, W.C.,

2003. Nuclear export of Vpr is required for efficient replication of

immunodeficiency virus type 1 in tissue macrophages. J. Virol. 77,

7582–7589.

Singhal, P.C., Sharma, P., Loona, R., Gibbons, N., Franki, N., Klotman,

P. Dickie et al. / Virology 322 (2004) 69–81 81

E.A., 1998. Enhanced proliferation, apoptosis, and matrix accumulation

by mesangial cells derived from HIV-1 transgenic mice. J. Investig.

Med. 46, 297–302.

Stewart, S.A., Poon, B., Jowett, J.B., Chen, L.S., 1997. Human immuno-

deficiency virus type 1 Vpr induces apoptosis following cell cycle

arrest. J. Virol. 71, 5579–5592.

Trono, D., 1995. HIV accessory proteins: leading roles for the supporting

cast. Cell 82, 189–192.

Watanabe, S., Yoshimura, A., Inui, K., Yokota, N., Liu, Y., Sugenoya, Y.,

Morita, H., Ideura, T., 2001. Acquisition of the monocytes/macro-

phage phenotype in human mesangial cells. J. Lab. Clin. Med. 138,

193–199.

Yao, X.J., Mouland, A.J., Subbramanian, R.A., Forget, J., Rougeau, N.,

Bergeron, D., Cohen, E.A., 1998. Vpr stimulates viral expression and

induces cell killing in human immunodeficiency virus type 1-infected

dividing Jurkat cells. J. Virol. 72, 4686–4693.