Upload
others
View
4
Download
0
Embed Size (px)
Citation preview
FMRFamide-like peptides and their
role in reproduction in the Chagas
vector, Rhodnius prolixus
by
Laura Sedra
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Department of Cell and Systems Biology
University of Toronto
© Copyright by Laura Sedra 2016
ii
FMRFamide-like peptides and their role in
reproduction in the Chagas vector, Rhodnius
prolixus
Laura Sedra
Doctor of Philosophy
Department of Cell and System Biology
University of Toronto
2016
Abstract
Insect reproductive systems are tightly modulated by neurotransmitters via direct
innervation, by neurohormones circulating in the haemolymph and by neuromodulators that
can be released either locally or more widespread in the periphery. FMRFamide-like peptides
(FLPs) are large families of neuropeptides with conserved RFamide C-termini and have been
implicated in vertebrate and invertebrate neuroendocrinology. This thesis examines the
differing roles that members of the FLP superfamily have in the adult female reproductive
system of Rhodnius prolixus. The entire female reproductive tract is composed of different
arrangements of striated muscles. Two members of the N-terminally extended
FM/L/IRFamides have been shown to stimulate ovariole, ovary, oviduct and bursal muscle
contraction in a dose-dependent manner; whereas the myosuppressin, RhoprMS, does not
have any myogenic effect on the reproductive tract. The RhoprNPF (neuropeptide F) and
RhoprNPF receptor (RhoprNPFR) genes have been cloned from the R. prolixus central
iii
nervous system (CNS) and phylogenetic analysis implies possible receptor-ligand co-
evolution. RhoprNPFR has been classified as a G-protein coupled receptor (GPCR)
containing 7 transmembrane domains and a conserved 8th
α-helix that are classic
characteristics of rhodopsin-type GPCRs. FMRFamide-like immunoreactivity (FLI) was
observed in cells and processes in the adult CNS and processes on the reproductive tract.
Moreover a specific subset of median neurosecretory cells (MNSCs) in the brain as well as
small cell bodies along the muscle fibers of the lateral oviduct express the RhoprNPF
transcript. The RhoprNPFR transcript is also expressed in putative pre-follicular cells of the
R. prolixus telotrophic ovariole. RhoprNPFR transcript appears to be supplied to the
developing oocyte during vitellogenesis and the receptor most likely aids in the
differentiation of pre-follicular cells into mature follicle cells surrounding the growing oocyte
and helps regulate the supply of nutrients. Screening members of the FLP family in an egg-
laying assay showed that N-terminally extended FM/L/IRFamides and short NPF stimulate
oogenesis, whereas MS inhibits it. Although RhoprNPF does not have a myogenic effect on
lateral oviduct muscle, I have shown that it potentially aids in ovulation. Sulfakinins exhibit
no effect on egg-laying. In summary, this thesis demonstrates the importance of FLPs in the
control and regulation of the female R. prolixus reproductive system.
iv
Acknowledgements
It has been a long road, and I would like to thank everyone that made it a pleasant
journey. I give my deepest thanks and appreciation to my supervisor Angela Lange. I entered
this degree during a very low point in my life, not really knowing what I wanted to do. A true
inspirational role model, Angela provided me with professional and personal guidance to get
me through. Her support, presence and mentorship were the sole reason I transferred into this
degree.
I would also like to extend a special thanks to Ian Orchard for the many weekends
spent (most likely with Angela) editing my work. Ian and Angela are splendid mentors and I
am truly grateful for the opportunity to just dive in the science, even when I didn’t think I
had the right molecular background and wasn’t sure what I was doing. Thank you for taking
a chance on me. And overlooking the bug phobia…
Special thanks goes out to Darryl Gwynne (the stats-guru) for making sure the
thought process behind all my stats work was good for publication.
Being here for 5 years, many lab colleagues, post-docs and undergrad students came
and went, and each person has provided me with great support, company and entertainment.
My evolving lab family has made coming into the lab more enjoyable and something to look
forward to on the dreary days.
I probably wouldn’t have been half as efficient if it wasn’t for my supportive (and
very driven) family members. Thank you to Daddy and Gena for tolerating my crazy and not
complaining (too much) about my daily ‘experiment updates’ on the car ride home. Thanks
for picking up the slack around the house whenever I couldn’t (or just chose not to). And a
big thanks goes to Daddy for waking me up at the forbidden hour of 5am every day and for
v
the many early morning rides. All in all, this journey would have been extremely difficult
without both of your support and boost-me ups.
Although Mommy was never aware of my acceptance into the program, I’m sure that
this is a time where she would have been extremely proud. I would have never been ready to
overtake such an accomplishment without all your love and constant encouragement. I wish I
could have brought this home to you and demanded that I autographed your copy. I hope
you’re at peace and watching down on us with joy and pride. I can finally say that I’m your
little ‘doctor’.
Last but certainly not least is a big thanks to my man (my main babe). Thank you to
my fiancée Mina Girgis for being my personal cheer squad and getting me through the rough
patches of failed experiments and never ending dissection days. Thanks for all the late night
calls and ensuring that I was alright even when you were bogged down with twice the
workload. Thanks for believing in me. Thanks for loving me…feelings!
vi
Table of Contents
Abstract .............................................................................................................. ii
Acknowledgments ............................................................................................. iv
Organization of the Thesis ................................................................................ x
List of Figures and Tables ................................................................................ xi
List of Abbreviations ....................................................................................... xv
Chapter 1
General Introduction ......................................................................................... 1
Neuropeptides ............................................................................................ 2
G-protein coupled receptors (GPCRs) ...................................................... 7
Control of Muscle Contraction .................................................................. 8
Gross Anatomy of Female Insect Reproductive Structures .................... 16
Oogenesis ................................................................................................. 19
Vitellogenesis .......................................................................................... 21
Oviposition .............................................................................................. 22
Rhodnius prolixus .................................................................................... 23
Significance ............................................................................................. 24
Objectives ................................................................................................ 25
References ............................................................................................... 29
Chapter 2
The female reproductive system of the kissing bug, Rhodnius prolixus:
arrangement of muscles, distribution and myoactivity of two endogenous
FMRFamide-like peptides .............................................................................. 40
Abstract .................................................................................................... 41
Introduction ............................................................................................. 42
Materials and Methods ............................................................................ 47
Results ..................................................................................................... 50
Discussion ................................................................................................ 74
References ............................................................................................... 79
vii
Acknowledgements ................................................................................. 83
Copyright Acknowledgement .................................................................. 84
Chapter 3
Myoinhibitors controlling oviduct contraction within the female blood-
gorging insect, Rhodnius prolixus .................................................................. 85
Abstract .................................................................................................... 86
Introduction ............................................................................................. 88
Materials and Methods ............................................................................ 90
Results ..................................................................................................... 94
Discussion .............................................................................................. 110
References ............................................................................................. 115
Acknowledgements ............................................................................... 120
Copyright Acknowledgement ................................................................ 121
Chapter 4 Establishing an egg-laying assay for a Rhodnius prolixus
Colony ............................................................................................................. 122
Abstract .................................................................................................. 123
Introduction ........................................................................................... 124
Materials and Methods .......................................................................... 128
Results ................................................................................................... 131
Discussion .............................................................................................. 141
References ............................................................................................. 146
Acknowledgements ............................................................................... 150
Chapter 5 Long neuropeptide F (NPF) as well as other FMRFamide-like peptides
(FLPs) regulate egg production in the Chagas vector R. prolixus ............ 151
Abstract .................................................................................................. 152
Introduction ........................................................................................... 153
Materials and Methods .......................................................................... 156
Results ................................................................................................... 167
viii
Discussion .............................................................................................. 185
Conclusions ........................................................................................... 190
Glossary ................................................................................................. 191
Author Contributions ............................................................................. 191
Funding .................................................................................................. 191
References ............................................................................................. 192
Acknowledgements ............................................................................... 197
Chapter 6 Characterization of a long neuropeptide F receptor (NPFR), a potential
regulator of egg production in the Chagas vector, Rhodnius prolixus .... 198
Abstract .................................................................................................. 199
Introduction ........................................................................................... 200
Materials and Methods .......................................................................... 202
Results ................................................................................................... 212
Discussion .............................................................................................. 236
References ............................................................................................. 242
Acknowledgements ............................................................................... 246
Chapter 7
General Discussion ........................................................................................ 247
Linking the Parts .................................................................................... 248
Muscle arrangement and spontaneous activity of the female
reproductive tract of R. prolixus ............................................................ 249
Presence of FLPs in the adult female R. prolixus ................................. 251
Effect of FLPs on R. prolixus reproductive tissue myoactivity ............ 254
Characterization of NPF and its receptor in R. prolixus ....................... 256
FLPs regulate Oogenesis ....................................................................... 258
Future Directions ................................................................................... 263
Determine if other FLPs activate the RhoprNPF receptor ......... 263
Knockdown RhoprNPF and RhoprNPFR ................................... 264
Determine whether RhoprNPF regulates ecdysteroid release ... 265
Identifying the ‘mating factor’ .................................................... 266
ix
Concluding remarks ............................................................................... 266
References ............................................................................................. 268
x
Organization of the Thesis
Chapter 1 provides a general introduction for my thesis and area of study.
Chapter 2 was published in Peptides (Sedra, L. and Lange, A.B. (2014). Peptides, 53: 140-
147; doi:10.1016/j.peptides.2013.04.003).
Chapter 3 was published in General and Comparative Endocrinology (Sedra, L., Haddad,
A.S. and Lange, A.B. (2015) General and Comparative Endocrinology, 211: 62-68;
doi:10.1016/j.ygcen.2014.11.019). A.S. Haddad performed the qPCR.
Chapter 4 has been written for the sole purpose of presenting all the preliminary research
that was necessary in developing the egg-laying assay.
Chapter 5 is in the revision process with Peptides.
Chapter 6 will be submitted for publication.
All dissections, experiments and data analysis were carried out by myself. The findings of
chapter 6 were obtained before that of chapter 5, and Meet Zandawala (a former Ph.D.
student from Ian Orchard’s lab) trained and mentored me in the techniques of molecular
biology. Dr. Lange provided guidance, comments, suggestions and funding for all the
chapters of this thesis. Dr. Orchard provided comments and suggestions for chapters 2 and 3.
Published manuscripts in this thesis were not modified with the exception for minor
formatting changes for this thesis. Copyright permission was granted from each publisher to
reprint chapters 2 and 3.
Chapter 7 summarizes the findings from chapters 2-6 and provides a general discussion that
integrates all the concepts presented in reference to insect reproductive physiology.
xi
List of Figures and Tables Chapter 1:
General Introduction ............................................................................................................. 1
Table 1: Predicted FLP sequences in the Rhodnius prolixus genome .................................... 6
Table 2: Some isolated FLP sequences and their various physiological roles in insects...... 10
Figure 1: Gross anatomy of the female reproductive system of Rhodnius prolixus ............. 17
Chapter 2:
The female reproductive system of the kissing bug, Rhodnius prolixus: arrangement of
muscles, distribution and myoactivity of two endogenous FMRFamide-like
peptides ..................................................................................................................... 40
Figure 1: Gross anatomy of the female reproductive system of Rhodnius prolixus ............. 45
Figure 2: Confocal images of Phalloidin staining muscle F-actin in the reproductive tissues
of adult female Rhodnius prolixus. ........................................................................... 56
Figure 3: Confocal images depicting FMRFamide-like immunoreactive staining associated
with neuronal cell bodies and axons in the CNS and dorsal vessel of the adult
Rhodnius prolixus. .................................................................................................... 58
Figure 4: Confocal images showing FMRFamide-like immunoreactive staining associated
with the muscle fibers of the adult female reproductive tract of Rhodnius prolixus. 60
Figure 5: Traces of spontaneous muscular contraction of the ovaries, oviducts and bursa of
female Rhodnius prolixus. ......................................................................................... 62
Figure 6: A bar graph of the differences in spontaneous contraction rate of each female
reproductive structure before and after isolation in the reproductive system of
Rhodnius prolixus. .................................................................................................... 64
Figure 7: Traces denoting the effect of AKDNFIRFa on ovariole contraction of adult female
Rhodnius prolixus. .................................................................................................... 66
Figure 8: The effects of GNDNFMRFa and AKDNFIRFa on ovary contraction of the female
adult Rhodnius prolixus. ........................................................................................... 68
Figure 9: The effects of GNDNFMRFa and AKDNFIRFa on oviduct contraction of the
female adult Rhodnius prolixus. ............................................................................... 70
xii
Figure 10: The effects of GNDNFMRFa and AKDNFIRFa on bursa contraction of the
female adult Rhodnius prolixus. ............................................................................... 72
Chapter 3:
Myoinhibitors controlling oviduct contraction within the female blood-gorging insect,
Rhodnius prolixus ..................................................................................................... 85
Figure 1: Confocal images depicting FGLa/AST immunoreactive staining associated with
the nervi corpora cardiac II (NCCII) and trunk nerves in the CNS, as well as the
common oviduct and spermatheca of the adult female Rhodnius.............................. 98
Figure 2: The effect of RhoprMIP-4 and RhoprAST-2 on the amplitude of spontaneous
oviduct contraction of adult female Rhodnius prolixus. ......................................... 100
Figure 3: The effect of RhoprMS on adult Rhodnius prolixus oviduct contraction. ......... 102
Figure 4: The effect of SchistoFLRFa on the basal tonus and amplitude of adult Rhodnius
prolixus oviduct contraction. ................................................................................... 104
Figure 5: The effect of RhoprMS on the amplitude of adult Locusta migratoria oviduct
contraction................................................................................................................ 106
Figure 6: Expression profile of the relative transcript level of the RhoprMS receptor
(RhoprMSR) in the CNS and the female reproductive tissue of the adult Rhodnius
prolixus. ................................................................................................................... 108
Chapter 4: Establishing an egg-laying assay for a Rhodnius prolixus colony .............. 122
Figure 1: The effect of feeding on egg-laying in virgin Rhodnius prolixus females. ......... 133
Figure 2: The effect of mating on egg-laying in fed Rhodnius prolixus females. .............. 135
Figure 3: Number of eggs laid per fed mated Rhodnius prolixus female that were either not
injected (control), injected with physiological saline or injected with corpus
cardiacum (CC) extracts. ......................................................................................... 137
Figure 4: Statistical comparison of the cumulative number of eggs laid 7, 10 and 14 days
after feeding for control, saline injected and CC injected females. ........................ 139
Chapter 5:
Long neuropeptide F (NPF) as well as other FMRFamide-like peptides (FLPs) regulate
egg production in the Chagas vector Rhodnius prolixus .................................... 151
xiii
Table 1: Gene specific primers (GSPs) designed to clone the RhoprNPF gene. ................ 163
Table 2: Primers used for the spatial and reproductive expression profile of RhoprNPF in
adult Rhodnius prolixus using quantitative PCR (qPCR) (table includes reference
gene primers as well). ............................................................................................. 164
Table 3: Primers used to synthesize sense (control) and antisense (experimental) RNA
probes to detect RhoprNPF mRNA via in situ hybridization. ................................. 165
Table 4: Amino acid sequences of neuropeptides injected into adult female Rhodnius
prolixus for the egg-laying assay. ............................................................................ 166
Figure 1: cDNA sequence and the deduced amino acid sequence of RhoprNPF in Rhodnius
prolixus. ................................................................................................................... 171
Figure 2: Exon-intron map of RhoprNPF. .......................................................................... 173
Figure 3: Amino acid sequence alignment using ClustalW of RhoprNPF with 11 other
identified/predicted NPF sequences from other species. ......................................... 175
Figure 4: (A) Spatial expression profile of the RhoprNPF transcript in different tissues of
fifth instar and adult Rhodnius prolixus as well as (B) adult male and female
reproductive expression profile................................................................................ 177
Figure 5: Schematic map of the CNS and confocal images showing RhoprNPF transcript
expression in cell bodies of fifth instar Rhodnius prolixus using in situ hybridization.
Expression was also found in the hindgut................................................................ 179
Figure 6: Schematic map of the CNS and confocal images showing RhoprNPF transcript
expression in cell bodies of adult Rhodnius prolixus using in situ hybridization.
Expression was also found in female lateral oviducts. ............................................ 181
Figure 7: (A) Experimental outline of the egg-laying assay. (B) Number of eggs produced or
laid per mated female treated with various neuropeptides (truncated RhoprNPF,
GNDNFMRFa, AKDNFIRFa, short RhoprNPF, RhoprMS, RhoprAST-2 and
RhoprSK). ............................................................................................................... 183
Chapter 6:
Characterization of a long neuropeptide F receptor (NPFR), a potential regulator of egg
production in the Chagas vector, Rhodnius prolixus .......................................... 198
Table 1: GSPs designed to clone the RhoprNPF receptor gene. ......................................... 209
Table 2: Primers used to detect the spatial and reproductive expression profile of
RhoprNPFR in fifth instar and adult Rhodnius prolixus using qPCR. .................... 210
xiv
Table 3: Primers used to synthesize the sense (control) and antisense (experimental) RNA
probes to detect RhoprNPFR using fluorescent in situ hybridization (FISH). ........ 211
Figure 1: cDNA sequence and the deduced amino acid sequence of NPFR in Rhodnius
prolixus. ................................................................................................................... 216
Figure 2: Exon-intron map of the RhoprNPF receptor. ...................................................... 218
Figure 3: Amino acid sequence alignment using ClustalW of RhoprNPFR with 13 other
identified/predicted NPF sequences from other species. ......................................... 220
Figure 4: Phylogenetic analysis of RhoprNPF and RhoprNPFR with other arthropods and
invertebrates. ........................................................................................................... 222
Figure 5: Spatial expression profile of the RhoprNPFR transcript in different tissues of fifth
instar and adult Rhodnius prolixus. .......................................................................... 224
Figure 6: Spatial expression profile of the RhoprNPFR gene in the adult reproductive tract of
Rhodnius prolixus. ................................................................................................... 226
Figure 7: Confocal images of RhoprNPFR transcript expression in cell bodies of fifth instar
Rhodnius prolixus using FISH. ................................................................................ 228
Figure 8: Expression of the RhoprNPFR transcript in adult Rhodnius prolixus CNS. ....... 230
Figure 9: Stacked confocal images of accessory cells in the adult female ovarioles
expressing RhoprNPFR using FISH. ....................................................................... 232
Figure 10: Stacked confocal images of stained cells along the fifth instar digestive tract of
Rhodnius prolixus using FISH. ................................................................................ 234
Chapter 7:
General Discussion ............................................................................................................. 247
Figure 1: Schematic overview of the endocrinological regulation of the ‘mating factor’ on
vitellogenesis and ovulation in R. prolixus. ............................................................. 261
xv
List of Abbreviations
Note: Abbreviations included in this list have also been defined when used for the first time
in the text.
aa amino acids
AMG anterior midgut
ANOVA analysis of variance
AP action potential
ARC American Red Cross
AST allatostatin
B bursa
B/CG bursa and cement gland
BLAST basic local alignment search tool
bp base pairs
Br brain
CA corpora allatum
Ca2+
calcium
CC corpus cardiacum
CC/CA corpus cardiacum/corpus allatum complex
CCAP crustacean cardioactive peptide
cDNA complementary deoxyribonucleic acid
CL calyx
CNS central nervous system
CO common oviduct
DV dorsal vessel
EC50 half maximal effective concentration
FB fat body
FG foregut
FGLa/ASTs FGLamide allatostatins
FISH fluorescent in situ hybridization
FLI FMRFamide-like immunoreactivity
FLPs FMRFamide-like peptides
GABA gamma amino butyric acid
GDP guanosine diphosphate
GPCR G-protein coupled receptor
GRK G-protein coupled receptor kinase
GS gene specific
GSP gene specific primers
GTP guanosine triphosphate
HG hindgut
JH juvenile hormone
LO lateral oviduct
MALDI/TOF matrix assisted laser desorption/ionization time of flight
MIP/ASTs myoinhibiting peptides
MNSCs median neurosecretory cells
xvi
mRNA messenger ribonucleic acid
MS myosuppressin
MT Malpighian tubules
MTGM mesothoracic ganglionic mass
NCCII nervi corpori cardiaci II
NGS normal goat serum
NPF long neuropeptide F
NPFR long neuropeptide F receptor
NPY neuropeptide Y
NSCs neurosecretory cells
NT neurotransmitters
O ovaries
ORF open reading frame
OV/SP oviducts and spermathecae
PBS phosphate-buffered saline
PKC protein kinase C
PMG posterior midgut
PRO prothoracic ganglion
PSP post-synaptic potential
qPCR quantitative polymerase chain reaction
RACE rapid amplification of cDNA ends
SEM standard error of the mean
SG salivary gland
SK sulfakinins
sNPF short neuropeptide F
SOG sub-oesophageal ganglion
SP spermathecae
SV/ED seminal vesicle and ejaculatory duct
T testes
TM transmembrane domain
trNPF truncated NPF
UTR untranslated region
VD/AG vas deferens and accessory glands
1
Chapter 1:
General Introduction
2
Neuropeptides
Chemical synaptic transmission is a well-studied mode of cell-to-cell communication.
In synaptic transmission an action potential (AP) propagates along the presynaptic axon to
the synaptic terminal. The change in membrane potential activates voltage-gated Ca2+
channels in the terminal’s plasma membrane leading to an influx of Ca2+
which initiates
exocytosis of synaptic vesicles and the release of their contents into the synaptic cleft (e.g.
Randall et al., 2002). The released neurotransmitter (NT) can then bind to receptors on the
postsynaptic cell resulting in downstream signaling changes. There are two kinds of chemical
synaptic transmission, one is fast/direct and the other is slow/indirect (e.g. Orchard et al.,
2001). Neurotransmitters released into the synaptic cleft can either bind to receptors that are
ligand-gated ion channels, causing a change in ionic current flow (fast); or, they can bind to
receptors that activate second messenger pathways in the postsynaptic cell that will
eventually modify ion flow across the membrane or lead to other changes within the cell such
as enzyme activation (slow) (Randall et al., 2002).
Fast-acting neurotransmitters are predominantly small molecules that are typically
synthesized and packaged within the synaptic axon terminal (see Randall et al., 2002). These
molecules can only be released at specialized active zones of the presynaptic membrane. On
the other hand, slow-acting neurotransmitters are generally larger molecules usually made up
of more than one amino acid linked together by peptide bonds (Randall et al., 2002). Slow-
acting neurotransmitters are typically synthesized in the soma of the presynaptic cell and are
packaged into larger granules and processed into active peptides as they are transported down
the axon to the terminal for release (Randall et al., 2002). Unlike fast-acting
neurotransmitters, slow-acting neurotransmitters can be released from their granules at many
3
sites of the presynaptic terminal (and not necessarily at the cleft). This allows
neurotransmitters (which are normally released at the synaptic cleft and only impact the
postsynaptic cell) to be also released more locally and to act as neuromodulators where they
can influence and communicate with other neighbouring cells. Slow-acting neurotransmitters
have slower effects which are longer lasting since mechanisms to terminate their action at the
synaptic cleft are slower and they generally have a higher binding affinity to their receptor;
therefore there is prolonged stimulation of the postsynaptic cell (Randall et al., 2002;
Orchard et al., 2001).
There are two kinds of slow-acting neurotransmitters: biogenic amines and
neuropeptides. Biogenic amines, such as dopamine and serotonin, are derived from one
amino acid. Neuropeptides on the other hand, consist of several amino acid residues linked
by peptide bonds. Instead of just being synthesized in the soma of a neuron within the central
nervous system (CNS), peptides can also be synthesized and released from intestinal
endocrine cells, sensory neurons and autonomic motor neurons (see Randall et al., 2002).
Neuropeptides, and biogenic amines, can also be synthesized and released from
neurosecretory cells (NSCs) into the haemolymph (blood) and circulate in the haemolymph
allowing them to reach many peripheral target tissues. Therefore, neuropeptides and biogenic
amines not only act as neurotransmitters and neuromodulators, but can be neurohormones.
FMRFamide-like peptides (FLPs) are a large superfamily of structurally similar
neuropeptides with diverse biological activities, and, based on their amino acid sequence, can
be subdivided into the following families: the N-terminally extended FM/L/IRFamides,
myosuppressins, sulfakinins (or HMRFamides), long neuropeptide F (NPF) and short
neuropeptide F (sNPF) (Table 1 and Table 2; Orchard et al. 2001; Ons et al. 2011). FLPs
4
have been characterized and cloned in a plethora of insect species and all share a common
amidated arginine-phenylalanine (RF)amide C-terminus. Due to the accessibility of the
Rhodnius prolixus genome, Ons et al. (2011) were able to predict many members of the FLP
superfamily in silico (Table 1). The N-terminally extended FM/L/IRFamides are generally
classified as excitatory neuropeptides, and in every scenario to date, and also seen in
Drosophila melanogaster, the extended FM/L/IRFamide gene encodes many copies of active
and sometimes redundant neuropeptides (Table 2; see Nässel, 2002). Duve et al. (1992)
isolated 13 extended FM/L/IRFamide neuropeptides in the Calliphora vomitoria
FMRFamide gene. FMRFamide is an important neuropeptide in several phyla such as
Arthropoda, Nematoda, Mollusca and Annelida (Orchard et al., 2001). Only found in
Arthropoda, myosuppressins have been identified in Schistocerca gregaria, Locusta
migratoria, Diploptera punctata, Manduca sexta, D. melanogaster and Neobelliera bullata
(see Orchard et al., 2001). Unlike the gene for the extended FM/L/IRFamides, the
myosuppressin gene for the most part only encodes for one neuropeptide that ends in a
conserved FLRFamide C-terminus (see Orchard et al., 2001). Recently, the myosuppressin
(MS) gene has been characterized and cloned in the hemipteran, R. prolixus, and found to
have a unique FMRFamide C-terminus (RhoprMS) (Table 1 and Table 2; Lee et al., 2012;
Ons et al., 2011). Generally involved in feeding and exhibiting a homology to vertebrate
gastrin, sulfakinins (SKs) have been identified in sulfated and non-sulfated forms in many
insects, including Leucophaea maderae (Nachman et al., 1986a), Periplaneta americana
(Veenstra, 1989) and L. migratoria (Schoofs et al., 1990). Lastly, until recent, short
neuropeptide F (sNPF) and long neuropeptide F (NPF) were believed to be evolutionarily-
related since they share some sequence similarity; however, they are present on entirely
5
different genes and therefore are now not thought to be related (Nässel and Wegener, 2011).
Both of these neuropeptides have been suggested to modulate feeding and reproduction in
insects (Table 2). Overall the same neuropeptide can have pleiotropic effects in the same
organism as well as between species (see Table 2). In this thesis, chapter two will examine
the physiological roles of two FLPs, one with an FMRFamide C-terminus and the other
ending with FIRFamide (extended FM/L/IRFamides). Chapter 3 will delve into the
importance of the highly conserved FLRFamide C-terminus of the myosuppressins compared
to the FMRFamide ending of RhoprMS of R. prolixus. Lastly, chapter 5 and chapter 6 will
present data on the cloning and characterization of long neuropeptide F and its receptor in R.
prolixus respectively.
6
Table 1: Predicted sequences of mature FLPs in R. prolixus* N-terminally extended FM/L/IRFamides m/z
SPLEKNFMRFa 1267.66
FDRARDNFMRFa 1473.72
AKDNFIRFa 1009.55
SKDNFMRFa 1043.51
IKDNFIRFa 1051.60
GNDNFMRFa 999.45
QRLSDKSDNFIRFa 1624.85
Myosuppressin (RhoprMS)
pQDIDHVFMRFa** 1289.60
Sulfakinins (RhoprSK)
pQFNEYGHMRFa 1310.60
GGSDEKFDDYGYMRFa 1785.75
Long neuropeptide F (RhoprNPF)
pQPIPADAMARPARPKSFASPDDLRTYLDQLGQYYAVAGRPRFa 4688.42
AVAGRPRFa 872.53
Short neuropeptide F (short RhoprNPF)
NNRSPQLRLRFa 1399.79 * modified from Ons et al., 2011
**cloned in Lee et al., 2012
7
G-protein coupled receptors (GPCRs)
G-protein coupled receptors (GPCRs) have many different kinds of ligands including
odorants, taste ligands, photons, glycoproteins, biogenic amines, and of course neuropeptides
(see Caers et al., 2012; Granier and Kobilka, 2012). GPCRs have many key topographical
characteristics that have been conserved through evolution. GPCRs are made up of 7
transmembrane domains (TM), each typically made up of 20-30 hydrophobic amino acids
that span the lipid bilayer (see Caers et al., 2012). Each of the 7 TMs forms an α-helical
secondary structure, and all 7 helices produce a final barrel conformation (see Iismaa and
Shine, 1992; Granier and Kobilka, 2012). The N-terminus is present on the extracellular side
of the lipid bilayer and contains N-glycosylation sites that are recognized by various
carbohydrate molecules and aid in protein folding (see Arey, 2012). Serine and threonine
residues on the cytosolic loops were found to be potential phosphorylation sites by either
protein kinase C (PKC) or G-protein coupled receptor kinase (GRK), resulting in receptor
internalization when over-stimulation of the receptor occurs (Marchese et al., 2003). GPCRs
are closely associated with heterotrimeric G-protein subunits (α-, β- and γ) on the cytosolic
side of the membrane, which explains the name. When the receptor is activated, a
conformational change takes place, allowing for the displacement of guanosine diphosphate
(GDP) with guanosine triphosphate (GTP). The GTP-bound α-subunit then dissociates from
the β/γ-subunit complex and is followed by a series of signal cascades (see Iismaa and Shine,
1992; Granier and Kobilka, 2012).
All characterized GPCRs are classified into 6 subfamilies; however, only 2 of these
subfamilies have neuropeptide ligands – the rhodopsin-type receptor (family A) and the
secretin-type receptor (family B). There are two other characterized and conserved traits
8
important for classifying rhodopsin-type GPCRs. All rhodopsin-type GPCRs to date contain
two 100% conserved cysteine residues on the first two extracellular loops that form a
disulfide bond that is critical for structure stabilization (see Iismaa and Shine, 1992).
Secondly, all type-A GPCRs have a conserved DRY motif on the cytosolic end of the third
transmembrane domain that is important for signaling and intracellular trafficking (Kim et
al., 2008).
Following all the criteria of GPCR structure, the RhoprNPF receptor (RhoprNPFR) is
classified as a rhodopsin-type GPCR and has only been cloned in two other insects: D.
melanogaster (Garczynski et al., 2002) and the African malaria mosquito, Anopheles
gambiae (Garczynski et al., 2005).
Control of Muscle Contraction
Muscle contraction is controlled and regulated by a variety of neuropeptides in insects
and these neurochemicals are deemed myotropic (see Klowden, 2007). The first neuropeptide
to be isolated in insects is the pentapeptide, proctolin, which was found to induce hindgut
contraction of the cockroach, P. americana (Brown and Starratt, 1975; Sullivan and
Newcomb, 1982). Several FLPs have also been shown to modulate muscle contraction in
insects (Table 2). For example, Hillyer et al. (2014) found that although low doses of
SALDKNFMRFamide (a member of the N-terminally extended FM/L/IRFamides) increases
heart contraction rates in A. gambiae, high doses exhibit the opposite effect. Moreover, FLPs
have been shown to regulate other essential physiological processes such as reproduction
(Table 2). For the most part, members of the N-terminally extended FM/L/IRFamides exhibit
myoexcitatory effects on various muscular tissues such as the gut, oviducts, segmental
9
muscles, skeletal muscle and the heart in many insects (Table 2). There are some exceptions
in D. melanogaster where DPKQDFMRFa (dFMRFa-(2-6)) and PDNFMRFa (dFMRFa-11)
cause a decrease in heart rate (Table 2; Johnson et al., 2000). In all cases observed,
myosuppressin always resulted in a decrease of muscle contraction of the digestive tract, the
oviducts and the heart of many insects (Table 2). The effects of the myosuppressins,
leucomyosuppressin (pQDVDHVFLRFa) and SchistoFLRFamide (PDVDHVFLRFa) have
been thoroughly assessed in many insect species (see Table 2). Although the presence of
sulfakinins predominantly results in a decrease in food intake by the insect, there were two
cases where the application of sulfakinins resulted in a dose-dependent increase in gut
contraction of Leucophaea maderae and P. americana (Nachman et al., 1986a; Veenstra,
1989). Lastly, long and short NPF have been heavily implicated in the stimulation of egg and
ovarian development and sNPF seems to decrease oviduct contraction in Tenebrio molitor
and Zophobas atratus (Table 2; Marciniak et al, 2013).
10
Table 2: Some native FMRFamide-like peptides (FLPs) and their physiological roles in insects.
Species of Isolation Sequence Name Sequence Physiological Role Species of Effect Reference N-terminally extended FM/L/IRFamides
Calliphora vomitoria
Met5-enkephalin-
Arg6-Phe
7
YGGFMRFa
Myoexcitatory on
extensor leg muscle Schistocerca gregaria
Evans and Myers, 1986
Cardioexcitatory Cuthbert and Evans,
1989
Increase salivary gland
secretion Calliphora vomitoria Duve et al., 1991
Myoexcitatory on
oviducts Locusta migratoria Peeff et al., 1993
CalliFMRFa 1 TPQQDFMRFa Cardioexcitatory
Calliphora vomitoria Duve et al., 1993
CalliFMRFa 2 TPSQDFMRFa No effect on heart
CalliFMRFa 3 SPSQDFMRFa No effect on heart
CalliFMRFa 4 KPNQDFMRFa No effect on heart
CalliFMRFa 5 APGQDFMRFa Cardioexcitatory
CalliFMRFa 6 ASGQDFMRFa No effect on heart
Locusta migratoria GQERNFLRFamide GQERNFLRFa Myoexcitatory on
oviducts Locusta migratoria Lange et al., 1994
AFIRFamide AFIRFa
Manduca sexta MasFLRFamide II GNSFLRFa
Myoexcitatory on ileum Manduca sexta Kingan et al., 1996 MasFLRFamide III DPSFLRFa
Drosophila melanogaster
dFMRFa-1 SVQDNFMHMa
Myoexcitatory on
segmental muscle
Drosophila melanogaster
Hewes et al., 1998
No effect on heart Johnson et al., 2000
dFMRFa-(2-6) DPKQDFMRFa
Myoexcitatory on
segmental muscle Hewes et al., 1998
Cardioinhibitory Johnson et al., 2000
dFMRFa-(7-8) TPAEDFMRFa
Myoexcitatory on
segmental muscle Hewes et al., 1998
No effect on heart Johnson et al., 2000
dFMRFa-9 SDNFMRFa
Myoexcitatory on
segmental muscle Hewes et al., 1998
Myoinhibitory on crop Kaminski et al., 2002
No effect on heart Johnson et al., 2000
11
dFMRFa-10 SPKQDFMRFa
Myoexcitatory on
segmental muscle Hewes et al., 1998
No effect on heart Johnson et al., 2000
dFMRFa-11 PDNFMRFa
Myoexcitatory on
segmental muscle Hewes et al., 1998
Cardioinhibitory Johnson et al., 2000
dFMRFa-12 SAPQDFVRSGKa
No effect on segmental
muscle tension Hewes et al., 1998
No effect on heart Johnson et al., 2000
dFMRFa-13 MDSNFIRFa
Myoexcitatory on
segmental muscle Hewes et al., 1998
No effect on heart Johnson et al., 2000
Anopheles gambiae SALDKNFMRFamide SALDKNFMRFa Cardioregulator Anopheles gambiae Hillyer et al., 2014
Myosuppressins
Leucophaea maderae leucomyosuppressin
(LMS) pQDVDHVFLRFa
Myoinhibitory on
foregut and hindgut
Leucophaea maderae Cook and Wagner, 1991 Myoinhibitory on
oviducts
Cardioinhibitory
Myoinhibitory on
hindgut Diploptera punctata
Holman et al., 1986
Myoinhibitory on
midgut Fuśe and Orchard, 1998
Cardioinhibitory Schistocerca gregaria
Cuthbert and Evans,
1989
Myoinhibitory on
oviducts Locusta migratoria
Peeff et al., 1993
Myoinhibitory on
midgut
Lange and Orchard,
1998
Cardioinhibitory Calliphora vomitoria Duve et al., 1993
Myoinhibitory on the
foregut and hindgut Blattella germanica
Aguilar et al., 2004 Decrease on food intake
Cardioinhibitory Maestro et al., 2011
Locusta migratoria PDVDHVFLRFamide PDVDHVFLRFa Myoinhibitory on Locusta migratoria Peeff et al., 1994
12
ADVGHVFLRFamide ADVGHVFLRFa oviducts
Schistocerca gregaria schistoFLRFamide PDVDHVFLRFa
Cardioinhibitory Schistocerca gregaria Robb et al., 1989
Myoinhibitory on
oviducts Locusta migratoria
Peeff et al., 1993
Myoinhibitory on
midgut
Lange and Orchard,
1998
No effect on heart Calliphora vomitoria Duve et al., 1993
Myoinhibitory on
midgut Diploptera punctata Fuśe and Orchard, 1998
Myoinhibitory on
foregut Blattella germanica Aguilar et al., 2004
Cardioinhibitory Baculum extradentatum Calvin and Lange, 2010
Manduca sexta manducaFLRFamide pQDVVHSFLRFa
Myoinhibitory on
midgut Locusta migratoria
Lange and Orchard,
1998
Myoinhibitory on
foregut Blattella germanica Aguilar et al., 2004
Neobellieria bullata neomyosuppressin
(NMS) TDVDHVFLRFa
Myoinhibitory on
foregut Blattella germanica Aguilar et al., 2004
Drosophila melanogaster dromyosuppressin Cardioinhibitory
Drosophila melanogaster Johnson et al., 2000
Myoinhibitory on crop Kaminski et al., 2002
Rhodnius prolixus RhoprMS pQDIDHVFMRFa
Myoinhibitory on
anterior midgut
Rhodnius prolixus Lee et al., 2012 Myoinhibitory on
hindgut
Cardioinhibitory
Sulfakinins (HMRFamides)
Leucophaea maderae
leucosulfakinin-I
(LSK) EQFEDY(SO3H)GHMRFa
Myoexcitatory on
hindgut Leucophaea maderae Nachman et al., 1986a
Decrease food intake Schistocerca gregaria Schoofs et al., 2001
leucosulfakinin-II
(LSK-II) pESDDY(SO3H)GHMRFa
Myoexcitatory on
hindgut Leucophaea maderae Nachman et al., 1986b
Decrease food intake Schistocerca gregaria Wei et al., 2000
Decrease food intake
Blattella germanica Maestro et al., 2001 Non-sulfated
LSK-II
pESDDYGHMRFa No effect on food
intake
13
Drosophila melanogaster
DSK-I FDDY(SO3H)GHMRFa
Myoinhibitory on gut Drosophila melanogaster Nichols, 2007 nsDSK-I FDDYGHMRFa
DSK-II GGDDQFDDY(SO3H)GHMRFa
nsDSK-II GGDDQFDDYGHMRFa
Periplaneta americana
perisulfakinin (PSK) EQFDDY(SO3H)GHMRFa
Myoexcitatory on
hindgut Periplaneta americana Veenstra, 1989
Decrease food intake Schistocerca gregaria Wei et al., 2000
No effect on crop
contraction Phormia regina Haselton et al., 2006
Decrease in blood-
feeding Tabanus nigrovittatus Downer et al., 2007
Decrease food intake
Blattella germanica Maestro et al., 2001 Non-sulfated PSK EQFDDYGHMRFa No effect on food
intake
Locusta migratoria
Lom-sulfakinin I pQLASDDY(SO3H)DDYGHMRFa
No effect on ovarian
development Locusta migratoria Cerstiaens et al., 1999
Decrease food intake
Schistocerca gregaria Wei et al., 2000 Non-sulfated
Lom-SK-I pQLASDDYDDYGHMRFa
No effect on food
intake
Long neuropeptide F (NPF)
Schistocerca gregaria truncated NPF
(trNPF) YSQVARPRFa
Increase in ovarian
development
Schistocerca gregaria
Schoofs et al., 2001 Increase oocyte
development
Increase food intake Van Wielendaele et al.,
2013a
Increase weight of
testes and seminal
vesicle Van Wielendaele et al.,
2013b Increase in male
courtship display
Increase in fecundity
Increase in oocyte size Van Wielendaele et al.,
2013c Increase in ovarian
ecdysteroid levels
14
Drosophila melanogaster Dm-NPF SNSRPPRKNDVNTMADAYKFL
QLDTYYGDRARVRFa
Increase food intake Drosophila melanogaster Wu et al., 2003
Cardioexcitatory Protophormia
terraenovae Setzu et al., 2012
Myoinhibitory on
hindgut Rhodnius prolixus
Gonzalez and Orchard,
2009
Aedes aegypti Aedae-NPF SSFTDARPQDDPTSVAEAIRLLQ
ELEKHAQHARPRFa
Myoinhibitory on
anterior stomach Aedes aegypti Onken et al., 2004
Reticulitermes flavipes Ref NPF KPSDPEQLADTLKYLEELDRF
YSQVARPRFa
Myoinhibitory on
hindgut Reticulitermes flavipes Nuss et al., 2010
Short neuropeptide F (sNPF)
Leptinotarsa decemlineata
Led-NPF-I ARGPQLRLRFa
No effect on food
intake Schistocerca gregaria Wei et al., 2000
Increase oocyte size
Locusta migratoria
Cerstiaens et al., 1999 Increase in ovarian
development
No effect on ovarian
development Neobellieria bullata
Cardioinhibitory
Tenebrio molitor
Marciniak et al., 2008
Myoinhibitory on
oviduct
Marciniak et al., 2013
Delayed larval molt but
accelerated pupal
eclosion
Increase in larval body
weight
Cardioinhibitory
Zophobas atratus
Marciniak et al., 2008
Myoinhibitory on
oviduct Marciniak et al., 2013
Led-NPF-II APSLRLRFa No effect on ovarian
development Locusta migratoria Cerstiaens et al., 1999
Drosophila melanogaster Dm-sNPF1 AQRSPSLRLRFa
Increase food intake Drosophila melanogaster Lee et al., 2004
Cardioexcitatory Protophormia
terraenovae Setzu et al., 2012
Inhibits α-amylase,
protease and lipase
activity Periplaneta americana Mikani et al., 2012
15
Dm-sNPF2 WFGDVNQKPIRSPSLRLRFa Increase food intake Drosophila melanogaster Lee et al., 2004
Aedes aegypti Aedae-sNPF APQLRLRFa Myoinhibitory on
anterior stomach Aedes aegypti Onken et al., 2004
Schistocerca gregaria Schgr-sNPF-1 SNRSPSLRLRFa
Inhibits food intake Schistocerca gregaria Dillen et al., 2014 Schgr-sNPF-2 SPSLRLRFa
*only FLPs with tested physiological roles were used in this table.
16
Gross Anatomy of Female Insect Reproductive Structures
The insect female reproductive tract contains two ovaries – this is where oogenesis
(egg development) takes place (Figure 1). Each ovary is composed of a number of ovarioles
in which oogonia differentiate into oocytes. The developing oocyte goes through
vitellogenesis, during which it takes up yolk proteins called vitellogenin and grows in size.
As the oocyte grows, moves distally down the ovariole. Once the terminal oocyte is fully
developed, a chorionic membrane is formed and spontaneous muscle contraction pushes the
oocyte into the lateral oviduct (ovulation). The developed eggs from the lateral oviducts then
move into the common oviduct with the aid of peristaltic contractions (Figure 1). Once the
eggs reach the common oviduct, they are fertilized by sperm stored in the spermatheca and
then pass into the bursa. The fertilized egg is deposited from the bursa along with fluid
secreted from an accessory gland (cement gland) that aids in the egg being fixed onto a
substrate during egg-laying (Figure 1).
17
Figure 1: Gross anatomy of the female reproductive system of R. prolixus. Diagram drawn
by Paul Hong.
18
19
Oogenesis
As mentioned earlier, ovaries are made up of ovarioles, and the ovariole is the site of
oocyte development. There are two main categories of ovarioles in insects, which are:
panoistic and meroistic (Chapman, 2013; Heming, 2003). Panoistic ovarioles are the
ancestral type, and all oogonia present at the apex or end of the ovariole differentiate into
oocytes surrounded by a monolayer of follicular cells. Panoistic ovarioles do not have any
accessory cells to provide nutrients for the oocytes (Chapman, 2013; Heming, 2003) and the
oocytes obtain all their nutrients through the surrounding follicular cells. Insects that have
panoistic ovarioles include orthopterans such as grasshoppers and locusts (Chapman, 2013;
Heming, 2003). On the other hand, undifferentiated oogonia within meroistic ovarioles
differentiate into either oocytes or nurse cells. These two cell types can be arranged in the
ovariole in two different ways therefore subdividing meroistic ovarioles into polytrophic
meroistic or telotrophic meroistic (see Chapman, 2013; Heming, 2003). Polytrophic ovarioles
have alternating nurse cells and oocytes along the length of the ovariole, with each oocyte
associated with a group of nurse cells that provide nutrients. Hymenoptera, Lepidoptera and
Diptera have polytrophic meroistic ovarioles (Chapman, 2013; Heming, 2003). Telotrophic
ovarioles on the other hand have nurse cells that are restricted to the apex of the ovariole and
provide nutrients to each developing oocyte via a nutritive cord. True bugs such as
hemipterans possess telotrophic meroistic ovarioles (Chapman, 2013; Heming, 2003).
Telotrophic ovarioles are composed of 4 main regions: the terminal filament, germarium,
vitellarium and the ovariole stalk. Each ovariole is attached anteriorly to the body wall by a
terminal filament (Figure 1). The germarium is at the apex of each ovariole below the
terminal filament and is densely packed with undifferentiated oogonia and nurse cells (also
20
known as trophocytes). All trophocytes share a trophic core in the germarium and supply
nutrients to each developing oocyte by a cytoplasmic based nutritive cord (Huebner, 1981).
The developing oocyte moves down the ovariole into the vitellarium and undergoes
vitellogenesis. Once the oocyte is fully developed, vitellogenesis is terminated, and the
formation of the chorion begins. The chorion contains holes to allow for sperm entry
(micropyles) and gas exchange (aeropyles) (Chapman, 2013).
Neuropeptides that circulate in the haemolymph as neurohormones or are directly
supplied to the ovary as neurotransmitters (via nerves) can regulate various reproductive
processes (Gäde and Hoffmann, 2005; Girardie and Girardie, 1998). Several early studies
have shown that the contents of ten median neurosecretory cells (MNSCs) in the pars
intercerebralis of the brain play a key role in oogenesis (Lea and Brown, 1990). Follicular
cells within the paired ovaries synthesize ecdysteroids at the end of vitellogenesis and have
been associated with oocyte deposition (Chapman, 2013). In a study by Ruegg et al. (1981),
the presence of ecdysteroids in the haemolymph was responsible for the release of a
neurohormone that is synthesized in the MNSCs and is released into the haemolymph via the
corpus cardiacum (CC). This neurohormone has been shown to increase the rate of oogenesis
in R. prolixus (Ruegg et al., 1981). Sevala et al. (1992) found that peaks in circulating levels
of FLPs in the haemolymph coincide with the peak of each gonadotrophic cycle (egg
production cycle) and speculated that the neurohormone that stimulated oogenesis was an
FLP. This thesis follows up on these findings.
21
Vitellogenesis
Each developing oocyte is surrounded by a monolayer of follicular cells. These
follicle cells form small gaps between cells at the time of vitellogenesis that allow diffusion
of small molecules circulating in the haemolymph to be taken up into the growing oocyte
(Davey, 2000). Neurohormones in the haemolymph can regulate or alter nourishment uptake
by the oocyte. Juvenile hormone (JH) is a lipid based sesquiterpenoid hormone synthesized
in the corpus allatum (CA) and plays a key role in vitellogenesis (Chapman, 2013).
Vitellogenesis is the process of egg growth through the uptake of yolk proteins such as
vitellogenin (Chapman, 2013). Vitellogenin can be supplied to the developing egg through
two means: (1) it can be synthesized by the surrounding follicular cells and delivered directly
to the oocyte, or (2) it can be synthesized by the fat body and delivered to the oocyte via the
haemolymph (Davey, 2000). JH has been shown to be involved in the process of
vitellogenesis by signaling for the presence of large gaps between follicular cells, allowing
for the uptake of large molecules such as vitellogenin into the growing oocyte (Davey, 2000).
Telotrophic vitellogenic oocytes receive nutrients through the follicle cells or from the
haemolymph as well as from the nurse cells at the apex of the ovariole via nutritive cords.
Nutritive cords have been shown to transport macromolecules such as mRNA and protein
from the trophic core into the egg (Huebner, 1981). At the end of vitellogenesis the uptake of
vitellogenin is terminated where the gaps between adjacent follicular cells are believed to be
blocked off, i.e. closed (Chapman, 2013). Instead of synthesizing and supplying vitellogenin
to the growing egg, surrounding follicle cells begin to secrete an elastic vitelline membrane,
followed by the chorion (Chapman, 2013).
22
Oviposition
After vitellogenesis is complete, the nutritive cord (in telotrophic ovarioles)
dissociates from the terminal and fully developed egg, and the follicular cells surrounding the
oocyte form a hard chorion (Huebner, 1981). Once the chorion has been formed, an ovulation
hormone signals the muscle fibers to contract and deposit the terminal oocyte into the lateral
oviduct (ovulation). The egg then ‘moves’ down the lateral oviduct and into the common
oviduct. Many biogenic amines and neuropeptides have been implicated in the regulation and
control of the movement of an egg from one part of the reproductive system to another via
the alteration muscle contraction. For example, octopamine has been shown to increase
oviduct contraction in D. melanogaster (Middleton et al., 2006), whereas in the locust, L.
migratoria it has been shown to inhibit oviduct contraction (Orchard and Lange, 1985).
Neuropeptides such as proctolin and crustacean cardioactive peptide (CCAP) have also been
shown to increase oviduct contraction in the horsefly Tabanus sulcifrons and the pine weevil
Hylobius abietis respectively (Cook and Meola, 1978; Rosiński et al., 2011). Proctolin also
exhibits a dose-dependent myostimulatory effect on R. prolixus oviducts (Lange, 1990). An
increase in the peristaltic contraction of the lateral oviducts will allow for egg movement
along the reproductive tract. Several members of the N-terminally extended FM/L/IRFamides
have also been found to stimulate oviduct contraction (Rosiński et al., 2011; Peeff et al.,
1993). FLPs not only stimulate oviduct contraction, but they inhibit such contractions as
well. Lange et al. (1991) found that myosuppressin elicits muscle relaxation in L. migratoria.
The combination of effect of these numerous neurohormones will result in the controlled
movement of the egg from the lateral oviduct to the common oviduct and will also allow for
spermathecal contractions that result in the release of sperm onto the micropyle region of the
23
fully developed egg leading to fertilization. Once the egg has been fertilized, it is quickly
oviposited from the bursa (also under muscle control), and with secretions from the cement
gland (accessory gland) it is fixed onto a substrate.
Rhodnius prolixus
Rhodnius prolixus is a blood-gorging hemipteran, commonly referred to as the kissing
bug, and requires a blood meal for their growth and development. However, R. prolixus has
been shown to be quite resilient and can survive for up to 200 days without a blood meal
(World Health Organization, 2002). R. prolixus passes through five nymphal instars before
molting into the adult stage. Within the natural environment there are two different types of
native populations that live two very different lifestyles - sylvan and domiciliary (Davey,
2007). Sylvan populations feed mostly from birds and mammals. Sylvan R. prolixus reside in
bird nests and trees and are in constant search for their next blood meal. Females commonly
lay their eggs on the feathers of birds, where they hatch and molt through all five nymphal
stages by obtaining a blood meal from their avian host (Davey, 2007). The other type of R.
prolixus population is the domiciliary population, which is closely associated with human
hosts. Domiciliary R. prolixus inhabit dark, damp crevices in people’s homes and they come
out at night to feed on the human host, where there is the least risk of predation (Davey,
2007). This population best resembles that of laboratory bred colonies, since they have
readily available meals, controlled environmental factors, and are generally less mobile.
R. prolixus is one of the primary vectors of Trypanosoma cruzi, the protozoan
parasite responsible for Chagas disease. Parasite transmission into the host occurs during
feeding. R. prolixus, as most blood-feeders, administers local anaesthetics to the host through
24
its proboscis in order to avoid detection (World Health Organization, 2002). After puncturing
the host, the average fifth instar R. prolixus has been observed to feed for 20min and
consumes a blood meal that is 10 times its unfed body mass (Orchard, 2006). This being a
taxing physiological change, R. prolixus then undergoes immediate diuresis to expel excess
water and salts, as well as the T. cruzi parasite. Upon scratching by the vertebrate host, the
parasite then enters the puncture wound and is introduced into the blood stream (World
Health Organization, 2002; Orchard, 2006). Side effects of Chagas disease include, but are
not limited to, cardiac irregularities, gastrointestinal malfunction and death (Kirchhoff and
Pearson, 2007). According to the World Health Organization (2002), R. prolixus now
predominantly resides in Columbia, El Salvador (where it was first discovered in 1915),
Guatemala, Mexico and Venezuela (Hashimoto and Schofield, 2012). Taking these factors
into account, R. prolixus is quickly becoming a model organism due to its medical relevance
and its tight regulation and coordination of growth and development, ecdysis, and
reproduction with blood-gorging meals.
Significance
The transmission of T. cruzi has caused a serious endemic spread of Chagas in the
Americas. Nearly 18 million reported cases of successful infection of Chagas have been
reported in Central and South America (Kirchhoff and Pearson, 2007). Recently, fear of
infection has spread to North America where more and more cases arise due to infection by
blood transfusion and organ transplants. Although discovered in 1915, it wasn’t until late
2007 that American Red Cross (ARC) and other similar organizations, implemented a more
strict policy in screening donors and current blood banks (Kirchhoff and Pearson, 2007).
25
R. prolixus has become highly adapted to domestic habitats (Hashimoto and
Schofield, 2012), making its containment and eradication extremely difficult. In a life span of
one and a half years, a female can lay over 600 eggs and needs only to mate once (World
Health Organization, 2002). Moreover, egg incubation only lasts 18-20 days before
hatchlings arise. This makes the reproductive turnover quite drastic.
Several neuropeptides and hormones have been implicated in the essential
physiological processes of mating, oogenesis, ovulation and oviposition. Long NPF and
several other FLPs have been implicatedd as modulators within the female reproductive
system of insects (Cerstiaens et al., 1999; Lange et al., 1991; Orchard et al., 2001; Peeff et
al., 1993; Van Wielendaele et al., 2013b). By understanding the involvement of FLPs in
regulating egg-production and egg growth one might be able to alter their signaling pathway
and reduce if not abolish egg-laying in R. prolixus. Therefore, the research presented in this
thesis is critical in providing the basic physiology of the control of reproductive tissue in R.
prolixus and how various known FLPs alter and regulate this essential physiological process.
Objectives
Feeding initiates the start of a gonadotrophic cycle in blood feeding insects which
includes physiological processes such as oogenesis, ovulation and oviposition. These
processes are tightly regulated and, therefore, blood-feeding insects provide an ideal model
system for studying a physiological process at the behavioural level all the way down to the
cellular and molecular level. As previously stated, FLPs have been implicated in the
regulation of several of these process in insects, and research in this thesis looks to better
26
assess and understand their involvement in regulating and controlling egg production and
movement of eggs throughout the reproductive tract.
The overall objective of this thesis is to determine if FLPs are present and involved in
the process of egg production and egg movement along the female reproductive system of R.
prolixus. Since FLPs are characterized into several families, a sample of neuropeptides from
each family was studied. I hypothesize that, FLPs are involved in the process of egg
production, egg movement and egg-laying in the blood-gorging insect, R. prolixus.
Before I delve into the involvement of each FLP family, I had to first define and
describe the female reproductive system of R. prolixus. In the second chapter, I describe for
the first time the differing muscle fiber arrangements of the female reproductive tract. I also
use immunohistochemical techniques to show that FLPs are present in cells and axons in the
adult CNS as well as in the innervation supplying the female reproductive tract. The
spontaneous muscle activity of the ovarioles, ovaries, lateral and common oviducts as well as
the bursa is also described, and effects of N-terminally extended FM/L/IRFamides on
spontaneous contraction are reported. The results strongly suggest a role for FLPs in the
regulation of egg movement.
In the third chapter, I examine the effect of RhoprMS (the sole member of the
myosuppressin subfamily in R. prolixus) on oviduct muscle contraction in R. prolixus and L.
migratoria and compare its effect to other well-known inhibitory neuropeptides such as
RhoprAST-2 and RhoprMIP-4 (members of the A-type and B-type allatostatins respectively).
Since RhoprMS is the first myosuppressin to possess a FMRFamide C-terminal ending
compared to the more common FLRFamide ending (Lee et al., 2012), a structure-activity
27
study was conducted comparing the inhibition efficiency between RhoprMS and the well-
known S. gregaria myosuppressin, SchistoFLRFamide.
The fourth chapter presents preliminary data used to establish an egg-laying bioassay
for female R. prolixus. The effect of feeding and mating was observed on the rate of egg-
laying, and CC extracts as well as physiological saline (control) were administered to
determine if there were any effects on egg laying produced by neurohormones in the CC and
whether they alter egg production or egg-laying rate.
RhoprNPF (Long neuropeptide F subfamily of FLPs) was cloned and characterized as
described in Chapter 5. The spatial expression profile of the mRNA transcript levels of
RhoprNPF was quantified in tissues of fifth instar and adult R. prolixus. Using in situ
hybridization, RhoprNPF mRNA was localized in bilaterally paired medial neurons in the
CNS, as well as in accessory cells within the lateral oviduct. The chapter concludes with the
screening of one FLP of each subfamily and the effect of each on egg production and
ovulation using the egg-laying bioassay.
Lastly, the RhoprNPF receptor (RhoprNPFR) was cloned and characterized in the
sixth chapter. Here I define several conserved traits that characterize this receptor as a
rhodopsin-type GPCR. RhoprNPFR was found to be highly conserved with NPFR amino
acid sequences from other arthropods, suggesting that it plays a critical role in a
physiological process. Phylogenetic analysis of RhoprNPF and RhoprNPFR with other
arthropods suggests possible ligand-receptor co-evolution. Similar with our studies with
RhoprNPF, receptor mRNA expression was also quantified across several tissues of fifth
instar and adult R. prolixus. Using FISH (Fluorescent in situ hybridization), RhoprNPFR was
28
localized in cells in the CNS as well as putative pre-follicular cells within the telotrophic
ovarioles of R. prolixus, suggesting a role in the regulation of vitellogenesis.
Chapter 7 provides a general discussion that links all of these findings together and
discusses possible future directions. In conclusion, I confirmed the distribution of FLPs using
immunohistochemical techniques and RhoprNPF and its receptor via FISH in adult R.
prolixus. In doing so I verified their presence as neurohormones and neuromodulators that
are released from the CC and as neurotransmitters present in axons that directly innervate the
lateral oviducts and bursa of the female reproductive tract. I also isolated and cloned
RhoprNPF and RhoprNPFR and determined the role of various FLPs including RhoprNPF on
the muscle contraction of the female reproductive tract, as well as egg-production and
oviposition.
29
References
Aguilar, R., Maestro, J.L., Vilaplana, L., Chiva, C., Andreu, D. and Bellés, X. (2004).
Identification of leucomyosuppressin in the German cockroach, Blattella germanica,
as an inhibitor of food intake. Regulatory Peptides, 119: 105-112.
Arey, B.J. (2012). The role of glycosylation in receptor signaling. In: Glycosylation. InTech:
http://dx.doi.org/10.5772/50262.
Brown, B.E. and Starratt, A.N. (1975). Isolation of proctolin, a myotropic peptide, from
Periplaneta americana. Journal of Insect Physiology, 21: 1879-1881.
Caers, J., Verlinden, H., Zels, S., Vandersmissen, H.P., Vuerinckx, K. and Schoofs, L.
(2012). More than two decades of research on insect neuropeptide GPCRs: an
overview. Frontiers in Endocrinology, 3: doi: 10.3389/fendo.2012.00151.
Calvin, A. and Lange, A.B. (2010). The association of the FMRFamide-related peptide
family with the heart of the stick insect, Baculum extradentatum. Open Access Insect
Physiology, 2: 1-10.
Cerstiaens, A., Benfekih, L., Zouiten, H., Verhaert, P., De Loof, A. and Schoofs, L. (1999).
Led-NPF-1 stimulates ovarian development in locusts. Peptides, 20: 39-44.
Chapman, R.F. (2013). Reproductive system: female. In: The insects: Structre and function.
New York: Cambridge University Press, 295-301.
Cook, B.J. and Meola, S. (1978). The oviduct musculature of the horsefly, Tabanus
sulcifrons, and its response to 5‐hydroxytryptamine and proctolin. Physiological
Entomology, 3: 273-280.
30
Cook, B.J. and Wagner, R.M. (1991). Comparative effects of leucomyosuppressin on the
visceral muscle systems of the cockroach Leucophaea maderae. Comparative
Biochemistry and Physiology C, 99: 95-99.
Cuthbert, B. and Evans, P.D. (1989). A comparison of the effects of FMRFamide-like
peptides on locust heart and skeletal muscle. Journal of Experimental Biology, 144:
395-415.
Davey, K. (2007). The interaction of feeding and mating in the hormonal control of egg
production in Rhodnius prolixus. Journal of Insect Physiology, 53: 208-215.
Davey, K.G. (2000). The modes of action of juvenile hormones: some questions we ought to
ask. Insect Biochemistry and Molecular Biology, 30: 663-669.
Dillen, S., Verdonck, R., Zels, S., Van Wielendaele, P. and Vanden Broeck, J. (2014).
Identification of the short neuropeptide F precursor in the desert locust: evidence for
an inhibitory role of sNPF in the control of feeding. Peptides, 53: 134-139.
Downer, K.E., Nachman, R.J. and Stoffolano Jr., J.G. (2007). Effect of seasonality and
perisulfakinin on engorgement by Tabanus nigrovittatus (Diptera: Tabanidae) in the
laboratory. Annals of the Entomological Society of America, 100: 251-256.
Duve, H., Elia, A.J., Orchard, I., Johnsen, A.H. and Thorpe, A. (1993). The effects of
CalliFMRFamides and other FMRFamide-related neuropeptides on the activity of the
heart of the blowfly Calliphora vomitoria. Journal of Insect Physiology, 39: 31-40.
Duve, H., Johnsen, A.H., Sewell, J.C., Scott, A.G., Orchard, I., Rehfeld, J.F. and Thorpe, A.
(1992). Isolation, structure, and activity of –Phe-Met-Arg-Phe-NH2 neuropeptides
(designated calliFMRFamides) from the blowfly Calliphora vomitoria. PNAS USA,
89: 2326-2330.
31
Duve, H., Sewell, J.C., Scott, A.G. and Thorpe, A. (1991). Chromatographic characterisation
and biological activity of neuropeptides immunoreactive to antisera against Met5-
enkephalin-Arg6-Phe
7 (YGGFMRF) extracted from the blowfly Calliphora vomitoria
(Diptera). Regulatory Peptides, 35: 145-159.
Evans, P.D. and Myers, C.M. (1986). The modulatory actions of FMRFamide and related
peptides on locust skeletal muscle. Journal of Experimental Biology, 126: 403-422.
Fuśe, M. and Orchard, I. (1998). The muscular contractions of the midgut of the cockroach,
Diploptera punctata: effects of the insect neuropeptides proctolin and
leucomyosuppressin. Regulatory Peptides, 77: 163-168.
Gäde, G. and Hoffmann, K.-H. (2005). Neuropeptides regulating development and
reproduction in insects. Physiological Entomology, 30: 103-121.
Garczynski, S. F., Crim, J. W. and Brown, M. R. (2005). Characterization of neuropeptide F
and its receptor from the African malaria mosquito, Anopheles gambiae. Peptides, 26:
99-107.
Garczynski, S.F., Brown, M.R., Shen, P., Murray, T.F. and Crim, J.W. (2002).
Characterization of a functional neuropeptide F receptor from Drosophila
melanogaster. Peptides, 23: 773-780.
Girardie, J. and Girardie, A. (1998). Endocrine regulation of oogenesis in insects. Annals of
the New York Academy of Sciences, 839: 118-122.
Gonzalez, R. and Orchard, I. (2009). Physiological activity of neuropeptide F on the hindgut
of the blood-feeding hemipteran, Rhodnius prolixus. Journal of Insect Science, 9: 1-
15.
32
Granier, S. and Kobilka, B. (2012). A new era of GPCR structural and chemical biology.
Nature Chemical Biology, 8: 670-673.
Gullan, P.G. and Cranston, P.S. (2005). Muscles and locomotion. In: The insects: an outline
of entomology. MA, USA: Blackwell Publishing, p. 50-56.
Haselton, A.T., Yin, C.-M. and Stoffolano Jr., J.G. (2006). The effects of Calliphora
vomitoria tachykinin-I and the FMRFamide-related peptide perisulfakinin on female
Phormia regina crop contractions, in vitro. Journal of Insect Physiology, 52: 436-
441.
Hashimoto, K. and Schofield, C.J. (2012). Elimination of Rhodnius prolixus in Central
America. Parasites and Vectors, 5: 45.
Heming, B.S. (2003). The female reproductive system and oogenesis. In: Insect development
and Evolution. New York: Cornell University Press, 29-39.
Hewes, R.S., Snowdeal III, E.C., Saitoe, M. and Taghert, P.H. (1998). Functional redundancy
of FMRFamide-related peptides at the Drosophila larval neuromuscular junction. The
Journal of Neuroscience, 18: 7138-7151.
Hillyer, J.F., Estévez-Lao, T.Y. and de la Parte, L.E. (2014). Myotropic effects of
FMRFamide containing peptides on the heart of the mosquito Anopheles gambiae.
General and Comparative Endocrinology, 202: 15-25.
Holman, G.M., Cook, B.J. and Nachman, R.J. (1986). Isolation, primary structure and
synthesis of leucomyosuppressin, an insect neuropeptide that inhibits spontaneous
contractions of the cockroach hindgut. Comparative Biochemistry and Physiology C,
85: 329-333.
33
Huebner, E. (1981). Nurse cell-oocyte interaction in the telotrophic ovarioles of an insect,
Rhodnius prolixus. Tissue and Cell, 13: 105-125.
Iismaa, T.P. and Shine, J. (1992). G protein-coupled receptors. Current Opinion in Cell
Biology, 4: 195-202.
Johnson, E., Ringo, J. and Dowse, H. (2000). Native and heterologous neuropeptides are
cardioactive in Drosophila melanogaster. Journal of Insect Physiology, 46: 1229-
1236.
Kaminski, S. Orlowski, E., Berry, K. and Nichols, R. (2002). The effects of three Drosophila
melanogaster myotropins on the frequency of foregut contractions differ. Journal of
Neurogenetics, 16: 125-134.
Kim, J.-H., Cho, E.-Y., Min, C., Park, J.H. and Kim, K.-M. (2008). Characterization of
functional roles of DRY motif in the 2nd
intracellular loop of dopamine D2 and D3
receptors. Archives of Pharmacal Research, 31: 474-481.
Kingan, T.G., Shabanowitz, J., Hunt, D.F. and Witten, J.L. (1996). Characterization of two
myotropic neuropeptides in the FMRFamide family from segmental ganglia of the
moth Manduca sexta: candidate neurohormones and neuromodulators. The Journal of
Experimental Biology, 199: 1095-1104.
Kirchhoff, L.V. and Pearson, R.D. (2007). The emergence of Chagas disease in the United
States and Canada. Current Infectious Disease Reports, 9: 347-350.
Klowden, M.J. (2007). Locomotor Systems. In: Physiological Systems in Insects. New York:
Academic Press, p. 464-485.
Lange, A.B. (1990). The presence of proctolin in the reproductive system of Rhodnius
prolixus. Journal of Insect Physiology, 36: 345-351.
34
Lange, A.B. and Orchard, I. (1998). The effects of SchistoFLRFamide on contractions of
Locust midgut. Peptides, 19: 459-467.
Lange, A.B., Orchard, I. and Te Brugge, V.A. (1991). Evidence for the involvement of a
SchistoFLRF-amide-like peptide in the neural control of locust oviduct. Journal of
Comparative Physiology, 168: 383-391.
Lange, A.B., Peeff, N.M. and Orchard, I. (1994). Isolation, sequence, and bioactivity of
FMRFamide-related peptides from the locust ventral nerve cord. Peptides, 15: 1089-
1094.
Lea, A. and Brown, M.R. (1990). Neuropeptides of mosquitoes. In: Molecular Insect
Science. New York: Plenum Press, p. 181-188.
Lee, D., Taufique, H., da Silva, R. and Lange, A.B. (2012). An unusual myosuppressin from
the blood-feeding bug, Rhodnius prolixus. Journal of Experimental Biology, 215:
2088–2095.
Lee, K.-S., You, K.-H., Choo, J.-K., Han, Y.-M. and Yu, K. (2004). Drosophila short
neuropeptide F regulates food intake and body size. The Journal of Biological
Chemistry, 279: 50781-50789.
Maestro, J.L., Aguilar, R., Pascual, N., Valero, M.-L., Piulachs, M.-D., Andreu, D., Navarro,
I. and Bellés, X. (2001). Screening of antifeedant activity in brain extracts led to the
identification of sulfakinin as a satiety promoter in the German cockroach. European
Journal of Biochemistry, 268: 5824-5830.
Maestro, J.L., Tobe, S.S. and Belles, X. (2011). Leucomyosuppressin modulates cardiac
rhythm in the cockroach Blattella germanica. Journal of Insect Physiology, 57: 1677-
1681.
35
Marchese, A., Chen, C., Kim, Y.-M. and Benovic, J.L. (2003). The ins and outs of G protein-
coupled receptor trafficking. TRENDS in Biochemical Sciences, 28: 369-376.
Marciniak, P., Grodecki, S., Konopińska, D. and Rosiński, G. (2008). Structure-activity
relationships for the cardiotropic action of the Led-NPF-I peptide in the beetles
Tenebrio molitor and Zophobas atratus. Journal of Peptide Science, 14: 329-334.
Marciniak, P., Szymczak, M., Rogalska, L. and Rosinski, G. (2013). Developmental and
myotropic effects of the Led-NPF-I peptide in tenebrionid beetles. Invertebrate
Reproduction and Development, 57: 309-315.
Middleton, C.A., Nongthomba, U., Parry, K., Sweeney, S.T., Sparrow, J.C. and Elliott, C.J.
(2006). Neuromuscular organization and aminergic modulation of contractions in the
Drosophila ovary. BMC Biology, 4:17.
Mikani, A., Wang, Q.-S. and Takeda, M. (2012). Brain-midgut short neuropeptide F
mechanism that inhibits digestive activity of the American cockroach, Periplaneta
americana upon starvation. Peptides, 34: 135-144.
Nachman, R.J., Holman, G.M., Cook, B.J., Haddon, W.F. and Ling, N. (1986a).
Leucosulfakinin, a sulfated insect neuropeptide with homology to gastrin and
cholecystokinin. Science, 234: 71-73.
Nachman, R.J., Holman, G.M., Cook, B.J., Haddon, W.F. and Ling, N. (1986b).
Leucosulfakinin-II, a blocked sulfated insect neuropeptide with homology to
cholecystokinin and gastrin. Biochemical and Biophysical Research Communications,
140: 357-364.
36
Nässel, D.R. (2002). Neuropeptides in the nervous system of Drosophila and other insects:
multiple roles as neuromodulators and neurohormones. Progress in Neurobiology, 68:
1-84.
Nässel, D.R. and Wegener, C. (2011). A comparative review of short and long neuropeptide
F signaling in invertebrates: any similarities to vertebrate neuropeptide Y signaling?
Peptides, 32:1335-1355.
Nichols, R. (2007). The first nonsulfated sulfakinins activity reported suggests nsDSK acts in
gut biology. Peptides, 28: 767-773.
Nuss, A.B., Forschler, B.T., Crim, J.W., TeBrugge, V., Pohl, J. and Brown, M. (2010).
Molecular characterization of neuropeptide F from the eastern subterranean termite
Reticulitermes flavipes (Kollar) (Isoptera: Rhinotermitidae). Peptides, 31: 419-428.
Onken, H., Moffett, S.B. and Moffett, D.F. (2004). The anterior stomach of larval
mosquitoes (Aedes aegypti): effects of neuropeptides on transepithelial ion transport
and muscular motility. The Journal of Experimental Biology, 207: 3731-3739.
Ons, S., Sterkel, M., Diambra, L., Urlaub, H. and Rivera-Pomar, R. (2011). Neuropeptide
precursor gene discovery in the Chagas disease vector Rhodnius prolixus. Insect
Molecular Biology, 20: 29-44.
Orchard, I. (2006). Serotonin: a coordinator of feeding-related physiological events in the
blood-gorging bug, Rhodnius prolixus. Comparative Biochemistry and Physiology,
Part A, 144: 316-324.
Orchard, I. and Lange, A.B. (1985). Evidence of octopaminergic modulation of an insect
visceral muscle. Journal of Neurobiology, 16: 171-181.
37
Orchard, I., Lange, A.B. and Bendena, W.G. (2001). FMRFamide-related peptides: a
multifunctional family of structurally related neuropeptides in insects. Advances in
Insect Physiology, 28: 267-329.
Peeff, N.M., Orchard, I. and Lange, A.B. (1993). The effects of FMRFamide-related peptides
on an insect (Locusta migratoria) visceral muscle. Journal of Insect Physiology, 39:
207-215.
Peeff, N.M., Orchard, I. and Lange, A.B. (1994). Isolation, sequence, and bioactivity of
PDVDHVFLRFamide and ADVGHVFLRFamide peptides from the Locust central
nervous system. Peptides, 15: 387-392.
Randall, D., Burggren, W. and French, K. (2002). Communication along and between
neurons. In: Eckert animal physiology: mechanisms and adaptations. New York:
W.H. Freeman and Company, p. 167-170.
Robb, S., Packman, L.C. and Evans, P.D. (1989). Isolation, primary structure and bioactivity
of SchistoFLRF-amide, a FMRFamide-like neuropeptide from the locust,
Schistocerca gregaria. Biochemical and Biophysical Research Communications, 160:
850-856.
Rosiński, G., Korczyński, I., Słocińska, M. and Kuźmiński, R. (2011). Peptide actions on
oviduct contractions in the large pine weevil, Hylobius abietis. Insect Science,
18:160-165.
Ruegg, R.P., Kriger, F.L., Davey, K.G. and Steel, C.G.H. (1981). Ovarian ecdysone elicits
release of a myotropic ovulation hormone in Rhodnius (Insecta: Hemiptera).
International Journal of Invertebrate Reproduction, 3: 357-361.
38
Schoofs, L., Clynen, E., Cerstiaens, A., Baggerman, G., Wei, Z., Vercammen, T., Nachman,
R., De Loof, A. and Tanaka, S. (2001). Newly discovered functions for some
myotropic neuropeptides in locusts. Peptides, 22: 219-227.
Schoofs, L., Holman, G.M., Hayes, T.K., Nachman, R.J. and De Loof, A. (1990).
Locustatachykinins I and II, two novel insect neuropeptides with homology to
peptides of the vertebrate tachykinin family. FEBS Letters, 261: 340-397.
Setzu, M., Biolchini, M., Lilliu, A., Manca, M., Muroni, P., Poddighe, S., Bass, C., Angioy,
A.M. and Nichols, R. (2012). Neuropeptide F peptides act through unique signaling
pathways to affect cardiac activity. Peptides, 33: 230-239.
Sevala, V.L., Sevala, V.M., Davey, K.G. and Loughton, B.G. (1992). A FMRFamide-like
peptide is associated with the myotropic ovulation hormone in Rhodnius prolixus.
Archives of Insect Biochemistry and Physiology, 20: 193-203.
Sullivan, R.E. and Newcomb, R.W. (1982). Structure and function analysis of an arthropod
peptide hormone: proctolin and synthetic analogues compared on the cockroach
hindgut receptor. Peptides, 3: 337-344.
Van Wielendaele, P., Dillen, S., Zels, S., Badisco, L. and Vanden Broeck, J. (2013a).
Regulation of feeding by neuropeptide F in the desert locust, Schistocerca gregaria.
Insect Biochemistry and Molecular Biology, 43: 102-114.
Van Wielendaele, P., Wynant, N., Dillen, S., Badisco, L., Marchal, E., and Vanden Broeck,
J. (2013c). In vivo effect of neuropeptide F on ecdysteroidogenesis in adult female
desert locusts (Schistocerca gregaria). Journal of Insect Physiology, 59: 624-630.
39
Van Wielendaele, P., Wynant, N., Dillen, S., Zels, S., Badisco, L. and Vanden Broeck, J.
(2013b). Neuropeptide F regulates male reproductive processes in the desert locust,
Schistocerca gregaria. Insect Biochemistry and Molecular Biology, 43: 252-259.
Veenstra, J.A. (1989). Isolation and structure of two gastrin/CCK-like neuropeptides from
the American cockroach homologous to the leucosulfakinins. Neuropeptides, 14: 145-
149.
Wei, Z., Baggerman, G., Nachman, R.J., Goldsworthy, G., Verhaert, P., De Loof, A. and
Schoofs, L. (2000). Sulfakinins reduce food intake in the desert locust Schistocerca
gregaria. Journal of Insect Physiology, 46: 1259-1265.
World Health Organization. (2002). Control of Chagas Disease. In: WHO Technical Report
Series. Brazil: 46-48.
Wu, Q., Wen, T., Lee, G., Park, J.H., Cai, H.N. and Shen, P. (2003). Developmental control
of foraging and social behaviour by the Drosophila neuropeptide Y-like system.
Neuron, 39: 147-161.
40
Chapter 2:
The female reproductive system of the kissing bug, Rhodnius
prolixus: arrangements of muscles, distribution and myoactivity
of two endogenous FMRFamide-like peptides
Laura Sedra1 and Angela B. Lange
1
1Department of Biology, University of Toronto Mississauga, Mississauga, ON, Canada L5L
1C6
** This chapter has been published in Peptides (Sedra, L. and Lange, A.B. (2014). Peptides,
53: 140-147; doi:10.1016/j.peptides.2013.04.003)
41
Abstract
Phalloidin staining F-actin was used to image muscle fiber arrangements present in
the reproductive system of the adult female Rhodnius prolixus. A mesh of muscle fibers
encircles the ovaries whereas a criss-cross pattern of finer muscle fibers covers each ovariole.
Two layers of muscle fibers (arranged longitudinally and circularly) form the lateral
oviducts. The circular layer of muscle fibers extends throughout the common oviduct and
spermathecae. A chevron pattern of thicker muscle fibers makes up the bursa. All of these
structures show spontaneous contractions that are stimulated in a dose-dependent manner by
the endogenous peptides, GNDNFMRFamide and AKDNFIRFamide which belong to the
family of the FMRFamide-like peptides (FLP). Immunohistochemistry shows that these
peptides could be supplied via nerves to the oviducts, spermathecae and bursa. Although no
FMRF-like immunoreactivity was observed on the ovarioles/ovary they still exhibited a
stimulatory response to the peptides indicating that they may be under the influence of FLPs
as neurohormones. This work implicates FLPs in the control of ovulation, egg movement and
oviposition in this insect.
Keywords: insect, neuropeptides, immunohistochemistry, reproductive system, muscle
contraction, F-actin
42
1. Introduction
Rhodnius prolixus is a blood-feeding insect that is a vector for the parasite
Trypanosoma cruzi. Trypanosoma cruzi is the cause of Chagas disease whereby 18 million
people in Central and South America are infected; side effects include cardiac irregularities,
gastrointestinal malfunction and death [14]. R. prolixus requires a blood-meal for growth and
development, and many physiological processes are regulated by feeding, including
reproduction [1, 6]. A blood meal is required for vitellogenesis and the subsequent ovulation
and oviposition of eggs [6].
Female R. prolixus require energy and nutrients from the blood meal to proceed
successfully with the egg-laying process [4, 6]. The gross anatomy of the female
reproductive system is shown in Figure 1. Each ovary contains 7 telotrophic ovarioles where
vitellogenesis takes place. Once the eggs mature and the chorion has hardened, ovulation
takes place and the eggs travel down the lateral and common oviducts through peristaltic
contractions of the muscles. Spermatozoa are released from the spermathecae (storage site of
the spermatozoa) onto the eggs for fertilization and then the eggs are oviposited in clusters
with the aid of contractions of the bursa and adjacent skeletal muscles. Visceral muscle
contraction has also been shown to be important in Locusta migratoria, Drosophila
melanogaster, Periplaneta americana and other insects for the coordination of processes
involved in egg-laying [3, 18, 21, 25, 29]. Reproduction in R. prolixus is strictly controlled
by a blood meal and occurs in a predicted and regulated time period when maintained in
culture; therefore, R. prolixus is a convenient insect model for examining endocrinological
and physiological aspects of reproduction.
43
Neuropeptides regulate many physiological processes involved in circulation,
digestion, and including those associated with reproduction [see 9, 18, 22, 24]. For example,
CCAP exhibits an excitatory effect on oviduct contractions of Manduca sexta and L.
migratoria [7, 20]. Extensive research has been carried out regarding the excitatory effect of
proctolin on L. migratoria oviducts [16] and proctolin has also been found to play a role in
controlling reproductive tissues of R. prolixus [19, 26]. In contrast, myoinhibiting peptides
(MIPs) have been found to have an inhibitory effect on the peristaltic contractions of the
oviducts in Schistocerca gregaria [34], as have some FMRFamide-like peptides (FLPs) such
as SchistoFLRFamide [31].
FMRFamide-like peptides are a large family of structurally similar neuropeptides
with diverse biological activities [see 24]. The tetrapeptide, FMRFamide, was the first to be
isolated and sequenced in the mollusc, Macrocallista nimbosa and as a tetrapeptide is the
smallest member of this vast family of peptides [28]. There are many subfamilies present
within the FLPs, one of which is the extended FMRFamides [see 22, 24].
FMRFamide-like peptides have been localized in cell bodies and processes
throughout the CNS and in processes on peripheral tissues of many insects, including R.
prolixus [8, 10, 11, 24, 33]. Moreover, extensive work has been carried out on the effects of
FLPs on the physiology of the insect female reproductive system [17, 27].
Little is known about the role of FLPs on female reproduction in R. prolixus, but the
recent sequencing of the R. prolixus neuropeptidome, has made available the sequences of a
variety of R. prolixus FLPs [23]. The neuromuscular system involved in R. prolixus
oogenesis and egg production is comprehensively described for the first time, including the
regulation of muscular contraction by two recently identified R. prolixus FLPs. Previous
44
work has shown that the reproductive system in R. prolixus is innervated by branches from
the trunk nerve from the central nervous system (CNS) [2, 13] and so immunohistochemistry
was utilized to determine if FLPs are associated with these nerves and the reproductive
tissues. FMRFamide-like immunoreactivity was observed in processes on the reproductive
system and therefore we also examined the spontaneous muscle activity of the ovarioles,
ovaries, oviducts and bursa as well as examined the effects of selected R. prolixus FLPs on
these contractions.
45
Fig. 1. Gross anatomy of the female reproductive system of R. prolixus.
46
47
2. Materials and methods
2.1. Animals
Rhodnius prolixus were raised at the University of Toronto Mississauga. Adult
females were maintained at 60% humidity, a temperature of 25˚C and fed on defibrinated
rabbit blood. All experiments were conducted on unfed adult females.
2.2. Chemicals
GNDNFMRFamide and AKDNFIRFamide were purchased from GenScript USA,
Inc. (Piscataway, NJ, USA). Stocks of 10-3
M were made in double-distilled water and stored
as 10µL aliquots at -20˚C. Physiological saline (NaCl 150mM, KCl 8.6mM, CaCl2 2mM,
NaHCO3 4mM, glucose 34mM, MgCl2 8.5mM, HEPES [pH 7.2] 5mM) was prepared in
double-distilled water and used for further dilutions of the peptide.
Rabbit anti-FMRFamide primary antibody and goat Cy3 anti-rabbit (IgG) secondary
antibody were purchased from Jackson ImmunoResearch Laboratories, Inc. (West Grove,
PA, USA); both were stored at -20˚C.
2.3. Immunohistochemistry
Adult female R. prolixus were dissected under physiological saline to expose visceral
tissue and CNS, and were submerged in cold 2% paraformaldehyde in Millonig’s buffer (pH
7.0; 130mM NaH2PO4∙H2O, 100mM NaOH, 1.2% glucose, 0.3mM CaCl2∙2H2O) for 1h at
room temperature. The immunohistochemical protocol has been explained previously [26]
with the following modifications. The tissues were incubated in rabbit anti-FMRFamide
primary antiserum (1:1000 in phosphate buffered saline (PBS; 2.1 mM NaH2PO4, 8.3 mM
48
Na2HPO4, 150 mM NaCl, pH 7.2) containing 0.4% Triton-X-100 and 2% normal goat serum
(NGS)) for 48h at 4˚C. Following the incubation in 1˚ antiserum, the tissues were washed
frequently for 6 hours and then incubated in goat anti-rabbit antibody conjugated to Cy3
(1:600 in 10% NGS in PBS) overnight at 4˚C. Preparations were then washed repeatedly in
PBS, run through a glycerol series and mounted on glass slides. Slides were viewed through
a Zeiss LSM 510 Confocal Laser Microscope (Carl Zeiss, Jena, Germany). To control for the
specificity of the primary antiserum, the primary antiserum was pre-absorbed overnight with
10-5
M GNDNFMRFamide. This eliminated all immunoreactive staining, indicating that the
staining was specific for FLPs.
2.4. Phalloidin staining
Phalloidin-tetramethylrhodamine B isothiocyanate conjugate (Sigma-Aldrich,
Oakville, ON, Canada) stains F-actin and was used to determine the muscular arrangements
associated with the various female reproductive structures. The reproductive structures were
fixed and washed as above for immunohistochemistry; however tissues were kept in the
fixative overnight at 4°C. The preparations were then incubated in phalloidin-Cy3 (1:330
dilution in PBS) for 45 minutes at room temperature. Tissues were washed in PBS and then
mounted on slides to be viewed on a Zeiss LSM 510 Confocal Laser Microscope.
2.5. Contraction assays
The effects of FLPs on spontaneous contraction of the ovarioles, ovaries, oviducts
and bursa of adult R. prolixus females were investigated. To record single ovariole
contractions, the ovarioles were left attached to the calyx where 6 ovarioles were pinned
49
down with minutien pins onto a Sylgard (Dow Corning Corporation, Midland, MI, USA)-
coated Petri dish. Two electrodes were placed on either side of the remaining ovariole to
monitor contraction frequency. These contractions were recorded using an impedance
convertor and analyzed via PicoScope 2200 (Pico Technology, St. Neots, UK) software
(http://www.picotech.com/download.html).
Ovaries were dissected out (separate of oviducts and bursa) and secured on a Sylgard-
coated dish. The anterior ends of the ovaries were secured with minutien pins while the
posterior portion of the ovaries (where it meets the lateral oviducts) were tied with a double
knotted silk thread attached to a Grass FT 03 force transducer (Grass Medical Instruments,
Quincy, MA, USA). The preparations were monitored and analyzed via PicoScope 2200.
Lateral oviducts were dissected out and secured on a Sylgard-coated dish by inserting
minutien pins through the anterior region of the lateral oviducts and tying a silk thread
around the common oviduct (above the spermathecae). The silk thread was then double
knotted onto the small hook constructed from 0.076mm stainless-steel wire of a force
transducer (Aksjeselskapet Mikro-elektronikk, Horten, Norway). The signal was then
amplified and recorded on a Linear Flat-bed chart recorder (VWR, Mississauga, ON,
Canada) to be analyzed.
To measure contractions from the bursa, it was transected from the common oviduct
but left attached to the ventral cuticle. Minutien pins were placed through the cuticle to
secure the preparation to the Sylgard-coated dish. One end of the silk thread was double
knotted beneath the spermathecae and the other was double knotted onto the Norwegian
force transducer and recorded using a chart recorder.
50
All preparations were maintained in 200µL of physiological saline. FLPs were
applied to the preparation by simultaneously adding 100µL of peptide at twice the
concentration recorded and removing 100µL of saline. The preparation was then washed
frequently with saline until the contractions returned to baseline. When the peptides were
applied, the change in basal tonus was measured when the contraction reached maximum
(with the exception of the ovariole assay where only frequency was monitored). These
measurements were then converted to force (mg). The data is represented as difference in
tension of basal tonus for each preparation and the means ± standard error of the mean
(SEM) of n replicates was graphed.
2.6. Statistical Analyses
Graph Pad Prism (www.graphpad.com) was used to construct all graphical
representations in this study and conduct statistical analyses. A paired t-test was used to
determine if there was a significant difference in spontaneous contraction of each
reproductive structure before and after it was isolated from the reproductive system. All
dose-response curves comparing the two extended FLPs used were analyzed by a Two Way
ANOVA followed by Bonferroni's test for each reproductive structure.
3. Results
3.1. Gross anatomy
Previous work has described the various morphological structures associated with the
female reproductive system of R. prolixus [2, 6, 19, see Figure 1]. Phalloidin staining of
muscle F-actin has been used in the current study to examine the arrangement of the muscles
51
present in the female reproductive tissues. A large mesh of muscle fibers (4µm diameter)
encircles each of the two ovaries (Figure 2A), and anteriorly results in a muscular terminal
filament. Each ovary contains 7 ovarioles, and each ovariole is encircled by fine muscle
fibers (1.3µm diameter) arranged in a criss-cross pattern with a muscular filament extending
anteriorly (Figure 2B). The ovarioles extend posteriorly and merge into the calyx. Thick
longitudinal muscle fibers (14µm diameter) run through the calyx and along the lateral
oviducts (Figure 2C). A second outer muscle layer composed of fine fibers (4µm diameter)
surrounds both the calyx and lateral oviducts in a circular layer, with a clear gap in the outer
muscle layer that appears to structurally separate the calyx from the lateral oviduct (Figure
2C). This circular muscle layer continues along the common oviduct and spermathecae;
however here, the muscle fibers are thicker (9µm diameter) and denser (Figure 2D and 2G).
The bursa is composed of thick muscle fibers (14µm diameter) arranged in the shape of a
chevron on the dorsal surface (Figure 2E and 2F). The longitudinal muscle fibers are also
attached to the cuticle by two accessory skeletal muscles (as shown previously [2]). These
include the dorsal muscles on the sides and the lateral muscles that are ventral to the bursa
(Figure 2E). Only the proximal end of the cement gland is muscular (Figure 2H).
3.2. FMRFamide-like immunoreactivity associated with the CNS and the female reproductive
tissue
The reproductive system of R. prolixus receives innervation from branches of the
trunk nerves of the CNS [2, 13]. The distribution of FLPs in adult female CNS and
reproductive tissues of R. prolixus was examined using immunohistochemistry. The anti-
FMRFamide antibody recognizes the C-terminal RFamide and therefore stains neurons and
52
processes of all families of FLPs. Many FMRFamide-like immunoreactive (FLI) cell bodies
are found throughout the adult female CNS in a similar fashion to that previously described
for Vth
instar R. prolixus [10, 33]. In the brain there are over 100 FLI cell bodies, the majority
of which are present in the optic lobes and dorsal medial portion of the brain (BR), and
include 10 bilaterally-paired median neurosecretory cells (Figure 3A). FMRFamide-like
immunoreactive neurons and processes are observed in the sub-oesophageal ganglion (SOG)
and the prothoracic ganglion (PRO) (Figure 3B). Approximately 5 axons containing FLI
staining extend from the SOG to the PRO in each connective (Figure 3B). FMRFamide-like
immunoreactive processes are associated with the corpus cardiacum (CC), where they
formed extensive neurohaemal sites with processes extending down the aorta (Figure 3C).
FMRFamide-like immunoreactive processes also extend along the foregut onto the anterior
midgut (Figure 3C). Some FLI cell bodies of the approximately 100 cells within the
mesothoracic ganglionic mass (MTGM) produce neurohaemal sites on the abdominal nerves,
while others project their axons into the trunk nerves (Figure 3D). The trunk nerves innervate
the tissues of the reproductive system as well as the hindgut [2, 13]. FLI blebs and
varicosities can be observed on the second and third abdominal nerves (Figure 3D).
The ovaries and the ovarioles (OV) do not contain FLI processes; however dispersed
FLI processes are present on the calyx (CL) (Figure 4A). FLI processes are observed along
the lateral (LO) and common oviducts (CO) (Figure 4B and 4C). FLI axons are present
within nerves R3 and R4 [see 13 for terminology] and ventrally innervate the common
oviduct and bursa (B) (Figure 4D and 4F). A chevron pattern of FLI processes is also found
on the bursa (Figure 4E) and an irregular pattern on the spermathecae (SP) (Figure 4F). No
FLI staining is found on the cement gland. A control was conducted with anti-FMRFamide
53
antibody pre-absorbed with 10-5
M GNDNFMRFamide and all staining was eliminated in
both the CNS and the reproductive tissues. In preparations in which staining was performed
for both F-actin and FMRFamide-like immunoreactivity, the immunoreactive processes were
observed to course along the surface of the muscle fibers (results not shown).
3.3. Physiology
3.3.1 Spontaneous contraction of the reproductive structures
The ovarioles, ovaries, oviducts and bursa in the adult R. prolixus are myogenic, and
individually exhibit spontaneous contractions in vitro (Figure 5 – 7). The criss-cross muscle
fibers that encircle the ovarioles result in contraction and relaxation of the ovarioles (Figure
7). The ovaries produce the weakest force of contraction and the oviducts produce the
strongest force of contraction (Figure 5). The ovaries display waves of spontaneous
contractions with durations ranging from 18 to 84 seconds, maximum tension of 9 mg
(Figure 5) and average frequency of 8 waves of contraction every 10 minutes (Figure 5). The
two lateral oviducts demonstrate a synchronized pattern of contraction. Initially one of the
lateral oviducts contracts, and while this lateral oviduct is relaxing the second lateral oviduct
begins its contraction – this results in a prolonged elevation in tension during each wave of
contraction (Figure 5). This is followed by a relaxation period of both lateral oviducts before
the cycle begins again. The duration of each bout of contraction is on average 30 seconds
long and phasic contractions are superimposed on the sustained contractions (Figure 5).
Approximately one bout of sustained contraction is observed per minute (Figure 5). The
bursa exhibits the least amount of spontaneous activity (Figure 5). An occasional twitch of
54
the bursa occurs with a duration ranging from 30 to 60 seconds and rarely exceeds 13mg in
tension (Figure 5).
Spontaneous activity of each reproductive structure in vitro was recorded before and
after it was surgically isolated from the reproductive system (Figure 6). The frequency of
spontaneous lateral oviduct contractions in the intact reproductive system average 33 phasic
contractions per minute (Figure 6). The frequency of spontaneous contractions exhibited by
the spermathecae significantly decreased after surgical removal from the remainder of the
reproductive system (Paired t-test, P=0.0025). Severing the bursa from the rest of the
reproductive system completely abolishes all spontaneous activity (Paired t-test, P=0.0009)
(Figure 6). The proximal end of the cement gland is muscular and spontaneously active, but
it was not possible to monitor its contractions.
3.3.2 The effects of extended FMRFamides on contraction of reproductive structures
Within the R. prolixus neuropeptidome, the extended FMRFamide family is
composed of peptides that contain two different C-terminal endings: FMRFamide and
FIRFamide [23]. Therefore, two peptides, GNDNFMRFamide and AKDNFIRFamide,
containing the two different terminal endings were used for the contraction assays.
An increase in the frequency of ovariole spontaneous contractions was observed after
the application of 5×10-6
M of AKDNFIRFamide (Figure 7). It was difficult to measure the
difference in contraction frequency of the ovarioles for smaller doses.
The ovaries, oviducts and bursa of the adult female R. prolixus responded in a dose-
dependent manner to the two extended FMRFamides, with an increase in basal tonus (Figure
8 – 10). An increase in phasic contractions was also observed superimposed on the sustained
55
contractions. Maximal response was achieved at 5×10-6
M for both peptides on all
reproductive tissues tested, with desensitization apparent at 10-5
M (Figure 8 – 10). For the
ovaries, oviducts and bursa, AKDNFIRFamide exhibited a greater increase in basal tonus
than GNDNFMRFamide (Figure 8 – 10). The effects of both peptides were reversible by
washing in physiological saline. Application of 5×10-6
M GNDNFMRFamide resulted in an
increase in tension of 5 mg by the ovaries. This tension was doubled by the same dose of
AKDNFIRFamide (Two Way ANOVA, P<0.0001; Bonferroni post test, P<0.05) (Figure
8B). This effect was also observed but to a smaller degree in the oviducts (Two Way
ANOVA, P = 0.0002) (Figure 9B). No dose exhibited a statistically different effect between
the two peptides (Figure 9B). Maximal tension of bursa contractions occurred at 5×10-6
M
GNDNFMRFamide and produced a contraction of 57 mg, whereas the same dose of
AKDNFIRFamide was 144 mg (Figure 10B). The effect of AKDNFIRFamide was
statistically significant from that of GNDNFMRFamide at 10-6
M and 5×10-6
M on the bursa
(Two Way ANOVA, P = 0.0004; Bonferroni post test, P<0.0001).
56
Fig. 2. Phalloidin staining muscle F-actin in female adult R. prolixus reproductive tissues.
(A) Muscle fiber network that encircles the ovaries. (B) Terminal filament is a muscular
structure and each ovariole exhibits a criss-cross pattern of the muscle fibers. (C)
Longitudinal and circular muscle layers are present on the lateral oviducts (LO). The gap in
the circular muscle layer appears to be a separation between the calyx (CL) and the lateral
oviduct. (D) Circular arrangement of thick muscle fibers along the common oviduct (CO)
and the spermathecae (SP). (E) Circular arrangement of muscle fibers ends at the posterior
common oviduct (CO) and thick longitudinal muscle fibers form the bursa (B). Lateral
muscles (open arrow) and dorsal skeletal muscles (closed arrow) attach the bursa to the
cuticle. (F) Higher magnification of the muscle arrangement in the bursa; F-actin muscle
banding pattern is indicated by the arrow. (G) Circular layer of muscle fibers surround the
spermathecae. (H) Only the proximal end (the excretory duct) of the cement gland is
muscular (arrow). Scale bars represent 100µm.
57
58
Fig. 3. FMRFamide-like immunoreactivity associated with the CNS in adult R. prolixus. (A)
Brain (BR) and sub-oesophageal ganglion (SOG) showing neuronal cell bodies and
processes. Also shown are immunoreactive processes and blebs associated with the corpus
cardiacum (CC) as indicated by the closed arrow. The open arrow denotes the median
neurosecretory cells. (B) FMRFamide-like immunoreactive axons (arrow) extend from the
SOG to the prothoracic ganglion (PRO). (C) FMRFamide-like immunoreactive processes on
the CC and heavily stained axons are present on the aorta (closed arrow). Immunoreactive
processes project along the foregut (open arrow). (D) Mesothoracic ganglionic mass
(MTGM) showing immunoreactive cell bodies, neurohaemal sites on abdominal nerves
(open arrows) and axons in the trunk nerves (closed arrow). Scale bars represent 100µm.
59
60
Fig. 4. FMRFamide-like immunoreactivity associated with the female reproductive tissue in
adult R. prolixus. (A) Ovaries (OV) showing FLI processes on the calyx (CL). (B) Lateral
oviduct (LO) containing a dense network of FLI processes and blebs. (C) Lateral oviducts
(LO) leading to the common oviduct (CO) displays FLI processes and blebs. (D)
FMRFamide-like immunoreactivity in processes in nerves R3 and R4 that project to the
bursa (B) as indicated by the arrow. (E) A network of immunoreactive processes and blebs
on the bursa. (F) Immunoreactive processes throughout the spermatheca (SP). FMRFamide-
like immunoreactive axons in nerve R3 (arrow) project to the spermathecae. Scale bars
represent 100µm.
61
62
Fig. 5. Spontaneous muscular activity exhibited by the various female reproductive tissues.
Traces displaying the tension over time of ovaries, oviducts and bursa. Each structure
exhibits a unique contraction pattern. Sample trace of 5 preparations.
63
64
Fig. 6. Spontaneous contractions of each reproductive structure before and after isolation
from the reproductive system. The spermatheca and bursa exhibited a significantly lower rate
of spontaneous contraction after isolation (Mean ± SEM; n=5; Paired t-test, * P=0.0025, **
P=0.0009). (OV=ovary, LO=lateral oviduct, CO=common oviduct, SP=spermatheca,
B=bursa)
65
.
66
Fig. 7. Traces denoting the effect of AKDNFIRFa on ovariole contraction of the female R.
prolixus. AKDNFIRFa (5×10-6
M) resulted in an increase in the frequency of ovariole
contractions when compared to basal rates in physiological saline. Scale bar represents 1min.
This is a sample trace of 5 preparations.
67
68
Fig. 8. The effects of GNDNFMRFa (closed triangles) and AKDNFIRFa (closed squares) on
ovary contraction of the female adult R. prolixus. (A) Traces showing spontaneous muscle
activity of the ovaries prior to peptide application. Sample traces illustrating that increasing
the concentration of either peptide results in an increase in basal tonus of the ovaries.Upward
arrow represents the application of the peptide, while downward arrow denoted when the
peptide was washed off with saline. (B) Dose-response curve shows that increasing
concentrations of GNDNFMRFa or AKDNFIRFa results in a dose-dependent increase in
basal tonus in the ovaries. AKDNFIRFa has a statistically greater effect on ovary contraction
than GNDNFMRFa at the maximal dose of 5×10-6
M (Two Way ANOVA followed by a
Bonferroni post test, * P<0.05). Data points are mean ± standard error of the mean (SEM) of
5 replicates.
69
70
Fig. 9. The effects of GNDNFMRFa (closed triangles) and AKDNFIRFa (closed squares) on
female adult R. prolixus oviduct contractions. (A) Traces showing spontaneous activity of the
oviducts prior to peptide application. Sample traces illustrating that increasing the
concentration of either peptide results in an increase in basal tonus of oviduct contractions.
Upward arrow represents the application of the peptide, while downward arrow denoted
when the peptide was washed off with saline. (B) Dose-response curve shows that increasing
concentrations of GNDNFMRFa or AKDNFIRFa results in an increase in basal tonus
contraction in the oviducts. Both peptides have the same maximum of 5×10-6
M and start to
desensitize at 10-5
M (Two Way ANOVA, P=0.0002). Data points are mean ± standard error
of the mean (SEM) of 5 replicates.
71
72
Fig. 10. The effects of GNDNFMRFa (closed triangles) and AKDNFIRFa (closed squares)
on female adult R. prolixus bursa contractions. (A) Traces showing normal spontaneous
activity of the bursa before peptide application. Sample traces illustrating that increasing the
concentration of either peptide results in an increase in basal tonus bursa contractions.
Upward arrow represents the application of the peptide. (B) Dose-response curve shows that
increasing concentrations of GNDNFMRFa or AKDNFIRFa results in an increase in basal
tonus contraction in the bursa. The effect of AKDNFIRFa is statistically significant from that
of GNDNFMRFa at 10-6
M and 5×10-6
M on the bursa (Two Way ANOVA followed by a
Bonferroni post test, * P<0.0001). Both peptides have the same maximum of 5×10-6
M and
start to desensitize at 10-5
M. Data points are mean ± standard error of the mean (SEM) of 6
replicates.
73
74
4. Discussion
The female reproductive system of R. prolixus is composed of muscular tissues
performing regulated contractions that aid in ovulation, egg movement and oviposition. All
parts of the reproductive system, namely the ovarioles, ovaries, oviducts, spermathecae,
bursa and proximal end of the cement gland exhibit spontaneous contractile activity that must
be coordinated for successful ovulation and oviposition. Interestingly, the ovarioles of R.
prolixus possess a criss-cross pattern of muscle fibres that show spontaneous contractile
activity, suggesting their role for moving the developing oocyte down the ovariole and
through the calyx. Spontaneous ovariole contractions were similarly observed in D.
melanogaster. In contrast, L. migratoria ovarioles do not contain muscle fibers or exhibit any
spontaneous myogenic activity (Lange, personal communication). The muscle fibers in R.
prolixus that form a circular muscle layer at the calyx (the structure where ovarioles unite to
form the lateral oviducts) and the anterior of the lateral oviducts might aid in the ovulation of
the egg, where the mature egg exits the ovaries and enters the lateral oviducts. Ovulation is
when the egg passes out of the ovaries into the lateral oviducts. Anatomically, ovulation
appears to be defined by the gap in the circular muscle layer present between the ovary and
lateral oviducts. Although longitudinal muscle fibers have not been identified in the D.
melanogaster female genital tract [21], thick longitudinal muscle fibers form the interior
muscle layer extending from the calyx all along the lateral oviducts in R. prolixus. F-actin
staining shows that this longitudinally-arranged muscle layer is surrounded by a second
circular muscle layer composed of fine muscle fibers. Muscle fibers are also arranged in an
overlapping circular manner forming the spermathecae where each contraction results in a
twisting of the spermatheca, thereby ejecting sperm onto unfertilized eggs in the common
75
oviduct. The chevron arrangement of muscle fibers in the bursa would aid in oviposition of
the mature fertilized egg onto the appropriate substrate. The bursa contains the most muscle
fibers and the largest diameter muscle fibers of all the female reproductive structures
suggesting the need for a stronger force to lay the egg.
The distribution of FMRFamide-like peptides throughout the CNS and reproductive
tissues of the female adult R. prolixus was observed using immunohistochemistry. The
antibody recognises all FLPs ending in the RFamide sequence, and is not specific for any
particular subfamily. FMRFamide-like immunoreactivity is present in approximately 200 cell
bodies and processes in the brain, SOG, PRO and MTGM of the adult female R. prolixus in a
pattern similar to that shown for Vth
instar R. prolixus [33]. Similar results have been
reported in D. melanogaster, S. gregaria, Phormia regina, and many other insects [10, 11,
24]. The 10 FMRFamide-like immunoreactive median neurosecretory cells in the brain of R.
prolixus and their immunoreactive processes associated with the CC, infer that FLPs are
potentially neurohormones and therefore could regulate peripheral tissues neurohormonally.
These results are consistent with earlier findings where the presence of an ovulation hormone
associated with the median neurosecretory cells of R. prolixus was demonstrated [5, 32].
Furthermore, these studies demonstrated and quantified the presence of an FLP in the
haemolymph that is of relatively high molecular weight (8.5 kD), at a time appropriate for an
ovulation hormone [32]. Thus, the response of the ovaries to two of the R. prolixus extended
FMRFamides is consistent with an FLP being an ovulation hormone. Interestingly, another
study suggested that the median neurosecretory cells in R. prolixus might contain long
neuropeptide F (NPF) [10]. This sub-family of FLPs contains higher molecular weight
peptides and so potentially, peptides related to long NPF might be the ovulation hormone in
76
R. prolixus. Long NPF has previously been suggested to be involved in female reproductive
physiology in the locust [30].
In addition to a possible neurohormonal role of FLPs on R. prolixus reproductive
tissue, FMRFamide-like immunoreactivity is present in axons within the trunk nerves that
project directly to the various reproductive tissues. Thus FLI is in processes overlying the
oviducts, spermatheca and bursa. In examining the comparative contractile properties and
responses to the selected R. prolixus extended FMRFamides, the oviducts exhibit the most
robust spontaneous contractile activity of all the reproductive structures and responded dose-
dependently to the two extended RFamides examined. Interestingly, AKDNFIRFamide had a
greater effect on contraction for all reproductive structures than GNDNFMRFamide. These
peptides are present on the same gene and in the same subfamily and most likely act on the
same receptor [35] but clearly have different structure-activity responses. Interestingly, this
family includes peptides that terminate with FMRFamide, FIRFamide or FLRFamide.
Previously, the FMRFamide C-terminal motif in this family has only been described in
Drosophila and in no other insect species. R. prolixus, therefore, is unusual in this respect,
and the gene for the extended FMRFamides codes for peptides which end in FMRFamide
and FIRFamide. However, a recent study has successfully sequenced neurohormone
precursors in Acyrthosiphon pisum (another hemipteran) and peptides containing
FMRFamide and FIRFamide terminal endings were also identified [12]. Thus, R. prolixus
has some similarities with Drosophila and A. pisum but differs from all other species. The
extended FMRFamides have been shown to be stimulatory on a variety of skeletal and
visceral muscles in insects [see 22, 24]. It was interesting to discover that although the
FMRFamide motif is an unusual feature of the R. prolixus peptides, its physiological effects
77
are retained and comparable to the extended FIRFamide tested. The isoleucine substitution in
place of the methionine may result in a slightly different secondary conformational structure;
this change would result in the AKDNFIRFamide peptide binding to the receptor more
tightly leading to a stronger stimulation. The family of peptides referred to as extended
FMRFamides are widely distributed amongst insects [see 24]. Clearly, the receptor can
tolerate these substitutions allowing binding of both peptides to the receptor.
The bursa was the least spontaneously active reproductive structure and lost all
spontaneous activity when isolated from the rest of the reproductive system. It would appear
likely that the bursa might be under more direct neural control over contractions (thereby
generating the forceful contractions needed for egg expulsion during egg-laying) rather than
modulation of spontaneous contractions. Indeed, at least 3 nerve branches from the trunk
nerve project to the bursa and stimulation of these nerves led to neurally-evoked contractions
of the bursa [2]. All three of these branches contain FLI axons.
Overall, we have described the gross anatomy of the female reproductive structures in
R. prolixus and its associated musculature. Immunohistochemistry shows that FLPs are
associated with neural processes on the muscle fibers of all of the reproductive structures,
except for the ovarioles/ovaries and cement gland, and most likely play a role in the neural
control of their muscular activity. The absence of FLI in processes over the ovarioles/ovaries,
their positive response to extended FMRFamides, and the presence of FMRFamide-like
immunoreactivity in previously defined ovulation hormone containing median
neurosecretory cells, indicates that the ovarioles/ovaries might be under neurohormonal
control from FLPs. Of the FLPs tested, AKDNFIRFamide was found to be a stronger
stimulator of contraction in the ovaries, oviducts and bursa when compared to
78
GNDNFMRFamide. This work implicates that this family of peptides may play a role in
ovulation, egg movement and oviposition in this insect.
79
References:
[1] Buxton PA. The biology of a blood-sucking bug, Rhodnius prolixus. Trans Entomol
Soc Lond 1930;78:227-56.
[2] Chiang RG, O'Donnell MJ. Functional anatomy of vagina muscles in the blood-feeding
insect, Rhodnius prolixus. Arthropod Struct Dev 2009;38:499-507.
[3] Cook BJ, Meola S. The oviduct musculature of the horsefly, Tabanus sulcifrons, and its
response to 5‐hydroxytryptamine and proctolin. Physiol Entomol 1978;3:273-80.
[4] Davey KG. Copulation and egg-production in Rhodnius prolixus: the role of the
spermathecae. J Exp Biol 1965;42:373-8.
[5] Davey KG, Kriger FL. Variations during the gonotrophic cycle in the titer of the
myotropic ovulation hormone and the response of the ovarian muscles in Rhodnius
prolixus. Gen Comp Endocrinol 1985;58:452-7.
[6] Davey KG. The interaction of feeding and mating in the hormonal control of egg
production in Rhodnius prolixus. J Insect Physiol 2007;53:208-15.
[7] Donini A, Agricola H, Lange AB. Crustacean cardioactive peptide is a modulator of
oviduct contractions in Locusta migratoria. J Insect Physiol 2001;47:277-85.
[8] Fusé M, Ali DW, Orchard I. The distribution and partial characterization of
FMRFamide-related peptides in the salivary glands of the locust, Locusta migratoria.
Cell Tissue Res 1996;284:425-33.
[9] Gäde G, Hoffmann K-H. Neuropeptides regulating development and reproduction in
insects. Physiol Entomol 2005;30:103-21.
[10] Gonzalez R, Orchard I. Characterization of neuropeptide F-like immunoreactivity in
the blood-feeding hemipteran, Rhodnius prolixus. Peptides 2008;29:545-58.
80
[11] Haselton AT, Yin CM, Stoffolano JG. FMRFamide-like immunoreactivity in the
central nervous system and alimentary tract of the non-hematophagous blowfly,
Phormia regina, and the hematophagous horse fly, Tabanus nigrovittatus. J Insect Sci
2008;8.
[12] Huybrechts J, Bonhomme J, Minoli S, Prunier-Leterme N, Dombrovsky A, Abdel-
Latief M, Robichon A, Veenstra JA, Tagu D. Neuropeptide and neurohormone
precursors in the pea aphid, Acyrthosiphon pisum. Insect Mol Biol 2010;19:87-95.
[13] Insausti TC. Nervous system of Triatoma infestans. J Morphol 1994;221:343-59.
[14] Kirchhoff LV, Pearson RD. The emergence of Chagas disease in the United States and
Canada. Curr Infect Dis Rep 2007;9:347-50.
[15] Kriger FL, Davey KG. Ovarian motility in mated Rhodnius prolixus requires an intact
cerebral neurosecretory system. Gen Comp Endocrinol 1983;48:130-4.
[16] Lange AB, Orchard I, Konopinska D. The effects of selected proctolin analogues on
contractions of locust Locusta migratoria oviducts. J Insect Physiol 1993;39:347-51.
[17] Lange AB, Orchard I, Te Brugge VA. Evidence for the involvement of a SchistoFLRF-
amide-like peptide in the neural control of locust oviduct. J Comp Physiol
1991;168:383-91.
[18] Lange AB. The female reproductive system and control of oviposition in Locusta
migratoria migratorioides. Can J Zool 2009;87:649-61.
[19] Lange AB. The presence of proctolin in the reproductive system of Rhodnius prolixus.
J Insect Physiol 1990;36:345-51.
[20] Marshall AK, Reynolds SE. Control of the insect oviduct: the role of the neuropeptide
CCAP in the tobacco hornworm, Manduca sexta. In: Coast GM, Webster SG, editors.
81
Recent advances in arthropod endocrinology, Cambridge: Cambridge University Press;
1998, p.334–53.
[21] Middleton CA, Nongthomba U, Parry K, Sweeney ST, Sparrow JC, Elliott CJ.
Neuromuscular organization and aminergic modulation of contractions in the
Drosophila ovary. BMC Biol 2006;4:17.
[22] Nässel DR. Neuropeptides in the nervous system of Drosophila and other insects:
multiple roles as neuromodulators and neurohormones. Prog Neurobiol 2002;68:1-84.
[23] Ons S, Sterkel M, Diambra L, Urlaub H, Rivera-Pomar R. Neuropeptide precursor gene
discovery in the Chagas disease vector Rhodnius prolixus. Insect Mol Biol 2011;20:29-
44.
[24] Orchard I, Lange AB, Bendena WG. FMRFamide-related peptides: a multifunctional
family of structurally related neuropeptides in insects. Adv Insect Physiol 2001;28:267-
329.
[25] Orchard I, Lange AB. Cockroach oviducts: The presence and release of octopamine
and proctolin. J Insect Physiol 1987;33:265-8.
[26] Orchard I, Lee DH, da Silva R, Lange AB. The proctolin gene and biological effects of
proctolin in the blood-feeding bug, Rhodnius prolixus. Front Endocrinol 2011;2:59.
[27] Peeff NM, Orchard I, Lange AB. The effects of FMRFamide-related peptides on an
insect (Locusta migratoria) visceral muscle. J Insect Physiol 1993;39:207-15.
[28] Price DA, Greenberg MJ. Structure of a molluscan cardioexcitatory neuropeptide.
Science 1977;197:670-1.
[29] Rosiński G, Korczyński I, Słocińska M, Kuźmiński R. Peptide actions on oviduct
contractions in the large pine weevil, Hylobius abietis. Insect Sci 2011;18:160-5.
82
[30] Schoofs L, Clynen E, Cerstiaens A, Baggerman G, Wei Z, Vercammen T, et al. Newly
discovered functions for some myotropic neuropeptides in locusts. Peptides
2001;22:219-27.
[31] Schoofs L, Holman GM, Paemen L, Veelaert D, Amelinckx M, De Loof A. Isolation,
identification, and synthesis of PDVDHFLRFamide (SchistoFLRFamide) in Locusta
migratoria and its association with the male accessory glands, the salivary glands, the
heart, and the oviduct. Peptides 1993;14:409-21.
[32] Sevala VL, Sevala VM, Davey KG, Loughton BG. A FMRFamide-like peptide is
associated with the myotropic ovulation hormone in Rhodnius prolixus. Arch Insect
Biochem Physiol 1992;20:193-203.
[33] Tsang PW, Orchard I. Distribution of FMRFamide-related peptides in the blood-
feeding bug, Rhodnius prolixus. J Comp Neurol 1991;311:17-32.
[34] Veelaert D, Devreese B, Schoofs L, Van Beeumen J, Vanden Broeck J, Tobe SS, De
Loof A. Isolation and characterization of eight myoinhibiting peptides from the desert
locust, Schistocerca gregaria: New members of the cockroach allatostatin family. Mol
Cell Endocrinol 1996;122:183-90.
[35] Wang Z, Lange AB, Orchard I. Coupling of a single receptor to two different G
proteins in the signal transduction of FMRFamide-related peptides. Biochem. Biophys.
Res. Commun. 1995;212:531-8.
83
Acknowledgments:
We would like to thank Paul Hong for drawing the reproductive system schematic.
This work was supported by Natural Sciences and Engineering Research Council of Canada
grants to ABL. We would like to thank Ian Orchard for reading this manuscript and for his
advice.
84
Copyright Acknowledgment:
The preceeding chapter was reproduced/adapted with permission from Elsevier.
Full citation details:
The female reprodutive system of the kissing bug, Rhodnius prolixus: arrangement of
muscles, distribution and myoactivity of two endogenous FMRFamide-like peptides.
Sedra, L. and Lange, A.B.
Peptides. 2014; 53: 140-147
DOI: 10.1016/j.peptides.2013.04.003
85
Chapter 3:
Myoinhibitors controlling oviduct contraction within the female
blood-gorging insect, Rhodnius prolixus
Laura Sedra1, Amir S. Haddad
1 and Angela B. Lange
1
1Department of Biology, University of Toronto Mississauga, Mississauga, ON, Canada L5L
1C6
** This chapter has been published in General and Comparative Endocrinology (Sedra, L.,
Haddad, A.S. and Lange, A.B. (2015). General and Comparative Endocrinology, 211: 62-68;
doi:10.1016/j.ygcen.2014.11.019)
86
Abstract
Muscle activity can be regulated by stimulatory and inhibitory neuropeptides
allowing for contraction and relaxation. There are various families of neuropeptides that can
be classified as inhibitors of insect muscle contraction. This study focuses on Rhodnius
prolixus and three neuropeptide families that have been shown to be myoinhibitors in insects:
A-type allatostatins, myoinhibiting peptides (B-type allatostatins) and myosuppressins.
FGLa/AST-like immunoreactive axons and blebs were found on the anterior of the dorsal
vessel and on the abdominal nerves. FGLa/AST-like immunoreactive axons were also seen in
the trunk nerves and on the bursa. The effects of RhoprAST-2 (FGLa/AST or A-type
allatostatins) and RhoprMIP-4 (MIP/AST or B-type allatostatins) were similar, producing
dose-dependent inhibition of R. prolixus spontaneous oviduct contractions with a maximum
of 70% inhibition and an EC50 at approximately 10-8
M. The myosuppressin of R. prolixus
(RhoprMS) has an unusual FMRFamide C-terminal motif (pQDIDHVFMRFa) as compared
to myosuppressins from other insects. Quantitative PCR results show that the RhoprMS
receptor transcript is present in adult female oviducts; however, RhoprMS does not have an
inhibitory effect on R. prolixus oviduct contractions, but does have a dose-dependent
inhibitory effect on the spontaneous contraction of Locusta migratoria oviducts.
SchistoFLRFamide, the myosuppressin of Schistocerca gregaria and L. migratoria, also does
not inhibit R. prolixus oviduct contractions. This implies that FGLa/ASTs and MIP/ASTs
may play a role in regulating egg movement within the oviducts, and that the myosuppressin
although myoinhibitory on other muscles in R. prolixus, does not inhibit the contractions of
R. prolixus oviducts and may play another role in the reproductive system.
87
Keywords: insect, neuropeptides, immunohistochemistry, reproductive system, muscle
contraction
88
1. Introduction
Neuropeptides are involved in the regulation of physiological processes in insects by
acting as neurotransmitters, neurohormones and/or neuromodulators (Nässel and Winther,
2010; Orchard et al., 2001). These processes generally include activities such as digestion,
circulation, and reproduction. With regard to reproduction, structures such as the ovaries,
oviducts, bursa, spermatheca, accessory glands, and testes maybe under neuropeptide control.
Many of these tissues are muscular, and their coordinated contractions aid in successful
reproductive strategies. Ovulation and egg movement along the oviducts and bursa are
regulated and coordinated by neuropeptides acting as neurohormones or supplied directly via
the innervation. For example, the pentapeptide proctolin stimulates oviduct contractions in
many insects including Leucophaea maderae, Tabanus sulcifrons, Locusta migratoria and
Rhodnius prolixus (Cook and Meola, 1978; Holman and Cook, 1979; Lange et al., 1986;
Lange, 1990). Crustacean cardioactive peptide has also been found to increase oviduct
contractions in L. migratoria (Donini et al., 2001). Sedra and Lange (2013) recently
demonstrated that two neuropeptides from the extended FMRFamide-like peptide (FLP)
families are responsible for stimulating oviduct and bursa contractions in R. prolixus. The
effects of extended FLPs have also been demonstrated in L. migratoria, where they result in
an increase of the amplitude and frequency of oviduct contractions (Peeff et al., 1993).
Muscular contractions coordinate the female reproductive tissues leading to ovulation and
egg-laying of mature eggs. In order to coordinate egg-laying, it is likely that inhibitory
factors also modulate muscle contraction of the reproductive system. Therefore,
neuropeptides that are myogenic inhibitors are equally important for the regulation of egg
movement along the oviducts and bursa. FGLamide allatostatins (FGLa/ASTs), a family of
89
well-known myoinhibitors in insects and also referred to as A-type allatostatins, were first
identified for their ability to inhibit juvenile hormone (JH) biosynthesis in the cockroach,
Diploptera punctata (Pratt et al., 1991; Woodhead et al., 1989), and later shown to be potent
inhibitors of insect hindgut muscle contraction (Lange et al., 1995). Studies have identified
FGLa/AST-like immunoreactivity associated with the innervation to the oviducts in D.
punctata (Garside et al., 2002; Woodhead et al., 2003) and Schistocerca gregaria (Skiebe et
al., 2006). FGLa/AST-like immunoreactivity has also been found to be associated with the
innervation to the spermatheca of L. migratoria, although allatostatin 1 does not alter muscle
contraction of this reproductive tissue (Lange and da Silva, 2007). Myoinhibiting peptides
(MIP/ASTs) are B-type allatostatins characterized by a W(X6)Wamide C-terminal motif and
recently an unusual W(X7)Wamide C-terminal motif has been found in R. prolixus (Ons et
al., 2011). Lange et al. (2012) have shown MIP/AST-like immunoreactive processes on the
lateral and common oviducts of R. prolixus, as has been shown for L. migratoria (Schoofs et
al., 1996). MIP/ASTs have been found to inhibit the frequency of L. migratoria oviduct
contractions (Schoofs et al., 1991). The effect of these myoinhibitory neuropeptides has not
been examined on oviduct contractions in R. prolixus.
As previously mentioned, FLPs are made up of several families, one of which is
referred to as the myosuppressins, which have been functionally classified as myoinhibitors
(see Orchard et al., 2001). Myosuppressins are only found in arthropods. This family is well
conserved across insect species consisting of X1DVX4HX6FLRFamide (where X1= pQ, P, T
or A, X4= D, G, or V and X6= V or S) (see Orchard et al., 2001). R. prolixus myosuppressin
(RhoprMS) is unique and is the only myosuppressin that has an FMRFamide C-terminal
motif (Lee at al., 2012; Ons et al., 2011). Myosuppressins have been found to inhibit oviduct
90
contractions in L. migratoria (Lange et al., 1991) and the contractions of the ejaculatory duct
and oviduct in Zophobas atratus (Marciniak et al., 2011). Nothing is known regarding
myosuppressin's physiological effects on the female reproductive tract of R. prolixus.
R. prolixus, a medically-important Hemipteran, is an ideal model organism since
growth and development, ecdysis, and reproduction, are tightly regulated and timed by blood
gorging which allows for the coordination of a variety of activities during these behaviours.
Both adult males and females require a blood meal to become reproductively active leading
to physiological events such as sperm production, mating and oviposition of mature eggs
(Davey, 2007). Recent sequencing of the R. prolixus genome has made this an opportune
time to study how endogenous neuropeptides regulate physiological functions in R. prolixus.
In this paper we examine the effects of a variety of myoinhibitory neuropeptides on R.
prolixus spontaneous oviduct contractions. These peptides include a myosuppressin
(RhoprMS), an FGLa/AST (RhoprAST-2) and a MIP/AST (RhoprMIP-4). Both RhoprAST-2
and RhoprMIP-4 inhibited oviduct contractions in a dose-dependent manner. Interestingly,
RhoprMS did not inhibit oviduct contractions of R. prolixus even though qPCR shows
expression of the transcript for the myosuppressin receptor in the oviducts.
2. Materials and methods
2.1 Animals
Adult female R. prolixus fed defibrinated rabbit blood (Hemostat Laboratories,
Dixon, CA, USA; supplied by Cedarlane, Burlington, ON, Canada) were reared in an
incubator at a temperature of 25°C and 60% humidity. All females used for experimentation
were unmated and unfed adults.
91
Eighteen day old, non-ovulated female L. migratoria adults were used. The colony
was maintained in crowded conditions of 30°C on a 12h:12h light cycle and fed wheat
seedlings and bran.
2.2 Chemicals
RhoprMS (pQDIDHVFMRFamide), RhoprMIP-4 (AWSDLQSSGWamide) and
RhoprAST-2 (LPVYNFGLamide) were purchased from GenScript USA, Inc. (Piscataway,
NJ, USA). SchistoFLRFamide (PDVDHVFLRFamide) was purchased from Peninsula
Laboratories, Inc. (Belmont, California). Peptides were dissolved in double-distilled water to
make 10-3
M stock solutions stored as 10µL aliquots at -20°C. Physiological R. prolixus
saline (pH 7.0; 150mM NaCl, 8.6mM KCl, 2mM CaCl2, 4mM NaHCO3, 34mM glucose,
8.5mM MgCl2, 5mM HEPES [pH 7.2]) was used in all the R. prolixus experiments. Locusta
migratoria saline (pH 7.2; 150mM NaCl, 10mM KCl, 4mM CaCl2, 2mM MgCl2, 4mM
NaHCO3, 5mM HEPES, 90mM sucrose, 5mM trehalose) was used for the L. migratoria
oviduct contraction assays.
Rabbit anti-AST 1 IgG fraction purified polyclonal antibody was used for the
immunohistochemical experiments (a gift from Professor Hans-Jürgen Agricola, Friedrich-
Schiller Universität, Jena, Germany). The antisera was originally collected from rabbits
injected with Dip-allatostatin I (APSGAQRLYGFGLamide) and shown to be specific for
peptides of the A-type allatostatins (Vitzthum, et al., 1996). Goat Cy3 anti-rabbit (IgG)
secondary antibody was purchased from Jackson ImmunoResearch Laboratories, Inc. (West
Grove, PA, USA).
92
2.3 Immunohistochemistry
The immunohistochemical procedure was as described previously (Sedra and Lange,
2013) with the following modifications. Adult female R. prolixus were dissected under
physiological saline and the central nervous system (CNS) and reproductive tissues were
fixed in cold 2% paraformaldehyde in Millonig's buffer (pH 7.0; 130mM NaH2PO4·H2O,
100mM NaOH, 1.2% glucose, 0.3mM CaCl2·2H2O) for 1 h at room temperature. The tissues
were then incubated in rabbit anti-AST 1 antibody (1:1000 in phosphate buffered saline
(PBS; pH 7.2; 2.1 mM NaH2PO4, 8.3 mM Na2HPO4, 150 mM NaCl) with 0.4% Triton-X-100
and 2% normal goat serum (NGS)) for 48 h at 4°C. This was followed by frequent washes
with PBS for approximately 6 h and then tissues were incubated in goat Cy3 anti-rabbit
secondary antibody (1:600 in 10% NGS in PBS) overnight at 4°C. The tissues were
processed and imaged using a Zeiss LSM 510 Confocal Laser Microscope (Carl Zeiss, Jena,
Germany) as earlier described (Sedra and Lange, 2013). To confirm the specificity of the
primary antiserum, the protocol was repeated using primary antibody that had been pre-
absorbed overnight with 10-5
M RhoprAST-2. All immunoreactive staining was eliminated
indicating that the immunoreactivity was specific for FGLa/ASTs.
2.4 Oviduct contraction assays
The lateral and common oviducts from R. prolixus were dissected under physiological
saline and attached to a Grass FT 03 force transducer (Grass Medical Instruments, Quincy,
MA,USA) to monitor contractions as previously described (Sedra and Lange, 2013). Results
were recorded and analyzed via PicoScope 2200 (PicoTechnology, St. Neots, UK) software
(http://www.picotech.com/download.html).
93
L. migratoria lateral and common oviducts were dissected under L. migratoria saline
and the ovaries were pinned to a Sylgard (Dow Corning Corporation, Midland, MI, USA)-
coated Petri dish using minutien pins. The posterior end of the common oviduct was tied with
a fine silk thread to the Grass FT 03 force transducer. Results were recorded on a Linear Flat-
bed chart recorder (VWR, Mississauga, ON, Canada) for analysis.
Muscle contraction was recorded and changes in basal tonus and amplitude were
measured. These measurements were then converted to mg of tension. The means±standard
error of the mean (SEM) of n replicates was then graphed.
2.5 Quantitative PCR (qPCR) tissue profiling for RhoprMS receptor (RhoprMSR)
CNS and male / female reproductive tissues (ovaries, oviducts and spermatheca,
bursa and cement gland) from R. prolixus were dissected and processed as previously
described (Paluzzi et al., 2008). For each sample, RNA was extracted using PureLink® RNA
Mini Kit (Life Technologies Corporation, Carlsbad, CA, USA) and 500ng of total RNA was
used to synthesize cDNA with iScript™ Reverse Transcription Supermix for RT-qPCR (Bio-
Rad Laboratories Ltd., Mississauga, ON, Canada). Synthesized cDNA was then diluted 10-
fold in nuclease-free-water and used as a template for qPCR. Specific primers were designed
based on the RhoprMSR sequence over exon-exon boundaries (Lee et al., 2014) (Table 1).
The primer efficiencies for each target were calculated and the delta-delta Ct method was
used to determine the relative expression of each transcript. Geometric averaging of the
transcript levels of three references genes (β actin, α tubulin and rp49) was used to normalize
the expression levels which were previously validated as reference genes for spatial
expression analysis of R. prolixus (Paluzzi and O’Donnell, 2012; Pfaffl, 2001). Experiments
94
were performed using an MX4000 Quantitative PCR System (Stratagene, La Jolla,
California, USA) with a temperature-cycling profile that consisted of an initial denaturation
(95°C for 30 sec) and 40 cycles of denaturation (95°C for 5 sec) and annealing / extension
(57°C for 24 sec), and this was followed by a melt curve analysis (60°C - 95°C). Three
biological replicates were carried out for each sample, each having two technical replicates as
well as a no-template and no reverse transcriptase control.
2.6 Statistical analyses
Graph Pad Prism (www.graphpad.com) was used to create all of the graphs as well as
carry out any statistical analyses. One Way ANOVA followed by a Tukey's test (when
appropriate) was performed on the dose-response curves. Two Way ANOVA followed by a
Bonferroni's test was carried out to assess the difference in effect between RhoprMIP-4 and
RhoprAST-2 on oviduct contraction.
3. Results
3.1 FGLa/AST-like immunoreactivity
Before assessing the physiological effect of RhoprAST-2 on oviduct contraction, the
distribution of FGLa/ASTs throughout the female reproductive tract of R. prolixus was
examined (Figure 1). FGLa/AST-like immunoreactive processes were seen to extend over the
anterior end of the dorsal vessel via axons in the nervi corpori cardiaci II (NCCII) (denoted
by the closed arrows) (Figure 1A). Although FGLa/AST-like immunoreactive staining was
present in axons in the NCCII, it is important to note that no staining was present on the
corpus cardiacum/corpus allatum (CC/CA) complex (Figure 1A). For the mesothoracic
95
ganglionic mass (MTGM) there were 2 faintly stained FGLa/AST-like immunoreactive
axons in each of the trunk nerves as well as neurohaemal release sites on all 5 abdominal
nerves (Figure 1B). No FGLa/AST-like staining was found on the common and lateral
oviducts (Figure 1C), or spermatheca (Figure 1D); however, a few FGLa/AST-like
immunoreactive processes were observed on the bursa (Figure 1D).
3.2 The effect of RhoprMIP-4 and RhoprAST-2 on R. prolixus oviduct contractions
Both RhoprMIP-4 and RhoprAST-2 have a significant dose-dependent inhibitory
effect on oviduct muscle contraction (One Way ANOVA, PRhoprMIP-4<0.0001 and PRhoprAST-
2<0.0001), resulting in a decrease in amplitude of spontaneous contraction (Figure 2). Both
peptides exhibited a threshold between 10-10
M and 10-9
M range and maximal inhibition of
approximately 70% at 10-5
M (Figure 2C). Overall, RhoprAST-2 exhibited a statistically
stronger effect on amplitude reduction than RhoprMIP-4 (Two Way ANOVA,
Ppeptide=0.0381, Pdose<0.0001 and Pinteraction=0.9405), however, no single concentration was
found responsible for this significant difference when followed with a Bonferroni post-hoc
test.
3.3 The effect of RhoprMS and SchistoFLRFamide on R. prolixus oviduct contractions
RhoprMS at 10-6
M or lower resulted in a minor though not statistical decrease in
basal tension of the oviducts (Figure 3A and 3B). RhoprMS at concentrations greater than 10-
6M resulted in an increase in basal tension (Figure 3A and 3B). Maximal stimulation
response was achieved at 5×10-6
M RhoprMS and apparent desensitization occurred at 10-5
M
(One Way ANOVA P<0.0001, post hoc Tukey's test, * P<0.001) (Figure 3B). No change in
96
amplitude of contractions was observed at all concentrations (One Way ANOVA, P=0.0806)
(Figure 3A and 3C).
In a similar fashion, the myosuppressin for L. migratoria, SchistoFLRFamide, did not
induce any significant change in basal tension of R. prolixus oviducts (One Way ANOVA,
P= 0.2953) (Figure 4A), although there was a slight though not significant dose-dependent
inhibition of the amplitude of oviduct contraction (One Way ANOVA, P=0.1983) (Figure
4B).
3.4 The effect of RhoprMS on L. migratoria oviduct contraction
In light of the inability of RhoprMS to inhibit oviducal contractions in R. prolixus a
heterologous assay was used to examine the effect of RhoprMS on L. migratoria oviduct
contractions. RhoprMS was a potent inhibitor of locust oviduct contractions resulting in a
dose-dependent decrease in the amplitude of phasic contractions (Figure 5). No significant
change in basal tension or frequency was observed (Figure 5A). Threshold of inhibition was
observed at about 10-10
M and maximal inhibition of 88% was seen at 10-6
M RhoprMS (One
Way ANOVA P<0.0001, post hoc Tukey's test, P≤0.001).
3.5 Spatial expression profile of the RhoprMSR throughout the R. prolixus reproductive
tissue
Transcript levels of RhoprMSR were determined relative to transcript levels present
within the oviducts / spermathecae. RhoprMSR transcript levels in the CNS were
significantly greater than RhoprMSR expression in the ovaries and the bursa / cement gland
(One Way ANOVA P=0.0208, post hoc Tukey's test P≤ 0.01) (Figure 6). CNS shows a two-
97
fold increase in RhoprMSR expression relative to oviducts / spermathecae (Figure 6). In the
reproductive tissues, transcript levels were greatest in the female oviducts / spermathecae,
with lower levels detected in the ovaries, bursa / cement gland (Figure 6).
98
Fig. 1. Distribution of FGLa/AST-like immunoreactivity associated with the peripheral
nervous system and the female reproductive tract of R. prolixus. (A) FGLa/AST-like
immunoreactive axons in the nervi corpori cardiaci II (NCCII) (arrows) extending to a
network of FGLa/AST-like immunoreactive processes over the anterior of the dorsal vessel
(DV). The corpus cardiacum/corpus allatum (CC/CA) complex (as indicated by the dashed
outline) was not stained. (B) In each trunk nerve there were 2 faintly stained axons (closed
arrows). FGL/AST-like immunoreactive processes (open arrows) are seen in all 5 abdominal
nerves. (C) No FGLa/AST-like staining was found on the lateral (LO) and common oviducts
(CO). (D) FGLa/AST-like immunoreactive processes (indicated by solid arrows) were found
on the bursa (BR) but not the spermathecae (SP). Scale bar denotes 100µm.
99
100
Fig. 2. RhoprMIP-4 and RhoprAST-2 inhibit the amplitude of spontaneous oviduct
contractions in R. prolixus. Physiological traces showing the dose-dependent inhibition of the
amplitude of oviduct contractions by (A) RhoprMIP-4 and (B) RhoprAST-2. Upward arrow
represents the application of either RhoprMIP-4 or RhoprAST-2. (C) Dose-response curves
showing the dose-dependent effect of RhoprMIP-4 (closed squares) and RhoprAST-2 (open
circles) on the amplitude of spontaneous oviduct contractions. Both RhoprMIP-4 and
RhoprAST-2 exhibited maximal inhibition at 10-5
M. RhoprAST-2 has an overall greater
inhibitory effect on oviduct contraction than does RhoprMIP-4 (Two-Way ANOVA,
Ppeptide=0.0381, Pdose<0.0001 and Pinteraction=0.9405). Data points are mean ± standard error of
the mean (SEM) of 5 replicates.
101
102
Fig. 3. The effects of RhoprMS on spontaneous oviduct contractions of the adult R. prolixus.
(A) Traces showing spontaneous muscle activity of the oviducts prior to and after peptide
application. Upward arrow represents the application of RhoprMS. (B) Dose-response curve
showing that concentrations of RhoprMS less than 10-6
M result in a slight decrease in basal
tonus, whereas a statistically significant increase in basal tonus is seen at 5×10-6
M and 10-5
M
RhoprMS (One Way ANOVA P<0.0001, post hoc Tukey's test, * P<0.001). (C) Dose-
response curve showing that RhoprMS has no effect on the amplitude of oviduct contractions
(One Way ANOVA, P=0.0806). Data points are mean ± standard error of the mean (SEM) of
5 replicates.
103
104
Fig. 4. The effects of SchistoFLRFamide on amplitude of R. prolixus spontaneous oviduct
contraction. Dose-response curve showing that SchistoFLRFamide did not result in a
significant change in the (A) basal tonus (One Way ANOVA, P=0.2953) or (B) amplitude
(One Way ANOVA, P=0.1983) of R. prolixus oviduct contractions. Data points are mean ±
standard error of the mean (SEM) of 5 replicates.
105
106
Fig. 5. The effects of RhoprMS on amplitude of L. migratoria spontaneous oviduct
contraction. (A) Traces showing spontaneous muscle activity of the oviducts prior to and
after peptide application. Sample traces showing RhoprMS decreases the amplitude of L.
migratoria oviduct contractions. Upward arrow represents the application of the peptide. (B)
Dose-response curve showing that RhoprMS leads to a dose-dependent inhibition of
amplitude of L. migratoria oviduct contractions, where 'a' and 'b' signify concentrations
exhibiting statistical differences (One Way ANOVA, P<0.0001, post hoc Tukey's test).
Amplitude of contraction is decreased to approximately 12% with either 10-7
or 10-6
M
RhoprMS and both concentrations have an effect statistically different from the remaining
concentrations tested . Data points are mean ± standard error of the mean (SEM) of 5
replicates.
107
108
Fig. 6. Expression profile of the relative transcript level of the RhoprMS receptor
(RhoprMSR) in the CNS and female reproductive tissues of adult R. prolixus. RhoprMSR
transcript levels were determined relative to RhoprMSR expression in the
oviducts/spermatheca, where 'a' and 'b' signify tissues exhibiting statistically different
transcript levels. Of all the reproductive structures, the female oviducts exhibited the highest
RhoprMSR transcript levels (One Way ANOVA, P>0.05).
109
110
4. Discussion
Insect reproductive tissue, such as the ovaries, oviducts and bursa, are composed of
visceral muscle allowing for sperm movement after mating, egg movement during egg-laying
and contributing to haemolymph circulation within the insect. Movement of developed eggs
along the female reproductive tract is tightly regulated by various stimulatory and inhibitory
neuropeptides which modify these contractions. Myogenic activity of the various tissues of
the reproductive system has been previously monitored in R. prolixus (Lange, 1990; Sedra
and Lange, 2013) and both GNDNFMRFamide and AKDNFIRFamide (members of the N-
terminally extended FMRFamides of FLPs) stimulate ovary, oviduct and bursa contractions
(Sedra and Lange, 2013).
Neuropeptides can also function as inhibitors of muscle contraction allowing for
relaxation of reproductive tissues. Families of myoinhibitors were tested in this study
including the RhoprFGLa/ASTs (A-type allatostatins), RhoprMIP/ASTs (B-type
allatostatins) and RhoprMS, and the association of FGLa/ASTs within the innervation to the
reproductive system was also examined. As previously found, FGLa/AST-like
immunoreactive staining was present in processes in the NCCII and these processes extend
over the anterior end of the dorsal vessel where they terminate at putative neurohaemal sites
(Sarkar et al., 2003; this study). In addition, there were FGLa/AST-like immunoreactive
blebs and varicosities on the abdominal nerves which also formed putative neurohaemal sites
(Sarkar et al., 2003; this study). FGLa/AST-like immunoreactive axons were also present in
the trunk nerves and on the bursa suggesting that FGLa/ASTs may regulate muscle
contraction at the reproductive system of R. prolixus as neurotransmitters / neuromodulators.
No FGLa/AST-like staining was found on the spermatheca, or the lateral and common
111
oviducts; however, FGLa/AST-like immunoreactivity has previously been observed on the
oviducts of other insects, such as D. punctata and S. gregaria (Garside et al., 2002; Skiebe et
al., 2006; Woodhead et al., 2003), and FGLa/AST-like immunoreactive axons have also been
found to directly innervate the L. migratoria spermathecae (Lange and da Silva, 2007).
Previous research has shown immunoreactive staining for MIP/ASTs on the common
and lateral oviducts of L. migratoria and R. prolixus (Lange et al., 2012; Schoofs et al.,
1996). MIP/AST-like immunoreactive axons and processes were also present on the CC as
well as within axons in the trunk nerves of R. prolixus (Lange et al., 2012). This implies that
MIP/ASTs in R. prolixus could be released into the blood from neurohaemal areas or could
be released directly at the female reproductive tissue to act as a neurotransmitter /
neuromodulator. RhoprAST-2 and RhoprMIP-4 inhibit the amplitude of spontaneous oviduct
contractions in a dose-dependent manner with similar thresholds, EC50s and maximal
inhibition concentrations. Clearly, these results suggest that in R. prolixus contraction of the
oviducts are under inhibitory control from FGLa/ASTs and MIP/ASTs with the peptides
having the potential to regulate egg movement.
Myosuppressins are also characterized as myoinhibitors and are one of the families of
FLPs. Insect myosuppressins have a strongly conserved sequence; however, RhoprMS is the
first insect myosuppressin to possess an FMRFamide C-terminal ending (see Orchard et al.,
2001; Ons et al., 2011). This FMRFamide ending is shared with many other FLPs but they
are invariably myostimulatory. Extensive FMRFamide-like immunoreactive staining has
been shown to be present on the female lateral and common oviducts, and the bursa (Sedra
and Lange, 2013), although the specific families underlying the immunoreactivity have not
been identified. Low doses of RhoprMS resulted in only a slight decrease in basal tension of
112
the oviducts; however, a statistically significant increase in basal tension was observed with
doses greater than 10-6
M RhoprMS. This is an unusual observation since myosuppressins are
potent inhibitors of oviduct contractions in L. migratoria and Z. atratus (Lange et al., 1991;
Marciniak et al., 2011). Here, we also tested SchistoFLRFamide on R. prolixus oviduct
contractions to see if the methionine substitution in the 8th
amino acid position for R. prolixus
is a contributing factor for this difference in biological activity. SchistoFLRFamide did not
stimulate or inhibit R. prolixus oviduct contractions. A heterologous assay was conducted to
determine the effect of RhoprMS on L. migratoria oviduct contractions. RhoprMS inhibited
L. migratoria spontaneous oviduct contractions in a dose-dependent manner with similar
threshold, EC50 and maximal inhibition concentrations as that found by Lange et al. (1991)
for SchistoFLRFamide inhibition of L. migratoria oviduct contractions. These results
indicate that RhoprMS is capable of binding and activating the L. migratoria myosuppressin
receptor in spite of its FMRFamide C-terminal ending. A previous study by Wang et al.
(1995a) observed the binding potency of various analogues to the L. migratoria
myosuppressin receptor. Substitution of a negatively charged D (aspartic acid), in the 8th
amino acid position in place of a positively charged L (lysine), disrupted the peptide binding
affinity and eliminated biological activity (Wang et al., 1995b); however, a neutrally charged
V (valine) substitution in the same position resulted in a slight reduction of potency yet
complete retention of inhibitory activity (Wang et al., 1995b). In considering this scenario for
RhoprMS, the neutrally charged M (methionine) would still enable the peptide to bind to the
receptor and hence inhibit locust oviduct contractions. RhoprMS, however, does not inhibit
R. prolixus oviduct muscle contraction and its minor stimulatory activity on the oviducts at
high concentrations might be due to it acting on a receptor for the extended FMRFamides
113
leading to stimulation. Spatial expression of the RhoprMS receptor showed that the CNS had
greater expression of the transcript relative to the reproductive tissues of adult R. prolixus.
This was similarly observed for both Drosophila myosuppressin receptors, DMSR-1 and
DMSR-2 (Egerod et al., 2003). Transcript levels of the RhoprMSR were also greatest in the
oviducts and much lower levels were detected in the ovaries and bursa. This was similarly
observed for the RhoprMIP receptor (Paluzzi et al., 2014) and RhoprAST receptor (M.
Zandawala, personal communication) in adult female R. prolixus. Expression of the transcript
for RhoprMIPR and RhoprASTR in oviduct / bursa tissue showed 1-fold and 20-fold greater
expression respectively than that found in the ovaries. The expression of these receptors in
the oviducts together with the ability of RhoprMIP-4 and RhoprAST-2 to inhibit oviduct
contractions indicate that these peptide families may play a role in the control of egg
movement during oviposition in R. prolixus. RhoprMSR has also been cloned in R. prolixus
and a functional receptor assay has verified that RhoprMS binds to the receptor, as does the
locust myosuppressin SchistoFLRFamide (Lee et al., 2014). RhoprMS has been previously
shown to inhibit phasic contractions of the anterior midgut, hindgut and inhibits the heart rate
of R. prolixus (Lee, et al., 2012), and therefore can still display inhibitory effects on
peripheral tissue of R. prolixus. This suggests that the peptide may play another role at the
reproductive tissues. One possible role could be to inhibit the contraction of the circular
muscle fibers of the oviducts and not the longitudinal fibers thereby holding eggs in the
lateral oviduct for fertilization and the bursa prior to egg-laying. Mercier and Lee (2002)
looked at the differences in contraction of longitudinal and circular muscle fibers of the
Procambarus clarkii hindgut, and found that proctolin increased amplitude and frequency of
longitudinal muscle fibers, whilst, only mildly affecting the tonus of circular muscle fibers.
114
RhoprMS may also play another role that does not pertain to muscle contraction, such as
affecting glandular secretion from the spermatheca. Kuster and Davey (1986) showed that
proteins within the neurosecretory cells of the pars intercerebralis of R. prolixus are essential
for the release of a proteinaceous secretion responsible for spermatozoa viability.
FMRFamide-like immunoreactivity is present in these median neurosecretory cells (Sedra
and Lange, 2013), and so RhoprMS may be a possible neuropeptide candidate for controlling
spermathecal glandular secretion.
This study has shed some light on the biological effect of various myoinhibitors on R.
prolixus oviducts. Peptides belonging to the FGLa/ASTs (A-type allatostatins) and
MIP/ASTs (B-type allatostatins) have been found to inhibit spontaneous oviduct
contractions, whereas RhoprMS does not seem to have any significant inhibitory effect on
oviduct muscle contraction and may play another role related to reproductive activity in R.
prolixus.
115
5. References
Cook, B.J., Maeola, S., 1978. The oviduct musculature of the horsefly, Tabanus sulcifrons,
and its response to 5-hydroxytryptamnie and proctolin. Physiol. Entomol. 3, 273–280.
Davey, K., 2007. The interaction of feeding and mating in the hormonal control of egg
production in Rhodnius prolixus. 53, 208-215.
Donini, A., Agricola, H.-J., Lange, A.B., 2001. Crustacean cardioactive peptide is a
modulator of oviduct contraction in Locusta migratoria. J. Insect Physiol. 47, 277–285.
Egerod, K., Reynisson, E., Hauser, F., Cazzamali, G., Williamson, M., Grimmelikhuijzen,
C.J.P., 2003. Molecular cloning and functional expression of the first two specific insect
myosuppressin receptors. PNAS. 100, 9808–9813.
Garside, C.S., Koladich, P.M., Bendena, W.G., Tobe, S.S., 2002. Expression of allatostatin in
the oviducts of the cockroach Diploptera punctata. Insect Biochem. Mol. Biol., 32, 1089–
1099.
Holman, G.M., Cook, B.J., 1979. Evidence of proctolin and a second myotropic peptide in
the cockroach, Leucophaea maderae, determined by bioassay and HPLC analysis. Insect
Biochem. 9, 149–154.
Kuster, J.E., and Davey, K.G., 1986. Mode of action of cerebral neurosecretory cells on the
function of the spermatheca in Rhodnius prolixus. Int. J. Inver. Rep. Dev., 10, 59–69.
Lange, A.B., Orchard, I., Adams, M.E., 1986. Peptidergic innervation of insect reproductive
tissue: The association of proctolin with oviduct visceral musculature. J. Comp. Neurol.
254, 279–286.
Lange, A.B., 1990. The presence of proctolin in the reproductive system of Rhodnius
prolixus. J. Insect Physiol. 36, 345–351.
116
Lange, A.B., Orchard, I., Te Brugge, V.A., 1991. Evidence for the involvement of a
SchistoFLRF-amide-like peptide in the neural control of locust oviduct. J. Comp. Physiol.
A. 168, 383–391.
Lange, A.B., Bendena, W.G., Tobe, S.S., 1995. The effect of the thirteen Dip-allatostatins on
myogenic and induced contractions of the cockroach (Diploptera punctata) hindgut. J.
Insect Physiol., 41, 581–588.
Lange, A.B., da Silva, R., 2007. Neural and hormonal control of muscular activity of the
spermatheca in the locust, Locusta migratoria. Peptides. 28, 174–184.
Lange, A.B., Alim, U., Vandersmissen, H.P., Mizoguchi, A., Vanden Broeck, J., Orchard, I.,
2012. The distribution and physiological effects of the myoinhibiting peptides in the
kissing bug, Rhodnius prolixus. Front. Neurosci. 6.
Lee, D., Taufique, H., da Silva, R., Lange, A.B., 2012. An unusual myosuppressin from the
blood-feeding bug, Rhodnius prolixus. J. Exp. Biol. 215, 2088–2095.
Lee, D., James, T., Lange, A.B., 2014. Identification, characterization and expression of a
receptor for the unusual myosuppressin in the blood-feeding bug, Rhodnius prolixus.
Insect Mol. Biol. Accepted.
Marciniak, P., Kuczer, M., Rosinski, G., 2011. New physiological activities of
myosuppressin, sulfakinin, and NVP-like peptide in Zophobas atratus beetle. J. Comp.
Physiol. B. 181, 721–730.
Mercier, A.J., Lee, J., 2002. Differential effects of neuropeptides on circular and longitudinal
muscles of the crayfish hindgut. Peptides. 23, 1751–1757.
Nässel, D.R., Winther, A.M.E., 2010. Drosophila neuropeptides in regulation of physiology
and behavior. Prog. Neurobiol. 92, 42–104.
117
Ons, S., Sterkel, M., Diambra, L., Urlaub, H., Rivera-Pomar, R., 2011. Neuropeptide gene
precursor gene discovery in the Chagas disease vector Rhodnius prolixus. Insect Mol.
Biol. 20, 29–44.
Orchard, I., Lange, A.B., Bendena, W.G., 2001. FMRFamide-related peptides: a
multifunctional family of structurally related neuropeptides in insects. Adv. Insect
Physiol. 28, 267–329.
Paluzzi, J.P., Russell, W.K., Nachman, R.J., Orchard, I., 2008. Isolation, cloning, and
expression mapping of a gene encoding an antidiuretic hormone and other CAPA-related
peptides in the disease vector, Rhodnius prolixus. Endocrinol. 149, 4638–4646.
Paluzzi, J.P., O'Donnell M, J., 2012. Identification, spatial expression analysis and functional
characterization of a pyrokinin-1 receptor in the Chagas’ disease vector, Rhodnius
prolixus. Mol. and Cell. Endocrinol. 363, 36–45.
Peeff, N.M., Orchard, I., Lange, A.B., 1993. The effects of FMRFamide-related peptides on
an insect (Locusta migratoria) visceral muscle. J. Insect Physiol. 39, 207–215.
Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-
PCR. Nucleic Acids Res. 29, e45.
Pratt, G.E., Farnsworth, D.E., Fok, K.F., Siegel, N.R., McCormack, A.L., Shabanowitz, J.,
Hunt, D.F., Feyereisen, R., 1991. Identity of a second type of allatostatin from cockroach
brains: an octadecapeptide amide with a tyrosine-rich address sequence. PNAS, 88, 2412–
2416.
Sarkar, S.R.S., Tobe, S.S., Orchard, I., 2003. The distribution and effects of Dippu-
allatostatin-like peptides in the blood-feeding bug, Rhodnius prolixus. Peptides. 24, 1553–
1562.
118
Schoofs, L., Holman, G.M., Hayes, T.K., Nachman, R.J., De Loof, A., 1991. Isolation,
identification and synthesis of locustamyoinhibiting peptide (LOM-MIP), a novel
biologically active neuropeptide from Locusta migratoria. Regul. Peptides. 36, 111–119.
Schoofs, L., Veelaert, D., Vanden Broeck, J., De Loof, A., 1996. Immunocytochemical
distribution of Locustamyoinhibiting peptide (Lom-MIP) in the nervous system of
Locusta migratoria. Regul. Peptides. 63, 171–179.
Sedra, L., Lange, A.B., 2013. The female reproductive system of the kissing bug, Rhodnius
prolixus: Arrangement of muscles, distribution and myoactivity of two endogenous
FMRFamide-like peptides. Peptides. 53, 140–147.
Skiebe, B., Biserova, N.M., Vedenina, V., Börner, J., Pflüger, H.-J., 2006. Allatostatin-like
immunoreactivity in the abdomen of the locust, Schistocerca gregaria. Cell Tissue Res.
325, 163–174.
Vitzthum, H., Homberg,U., Agricola, H., 1996. Distribution of Dip-Allatostatin I-like
immunoreactivity in the brain of the locust Schistocerca gregaria with detailed analysis of
immunostaining in the central complex. J. Comp. Neurobiol. 369, 419–437.
Wang, Z., Orchard, I., Lange, A.B., Chen, X., Starratt, A.N., 1995a. A single receptor
transduces both inhibitory and stimulatory signals of FMRFamide-related peptides.
Peptides. 16, 1181–1186.
Wang, Z.X., Lange, A.B., Orchard, I., 1995b. Coupling of a single receptor to two different
G proteins in the signal transduction of FMRFamide-related peptides. Biochem. Biophys.
Res. Commun. 212, 531–538.
119
Woodhead, A.P., Stay, B., Seidel, S.L., Khan, M.A., Tobe, S.S., 1989. Primary structure of
four allatostatins: neuropeptide inhibitors of juvenile hormone synthesis. PNAS, 86,
5997–6001.
Woodhead, A.P., Thompson, M.E., Chan, K.K., Stay, B., 2003. Allatostatin in ovaries,
oviducts and young embryos in the cockroach, Diploptera punctata. J. Insect Physiol. 49,
1103–1114.
120
6. Acknowledgments
This work was supported by Natural Sciences and Engineering Research Council of
Canada grants to ABL. We would like to thank Ian Orchard for reading this manuscript.
121
7. Copyright Acknowledgment
The preceeding chapter was reproduced/adapted with permission from Elsevier.
Full citation details:
Myoinhibitors controlling oviduct contraction within the female blood-gorging insect,
Rhodnius prolixus.
Sedra, L., Haddad, A.S. and Lange, A.B.
General and Comparative Endocrinology. 2015; 211: 62-68
DOI: 10.1016/j.ygcen.2014.11.019
122
Chapter 4:
Establishing an egg-laying assay for a Rhodnius prolixus colony
123
Abstract
Earlier studies have examined the effects of various factors such as feeding and
mating on egg-laying rate in Rhodnius prolixus. This chapter shows that females need a
blood meal as it provides the nutrients necessary for oogenesis to take place. Fed virgin
females lay approximately 1 egg per day during their first gonadotrophic cycle, and overall
produce on average of 7 eggs per gonadotropic cycle. In order for males and females to mate,
both individuals require a blood meal. Mated females lay eggs at over twice the rate
exhibited by virgins and lay approximately 17-20 eggs in their first gonadotrophic cycle.
Moreover, the injection of corpus cardiacum (CC) extracts into mated females results in a
shift to the left in the cumulative number of eggs laid per female curve, indicating that mated
females injected with CC extracts lay their eggs faster than control females. Thus, this
chapter establishes an egg-laying assay that can be used to investigate the effects of
neuropeptides on egg production and oviposition in R. prolixus.
124
Introduction
Triatomines are blood-feeding hemipterans that are predominantly localized in
Central and South America. Rhodnius prolixus is one of the principal vectors of
Trypanosoma cruzi – the parasite responsible for Chagas disease. To date, R. prolixus exhibit
a geographical distribution that includes Columbia, El Salvador, Guatemala, Mexico and
Venezuela (World Health Organization, 2002). Chronic symptoms of Chagas disease include
but are not limited to cardiac irregularities, gastrointestinal malfunction and death. Pest
control over the years has been strikingly difficult due to the insect’s resilience as well as its
fast reproductive cycle. Females can produce on average 600 eggs in their life time and need
only mate once in order to fertilize all their eggs (World Health Organization, 2002).
There are two native populations of R. prolixus that are present in the environment –
sylvan and domiciliary (Davey, 2007). Sylvan populations have been generally associated
with mammals, birds and marsupials. They can live in nests or in trees and face the challenge
of finding their next meal. This is not completely taxing to their survival since they have
been known to survive without a blood meal for up to 200 days (World Health Organization,
2002). To ensure the survival of progeny, female R. prolixus have been observed laying their
eggs on the feathers of birds. There the eggs hatch, and babies feed from their host until they
molt through all five instars and fly off as adults (Davey, 2007). Domiciliary R. prolixus, the
other population type, better resemble laboratory populations. This population is more
closely affiliated with humans, since these insects live in the dark, damp crevices of homes
and come out at night to feed. Like in-bred laboratory populations, domiciliary R. prolixus
have readily available meals, controlled environments (temperature and light) and are not as
mobile as their sylvan counterparts. It is important to take all of these factors into
125
consideration when studying important biological processes of an organism and determining
how relevant the results can be.
R. prolixus are exemplary model organisms. Since a blood meal is required to initiate
growth and development, it is easier to assess changes in physiological and endocrinological
processes and to determine how these processes are regulated. One of these highly regulated
processes is oogenesis or egg production. Blood-meals are crucial for egg production and
provide the necessary nutrients required for the production of vitellogenin in fat body stores.
Eggs originate from oogonia present in the developed ovary. Female R. prolixus possess a
fully developed reproductive tract as fed fifth instars (Lutz and Huebner, 1980). When
provided with nutrients and the correct hormonal signals the process of oogenesis can begin
when they emerge as adults. The adult female reproductive tract is composed of 2 heavily
tracheated ovaries (see Sedra and Lange, 2014). The number of ovarioles present in each
ovary can vary greatly and is species specific; R. prolixus in particular possess 7 telotrophic
ovarioles within each ovary. Telotrophic ovarioles are meroistic; unlike panoistic ovarioles
they receive nourishment from the surrounding follicular cells as well as nurse cells or
trophic cells (see Heming, 2003). The telotrophic ovariole is composed of 4 main regions: the
terminal filament, the germarium, the vitellarium and the pedicle. Within the germarium are
trophocytes that are connected to a unifying trophic core via intercellular bridges. Unlike the
polytrophic meroistic ovarioles, where the trophocytes (also known as nurse cells)
accompany each developing oocyte, the telotrophic ovarioles contain all of their nurse cells
within the germarium (Chapman, 2013). Each nucleated nurse cell is connected to each pre-
vitellogenic and vitellogenic ovariole by a nutritive cord (also known as a trophic cord) that
grows in diameter along with the growth of the oocyte (Huebner, 1981). The nutritive cord
126
allows the transport of macromolecules, such as mRNA and protein, from the trophic core to
the developing oocyte. Each oocyte is surrounded by a layer of binucleated follicle cells, and
small gap junctions allow small molecules to nourish the cells (Huebner and Anderson,
1972). The second source of nutrition that is supplied to the growing oocyte is vitellogenin.
Vitellogenin is only supplied to the last 2 oocytes in the vitellarium of the ovariole
undergoing vitellogenesis (Huebner and Anderson, 1972). Vitellogenin, which circulates in
the haemolymph, comes mainly from the fat body stores. Davey (2000) was able to elucidate
the importance of juvenile hormone (JH) on the transport of vitellogenin into the oocyte,
where receptor-mediated endocytosis allow for large spaces to form between follicular
epithelial cells thereby granting access to vitellogenin from the haemolymph into the growing
oocyte. Vitellogenin can also be directly synthesized within the follicle cells and delivered to
the oocyte (Melo et al., 2000). Once vitellogenesis is complete, the chorion is formed on the
terminal oocyte which then passes through the pedicel into the lateral oviduct, resulting in
ovulation. Spontaneous muscle contractions of the circular and longitudinal layers of muscle
fibers move the egg down the lateral oviduct and into the common oviduct (Sedra and Lange,
2014).
Upon mating, the female stores the spermatozoa and nutrients received from the male
in the spermathecae (Khalifa, 1950). Once the chorionated egg has entered the common
oviduct, the sperm enters the micropyles at the anterior end of the egg, and fertilization takes
place. It has been long speculated that within the spermatophore, the male also transfers a
compound such as a mating factor that signals the female that she is mated (Davey, 2007). It
was believed that this signal drives the mated female to produce more eggs than a virgin
female. Davey (1964) was able to show that placing accessory gland and/or seminal vesicle
127
content into a virgin female does not have an effect on egg production, but that placing
spermathecal content of a mated female into a virgin female increased oogenesis in R.
prolixus. This means that this mating factor is in fact synthesized within the mated female
spermathecae. Once the mature egg has been fertilized it enters the bursa, and the multiple
layers of chevron arranged muscle fibers contract and the egg is oviposited onto a substrate
(Sedra and Lange, 2014). Schilman et al. (1996) were able to show that the type of substrate
can affect not only the rate of egg-laying but the numberof eggs laid per R. prolixus female as
well.
As previously mentioned, a blood meal is critical for oogenesis. Kriger and Davey
(1983) have previously shown that after feeding, virgin females exhibit an increase in ovarian
contraction that coincides with egg production in the first gonadotrophic cycle in R. prolixus.
On the other hand, mated females not only exhibited the same peak in egg-production and
ovarian contraction the 1st day after feeding, but also a second peak approximately 7 days
after feeding (Kriger and Davey, 1983). JH has been hypothesized to be released from the
corpus allatum (CA) in both virgin and mated females upon feeding. The release of JH from
the CA increases the rate of vitellogenesis and is therefore associated with the first round of
egg production (Pratt and Davey, 1971a). However, the second batch of eggs produced in
mated females is a result of two things: the ‘mating factor’ synthesized in the female
spermathecae (Davey, 1964) and ecdysteroid release from the ovary itself, which induces the
release of ‘myotropin’, a peptide secreted from 10 bilaterally-paired neurosecretory cells in
the brain and is thought to be the cause of the increased rate of ovulation in mated females
(Kriger and Davey, 1983; Reugg et al., 1981). Not only do mated females overall lay more
eggs, but they have also been found to oviposit at a faster rate than that of virgin females
128
(Pratt and Davey, 1971b). Moreover, the release of what is believed to be JH from the CA
seems to be prolonged in mated females, and it was found that an antigonadotropin inhibits
that release earlier on in virgin females (Davey, 2000).
After looking at the process of oogenesis, ovulation, vitellogenesis and oviposition, it
is easy to see that there are many steps that are most likely under hormonal control. I am
interested in looking at the potential role that FMRFamide-like peptide (FLPs) can play on
any of these steps, since Sevala et al. (1992) isolated a large FLP whose concentration
fluctuates in female R. prolixus haemolymph with the egg-laying cycle. This peptide was
hypothesized to be responsible for the release of ‘myotropin’ (Sevala et al., 1992). In order to
assess whether any FLP regulates egg production or oviposition, a standardized egg-laying
assay was needed for our colony of R. prolixus.
This chapter solely focuses on observing the effects of feeding and mating on egg-
laying in R. prolixus. It is also important to note that factors such as temperature and
humidity (Okasha et al., 1970) and light/dark cycles (Ampleford and Davey, 1989) greatly
effect egg-laying. Therefore, I assess egg-laying in our colony under specific conditions to
establish controls for all future experiments.
Materials and Methods
Animals
The main R. prolixus colony was reared in an incubator with a temperature of 25°C
and 60% humidity. Adult males and females were immediately isolated upon molting. All
experimental insects were maintained in a separate incubator with 12h:12h light/dark cycle at
129
28°C and 50% humidity. There were two different factors tested in this study: effect of
feeding and effect of matedness on egg-laying.
Effect of Feeding
The effect of feeding on egg-laying was tested, and two experimental groups were set
up: unfed virgin females and fed virgin females. Depending on the treatment group,
experimental females were either fed defibrinated rabbit blood until satiation (20 days after
molting into adults) or were left unfed. Each female was given an identification, and all were
isolated into individual clear cages for the remainder of the experiment. A small piece of
paper towel was kept in every cage to provide the preferred substrate for egg-laying. All
cages were undisturbed.
Effect of Mating
With regard to matedness, all females and males used in this experiment were fed.
Previous literature has shown the importance of a blood meal in the facilitation of mating in
R. prolixus (see Davey, 2007). It has also been observed first hand in the lab, that mating
does not take place unless both male and female have been previously fed a blood meal to
satiation. All experimental adults (males and females kept separate) were fed a blood meal
approximately 20 days after molting, and this day is considered day 0 of the experiment. On
the 3rd
day after the blood meal, each individual female was either kept as a virgin or mated
with 2 males for 48h. To ensure that mating has taken place, the cage for every ‘mated’
female was checked for the deposited spermatophore (Khalifa, 1950; Davey, 1959). If a
spermatophore was found, then data collected from the female were included in the study.
130
Injection Treatments
To test the effect of various hormones and neuropeptides on egg-laying, several
controls were performed. All injections were carried out with a 10µL Hamilton syringe 6
days after feeding. The most effective and least disruptive injection site found for adult R.
prolixus is distally on the ventral cuticle through the connective ligament between the thorax
and the abdomen. A 2µL injection was administered for all treatments so as not to alter total
blood volume of the insect. To ensure that the act of injection did not have an effect on egg-
laying, two control groups were compared: insects that have not been injected (non-injected
control) and an “injection control”, those injected with 2µL of physiological saline (pH 7.0;
150mM NaCl, 8.6mM KCl, 2mM CaCl2, 4mM NaHCO3, 34mM glucose, 8.5mM MgCl2,
5mM HEPES [pH 7.2]). Moreover, in order to ensure that the assay worked, a positive
control was also carried out, where insects were injected with 2µL of CC extract (0.5CC/2µL
ddH2O). Previous literature has shown that there is a substance within the median
neurosecretory cells (MNSCs) that increases egg production and egg-laying (Kriger and
Davey, 1983). It was assumed that neurohormones within the MNSCs are released into the
haemolymph via the CC.
Data Collection and Analysis
All females were then isolated into individual cages, and eggs were counted daily at
8:30am each morning. The first sets of experiments were carried out for 25-35 days to
observe the cycles of egg-laying. The data were presented in two different ways: as number
of eggs laid per female per day and as the cumulative number of eggs laid per female over
the observation period. For the feeding and mating experiments each data point represents the
131
mean ± standard error of the mean (SEM) number of eggs laid per female (n ~ 7). The
sample sizes for the control, saline and CC injected groups were 12, 6 and 9 insects,
respectively.
Graph pad prism 5.0 (www.graphpad.com) was the software used to construct all the
graphs and conduct all statistical analyses. A two-way ANOVA followed by a Bonferroni
post-hoc test was carried out for the injection experiments to determine differences in egg-
laying while taking into consideration two factors: days after the feed and type of injection
(control, saline or CC extract).
Results
Effect of Feeding on Egg-laying
Unfed virgin females did not lay any eggs over the duration of the experiment (Figure
1). All replicates exhibited the same result. When virgin females were fed, they began to lay
eggs approximately 6 days after feeding. After 30 days, all fed virgin females stopped laying
eggs (Figure 1). On average, fed virgin females laid 13 eggs in total (Figure 1B).
Effect of Mating on Egg-laying
Two original treatment groups were tested: fed virgin females and fed mated females.
Similar to fed virgin females, fed mated females started laying eggs 6 days after feeding
(Figure 2). Overall, mated females exhibited a greater egg-laying rate (exhibit a steeper
slope) than unmated females (Figure 2). Since mated females laid their eggs at a faster rate,
they also stopped laying eggs earlier than unmated females (Figure 2). Unmated females laid
eggs after a blood meal for approximately 27 days, whereas mated females only laid eggs for
132
14 days (Figure 1 and 2). The total number of eggs produced per mated female at the end of
their egg-laying cycle was higher than that of virgin fed females (17-20 eggs and 7 eggs,
respectively).
Effect of Injection Treatments on Egg-laying
Fed mated females that were injected with saline exhibited similar egg-laying curves
to those not injected (Figure 3). Moreover, both treatment groups laid approximately similar
number of eggs (Two-Way ANOVA Ptreatment<0.0001, Bonferroni post-test P>0.05) (Figure
4). Fed and mated females that were injected with CC extracts (0.5CC per µL ddH2O)
exhibited a faster egg-laying rate (Figure 3). This can be observed by the shift to the left in
the eggs laid per day graph (Figure 3A) and the steeper curve in the cumulative number of
eggs laid per female (Figure 3B). When comparing the cumulative number of eggs laid per
female 7, 10 and 14 days post feeding, females injected with CC extracts laid significantly
more eggs than non-injected and saline injected females (Two-Way ANOVA,
Ptreatment<0.0001, PDaysAfterFeeding<0.0001 and Pinteraction=0.0046, Bonferroni post-test P7>0.01,
P10<0.001 and P14<0.05).
133
Figure 1: The effect of feeding on egg-laying in virgin R. prolixus females. (A) Average
number of eggs laid per female per day. Unfed virgins do not lay any eggs. It takes
approximately 6 days for a fed virgin female to start to lay eggs. (B) Cumulative number of
eggs laid per female over 33 days. It takes approximately 27 days for a fed virgin female to
lay all the eggs of the first cycle of egg production. Downward arrow depicts the end of the
egg production cycle for fed virgin females. Data points are mean ± standard error of the
mean (SEM) of 7 replicates.
134
135
Figure 2: The effect of mating on egg-laying in fed R. prolixus females. (A) Average
number of eggs laid per female per day. All females start to lay eggs approximately 6 days
after a blood meal. Mated females lay more eggs per day. (B) Cumulative number of eggs
laid per female over 24 days. Overall, a fed mated female will lay more eggs during the first
cycle of egg production than fed virgin females. Downward arrow depicts the end of the egg
production cycle for fed mated females. Data points are mean ± standard error of the mean
(SEM) of 7 replicates.
136
137
Figure 3: Number of eggs laid per fed mated female R. prolixus that were either not injected
(control - black), injected with saline (red) or injected with CC extracts (green). (A) Average
number of eggs laid per female per day. Females were fed on day zero (triangle), mated on
day 3 and 4 (bar) and then injected on day 6 (┬). All females started to lay eggs
approximately 6 days after a blood meal. (B) Cumulative number of eggs laid per female
across 13 days. Females that were injected with CC extracts laid the most number of eggs.
Data points are mean ± standard error of the mean (SEM).
138
139
Figure 4: Bar-graph comparing average cumulative eggs laid per female on 7, 10 and 14
days after feeding for the three treatment groups: control (not injected), saline injected and
CC injected. These days were chosen to represent the beginning, middle and end of the egg
production cycle. CC injected R. prolixus females lay significantly more eggs than control
and saline injected females for all the days analyzed after feeding (Two-Way ANOVA,
Ptreatment<0.0001, PDaysAfterFeeding<0.0001 and Pinteraction=0.0046, Bonferroni post-test P7>0.01,
P10<0.001 and P14<0.05). All throughout, control females lay the same amount of eggs as
saline injected females with no statistical difference between the two treatment groups. Data
points are mean ± standard error of the mean (SEM).
140
141
Discussion
The majority of the laboratory colonies of R. prolixus around the world were
established from eggs sent from Venezuela around 1912 to the Brumpt Lab in Paris (Davey
2007). Laboratory colonies best resemble the domiciliary population of R. prolixus in Central
and South America. Both populations have a constant and regulated supply of food (be it
weekly administered or constantly available in the home they co-inhabit with their host).
Moreover, the optimal physiological temperature for these hemipterans was found to be
around 28ºC with high humidity, where adult R. prolixus exhibited the lowest mortality rate
and the majority of the population did not require to re-feed after receiving the first blood
meal (Luz et al., 1999). Just as natural R. prolixus populations experience light/dark cycles,
all insects used in this assay were placed in an incubator with a 12h:12h light/dark cycle.
Moreover, Ampleford and Davey (1989) found that the majority of females in a 12h:12h
light/dark cycle lay their daily eggs at the start of the dark cycle, and this is under circadian
control. Therefore, by simulating the environmental conditions of the domiciliary population
in the world, we hope to observe similar results and determine more accurate rates of egg-
laying in our colony.
In this study egg-laying patterns of adult female R. prolixus were observed under
various treatment conditions. All of the findings in this chapter have been previously
observed and published by various other labs; however they were repeated here in order to
obtain accurate control numbers for our colony and to establish an egg-laying assay. As
many have discussed, adult females need to be fed so that oogenesis can take place. If unfed,
females would use the limited supply of nutrients on essential physiological processes related
to survival as opposed to making eggs (Davey, 2007). Therefore, feeding is indeed crucial, as
142
it provides the nutrients necessary for the production of vitellogenin in fat stores, and results
in the initiation of vitellogenesis and oocyte growth.
I found that when the animals were contained in a 12h:12h light/dark cycle at 28ºC
and 50% humidity both virgin and mated females started their first gonadotrophic cycle (egg
production cycle) approximately 6 days after they were fed. This was similarly observed by
Kriger and Davey (1983) in their R. prolixus colony. In that study, the first gonadotrophic
cycle in mated females lasted 12 days, whereas for our colony the first cycle lasted 14 days.
This discrepancy can be a result of them maintaining their animals in total dark as opposed to
having a light dark cycle. Only the first gonadotrophic cycle was observed in this study; to
initiate the second gonadotrophic cycle a second blood meal would have been required.
Mated females lay their eggs faster than virgin females, and a steeper curve is
observed when the cumulative number of eggs laid is plotted against days after feeding
(Davey, 1964). Davey (1964) reported that, on average, fed, virgin females lay 2.5 eggs per
day, whereas our colony for the most part averaged at about 1 egg per day. Davey also
reported mated females laying 4.3 eggs per day, but I observed an average of approximately
2.5 eggs. In both scenarios, mated females laid eggs at approximately double the rate than
that of virgin, fed females. The release of JH from the CA occurs for a longer duration of
time in mated females when compared to virgin females (see Davey, 1993). Pratt and Davey
(1972a) also found that after removing the CA, they observed lower levels of vitellogenin in
the haemolymph, and that overall the initiation of vitellogenesis was delayed and slow.
Therefore, in both mated and virgin females, the presence of the CA is essential and is
responsible for the first peak of egg-laying, as it initiates the synthesis and uptake of
vitellogenesis.
143
Overall, fed, virgin females produced 7 eggs in their first gonadotrophic cycle, and
mated females produced 17-20 eggs in our colony, whereas Pratt and Davey (1972b) reported
17 and 30 eggs, respectively. It is important to note that we stopped counting the number of
eggs laid by 25 days (as performed in other studies). The graphs illustrate that mated females
produce more eggs per gonadotrophic cycle than do virgin females. The Davey lab was able
to conclude that the CA in R. prolixus was active for a longer period of time in mated
females compared to virgins (Davey 2007). This means that more JH is circulating in the
haemolymph for a prolonged duration and is signaling fat body stores to synthesize
vitellogenin and through receptor-mediated endocytosis, aids follicular epithelial cells in the
vitellarium to form gaps and allow the entrance of vitellogenin into the growing oocyte
(Davey, 2000). Therefore, egg production and vitellogenesis can take place in mated females
for a longer period of time than in virgin females. JH production and release from the CA are
also under inhibitory control, and this has been studied in many insect species including
Manduca sexta (Bhaskaran et al., 1990), Diploptera punctata (Rüegg et al., 1983; Rankin
and Stay, 1985) and Aedes aegypti (Rossignol et al., 1981). JH synthesis in the corpus
allatum is inhibited by both neural innervation and endocrinological negative feedback from
the ovary. Rüegg et al. (1983) showed that an inhibitory substance (hypothesized to be
allatostatin - AST) is supplied to the CA via the paired nervi corporis cardiac I (NCC I) and
is responsible for the inhibition of JH synthesis in the CA; when these nerves are severed JH
biosynthesis is elevated in D. punctata. This inhibitory substance is synthesized and supplied
by the MNSCs. Immunohistochemistry in R. prolixus (Fifth instars and adults) showed
FGLa/AST-like immunoreactive axons in the paired NCC II leading to the corpus
cardiacum/corpus allatum (CC/CA) complex (Sarkar et al., 2003; Sedra et al., 2015). This
144
shows that AST is supplied to the CA, and possibly inhibits JH production. Moreover,
RhoprAST-2 has been shown to inhibit oviduct contraction in R. prolixus and most likely
slows down egg movement (Sedra et al., 2015). Further immunohistochemical studies in R.
prolixus need to be carried out to verify differential staining of FGLa/AST-like
immunoreactivity between virgin and mated females. JH synthesis in the CA is secondarily
controlled by the release of a hormone from the mature ovary. Rankin and Stay (1985) found
that a hormone released from the ovary at the end of its gonadotrophic cycle results in the
decrease of JH production and release from the CA, thus creating a negative feedback loop.
Besides the inhibition of JH synthesis at an earlier time in virgin females, mated
females overall produce more eggs because of a ‘mating factor’ that initiates a signaling
cascade leading to increased oogenesis. It has been long believed that during mating, the
male transfers a ‘mating factor’ to the female that signals matedness and leads to an increase
in egg production. However, Davey (1964) was able to show that this ‘mating factor’ is
actually synthesized within the female spermathecae and is correlated with the release of
ecdysone from the mature ovary. The release of ecdysone into the haemolymph results in the
elevation of ‘myotropin’ release from the MNSCs via the CC and this stimulates oogenesis
and increases ovarian motility, resulting in an increase in the number of eggs laid (Ruegg et
al., 1981; Kriger and Davey, 1983).
Various hormones and neuropeptides have been hypothesized to play a role in
regulating egg production, via either stimulation or inhibition. Sevala et al. (1992) found a
FMRFamide-like peptide whose level in the haemolymph fluctuated in a pattern that was
coordinated with the gonadotrophic cycle of R. prolixus using a radioimmunoassay (RIA).
They also found that the presence of this peptide in the haemolymph peaked at approximately
145
the same time as ‘myotropin’, suggesting that either ‘myotropin’ leads to FMRFamide-like
peptide release or vice versa. When they injected an antiserum against RFamide into the
haemolymph of mated fed females, they observed a delay in oviposition (Sevala et al., 1992).
However, it is unclear exactly how this particular FLP regulates egg-laying. Several studies
have localized FMRFamide-like peptides in the MNSCs of R. prolixus (Tsang and Orchard,
1991; Sevala et al., 1992; Sedra and Lange, 2014). Neuropeptides synthesized within the
MNSCs are released into the haemolymph via the CC, and bright RFamide-like
immunoreactive staining has been observed in processes in the CC as well. Therefore, as a
positive control, one would assume that injection of CC extracts would result in a dramatic
increase in egg-laying. We found that CC extracts did not necessarily increase the number of
eggs laid; however, it did increase the rate of egg-laying, which can be clearly seen by the
shift in the egg-laying curve to the left. This was something that was consistently observed.
Although it is not as dramatic a change as anticipated, it was consistent and served as the
positive control. It is also important to note that the CC is filled with numerous neuropeptides
that are released from the MNSCs. Some of the neuropeptides are most likely inhibitory as
well. This explains why the effect was not dramatic.
In conclusion, I determined the egg-laying rate of virgin fed females and that of
mated females for the colony of R. prolixus at UTM. I was successful in establishing an egg-
laying assay and ensured that the injection process did not affect the rate or the cumulative
number of eggs laid by a female R. prolixus. Further studies will involve observing the effect
of specific neuropeptides on oogenesis and oviposition.
146
References
Ampleford, E.J. and Davey, K.G. (1989). Egg laying in the insect Rhodnius prolixus is timed
in a circadian fashion. Journal of Insect Physiology, 35: 183-187.
Bhaskaran, G., Dahm, K.H., Barrera, P., Pacheco, J.L., Peck, K.E. and Muszynska-Pytel, M.
(1990). Allatinhibin, a neurohormonal inhibitor of juvenile hormone biosynthesis in
Manduca sexta. General and Comparative Endocrinology, 78: 123-136.
Chapman, R.F. (2013). Reproductive system: female. In: The insects: Structre and function.
New York: Cambridge University Press, 295-301.
Davey, K. (2007). The interaction of feeding and mating in the hormonal control of egg
production in Rhodnius prolixus. Journal of Insect Physiology, 53: 208-215.
Davey, K.G. (1959). Spermatophore production in Rhodnius prolixus. Journal of Cell
Science, 100: 221-230.
Davey, K.G. (1964). Copulation and egg-production in Rhodnius prolixus: the role of the
spermathecae. Journal of Experimental Biology, 42: 373-378.
Davey, K.G. (1993). Hormonal integration of egg production in Rhodnius prolixus. American
Zoologist, 33: 397-402.
Davey, K.G. (2000). The modes of action of juvenile hormones: some questions we ought to
ask. Insect Biochemistry and Molecular Biology, 30: 663-669.
Heming, B.S. (2003). The female reproductive system and oogenesis. In: Insect development
and Evolution. New York: Cornell University Press, 29-39.
Huebner, E. (1981). Nurse cell-oocyte interaction in the telotrophic ovarioles of an insect,
Rhodnius prolixus. Tissue and Cell, 13: 105-125.
147
Huebner, E. and Anderson, E. (1972). Cytological study of the ovary of Rhodnius prolixus.
The ontogeny of the follicular epithelium. Journal of Morphology, 136: 459-494.
Khalifa, A. (1950). Spermatophore production and egg-laying behaviour in Rhodnius
prolixus Stal. (Hemiptera; Reduviidae). Parasitology, 40: 283-289
Kriger, F.L. and Davey, K.G. (1983). Ovarian motility in mated Rhodnius prolixus requires
an intact cerebral neurosecretory system. General and Comparative Endocrinology,
48: 130-134.
Lutz, D.A. and Huebner, E. (1980). Development and cellular differentiation of an insect
telotrophic ovary (Rhodnius prolixus). Tissue and Cell, 12: 773-794.
Luz, C., Fargues, J. and Grunewald, J. (1999). Development of Rhodnius prolixus
(Hemiptera: Reduviidae) under constant and cyclic conditions of temperature and
humidity. Memórias do Instituto Oswaldo Cruz, 94: 403-409.
Melo, A.C.A., Valle, D., Machado, E.A., Salerno, A.P., Paiva-Silva, G.O., Cunha E Silva,
N.L., de Souza, W. and Masuda, H. (2000). Synthesis of vitellogenin by the follicle
cells of Rhonidus prolixus. Insect Biochemistry and Molecular Biology, 30: 549-557.
Okasha, Y.K., Hassanein, A.M.M. and Farahat, A.Z. (1970). Effects of sub-lethal high
temperature on an insect, Rhodnius prolixus (Stål). Journal of Experimental Biology,
53: 25-36.
Pratt, G.E. and Davey, K.G. (1972a). The corpus allatum and oogenesis in Rhodnius prolixus
(Stål). The effects of allatectomy. Journal of Experimental Biology, 56: 201-214.
Pratt, G.E. and Davey, K.G. (1972b). The corpus allatum and oogenesis in Rhodnius prolixus
(Stål). The effect of mating. Journal of Experimental Biology, 56: 223-237.
148
Rankin, S.M. and Stay, B. (1985). Ovarian inhibition of juvenile hormone synthesis in the
viviparous cockroach, Diploptera punctata. General and Comparative
Endocrinology, 59: 230-237.
Rossignol, P.A., Feinsod, F.M. and Spielman, A. (1981). Inhibitory regulation of corpus
allatum activity in mosquitoes. Journal of Insect Physiology, 24: 651-654.
Ruegg, R.P., Kriger, F.L., Davey, K.G. and Steel, C.G.H. (1981). Ovarian ecdysone elicits
release of a myotropic ovulation hormone in Rhodnius (Insecta: Hemiptera).
International Journal of Invertebrate Reproduction, 3: 357-361.
Rüegg, R.P., Lococo, D.J. and Tobe, S.S. (1983). Control of corpus allatum activity in
Diploptera punctata: roles of the pars intercerebralis and pars lateralis. Experientia,
39: 1329-1334.
Sarkar, N.R.S., Tobe, S.S. and Orchard, I. (2003). The distribution and effects od Dippu-
allatostatin-like peptides in the blood-feeding bug, Rhodnius prolixus. Peptides, 24:
1553-1562.
Schilman, P.E., Núñez, J.A. and Lazzari, C.R. (1996). Attributes of oviposition substrates
affect fecundity in Rhonius prolixus. Journal of Insect Physiology, 42: 837-841.
Sedra, L., Haddad, A.S. and Lange, A.B. (2015). Myoinhibitors controlling oviduct
contraction within the female blood-gorging insect, Rhodnius prolixus. General and
Comparative Endocrinology, 211: 62-68.
Sedra, L. and Lange, A.B. (2014). The female reproductive system of the kissing bug,
Rhodnius prolixus: arrangements of muscles, distribution and myoactivity of two
endogenous FMRFamide-like peptides. Peptides, 53: 140-147.
149
Sevala, V.L., Sevala, V.M., Davey, K.G. and Loughton, B.G. (1992). A FMRFamide-like
peptide is associated with the myotropic ovulation hormone in Rhodnius prolixus.
Archives of Insect Biochemistry and Physiology, 20: 193-203.
Tsang, P.W. and Orchard, I. (1991). Distribution of FMRFamide-related peptides in the
blood-feeding bug, Rhodnius prolixus. The Journal of Comparative Neurology, 311:
14-32.
World Health Organization. (2002). Control of Chagas Disease. In: WHO Technical Report
Series. Brazil: 46-48.
150
Acknowledgements
I would like to personally thank Nikki Sarkar for carrying out all the feeding for the
colony insects as well as my experimental males and females.
151
Chapter 5:
Long neuropeptide F (NPF) as well as other FMRFamide-like
peptides (FLPs) regulate egg production in the Chagas vector
Rhodnius prolixus
Laura Sedra1 and Angela B. Lange
1
1Department of Biology, University of Toronto Mississauga, Mississauga, ON, Canada L5L
1C6
** This chapter is under revision in Peptides
152
Abstract
Long neuropeptide F (NPF) is a neuropeptide implicated in the control of feeding,
digestion and reproduction in various insect species. Here we have isolated the cDNA
sequence encoding NPF in Rhodnius prolixus (RhoprNPF). The RhoprNPF gene is composed
of 3 exons and 2 introns, one of which is present in the peptide coding region. RhoprNPF is
42 amino acids long and has the characteristic RFamide C-terminus, which is common to
FMRFamide-like peptides (FLPs). Quantitative PCR (qPCR) shows that RhoprNPF mRNA
is present in higher amounts in fifth instars than in adults, implying that it may play a role in
growth and development. In situ hybridization shows that the RhoprNPF transcript is present
in median neurosecretory cells (MNSCs) in the brain, cells in the fifth instar hindgut and
cells along the longitudinal muscle fibers of the adult female lateral oviducts. Injection of the
last 8 amino acids of RhoprNPF (truncated RhoprNPF, AVAGRPRFa), which is considered
to be the active core sequence for biological activity, into mated, fed, female adult R.
prolixus decreased the number of eggs found in the ovaries as well as increased the number
of eggs laid. This suggests that RhoprNPF may play a role in accelerating the process of
ovulation from the ovary of the female R. prolixus. An increase in oogenesis was observed
following the injection of other FLPs such as short RhoprNPF, GNDNFMRFamide and
AKDNFIRFamide, whereas the FLP, RhoprMS, and the allatostatin, RhoprAST-2, inhibited
egg production.
Keywords: egg-laying; in situ hybridization; insect; neuropeptide; ovulation
153
1. Introduction
Egg-laying is a physiological process that is highly coordinated and regulated in
insect species [3, 14, 19, 23 and 40]. Previous literature has examined the cycles of egg-
laying and how it is linked to the massive blood meal taken by female Rhodnius prolixus [6].
Other factors likely to affect egg production include temperature, light and dark cycles, and
matedness [1, 7 and 26]. Once the terminal oocyte is fully developed in the ovariole, the
mature egg travels through the ovariole stalk and into the lateral oviduct, thereby being
ovulated [3, 40]. At the time of egg-laying forceful muscular contractions of the circular and
longitudinal muscle fibers in the lateral oviduct, along with secretions from epithelial cells,
propel the egg into the common oviduct where it is then fertilized by spermatozoa from the
spermathecae [3, 33 and 40]. Immediately after the egg passes into the bursa it contracts, and
the egg is laid along with secretions from the cement gland, fixing the egg to a substrate.
Many neurohormones appear to regulate one or more steps of this highly coordinated
physiological process.
FMRFamide-like peptides (FLPs) are a large family of neuropeptides composed of
several subfamilies. Previous studies have shown that several extended FM/IRFamides of R.
prolixus increase muscle contraction of the female reproductive tract [33], whereas
RhoprAST-2 (FGLa/AST or A-type allatostatins) results in the inhibition of lateral oviduct
muscle contraction in R. prolixus [34]. Another member of the FLP superfamily,
neuropeptide F (NPF), is mostly found among invertebrates and has three known
homologous peptides among vertebrates: NPY, peptide YY and pancreatic polypeptide (PP)
[22]. NPF generally consists of one gene containing one functional peptide that is well
conserved across invertebrate species [22]. The NPF members of the FLPs are the only ones
154
shown to have either an RFamide or RYamide C-terminal ending. The first NPF was isolated
from the parasitic flatworm, Monieza expansa, and consists of 39 amino acids; it was shown
to be structurally similar to vertebrate PPs [18]. Since then numerous NPFs have been
sequenced from invertebrates, including the great pond snail Lymnaea stagnalis [8], the sea
slug Aplysia californica [29], the African malaria mosquito Anopheles gambiae [9] and the
termite Reticulitermes flavipes [25]. The majority of NPFs possess a common C-terminus of
GRPRFamide, where a hydrophobic phenylalanine (F) is the substitute for tyrosine (Y).
NPFs generally consist of 28-45 amino acid residues, thus resulting in their assigned name,
long neuropeptide F [see 22]. A recent study by Van Wielendaele et al. (2013a) showed that
only the last 9 amino acids of NPF (truncated NPF - trNPF) are required for biological
activity, and this trNPF was shown to be present and to increase food intake and overall
weight in the desert locust, Schistocerca gregaria, following injection.
Brown et al. (1999) determined the transcript expression of NPF using in situ
hybridization in Drosophila melanogaster. NPF was expressed in neurons within the brain of
larvae and adult D. melanogaster, with no cell bodies expressing NPF in the remainder of the
ventral nerve cord [2]. Stained endocrine cells were found in the midgut [2]. A later study
using immunohistochemical techniques in Rhodnius prolixus with a polyclonal DrmNPF
antiserum (pre-absorbed with GDRARVRFamide) stained neurons throughout the CNS
including the medial neurosecretory cells (MNSCs) and processes across the hindgut of fifth
instars [10]. NPF-like immunoreactive endocrine cells were also found on the midgut in
several species, such as the moth Helicoverpa zea (H. zea antiserum with high specificity for
QAARPRFa) [12], R. flavipes (H. zea antiserum) [24] and A. aegypti (DrmNPF antiserum)
[36]. The presence of NPF in the CNS as well as in endocrine cells in the gut has been further
155
validated in A. gambiae and R. flavipes using RT-PCR [9 and 25]. Expression levels of the
NPF transcript were shown to be high in the CNS and the gut of S. gregaria [37].
Whereas most studies have focused on the effect of NPF on feeding and digestion, a
few have also looked at the effect of this FLP on reproduction. After determining that trNPF
injections increased weight gain in male and female S. gregaria, Van Wielendaele et al.
(2013b) also showed that trNPF injected into males increased courtship behaviour and egg
viability. Other studies have also shown that injection of NPF results in an increase in egg
development and stimulation of oocyte maturation in Locusta migratoria and S. gregaria [4
and 38]. Within R. prolixus, injection of MNSC extracts induces ovulation [13].
Interestingly, FLPs are present in these MNSCs, including the possibility of NPF [10 and
33]. In addition, Sevala et al. (1992) suggested that an FLP was present in the haemolymph
of R. prolixus with the titre changing throughout the egg cycle. These observations led us to
hypothesize that NPF, as well as other FLPs, may play a role in the regulation of egg
production in female R. prolixus.
In this study, we have cloned and characterized the neuropeptide F cDNA in R.
prolixus and determined the spatial expression of NPF mRNA across various tissues in fifth
instars as well as adults. In situ hybridization was used to determine the distribution of NPF
transcript within neurons in the CNS as well as cells in the gut and female reproductive tract.
We have also tested the effect of injecting CC extracts, truncated RhoprNPF as well as other
FLPs on egg production and egg-laying in R. prolixus.
156
2. Materials and Methods
2.1 Animals
Male and female fifth instar and adult R. prolixus were obtained from a colony fed on
defibrinated rabbit blood (Hemostat Laboratories, Dixon, CA, USA; supplied by Cedarlane,
Burlington, ON, Canada). The colony was reared in an incubator maintained at a temperature
of 25°C and 60% humidity. Insects were kept in an incubator with a 12h: 12h light / dark
cycle at 28°C and 50% humidity.
2.2 Chemicals
Truncated RhoprNPF (AVAGRPRFamide), short RhoprNPF
(NNRSPQLRLRFamide), GNDNFMRFamide, AKDNFIRFamide, the sulfakinin RhoprSK-1
(pQFNEY(SO3)GHMRFamide), the myosuppressin RhoprMS (pQDIDHVFMRFamide) and
the allatostatin RhoprAST-2 (LPVYNFGLamide) were purchased as powders from
GenScript (Piscataway, NJ, USA). Powders were dissolved in double-distilled water and
stored at -20°C.
2.3 Isolation of the RhoprNPF cDNA sequence from R. prolixus CNS cDNA library
Previously characterized and predicted amino acid sequences of long neuropeptide F
in other insects (Aphis gossyppi, HQ613405; Acyrthosiphon pisum, XM_001944830;
Anopheles gambiae, AY579077) were used to screen the R. prolixus genome via a BLAST
search (Basic Local Alignment Search Tool) [9]. All the remaining in silico work was
completed in Geneious v.4.7.6 (http://www.geneious.com/). Using the above sequences, a
putative long NPF sequence was defined in the R. prolixus genome (Supercontig: GL562724)
157
and gene specific primers (GSP) were designed to clone the open reading frame (ORF)
(Table 1A). Gene specific (GS) forward and reverse primers were designed after and before
predicted splice sites respectively (http://www.fruitfly.org/seq_tools/splice.html) [30]. All
GSPs were synthesized and ordered from Sigma-Aldrich (Oakville, Ontario, Canada). PCR
conditions were maintained at: 3 min at 94°C, 30 s at 94°C, 30 s at 61°C, 60 s at 72°C and
10min at 72°C. Amplified cDNA was run on a 1.2% agarose gel and stained with RedSafeTM
nucleic acid staining solution (iNtRON Biotechnology, New Jersey, USA) for visualization.
Using gel electrophoresis the size of all amplified products was confirmed. The purified
cDNA was ligated in a pGEM-T Easy vector (Promega, Madison, Wisconsin, USA) and
transformed into competent One Shot® E. coli cells (Invitrogen, Burlington, Ontario,
Canada). Transformed cells were plated on X-gal/ampR LB agar, and colonies were screened
using the plasmid specific primers T7 and SP6 (Table 1B) to confirm the correct insert size.
Positive colonies were inoculated with ampR medium and the plasmids were extracted and
purified from the cells. Samples were sent for sequencing at the Hospital for Sick Children,
Toronto (www.tcag.ca/facilities/dnaSequencingSynthesis.html) (MaRS Centre, Toronto,
Ontario, Canada).
Modified 5' and 3' rapid amplification of cDNA ends (RACE) was used and GSPs
were designed in order to extend the 5' and 3' end of the sequence (Table 1C). Using the CNS
cDNA library as the template, 5' RACE GS reverse primers alongside with library plasmid
forward primers (pDNR_LIB FOR 1 and pDNR_LIB FOR2) were used to extend the 5' end
of the sequence (Table 1D). This was also done for the 3' end of the sequence using 3' RACE
GS forward primers (Table 1C) and library plasmid reverse primers (pDNR_LIB-88REV and
pDNR_LIB-25REV)(Table 1D). The product was then gel extracted and purified. These
158
extended cDNA fragments were used as a template for the following nested PCR
experiments to filter out non-specific products (since the library plasmid primers are not
specific to our amplified cDNA product). Final products were then purified and plasmids
were sent for sequencing.
2.4 Multiple Sequence Analysis of the NPF prepropeptide
As previously mentioned, online software was used for splice-site prediction and
aided in the determination of intron-exon boundaries within the R. prolixus NPF gene
(http://www.fruitfly.org/seq_tools/splice.html) [30]. The cloned nucleotide sequence was
BLAST searched against the original R. prolixus genome using the Geneious software. All
contigs were then aligned and the size of the introns was determined. The signal peptide was
predicted using the SignalP 4.1 server (http://www.cbs.dtu.dk/services/SignalP/) [28].
Multiple arthropod and vertebrate sequences were aligned against the cloned amino acid
sequence of RhoprNPF using ClustalW server
(http://www.ch.embnet.org/software/ClustalW.html). Using the BOXSHADE 3.21 server
(http://www.ch.embnet.org/software/BOX_form.html) the aligned sequences were shaded,
where identical amino acid residues were represented in black and similar amino acids in
gray following the 60% majority rule.
2.5 RNA extraction and cDNA synthesis of the RhoprNPF transcript in various tissues
CNS (brain, prothoracic ganglion, mesothoracic ganglionic mass) and peripheral
tissues (salivary gland, dorsal vessel, foregut, anterior midgut, posterior midgut, hindgut,
Malpighian tubules, fat body, ovaries and testes) of fifth instar and adult R. prolixus were
dissected in phosphate-buffered saline (PBS) prepared in nuclease-free water (Invitrogen,
159
Burlington, Ontario, Canada). Similar dissections were completed for the whole adult CNS,
female (ovaries, oviduct/spermathecae and bursa/cement gland) and male (testes, vas
deferens/accessory glands and seminal vesicle/ejaculatory duct) reproductive tissues. There
were three biological replicates for every sample. Tissues were then stored in separate tubes
containing RNA later solution (Ambion, Carlsbad, California, USA). After removing the
RNA later and adding lysis buffer (including β-mercaptoethanol), each sample was passed
through an 18-gauge syringe needle (Ambion, Carlsbad, California, USA) at least 10 times.
Using the PureLink® RNA mini-kit (Ambion, Carlsbad, California, USA), the homogenate
was purified. Purity and concentration of the RNA of each sample were determined using a
Nanodrop UV spectrophotometer (Thermo Scientific, Wilmington, Delaware, USA). Exactly
200ng of the total RNA of each sample was the template to synthesize cDNA using iScriptTM
Reverse Transcription Supermix RT-qPCR (Bio-Rad Laboratories Ltd., Mississauga,
Ontario, Canada) and following the manufacturer's protocols. Synthesized cDNA was then
diluted 10-fold and used as template for quantitative PCR (qPCR).
2.6 Real-Time qPCR of RhoprNPF across various tissues
All experiments were performed on an MX3005P Quantitative PCR system
(Stratagene, Mississauga, Ontario, Canada). The temperature-cycling profile consisted of an
initial denaturation period (95°C for 30s), 40 cycles of denaturation (95°C for 5s) and
annealing/extension (60°C for 24s), and a melt-curve analysis (60-95°C). GSPs were
designed over exon/exon boundaries to determine the transcript level of the peptide in the
various tissues (Table 2A). Primers for three reference genes were also used for analysis
(ribosomal protein 49, β-actin and α-tubulin) (Table 2B). Primer efficiencies were then
160
determined for each target and the ΔΔCt method of analysis was used to determine the fold-
differences of RhoprNPF transcript expression in the tissues relative to hindgut in fifth
instars and adults. A more thorough analysis looking at the transcript expression of
RhoprNPF throughout the adult male and female reproductive tract relative to CNS was also
carried out. Relative fold-differences were normalized to the three chosen reference genes for
all tissues sampled. Two technical replicates were performed for each tissue in each
biological replicate. All experiments and samples were run using SsoFastTM EvaGreen®
Supermix with Low ROX (BIO-Rad Laboratories Ltd., Mississauga, Ontario, Canada). Each
sample was run alongside a no template control.
2.7 Fluorescent in situ hybridization
Sense (T7-NPFpep-FOR1 and NPFpep-REV4) and antisense (NPFpep-FOR1 and T7-
NPFpep-REV4) gene specific primers were designed over the RhoprNPF ORF to synthesize
the cDNA template for the RNA probes used for in situ hybridization (Table 3A and B).
Using a DIG/RNA labelling kit (Roche Applied Science, Mannheim, Germany),
approximately 1 µg of both sense and antisense templates were transcribed in either the
forward or reverse direction (depending on the placement of the T7 primer). DNase I was
used to remove remaining template DNA, and template size was confirmed on a 1.2%
agarose gel using electrophoresis. To confirm transcription direction the probes were cloned
and sent for sequencing (as explained above). Probes were then aliquoted to approximately
100ng per experiment and stored at -20°C.
Fifth instar/adult CNS and gut as well as the adult female reproductive tract were
dissected in RNAase-free 1xPBS (Dulbecco's phosphate buffered saline - D1408: Sigma
161
Aldrich, Oakville, ON, Canada) and then incubated for 1h in 2% paraformaldehyde made up
in PBST (1xPBS and 0.1% Tween-20: BioShop® Canada Inc., Burlington, ON, Canada) on a
shaker at room temperature. Tissues were then washed with PBST and permeablized with 1%
H2O2 as well as 4% Triton-X solution made up in PBST [as explained in 15]. After a post-
fixation treatment, tissues were stored in RNA hybridization solution at -20°C for no longer
than 7 days. Tissues were then incubated in heat-treated RNA hybridization for about 6-8h
on a rotating wheel at 56°C and treated with experimental or control probe solutions [15].
Samples were then blocked in 1% BSA (Bovine Serum Albumins: Sigma Aldrich, Oakville,
ON, Canada) and incubated in 1:400 biotin-SP-conjugated IgG monoclonal mouse
antidigoxigenin (DIG: Jackson ImmunoResearch Laboratories Inc., West Grove, PA)
overnight at 4°C. Samples were treated with 1:100 streptavidin-HRP solution followed by
1:100 Alex Fluor 568 tyramide conjugate made up in amplification buffer provided in the
TSA amplification kit (with 0.0015% H2O2) (Molecular Probes, Life Technologies, MA,
USA) [as described in 15]. Lastly, tissues were mounted on glass slides in 100% glycerol
(Sigma Aldrich, Oakville, ON, Canada) and imaged on a Zeiss LSM 510 Confocal Laser
Microscope (Carl Zeiss, Jena, Germany).
2.8 Egg-laying Assay
Unfed males and females were separated as fifth instars and then fed defibrinated
rabbit blood, allowing them to molt into adults and remain virgins. Approximately 20 days
after molting into adults they were supplied with a blood meal to satiation (this is considered
day 0 – see Fig. 7A). On the third day after feeding, all females were isolated into individual
cages containing 2 males, and they were allowed to mate for 48 h (Fig. 7A). On the morning
162
of day 5, all males were removed from the cages. On day 6, the mated females were injected
with 2 µL of either saline (control: pH 7.0; 150mM NaCl, 8.6mM KCl, 2mM CaCl2, 4mM
NaHCO3, 34mM glucose, 8.5mM MgCl2, 5mM HEPES [pH 7.2]), corpus cardiacum extracts
(0.5CC per 2 µL ddH2O) or 10-3
M of a neuropeptide (resulting in a 5 x 10-5
M in vivo
concentration) (Fig. 7A). After the injection on the sixth day, the females were left
undisturbed, and eggs laid were counted every morning until the last day of the experiment
(day 10). On day 10, females were then dissected, and eggs throughout the reproductive tract
were counted and tabulated to determine the effect of these neuropeptides on ovulation and
egg-laying rates. The mean ± standard error was then plotted to show the spatial distribution
of eggs on the tenth day of the experiment, final number of eggs laid, as well as total egg
production per female. This assay was used to test the effects of the following neuropeptides:
the active C-terminal of RhoprNPF (truncated RhoprNPF), short RhoprNPF,
GNDNFMRFamide, AKDNFIRFamide, RhoprSK, RhoprMS, and RhoprAST-2 (Table 4).
163
Table 1. Gene specific primers (GSPs) designed to clone the RhoprNPF gene.
A) ORF primers (5' to 3')
NPFpep-FOR1 ATGAACTGTTGGCTGCTGTG
NPFpep-REV3 GGCAACAGCATAATATTGTCCTAGTTGGTCAAGA
B) pGEM-T Easy vector specific primers
T7 TAATACGACTCACTATAGGG
SP6 TATTTAGGTGACACTATAG
C) 5' and 3' RACE GS primers
raceNPFpep-REV1 CCATCAGTCCGGTCCAG
raceNPFpep-REV2 CACAGCAGCCAACAGTTCAT
raceNPFpep-REV3 CGACTTTGTTTTTAAACTGAAG
raceNPFpep-REV4 GATGACGATGAAAATTAAATTTTGTAAAC
raceNPFpep-FOR1 AAATCCTTTGCCTCACC
raceNPFpep-FOR2 TTATGCTGTTGCCGGC
D) 5' and 3' RACE library plasmid primers
pDNR_LIB FOR 1 GTGGATAACCGTATTACCGCC
pDNR_LIB FOR2 ACGGTACCGGACATATGCC
pDNR_LIB-88REV AGTCATACCAGGATCTCCTAGGG
pDNR_LIB-25REV GCCAAACGAATGGTCTAGAAAG
164
Table 2. Primers used to detect the spatial and reproductive profile expression of RhoprNPF qPCR.
A) GSPs for qPCR
qPCR-NPFpep-FOR1 ATGAACTGTTGGCTGCTGTG
qPCR-NPFpep-REV1 CGGCAACAGCATAATATTGTCC
B) Reference gene primers
rp49-qPCR-F GTGAAACTCAGGAGAAATTGG
rp49-qPCR-R AGGACACACCATGCGCTATC
Actin5C-qPCR-F AGAGAAAAGATGACGCAGATA
Actin5C-qPCR-R ATATCCCTAACAATTTCACGTT
alphaTUB-qPCR-F GTGTTTGTTGATTTGGAACCTA
alphaTUB-qPCR-R CCGTAATCAACAGACAATCTTT
* GSPs designed on exon-exon boundaries to avoid accidental amplification of genomic DNA.
165
Table 3. Primers used to synthesize sense (control) and antisense (experimental) RNA probes to detect RhoprNPF mRNA via in situ hybridization.
A) GSPs for sense probe
T7-NPFpep-FOR1 TAATACGACTTATAGGGAGAATGAACTGTTGGCTGCTGTG
NPFpep-REV4 CGGCAACAGCATAATATTGTCC
B) GSPs for antisense probe
NPFpep-FOR1 ATGAACTGTTGGCTGCTGTG
T7-NPFpep-REV4 TAATACGACTTATAGGGAGACGGCAACAGCATAATATTGTCC
166
Table 4. Neuropeptides injected in R. prolixus adult females (2 µL of 10-3 M), 6 days post-feeding, to test egg production and eggs laid.
Truncated RhoprNPF AVAGRPRFamide
Short RhoprNPF NNRSPQLRLRFamide
Extended FMRFa GNDNFMRFamide
Extended FIRFa AKDNFIRFamide
RhoprSK pQFNEY(SO3)GHMRFamide
RhoprMS pQDIDHVFMRFamide
RhoprAST-2 LPVYNFGLamide
167
3. Results
3.1 Isolation of the RhoprNPF gene in R. prolixus
The ORF of RhoprNPF was cloned and found to be 315bp long, translating to 105
amino acids, not including the stop codon (Fig. 1: Accession # - KT98124). The gene is
composed of 3 exons and two introns (Figs 1, 2). The ORF lies on 2 exons, where ATG is the
start codon and TGA is the stop codon (Fig. 1, 2). Approximately 94bp of the 5'UTR was
cloned, as well as 84bp of the 3'UTR where a chain of adenine residues is present in the end
of the nucleotide sequence. The first intron is substantially larger in size (83,647bp) when
compared to the intron that interrupts the ORF (930bp) (Fig. 2). A putative signal peptide is
predicted to be cleaved in the endoplasmic reticulum resulting in a propeptide (Fig. 1). The
dibasic cleavage site (KR) would then be cleaved by carboxypeptidases yielding the
neuropeptide (Fig. 1), which following post-translational modification by amidation of the
glycine residue would result in the amidated RhoprNPF composed of 42 amino acids (Fig. 1).
3.2 Multiple Sequence Alignment of the RhoprNPF ORF in various species
The complete ORF of RhoprNPF in R. prolixus was aligned with eleven other NPF
ORFs from a variety of insects, molluscs and one vertebrate species (Fig. 3). BOXSHADE
was used to shade in identical (black) or similar amino acid residues (grey) where a 60%
majority rule was applied. RhoprNPF was found to be most similar (53% similarity) to NPF
in other Hemipterans such as the cotton and pea aphid (A. gossypii and A. pisum) (Fig. 3).
Other wasp and bee species (Hymenoptera) were more similar to each other but overall
exhibited 30% similarity to the R. prolixus amino acid sequence. Even when comparisons
included H. sapiens, all NPF sequences analyzed had at least 21% of the ORF exhibiting
168
identical residues. The majority of these similarities in sequences are found in the peptide
coding region of the ORF. The glycine residue necessary for amidation of the peptide is
100% conserved across all 11 species. For the most part, all NPF sequences compared have a
conserved G(R/K)(P/A)R(F/Y) C-terminal ending, where arginine/lysine, proline/alanine and
phenylalanine/tyrosine are very similar in chemical structure.
3.3 Spatial expression of the RhoprNPF transcript in various tissues
The expression of the RhoprNPF mRNA was quantified in the CNS and various
peripheral tissues of fifth instar and adult R. prolixus. Overall, the RhoprNPF transcript
exhibits higher expression in fifth instars than adults. There is almost a 5-fold higher
transcript level in the CNS of fifth instars compared to adults (Fig. 4A). RhoprNPF mRNA is
predominantly present in the CNS as well as the reproductive tissues in fifth instar R.
prolixus with some expression in the dorsal vessel, Malpighian tubules, and the fat body (Fig.
4A). In the adult, the CNS and testis have transcript levels that are statistically higher than
the remaining parts of the reproductive tissues (Fig. 4B) (One Way ANOVA P<0.0001, post
hoc Tukey's test, * PCNS/T < 0.0001). Overall, RhoprNPF transcript is more abundant in the
male reproductive tissues than the female reproductive tissues (Fig. 4B).
3.4 Distribution of the RhoprNPF transcript in the CNS of fifth instar and adult R. prolixus
Fluorescent in situ hybridization was used to observe the distribution of the
RhoprNPF transcript throughout the CNS in both fifth instar and adult R. prolixus. Transcript
expression was seen in neurons of the brain and mesothoracic ganglionic mass (MTGM) of
fifth instars, and in the brain, prothoracic ganglion (PRO) and MTGM of adults (Figs 5, 6).
169
No expression was seen in the sub-oesophageal ganglion (SOG) in either fifth instars or
adults. Strickingly, in both developmental stages there was a group of 12 bilaterally paired
cell bodies located on the dorsal medial surface of the protocerebrum, most likely median
neurosecretory cells (Fifth instar: 40-50 µm in diameter; Adult: 30-40 µm in diameter). In
addition, there was 1 pair of anterior ventral neurons in the brain and 1 pair of medial ventral
neurons present in the MTGM that were similarly found in both fifth instars and adults (Figs
5B, 6B). The adult has additional, bilaterally paired neurons present in the PRO and MTGM
(Fig. 6).
3.5 Distribution of the RhoprNPF transcript in peripheral tissue
The RhoprNPF transcript expression was also found in cells associated with muscle
fibers in the hindgut of fifth instars and the lateral oviducts of adult females (Figs 5D,E,
6D,E). These cells were small, approximately 6-7µm in diameter. No expression was
observed in the anterior and posterior midgut of fifth instars, or across the entirety of the
digestive tract in adults. No expression was also found in the Malpighian tubules. Besides the
cells expressing RhoprNPF on the lateral oviducts, the remaining reproductive structures
including the ovaries, spermathecae and the bursa were void of staining.
3.6 The effects of various RFamides on egg production and egg-laying
An egg-laying assay was established to determine the effect of neuropeptides on egg-
laying rate and total egg production. Injection of corpus cardiacum extract was used as a
positive control since previous literature has shown that neurohormones from the MNSCs,
which are released from the corpus cardiacum, contain a factor that stimulates an increase in
170
egg production and egg-laying [13]. A truncated version of RhoprNPF was examined since in
locusts the truncated NPF appears to be the active peptide, and the 8 amino acid C-terminal
sequence of RhoprNPF has been isolated from R. prolixus [27]. On day 10, it was observed
that injection of CC extracts (0.5 CC per 2 µL ddH2O injected on day 6) increases the
number of eggs produced and laid compared to saline injected females (One Way ANOVA
P<0.0001, post hoc Tukey's test, *Plaid/made<0.001). There is no change in the number of eggs
found in the ovaries; however, when the total number of eggs (both produced and laid) was
analyzed there was a significant increase in egg production (Fig. 7B). Injection of the
truncated RhoprNPF also increased the number of eggs laid; however, females had a
significantly lower number of eggs in the ovaries compared to saline (One Way ANOVA
P<0.0001, post hoc Tukey's test, *PNPF<0.001). Other FLPs were also tested. GNDNFMRFa,
AKDNFIRFa, and short RhoprNPF produced similar results; indeed, AKDNFIRFa-injected
females produced and laid the highest number of eggs (One Way ANOVA P<0.0001, post
hoc Tukey's test, *PFIRFa<0.001). RhoprSK was without effect. On the other hand, injecting
females with RhoprMS or RhoprAST-2 resulted in both a decrease in eggs produced and
eggs laid (One Way ANOVA P<0.0001, post hoc Tukey's test, *PMS<0.001, *PAST-2<0.001).
There was also a significant decrease in the number of eggs found in the ovaries of
RhoprAST-2 injected females (One Way ANOVA P<0.0001, post hoc Tukey's test,
*PAST-2<0.001). In none of the treatments were eggs ever found in the bursa (Fig. 7B).
171
Figure 1: cDNA sequence and the deduced amino acid sequence of RhoprNPF in R.
prolixus. Nucleotide and amino acid sequence of the ORF of RhoprNPF, where numbers for
each sequence are provided on the left. The ORF starts with the ATG start codon and the
asterisk denotes the stop codon (TGA) (GenBank accession #: KT898124). The full ORF is
315 bp long and translates into 105 amino acid residues not including the stop codon. Exon-
exon boundaries are denoted by the downward solid arrowheads. The putative signal peptide
is underlined with a solid line at the beginning of the ORF, where the upward red arrowhead
signifies the cleavage site. The remaining propeptide is shaded in grey. A dibasic cleavage
site is present at the end of the mature peptide and is double-underline, and the square
represents the C-terminal glycine predicting amidation.
172
173
Figure 2: Exon-intron map of RhoprNPF. Graphical representation of splice sites where
the boxes represent exons. White boxes denote the 5' and 3' untranslated regions (UTRs) and
the gray boxes represent the open reading frame (ORF), based on splice site predictions and
BLAST analysis against the Rhodnius genome. The ORF contains a total of 2 exons (drawn
to scale). Numbers denote exon and intron sizes. Introns are not drawn to scale.
174
175
Figure 3: Amino acid sequence alignment of RhoprNPF, identified or predicted in 11
other species, using ClustalW. The putative signal peptide and propeptide are indicated in
red above the alignment, whereas the mature active peptide is underlined in green (below the
alignment). Residues that are 100% conserved across all 11 species are denoted with an
asterisk. A downward arrow denotes the glycine reside that is required for amidation.
Following the 60% majority rule, identical amino acids are shaded in black and similar
amino acids are shaded in gray. NPF/NPY-like sequences from R. prolixus (Rhopr), A.
gossyppi (Aphgo: HQ613405), A. pisum (Acypi: XM_001944830), N. vitripennis (Nasvi:
NM_001167721), A. rosae (Athro: XM_012410270), A. mellifera, (Apime:
NM_001167720), A. florea (Apifl: XM_012494898), A. dorsata, (Apido: XM_006609500),
L. gigantea, (Lotgi: XM_009065364), L. stagnalis (Lymst: AJ238276), A. californica
(Aplca: NM_001204706), and H. sapiens (Homsa: D13899) were used.
176
177
Figure 4: Spatial expression profile of the RhoprNPF transcript in different tissues of
fifth instar and adult R. prolixus as well as the adult male and female reproductive
tissue. (A) RhoprNPF transcript levels were measured in the CNS as well as various
peripheral tissues in fifth instar (black) and adult (white) R. prolixus. The fold-difference in
gene expression observed is relative to fifth instar and adult hindgut, which is similar in fifth
instar and adults. High expression of the transcript was found in the CNS as well as male and
female reproductive tissues. Data points are mean ± standard error of the mean (SEM) of 3
biological replicates. Abbreviations: CNS, central nervous system; SG, salivary gland; DV,
dorsal vessel; FG, foregut; AMG, anterior midgut; PMG, posterior midgut; HG, hindgut;
MT, Malpighian tubules; FB, fat bodies; O, ovaries; T, testes. (B) RhoprNPF transcript levels
were also observed in adult male and female reproductive tissues. The RhoprNPF transcript
is more abundant in the male reproductive tract compared to the female (One Way ANOVA
P<0.0001, post hoc Tukey's test, * PT < 0.0001). High expression of the transcript was found
in the CNS and testes (One Way ANOVA P<0.0001, post hoc Tukey's test, * PCNS/T <
0.0001), as well as oviduct/spermathecae, and seminal vesicle/ejaculatory duct. Data points
are mean ± standard error of the mean (SEM) of 3 biological replicates. Abbreviations: CNS,
central nervous system; O, ovaries; OV/SP, oviducts and spermathecae; B/CG, bursa and
cement gland; T, testes; VD/AG, vas deferens and accessory glands; SV/ED, seminal vesicle
and ejaculatory duct.
178
179
Figure 5: Confocal images of RhoprNPF transcript expression in cell bodies of 5th
instar
R. prolixus using fluorescent in situ hybridization. (A) A stacked image showing the 12
stained dorsal pairs of neurons in the brain, (B) as well as 1 ventral pair of neurons in the
mesothoracic ganglionic mass (MTGM). (C) A schematic map of the CNS outlining the
distribution of all stained neurons that exhibit RhoprNPF transcript expression, where
dorsally located neurons are represented by closed circles and ventral neurons are open
circles. Scale bar for map represents 200 µm. (D) A 10X and (E) 20X stacked image showing
stained cell bodies in the 5th
instar hindgut. Scale bars for confocal images represent 100 µm.
180
181
Figure 6: Confocal images of RhoprNPF transcript expression in cell bodies of adult R.
prolixus using fluorescent in situ hybridization. (A) A stacked image showing the 12
stained dorsal pairs of neurons in the brain. (B) Staining of paired neurons in the
mesothoracic ganglionic mass (MTGM) with 1 ventral pair in the center and 8 clusters of
dorsal neurons (within the dashed circles). (C) A schematic map of the CNS outlining the
distribution of all stained neurons that exhibit RhoprNPF transcript expression, where
dorsally located neurons are represented by closed circles and ventral neurons are open
circles. Scale bar for map represents 200 µm. (D) A magnified image showing the posterior
clusters of stained neurons. (E) A 20X and 40X stacked image showing stained cell bodies on
the muscle fibers of the lateral oviducts of the adult female reproductive tract. Scale bars for
confocal images represent 100 µm, with the exception of the 40X confocal image with a
50µm scale bar.
182
183
Figure 7: Number of eggs produced or laid per fed, mated female R. prolixus after
injection of CC extract (0.5 CC per 2 µL ddH2O) or a variety of neuropeptides (final
haemolymph concentration of 5 X 10-5
M). (A) Experimental protocol of the egg laying
assay (see materials and methods). (B) Number of eggs produced or laid per female after
injection with saline, CC extract or a neuropeptide. Females injected with truncated
RhoprNPF, GNDNFMRFamide, AKDNFIRFamide, short RhoprNPF or CC extracts
produced and laid more eggs compared to saline injected insects (One Way ANOVA P<0.0001,
post hoc Tukey's test, * P < 0.001); whereas females injected with RhoprMS and RhoprAST-2
produced and laid fewer eggs (One Way ANOVA P<0.0001, post hoc Tukey's test, * P < 0.001).
Females treated with RhoprSK exhibited no effect when compared to saline injected. Data
points are mean ± standard error of the mean (SEM) of 8 replicates.
184
185
4. Discussion
The NPF gene has been cloned and characterized in various invertebrates, including
the flatworm [18], mollusks [8 and 29], mosquitoes [10] and the termite [25]. The RhoprNPF
gene is composed of 3 exons and 2 introns with the entire ORF spanning two exons with only
the last two amino acid residues of the peptide - RF on the second exon. This is similar to A.
gambiae, M. expansa and R. flavipes, where the exon boundary precedes the RFG sequence.
The glycine residue would be processed to form an amidated C-terminus [9, 16 and 25]. The
location of the intron in the coding region is highly conserved among invertebrates [5 and
16]. No splice variants of the RhoprNPF cDNA sequence were cloned.
The RhoprNPF ORF contains a signal peptide at the N-terminus responsible for
translocation of the prepropeptide to the endoplasmic reticulum membrane. The putative
signal peptide of RhoprNPF is composed of 22 amino acids, and most residues have
hydrophobic properties. The hydrophobic residues are believed to interact with translocation
channels as well as the membrane to allow for recognition and cleavage by signal peptidase
enzymes at the 23rd
residue [28]. Several of these hydrophobic properties within the signal
peptide are conserved across arthropod species. The conserved propeptide would undergo a
second cleavage at the dibasic cleavage site (KR) by carboxypeptidases, followed by post-
translational modification, resulting in an amidated RhoprNPF of 42 amino acids in length.
NPF is the longest bioactive FLP observed to date among invertebrates and is highly
conserved, with approximately 60% similarity in sequences. The last 9 amino acids of the
full peptide have been shown to be biologically active [2, 37 and 38], and this truncated NPF
has been found in locusts [37]. Similarly, a truncated RhoprNPF has also been isolated and
186
sequenced de novo, and it consists of the C-terminal 8 amino acids [27]. All NPF sequences
contain the conserved C-terminal ending G(R/K)(P/A)R(F/Y) [22].
NPF transcript expression has been found in the CNS and gut of insects [9 and 25]
and Van Wielendaele et al. (2013a) found expression to be the highest in the optic lobes,
brain and midgut of adult male and female S. gregaria. Previous studies have found in situ
hybridization to stain neurons in the brain of D. melanogaster [2]. The RhoprNPF mRNA
expression observed in neurons of R. prolixus adult CNS matches those previously identified
using a polyclonal DrmNPF antiserum (pre-absorbed in GDRARVRFamide) in R. prolixus
[10]. The group of 12 dorsal bilaterally-paired cells in the protocerebrum as well as the
ventral pair of cells in the brain are stained by both in situ hybridization as well as
immunohistochemistry [10]. The dorsal anterior bilateral pairs and ventral posterior bilateral
pairs of cells in the PRO are also stained by immunohistochemistry [10], as are the 6 clusters
of cells in the MTGM [10]. This suggests that these neurons not only synthesize the mRNA
for RhoprNPF but have the cell machinery required for translation and synthesis of
RhoprNPF.
NPF mRNA has been also found within midgut endocrine cells of Dipteran species
such as D. melanogaster [2]. However, expression of RhoprNPF was not seen in endocrine
cells of either the fifth instar or adult midgut of R. prolixus. Similarly, RhoprNPF in midgut
endocrine cells was not observed by Gonzalez and Orchard (2008) using
immunohistochemistry. In this study we found RhoprNPF mRNA expressed in cells of the
hindgut in fifth instar R. prolixus. Gonzalez and Orchard (2008) did not observe any NPF-
like immunoreactivity in cells of the hindgut but they did find axons containing NPF-like
immunoreactivity at the fifth instar hindgut and were able to observe an inhibition of the
187
amplitude and frequency of spontaneous hindgut contraction in R. prolixus after the addition
of NPF [11].
R. prolixus instars experience a blood meal that is 10 times their original mass. This
feed is essential for development and the process of molting into the next instar. NPF has
been classified as a brain-gut peptide throughout literature [see 22]. Interestingly in R.
prolixus there is a 5-fold higher transcript expression in the CNS of fifth instars in
comparison to adults. High RhoprNPF expression is also found in the undeveloped ovaries
and testis of fifth instars. Although the transcript is present in the oviducts/spermathecae of
females, there seems to be an overall greater abundance of RhoprNPF expression within male
compared to female reproductive tissue of R. prolixus. Similarly, with regard to NPF
involvement in the male reproductive system, Van Wielendaele et al. (2013b) found that the
injection of trNPF in male locusts resulted in heavier testes and seminal vesicles, as well as
increased courtship behaviour. Injection of trNPF in males that mated with untreated females
also resulted in larger egg pod size as well as greater viability [38].
This is the first study to look at NPF expression in adult reproductive tissue of any
arthropod. Expression appears in cells present along the longitudinal muscle fibers of the
lateral oviducts of R. prolixus. Although we found that truncated RhoprNPF does not affect
oviduct muscle contraction in R. prolixus (unpublished), we found RhoprNPF mRNA present
in what appears to be cells on the female lateral oviduct. Insect lateral oviducts are generally
composed of both muscle cells and epithelial cells containing secretion granules on the
lumen side of the cell [3]. Macromolecules are synthesized in these cells and secreted into the
oviduct via granules. It has been hypothesized that these secretions along with the oviduct’s
own spontaneous contractions aid the egg in sliding down the muscular tube [17]. RhoprNPF
188
in cells of the oviducts could possibly play a sensory role involved in signaling the presence
of an egg passing through the common oviduct and perhaps altering the level of secretion
from these epithelial cells via a feedback mechanism. Several studies have already suggested
a role for trNPF in oocyte maturation and development in female locusts [4 and 38]. Van
Wielendaele et al. (2013c) also discovered that daily injections of trNPF resulted in not only
an increase in oocyte size, but an increase in ovarian ecdysteroid concentrations in S.
gregaria. Therefore, a possible function of RhoprNPF on egg development in R. prolixus
may be that it is involved in regulating the production of ecdysteroids in the mature ovary.
Future work is currently being carried out to determine if the RhoprNPF receptor is present
in the ovary of R. prolixus and if it might be in the signaling pathway controlling egg
production. Ruegg et al. (1981) also found that ecdysteroid levels in the haemolymph are
responsible for the release of a myotropic ovulation hormone from the median neurosecretory
cells of mated R. prolixus females. Therefore, RhoprNPF from either the MNSCs of the brain
or from the cells of the oviduct could influence ecdysteroid secretion from the ovary which in
turn leads to the release of a myotropic hormone from the MNSCs to influence ovulation.
Alternatively, RhoprNPF might be the myotropic ovulation hormone identified by Ruegg et
al (1981) since it is located in MNSCs of the same size as those shown to contain the
ovulation hormone. Further studies are needed to determine the specific role that NPF plays
in oogenesis and egg-laying in R. prolixus.
Sevala et al. (1992) have found that a high molecular weight FLP is present during
peaks of egg-laying in R. prolixus. Moreover, Kriger and Davey (1983) showed that a
potential ovulation hormone called myotropin is present in MNSCs of R. prolixus that are
approximately 40µm in diameter. These MNSCs have previously been shown to be
189
responsible for inducing ovulation in R. prolixus [13]. Some of the 12 bilaterally paired cells
identified in this study are of similar diameter and shape to the MNSCs previously identified
by Kriger and Davey (1983). These findings taken together suggest that FLPs such as
RhoprNPF may play a role in ovulation. The effect of a representative neuropeptide from
each group of the FLPs was therefore tested for their ability to alter egg production and/or
egg-laying. These include long NPF, short NPF, extended FM/IRFamides, sulfakinins, and
myosuppressin. In addition, allatostatin was tested as an outgroup. Truncated RhoprNPF and
CC extract injection resulted in a depletion of eggs present in the ovaries, and a substantial
increase in the number of eggs being laid. This implies that RhoprNPF works in the ovaries
to increase the rate of ovulation resulting in a depletion of eggs found in the ovaries and a
substantial increase in the eggs being oviposited. The similar effects observed by CC extracts
imply the presence of RhoprNPF in the CC, which is to be expected since the MNSCs release
their product via this neurohaemal organ. Interestingly, short RhoprNPF, GNDNFMRFa and
AKDNFIRFa all increase the total eggs laid per female without affecting the number of eggs
present in the ovaries. This implies that these neuropeptides may not have an effect on the
rate of egg-laying but actually stimulate oogenesis, thus producing more eggs that are then
laid at the expected rate. AKDNFIRFamide also exhibited a significantly greater increase in
egg production compared to GNDNFMRFamide. Interestingly, these results match previous
findings where AKDNFIRFamide had a greater stimulatory effect on spontaneous R. prolixus
oviduct contractions when compared to GNDNFMRFamide [33]. Conversely, injection of
RhoprMS and RhoprAST-2, both previously identified as myoinhibitors [31 and 34], resulted
in significant decreases in the number of eggs laid, possibly inhibiting the process of
oogenesis as well.
190
Although the MNSCs contain RhoprNPF, it is likely that other FLPs might also be
present in these cells. Thus, the ovaries may be under the control of multiple FLPs that
eventually result in the stimulation of oogenesis, ovulation and oviposition. Current work is
being done to clone the cDNA of FLPs and their G-protein coupled receptors to more finely
dissect these neuroendocrinological changes.
5. Conclusions
In conclusion, the RhoprNPF cDNA has been cloned and comparison with other
arthropods shows it is highly conserved. The RhoprNPF transcript is present in MNSCs in
the brain as well as in cells on the lateral oviduct of female adult R. prolixus. RhoprNPF, as
well as other FLPs would appear to be involved in the regulation of oogenesis, ovulation and
oviposition in the blood-gorging hemipteran, R. prolixus.
191
6. Glossary
NPY – neuropeptide Y
NPF – neuropeptide F
FLP – FMRFamide-like peptide
cDNA – complimentary deoxyribonucleic acid
CNS – central nervous system
CC – corpus cardiacum
MNSC – median neurosecretory cell
GPCR – G-protein coupled receptor
ORF – open reading frame
GS – gene specific
PCR – polymerase chain reaction
7. Author Contributions
LS performed all experiments in this study, analyzed data and wrote manuscript. ABL edited
the manuscript and provided guidance, support and feedback throughout the process.
8. Funding
This research was funded by Natural Sciences and Engineering Research Council of Canada
grants to ABL.
192
9. References
[1] Ampleford, EJ and Davey, KG. Egg laying in the insect Rhodnius prolixus is timed in a
circadian fashion. J Insect Physiol 1989;35:183-7.
[2] Brown, MR, Crim, JW, Arata, RC, Cai, HN, Chun, C, Shen, P. Identification of a
Drosophila brain-gut peptide related to the neuropeptide Y family. Peptides
1999;20:1035-42.
[3] Büning, J. The ovary of ectognatha, the Insecta s str. In: The insect ovary: ultrastructure,
previtellogenic growth and evolution. New York: Chapman & Hall; 1994, p. 91-2.
[4] Cerstiaens, A, Benfekih, L, Zouiten, H, Verhaert, P, De Loof, A and Schoofs, L. Led-
NPF-1 stimulates ovarian development in locusts. Peptides 1999;20:39-44.
[5] Christie, AE, Chapline, MC, Jackson, JM, Dowda, JK, Hartline, N, Malecha, SR and
Lenz, PH. Identification, tissue distribution and orexigenic activity of neuropeptide F
(NPF) in panaeid shrimp. J Exp Biol 2011;214:1386-96.
[6] Davey, KG. Copulation and egg-production in Rhodnius prolixus: the role of the
spermathecae. J Exp Biol 1965;42:373-8.
[7] Davey, KG. Hormonal integration of egg production in Rhodnius prolixus. Am Zool
1993;33:397-402.
[8] de Jong-Brink, M, ter Maat, A and Tensen, CP. NPY in invertebrates: molecular answers
to altered functions during evolution. Peptides 2001;22:309-15.
[9] Garczynski, SF, Crim, JW and Brown, MR. Characterization of neuropeptide F and its
receptor from the African malaria mosquito, Anopheles gambiae. Peptides 2005;26:99-
107.
193
[10] Gonzalez, R and Orchard, I. Characterization of neuropeptide F-like
immunoreactivity in the blood-feeding hemipteran, Rhodnius prolixus. Peptides
2008;29:545-58.
[11] Gonzalez, R and Orchard, O. Physiological activity of neuropeptide F on the hindgut
of the blood-feeding hemipteran, Rhodnius prolixus. J of Insect Sci 2009;9:15.
[12] Huang, Y, Crim, JW, Nuss, AB and Brown, MR. Neuropeptide F and the corn
earworm, Helicoverpa zea: a midgut peptide revisited. Peptides 2001;32:483-92.
[13] Kriger, FL and Davey, KG. Ovulation in Rhodnius prolixus Stål is induced by an
extract of neurosecretory cells. Can J Zoolog 1983;61:684-6.
[14] Lange, AB. The female reproductive system and control of oviposition in Locusta
migratoria migratorioides. Can J Zoolog 2009;87:649-61.
[15] Lee, DH, Paluzzi, JP, Orchard, I and Lange, AB. Isolation, cloning and expression of
the Crustacean cardioactive peptide gene in the Chagas' disease vector, Rhodnius
prolixus. Peptides 2011;32:475-82.
[16] Mair, GR, Halton, DW, Shaw, C and Maule, AG. The neuropeptide F (NPF)
encoding gene from the cestode, Moniezia expansa. Parasitology 2000;120:71-7.
[17] Masetti, M, Fabiani, O and Giorgi, F. Secretory activity of the oviductal epithelium of
the stick insect Carausius morosus (Insecta, Phasmatodea). Boll Zool 1994;61:105-13.
[18] Maule, AG, Shaw, C, Halton, DW, Thim, L, Johnston, CF, Fairweather, I and
Bunchanan, KD. Neuropeptide F: a novel parasitic flatworm regulatory peptide from
Moniezia expansa (Cestoda: Cyclophyllidea). Parasitology 1991;102:309-16.
194
[19] Middleton, CA, Nongthomba, U, Parry, K, Sweeney, ST, Sparrow, JC and Elliott, CJ.
Neuromuscular organization and aminergic modulation of contractions in the Drosophila
ovary. BMC Biol 2006;4, 17.
[20] Nässel, DR. Neuropeptides in the insect brain: a review. Cell Tissue Res 1993;273:1-
29.
[21] Nässel, DR. Neuropeptides in the nervous system of Drosophila and other insects:
multiple roles as neuromodulators and neurohormones. Prog Neurobiol 2002;68:1-84.
[22] Nässel, DR and Wegener, C. A comparative review of short and long neuropeptide F
signaling in invertebrates: any similarities to vertebrate neuropeptide Y signaling?
Peptides 2011;32:1335-55.
[23] Nässel, DR and Winthner, AME. Drosophila neuropeptides in regulation of
physiology and behaviour. Prog Neurobiol 2010;92:42-104.
[24] Nuss, AB, Forschler, BT, Crim, JW and Brown, MR. Distribution of neuropeptide F-
like immunoreactivity in the Eastern Subterranean termite, Reticulitermes flavipes. J
Insect Sci 2008;8:1-18.
[25] Nuss, AB, Forschler, BT, Crim, JW, TeBrugge, V, Pohol, J and Brown, MR.
Molecular characterization of neuropeptide F from the eastern subterranean termite
Reticulitermes flavipes (Kollar) (Isoptera: Rhinotermitidae). Peptides 2010;31:419-28.
[26] Okasha, AYK, Hassanein, AMM and Farahat, AZ. Effects of sub-lethal high
temperature on an insect, Rhodnius prolixus (Stål.). J Exp Biol 1970;53:25-36.
[27] Ons, S, Sterkel, M, Diambra, L, Urlaub, H and Rivera-Pomar, R. Neuropeptide
precursor gene discovery in the Chagas disease vector Rhodnius prolixus. Insect Mol Biol
2011;20:29-44.
195
[28] Petersen, TN, Brunak, S, von Heijne, G and Nielsen, H. SignalP 4.0: discriminating
signal peptides from transmembrane regions. Nat Methods 2011;8:785-6.
[29] Rajpara, SM, Garcia, PD, Roberts, R, Eliassen, JC, Owens, DF, Maltby, D, Myers,
RM and Maier, E. Identification and molecular cloning of neuropeptide Y homolog that
produces prolonged inhibition in Aplysia neurons. Neuron 1992;9:505-13.
[30] Reese, MG, Eeckman, FH, Kulp, D and Haussler, D. Improved splice site detection in
Genie. J Comp Biol 1997;4:311-23.
[31] Robertson, L, Rodriguez, EP and Lange, AB. The neural and peptidergic control of
gut contraction in Locusta migratoria: the effect of an FGLa/AST. J Exp Biol
2012;215:3394-402.
[32] Ruegg, RP, Kriger, FL, Davey, KG and Steel, CGH. Ovarian ecdysone elicits release
of a myotropic ovulation hormone in Rhodnius (Insecta: Hemiptera). Int J Inver Rep
1981;3:357-61.
[33] Sedra, L and Lange, AB. The female reproductive system of the kissing bug,
Rhodnius prolixus: arrangements of muscles, distribution and myoactivity of two
endogenous FMRFamide-like peptides. Peptides 2014;53:140-7.
[34] Sedra, L, Haddad, AS and Lange, AB. Myoinhibitors controlling oviduct contraction
within the female blood-gorging, Rhodnius prolixus. Gen Comp Endocr 2015;211:62-8.
[35] Sevala, VL, Sevala, VM, Davey, KG and Loughton, BG. A FMRFamide like peptide
is associated with the myotropic ovulation hormone in Rhodnius prolixus. Arch Insect
Biochem 1992;20:193-203.
[36] Stanek, DM, Pohl, J, Crim, JW and Brown, MR. (2002). Neuropeptide F and its
expression in the yellow fever mosquito, Aedes aegypti. Peptides 2002;23:3262-7.
196
[37] Van Wielendaele, P, Dillen, S, Zels, S, Badisco, L and Vanden Broeck, J. Regulation
of feeding by neuropeptide F in the desert locust, Schistocerca gregaria. Insect Biochem
Mol 2013a;43:102-14.
[38] Van Wielendaele, P, Wynant, N, Dillen, S, Zels, S, Badisco, L and Vanden Broeck, J.
Neuropeptide F regulates male reproductive processes in the desert locust, Schistocerca
gregaria. Insect Biochem Mol 2013b;43:252-9.
[39] Van Wielendaele, P, Wynant, N, Dillen, S, Badisco, L, Marchal, E and Vanden
Broeck, J. In vivo effect of neuropeptide F on ecdysteroidogenesis in adult female desert
locusts (Schistocerca gregaria). J Insect Physiol 2013c;59:624-30.
[40] Wigglesworth, VB. Reproductive System. In: The principles of insect physiology,
New York: Halsted Press; 1972, p. 700-7.
197
10. Acknowledgments
We would like to thank Nikki Sarkar for maintaining the insect colony and Meet
Zandawala for training in molecular biology.
198
Chapter 6:
Characterization of a long neuropeptide F (NPF) receptor, a
potential regulator of egg production in the Chagas vector
Rhodnius prolixus
199
Abstract
The process of oogenesis and ovulation is regulated by many factors such as meal
frequency, matedness and various neuropeptides. Many neuropeptides are ligands to G-
protein coupled receptors (GPCRs). In this study, I have cloned and characterized the long
neuropeptide F receptor of the blood-feeding hemipteran, Rhodnius prolixus (RhoprNPFR).
Approximately 70% of the receptor open reading frame (ORF) is identical to those of other
hemipteran NPFRs. RhoprNPFR has 7 conserved transmembrane domains, 2 cysteine
residues in the 2nd
and 3rd
extracellular loops that likely form a disulfide bond integral for
maintaining the structure of the receptor, a 100% conserved DRY motif after the third
transmembrane domain, and an 8th
α-helix that is slightly hydrophobic and associates with
the membrane. All of these characteristics are typical of class A GPCRs – rhodopsins. The
receptor was predominantly expressed in the CNS and gut of both fifth instar and adult R.
prolixus. Using fluorescent in situ hybridization (FISH) we were able to identify 6
bilaterally-paired large median neurosecretory cells (approximately 30µm in diameter) that
express RhoprNPFR mRNA. We also found receptor transcript present in closed endocrine
cells in the anterior midgut of fifth instars, as well as in putative pre-follicular cells present in
the germarium, and between developing oocytes. This implies that the RhoprNPFR plays a
role in egg production and/or egg development.
200
Introduction
Rhodnius prolixus are oviparous organisms, in which the first instars only hatch after
the egg has been laid. Oogenesis, the process of egg production, is regulated by the frequency
and quality of a female blood meal in blood-feeding insects such as R. prolixus (Patchin and
Davey, 1968), and matedness has been shown to affect the rate of egg production (Davey,
2007). Ovulation and egg-laying are physiological processes that are highly coordinated and
regulated in many insect species (Wigglesworth, 1972; Middleton et al., 2006; Lange, 2009;
Nässel and Winthner, 2010).
There are three types of ovarioles among insects: panoistic, polytrophic and
telotrophic. Hemipterans have been shown to possess telotrophic ovarioles. Telotrophic
ovarioles are composed of 4 major structural regions: terminal filament, germarium,
vitellarium and ovariole stalk. Each of the 7 ovarioles in R. prolixus is connected to the body
wall by the terminal filaments that extend from a muscular sheath around the ovarioles
(Sedra and Lange, 2014). At the apex of each ovariole is the germarium, also known as the
tropharium, where there are densely packed primordial oogonia that differentiate into either
oocytes or trophocytes (nurse cells). All trophocytes are connected to an originating trophic
core through elongated intercellular bridges (see Chapman et al., 2013; Huebner, 1981). Each
oocyte is associated with two different types of accessory cells: follicular cells and nurse
cells (Huebner and Anderson, 1972a). Follicular cells form a layer around the oocyte and are
able to provide small molecule nourishment through gap-junctions (Huebner and Anderson,
1972a), whereas nurse cells tend to cluster in the germarium and provide nutrients in the
form of mitochondria and cytoplasmic components such as protein and RNA through a
nutritive cord (Huebner and Anderson, 1972b; Lutz and Huebner, 1980). As each oocyte
201
grows and develops into an ovum, the crisscrossed fine muscle fibers that make up the sheath
around the ovarioles contract and push the developing ovum down the ovariole into the third
region, the vitellarium, forming a chain of ova in different developmental stages
(Wigglesworth, 1972; Sedra and Lange, 2014). Once the terminal oocyte is fully developed,
the follicular cells form a hard chorion encompassing the mature egg with micropyles at the
anterior end by which spermatozoa enter to fertilize the egg during oviposition. Lastly, the
mature egg travels through the last and fourth region, the ovariole stalk and into the lateral
oviduct allowing for ovulation (Wiggelsworth, 1962; Sedra and Lange, 2014). Forceful
muscular contractions by the circular and longitudinal muscle fibers of the lateral oviduct
allow the egg to move into the common oviduct and be fertilized by spermatozoa from the
spermathecae (Sedra and Lange, 2014). Very quickly after entering the bursa, the bursa
contracts and the egg is laid along with secretions from the cement gland fixing the egg to a
substrate.
Neuropeptides and their receptors regulate many physiological processes such as
development, metabolism and reproduction. Many of these functions are modulated by G-
protein coupled receptors (GPCRs), the largest and most diverse group of membrane
receptors (Iismaa and Shine, 1992). Evolutionary conservation has been deduced for many
ligand-receptor pairs, including the vertebrate neuropeptide Y (NPY; Nässel and Wegener,
2011). The orthologous neuropeptide and receptor among invertebrates is neuropeptide F
(NPF; Nässel and Wegener, 2011). Recently, the NPF cDNA has been cloned in R. prolixus,
and the neuropeptide was determined to be 42aa in length, and the fragment composed of the
last 8 amino acids (truncated RhoprNPF) was found to be biologically active (Chapter 5).
This was also similarly observed in Schistocerca gregaria when regulating food intake and
202
body weight (Van Wielendaele et al., 2013a). The RhoprNPF mRNA transcript was found in
the central nervous system (CNS), as well as in cells along the longitudinal muscle fibers of
the lateral oviduct (Chapter 5). Although RhoprNPF did not have an effect on oviduct muscle
contraction (unpublished), recently we have been able to show that it is one of the
neuropeptides responsible for regulating egg production (Chapter 5). The first NPFR was
cloned in Drosophila melanogaster (Garczynski et al., 2002). DmNPFR1 transcript was
found in neurons in the CNS of late third instar larva as well as in endocrine cells in the
midgut using in situ hybridization techniques (Garczynski et al., 2002). NPFR was also
characterized in Anopheles gambiae and RT-PCR was able to show that Ang-NPFR is
present in head, thorax and abdomen all life stages of A. gambiae (Garczynski et al., 2005).
Lastly, NPFR was cloned in the pond snail, Lymnaea stagnalis; however it was first
described as an NPY receptor (Tensen et al., 1998). Other than these studies, very little is
known about the NPF receptor in molluscs or arthropods. Moreover, the NPF receptor has
never been knocked down in any arthropod species to date.
In this study, we cloned the NPFR cDNA sequence in R. prolixus and determined the
transcript spatial expression in fifth instars and adults. Quantitative PCR (qPCR) was also
used to determine the presence of NPFR in the female and male reproductive tracts. NPFR
expression was visualized in neurons of the CNS, cells in the ovaries and endocrine cells
along the gut using fluorescent in situ hybridization (FISH).
Materials and Methods
Animals
Fifth instar and adult R. prolixus were obtained from a colony fed on defibrinated
rabbit blood (Hemostat Laboratories, Dixon, CA, USA; supplied by Cedarlane, Burlington,
203
ON, Canada). A blood meal is required for molting and sexual maturation. The colony was
maintained in a dark incubator at 25°C and 60% humidity. However, experimental insects
were kept in a separate incubator with a 12h: 12h light/dark cycle at 28°C and 50% humidity.
Chemicals
Truncated RhoprNPF (AVAGRPRFamide) was purchased as powders from
GenScript (Piscataway, NJ, USA). Powders were dissolved in double-distilled water and
stored at -20°C. All gene specific primers and probes used were designed with Geneious
v.4.7.6 (http://www.geneious.com/) and purchased as a powder from Sigma-Aldrich
(Oakville, Ontario, Canada) and was made up in RNA-free double-distilled water and stored
at -20°C.
Cloning of the RhoprNPFR cDNA sequence
The previously characterized amino acid sequence of the long neuropeptide F
receptor from the (Dipteran) mosquito A. gambiae (Ang-NPFR: AY579078) was used to
screen the R. prolixus genome via a BLAST search (Basic Local Alignment Search Tool)
(Garczynski et al., 2005). All in silico work was completed in Geneious, and a putative
NPFR sequence was defined (Supercontig: GL563029) in the R. prolixus genome. Gene
specific primers (GSP) were designed to clone the open reading frame (ORF) (Table 1A).
Predicted splice sites were taken into consideration when designing any forward or reverse
primer (http://www.fruitfly.org/seq_tools/splice.html; Reese et al., 1997). Amplification and
cloning conditions were essentially the same as previously described in Chapter 5. Size,
concentration and purity of all amplified products were checked on a 1.2% agarose gel
stained with RedSafeTM
nucleic acid staining solution (iNtRON Biotechnology, New Jersey,
204
USA) and a Nanodrop UV spectrophotometer (Thermo Scientific, Wilmington, Delaware,
USA). Samples were then sent for sequencing at the Hospital for Sick Children, Toronto
(www.tcag.ca/facilities/dnaSequencingSynthesis.html) (MaRS Centre, Toronto, Ontario,
Canada). Sequencing results were then further analyzed using the Geneious software.
Modified 5' and 3' rapid amplification of cDNA ends (RACE) was used to clone the
ends of the ORF as well as a portion of the 5’ and 3’ untranslated region (UTR) (Table 1C).
The fifth instar CNS cDNA library was used as a template, and 5' RACE GS reverse primers
as well as library plasmid forwards were used to extend the 5' end of the sequence. This was
similarly carried out for the 3’ end. These products were then used as the cDNA template for
further nested PCRs as previously described in Chapter 5.
To clone the full receptor, GSPs were designed at the start and end of the complete
ORF, and products were sent for sequencing to confirm that the full receptor has been cloned
correctly (Table 1D). An iProofTM
High fidelity DNA polymerase (BioRad, Ontario, Canada)
was used to proofread while amplifying and confirmed the correct full sequence of the
RhoprNPFR.
Sequence Analysis of the RhoprNPF receptor
The complete cloned nucleotide sequence was BLAST searched against the original
R. prolixus genome using the Geneious software. All contigs were then aligned, and the size
of the introns was determined. Splice-sites at intron-exon boundaries were confirmed using
NNSPLICE 0.9 (http://www.fruitfly.org/seq_tools/splice.html; Reese et al., 1997). N-linked
glycosylation sites on the N-terminal extracellular chain were predicted using the NetNGlyc
1.0 server (http://www.cbs.dtu.dk/services/NetNGlyc/; Blom et al., 2004). The TMHMM
server v. 2.0 (TransMembrane Hidden Markov Model) was used to determine the
205
hydrophobic transmembrane helical domains within the receptor
(http://www.cbs.dtu.dk/services/TMHMM/). These predictions were then confirmed on
Geneious using the ‘Predict Transmembrane Region’ plugin under Tools. The DiANNA1.1
web server was used to predict potential cysteine residues within the ORF that can form a
disulfide bond (http://clavius.bc.edu/~clotelab/DiANNA/). Lastly, to predict potential
phosphorylation sites on the intracellular loops and C-terminal cytoplasmic chain, the
NetPhos 2.0 server was utilized (http://www.cbs.dtu.dk/services/NetPhos/; Blom et al.,
1999). To gain a fuller understanding of the correct folding and final tertiary structure of this
protein, SWISS-MODEL software was used to match the conserved portions of the cloned
RhoprNPFR against previously characterized sequences with known tertiary structures
(http://swissmodel.expasy.org; Biasini et al., 2014).
Multiple Sequence Analysis of NPFR
Multiple arthropod and vertebrate cloned and predicted sequences of NPFR and
NPYR were aligned against the amino acid sequence of RhoprNPFR using ClustalW server
(sequences defined in the figure captions;
http://www.ch.embnet.org/software/ClustalW.html). The alignment was then imported onto
the BOXSHADE 3.21 server (http://www.ch.embnet.org/software/BOX_form.html), and
conserved sequences were shaded so that identical amino acid residues were represented in
black and amino acids with similar chemical characteristics in gray following the 60%
majority rule. Residues that were 100% conserved across all 14 species were manually
determined and denoted by an asterisk.
206
All FASTA sequences (NPF and NPFR separately) were imported into MEGA 6.06
(Molecular Evolutionary Genetics Analysis; http://www.megasoftware.net/; Tamura et al.,
2013) and the ‘Find Best DNA/Protein Model’ feature of the software was used to determine
the most accurate mode of analysis. An unrooted phylogenetic tree was generated using the
Maximum Likelihood method (L+G Model) that takes all possible tree topology and branch
lengths into account. Statistical bootstrap values were determined based on 500 replicates.
RNA extraction and cDNA synthesis of the RhoprNPFR transcript in various tissues
CNS (brain, prothoracic ganglion, mesothoracic ganglionic mass) and peripheral
tissues (salivary gland, dorsal vessel, foregut, anterior midgut, posterior midgut, hindgut,
Malpighian tubules, fat body, ovaries and testes) of fifth instar and adult R. prolixus were
dissected and stored in RNA later solution (Ambion, Carlsbad, California, USA). Similar
dissections were completed for adult CNS, as well as reproductive tissues of females
(ovaries, oviduct/spermathecae and bursa/cement gland) and males (testes, vas
deferens/accessory glands and seminal vesicle/ejaculatory duct). There were three biological
replicates for every sample. Tissues were then processed as previously described in Chapter 5
using the PureLink® RNA mini-kit (Ambion, Carlsbad, California, USA). The purity and
concentration of each RNA sample was determined by the Nanodrop. RNA extracted from
these dissections was used for the spatial profiling of RhoprNPFR. Approximately 200ng of
the total RNA of each sample was used to synthesize cDNA using iScriptTM
Reverse
Transcription Supermix RT-qPCR (Bio-Rad Laboratories Ltd., Mississauga, Ontario,
Canada). The product was then diluted 10-fold and used as cDNA template for quantitative
PCR (qPCR).
Real-Time qPCR of RhoprNPF across various tissues
207
All spatial profiling experiments were performed on an MX3005P Quantitative PCR
system (Stratagene, Mississauga, Ontario, Canada) as described in Chapter 5. GSPs were
designed over exon/exon boundaries to determine the transcript level of the receptor in each
sample (Table 2A). Three reference genes were used for analysis (ribosomal protein 49, β-
actin and α-tubulin) (Table 2B). Efficiencies for all primers used were determined, and the
ΔΔCt method of analysis was used to determine the fold-differences of RhoprNPFR
expression in the tissues relative to testis in fifth instars and adults. The data were then
reanalyzed, and the fold-difference of receptor expression in each tissue was calculated in
adults relative to fifth instars. This was to determine if there was an increase or decrease in
NPFR expression between the two developmental stages. A fold-difference of 1 implied that
there was no change in receptor mRNA expression.
With a particular interest in the adult reproductive tract, transcript expression of
RhoprNPFR was determined throughout the adult male and female reproductive tract relative
to ovaries. All spatial profiling samples were run using SsoFastTM EvaGreen® Supermix
with Low ROX (BIO-Rad Laboratories Ltd., Mississauga, Ontario, Canada). Data were
normalized to the three chosen reference genes for all tissues sampled. Two technical
replicates were performed (as well as a no template control) for each biological replicate.
Fluorescent in situ hybridization (FISH)
Sense (T7-NPFR-FOR1 and iNPFR-REV1) and antisense (NPFR-FOR1 and T7-
iNPFR-REV1) gene specific primers were designed within the RhoprNPFR ORF to
synthesize the cDNA template for the RNA probes used for fluorescent in situ hybridization
(Table 3A and B). A DIG/RNA labelling kit (Roche Applied Science, Mannheim, Germany)
208
was used to transcribe approximately 1µg of the forward and reverse probes. DNase I
removed any remaining template DNA, and template size was verified on a 1.2% agarose gel
using electrophoresis. Probes were then aliquoted and stored at -20°C.
Tissues from fifth instar and adult R. prolixus (CNS, gut and adult female
reproductive tract) were dissected and incubated for 1h in 2% paraformaldehyde made up in
PBST (1xPBS and 0.1% Tween-20: BioShop® Canada Inc., Burlington, ON, Canada).
Tissues were washed then permeablized with 1% H2O2 as well as 4% Triton-X solution.
Samples were processed as previously described by Sedra and Lange (2016) using the TSA
amplification kit (Molecular Probes, Life Technologies, MA, USA), the only modification
being the probes in which the tissues were incubated. For observation, tissues were mounted
in 100% glycerol on glass slides (Sigma Aldrich, Oakville, ON, Canada) and imaged on a
Zeiss LSM 510 Confocal Laser Microscope (Carl Zeiss, Jena, Germany). Separate
preparations were simultaneously incubated with sense probes for every experiment as a
negative control.
209
Table 1. Gene specific primers (GSPs) designed to clone the RhoprNPF receptor.
A) ORF primers (5' to 3') NPFR-FOR1 CAAAAACGACGATCACAATGTTG
NPFR-REV1 CTGTATAAGTAGTGGCCGGTTGTTG
B) pGEM-T Easy vector specific primers T7 TAATACGACTCACTATAGGG
SP6 TATTTAGGTGACACTATAG
C) 5' and 3' RACE primers raceNPFR-REV1 TCACAATGTATAAATTCCGAGCAG
raceNPFR-REV2 TACCGACAACAATTAATAAAGCGTACAG
raceNPFR-REV3 CAACATTGTGATCGTCGTTTTTG
raceNPFR-FOR1 CAACAACAGACCACAAATGCAC
raceNPFR-FOR2 CAAGTCCAACGATAATGTTATGCC
raceNPFR-FOR3 CAACAACCGGCCACTACTTATACAG
D) Complete Receptor fullNPFR-FOR1 GACGAAACTGCCCCATAAC
fullNPFR-REV1 GTAGATTTACAAAATGTCACATTTAGTTTTATAC
210
Table 2. Primers used to detect the spatial and reproductive profile expression of RhoprNPFR in fifth instars and adults using qPCR.
A) GSPs for qPCR qPCR-NPFR-FOR1 CAGTCGTCTTCTTCCAGATAGTGG
qPCR-NPFR-REV2 CGAACAGTACTGCTACCGCTG
B) Reference gene primers rp49-qPCR-F GTGAAACTCAGGAGAAATTGG
rp49-qPCR-R AGGACACACCATGCGCTATC
Actin5C-qPCR-F AGAGAAAAGATGACGCAGATA
Actin5C-qPCR-R ATATCCCTAACAATTTCACGTT
alphaTUB-qPCR-F GTGTTTGTTGATTTGGAACCTA
alphaTUB-qPCR-R CCGTAATCAACAGACAATCTTT
* GSPs designed on exon-exon boundaries to avoid accidental amplification of genomic DNA.
211
Table 3. Primers used to synthesize sense (control) and antisense (experimental) RNA probes to detect RhoprNPFR mRNA via FISH.
A) GSPs for sense strand
T7-NPFR-FOR1 TAATACGACTTATAGGGAGACAAAAACGACGATCACAATGTTG
iNPFR-REV1 GGATATGACTCGGCGTC
B) GSPs for antisense strand
NPFR-FOR1 CAAAAACGACGATCACAATGTTG
T7-iNPFR-REV1 TAATACGACTTATAGGGAGAGGATATGACTCGGCGTC
212
Results
NPF receptor in R. prolixus
The long neuropeptide F receptor of R. prolixus has been cloned, and the ORF
sequence is composed of 1173bp and translates to a 390 amino acid polypeptide (not
including the stop codon) (Figure 1; Accession # - KM882822). Using 5' and 3' RACE we
were able to elucidate 30 nucleotides on the 5' end and 62 nucleotides at the 3' end (Figure 1).
The RhoprNPFR ORF is composed of 3 exons (605bp, 253bp and 419bp) and 2 introns
(180,638bp and 22,990bp) (a partial exon was cloned on the 5' end; Figure 2). RhoprNPFR
appears to be a classic rhodopsin-like GPCR, with 7 hydrophobic transmembrane domains, 3
hydrophilic extracellular loops and 3 cytoplasmic loops (Figure 1). RhoprNPFR shares
various conserved amino acid motifs in the transmembrane regions with other rhodopsin
GPCRS (denoted by red asterisks; Fredriksson et al., 2003). The cytoplasmic end of the third
transmembrane domain has a 100% conserved DRY motif that is typical of rhodopsin
GPCRs (Kim et al., 2008). Lastly, R. prolixus as well as many other invertebrate and
vertebrate species share an NPXXY motif in the seventh transmembrane domain that is also
typical of GPCRs (Figure 3; Fredriksson et al., 2003). RhoprNPFR has a short N-terminus
that contains two glycosylation sites (Figure 1). Six phosphorylation sites were predicted on
the cytoplasmic loops and C-terminal end of the receptor (Figure 1). There are two cysteine
residues in position 124 and 204 that exhibit 100% conservation across all species analyzed
and are predicted to form a disulfide bond between the first two extracellular loops for
structural purposes. An 8th
α-helical chain is predicted at the end of the receptor where not all
the residues are hydrophobic and, therefore, it is not a transmembrane chain.
213
Alignment and phylogenetic analysis of RhoprNPFR
The translated RhoprNPFR ORF was aligned with NPFR sequences from 11 other
insect species, one mollusk and a vertebrate. The N-linked glycosylation sites appear to be
conserved in insects, whereas all 7 transmembrane domains are evolutionarily conserved.
The 8th
α-helix is also well conserved. Compared to other Hemipterans (A. pisum and N.
lugens), RhoprNPFR exhibits 82% sequence similarity and 70% of the receptor ORF is
identical between all three species. When comparing RhoprNPFR to Diptera, mollusk and
vertebrate species, approximately 43% of the amino acid residues exhibit chemical similarity
and 29% are identical across all 13 species (Figure 3; shaded in black by BOXSHADE where
a 60% majority rule was applied).
A maximum likelihood phylogenetic analysis was able to show that RhoprNPF and
RhoprNPFR form a monophyletic group with other hemipteran NPF sequences (A. gossyppi
and A. pisum) and NPFR sequences (A. pisum and N. lugens) respectively (Figure 4).
Dipteran (A. aegypti, A. gambiae, C. capitata, M. domestica and D. melanogaster) and
hymenopteran (N. vitripennis and A. mellifera) NPFRs are sister clades and form a
polyphyletic group with RhoprNPFR. Hemipterans, being true bugs, are also ancestral to
orders such as Diptera and Hymenoptera; this also makes R. prolixus more evolutionarily
related to mollusks (L. gigantea or A. californica). Each phylogram was simulated 500 times
and the majority of bootstrap values calculated are above 70 and very close to 100, which
infers high statistical confidence in each branch split. A scale of 0.2 implies 20% genetic
change for every 100 nucleotide sites.
214
Expression profiling of RhoprNPFR
The spatial expression of the RhoprNPF receptor transcript was observed across
various tissues in two developmental stages: fifth instars and adults. In both stages, receptor
mRNA was predominantly present in the CNS as well as digestive tract (foregut, anterior
midgut, posterior midgut and hindgut) (Figure 6A). When the data were reanalyzed to look at
the relative fold-difference of mRNA expression in each tissue between the two
developmental stages, only the CNS exhibited a 10-fold increase in expression (Figure 6B).
Fold differences in expression that are around 1 imply no change in transcript expression in
adults relative to fifth instars for that particular target tissue.
A more thorough analysis of the developed adult reproductive system of males and
females shows that the RhoprNPFR transcript is present throughout the whole reproductive
system. Although expression in the CNS is approximately 850-fold greater relative to the
transcript expression found in the ovaries, RhoprNPFR transcript is present in the oviduct
and spermathecae of females as well as in the seminal vesicle and ejaculatory duct of males.
Trace levels of mRNA were also found in the bursa and cement gland, testes, as well as the
vas deferens and accessory glands (combination of transparent and opaque) in males.
Distribution of RhoprNPFR mRNA in the CNS
The NPF receptor transcript was shown to be expressed in the CNS of fifth instar and
adult R. prolixus using qPCR. Fluorescent in situ hybridization was used to determine which
neurons in the CNS express the transcript (Figure 7 and 8). RhoprNPFR is present in a group
of 5 large bilaterally-paired dorsal medial neurosecretory cells (MNSCs) in the brain,
approximately 30µm in diameter (Figure 7A). A large bilateral pair of cells is also present on
215
the ventral surface of the brain, as well as a group of 6 smaller bilaterally-paired neurons that
are localized more laterally, that are approximately 12.5µm in diameter (Figure 7B). Adults
express the NPF receptor transcript in a group of 6 large bilaterally-paired dorsal MNSCs
(Figure 8A). There were also 2 bilaterally-paired clusters of 3-4 cells located medially on the
ventral surface of the adult brain.
Fluorescent staining of the receptor transcript was also present in the prothoracic
ganglion within 4 dorsolateral paired neurons in fifth instars (Figure 7C) as well as adults
(Figure 8C). Bilaterally-paired clusters of cells were also present in the adult mesothoracic
ganglionic mass (MTGM) (Figure 8C). qPCR results also show that there is a two-fold
increase in RhoprNPFR transcript expression in the brain relative to the PRO and MTGM
(Figure 8D).
Presence of RhoprNPFR in the peripheral tissue of R. prolixus
RhoprNPF receptor mRNA was present in putative pre-follicular cells within the
germarium (Figure 9A) and between developing eggs of the adult ovariole (Figure 9B) as
well as along the nutritive cord (Figure 9C). The transcript was absent from the adult
digestive tract, but was found in closed endocrine-like cells of the fifth instar anterior midgut
(Figure 10A and B). Moreover, staining was present in small cells of the fifth instar hindgut
with the greatest density of cells found in the anterior half of the hindgut (Figure 10C and D).
216
Figure 1: cDNA sequence and the deduced amino acid sequence of NPFR in R. prolixus.
Nucleotide and amino acid sequence of the open reading frame (ORF), where numbers for
each sequence are provided on the left. The ORF starts with the ATG start codon and the
asterisk denotes the stop codon (TAA). The full ORF is 1173bp long and translates into 390
amino acid residues not including the stop codon (GenBank accession #: KM882822). The
stop codon before the methionine start codon is bolded, enlarged in font and italicized in the
5’ untranslated region (UTR). Exon-exon boundaries are represented by the downward solid
arrowheads. The seven hydrophobic transmembrane domains are outlined and labeled (TM1-
7) and both cysteine residues predicted to be involved in a disulfide bond are underlined.
Potential N-linked glycosylation sites are boxed at the amino-terminal chain, whereas the
predicted phosphorylation sites on the cytoplasmic loops are shaded in gray.
217
218
Figure 2: Exon-intron map of the RhoprNPF receptor. A graphical representation of the
gene comprised of boxed exons, where every break represents a splice site. White boxes
denote the 5' and 3' UTRs and the gray boxes represent the ORF, based on splice site
predictions and BLAST analysis against the Rhodnius genome. The start and stop codons are
labeled with arrows. The ORF contains a total of 3 exons (drawn to scale). Numbers denote
exon and intron sizes in nucleotide base pairs. Introns are not drawn to scale.
219
220
Figure 3: Amino acid sequence alignment of NPFR identified or predicted in 13 other
species, using ClustalW. The predicted seven transmembrane regions (TM 1-7) are
indicated above the alignment. The two conserved cysteine residues used in a disulfide bond
are denoted by downward pointing arrows. Residues that are 100% conserved across all 14
species are denoted with a black asterisk, whereas residues that are classic identifiers of
GPCRs and are commonly conserved were represented by a red asterisk. Following the 60%
majority rule, identical amino acids are shaded in black and similar amino acids are shaded in
gray. NPF/NPY-like receptor sequences from R. prolixus (Rhopr), A. pisum (Acypi:
XM_001943673), N. lugens (Nillu: A817321), A. gambiae (Anoga: AY579078), A. aegypti
(Aedae: KC439539), D. melanogaster (Drome: AF36440), C. capitata (Cerca:
XM_004534122), M. domestica (Musdo: XM_005182221), M. occidentalis (Metoc:
XM_003739518), A. mellifera, (Apime: XM_001123033), N. vitripennis (Nasvi:
XM_001601922), I. scapularis (Ixosc: KC439541), A. californica (Aplca: XM_005089570)
and H. sapiens (Homsa: AY2365401) were used.
221
222
Figure 4: Phylogenetic analysis of RhoprNPF and RhoprNPFR with other invertebrates
and with arthropods and vertebrates. An unrooted phylogenetic tree showing the
evolutionary relations of (A) RhoprNPF and (B) RhoprNPFR to 8 and 14 other species
respectively. These trees were generated using the Maximum Likelihood method, where the
statistical value at each node represents the confidence of the split according to 500 bootstrap
replicates. Each phylogenetic tree was drawn to scale where a 0.2 branch length implies 20%
likelihood of a substitution per nucleotide site. Accession numbers for sequences used are
included in the figure.
223
224
Figure 5: Spatial expression profile of the RhoprNPFR transcript in different tissues of
fifth instar and adult R. prolixus. (A) RhoprNPFR transcript levels were measured in the
CNS as well as various peripheral tissues in fifth instar (black) and adult (white) R. prolixus.
The fold-difference in gene expression observed is relative to fifth instar and adult testes,
which is similar in fifth instar and adults. Relatively high expression of the transcript was
found in the CNS as well as the gut (FG, AMG, PMG and HG) of fifth instars and adults. (B)
The raw data was re-analyzed to show expression of every tissue tested of adults relative to
fifth instars, where a fold difference of 1 indicates no change in receptor expression between
the two developmental stages. Adult CNS exhibit a 10-fold increase in receptor expression
relative to fifth instars. Data points are mean ± standard error of the mean (SEM) of 3
biological replicates. Abbreviations: CNS, central nervous system; SG, salivary gland; DV,
dorsal vessel; FG, foregut; AMG, anterior midgut; PMG, posterior midgut; HG, hindgut;
MT, Malpighian tubules; FB, fat bodies; O, ovaries; T, testes.
225
226
Figure 6: Spatial expression profile of the RhoprNPFR gene in the adult reproductive
tract of R. prolixus. RhoprNPFR transcript levels were observed in adult male and female
reproductive tissues relative to the female ovaries. High expression of the transcript was
found in the CNS, approximately 850-fold higher than the ovaries. Traces were observed in
the remaining reproductive tissues, particularly higher in the oviducts and spermatheca as
well as the seminal vesicle and ejaculatory duct. Data points are mean ± standard error of the
mean (SEM) of 3 biological replicates. Abbreviations: CNS, central nervous system; O,
ovaries; OV/SP, oviducts and spermathecae; B/CG, bursa and cement gland; T, testes;
VD/AG, vas deferens and accessory glands; SV/ED, seminal vesicle and ejaculatory duct.
227
228
Figure 7: Confocal images of RhoprNPFR transcript expression in cell bodies of 5th
instar R. prolixus using FISH. (A) A stacked image showing the 5 stained dorsal pairs, (B)
and 7 ventral pairs of neurons in the brain. Scale bars for confocal images represent 100 µm.
(C) A schematic map of the CNS portraying the distribution of all stained neurons that
express the RhoprNPFR mRNA transcript, where dorsally located neurons are represented by
closed circles and ventral neurons are open circles. The anterior end of the prothoracic
ganglion (PRO) contained 4 dorsolaterally paired cells that express RhorpNPFR. Scale bar
for map represents 200 µm. Abbreviations: SOG, suboesophegeal ganglion; PRO,
prothoracic ganglion; MTGM, mesothoracic ganglionic mass.
229
230
Figure 8: Expression of RhoprNPFR transcript in adult R. prolixus CNS. (A) A stacked
image showing the 6 stained dorsal pairs of neurons in the brain, where one paired neuron
(indicated by the smaller arrows) is substantially smaller in size than the remaining 5
neurons. (B) Ventral view of the brain showing medially paired clusters of 3 stainend
neurons and laterally paired clusters of neurons contining 4 neurons. Each cluster is indicated
by a large arrow. Scale bars for confocal images represent 100 µm. (C) A schematic map of
the CNS outlining the distribution of all stained neurons that exhibit RhoprNPFR transcript
expression, where dorsally located neurons are represented by closed circles and ventral
neurons are open circles. Clusters of paired cells expressing RhoprNPFR transcript are
present in the PRO as well as the MTGM. Scale bar for map represents 200 µm. (D) Twice
as much RhoprNPFR mRNA is present in the brain and SOG when compared to the PRO and
MTGM. Abbreviations: BR, brain; SOG, suboesophegeal ganglion; PRO, prothoracic
ganglion; MTGM, mesothoracic ganglionic mass.
231
232
Figure 9: Stacked confocal images of accessory cells in the adult female ovarioles
expressing RhoprNPFR using FISH. (A) A cluster of stained cells near the terminal
filament and within the germarium, (B) in pre-follicular cells between developing oocytes
and (C) along the nutritive cord of an ovariole expressing RhoprNPFR transcript. The
nucleus of each cell exhibits no transcript staining. Scale bars for confocal images represent
100 µm.
233
234
Figure 10: Stacked confocal images of stained cells along the fifth instar digestive tract
of R. prolixus using FISH. (A) A stacked image showing stained endocrine cells along the
anterior midgut of fifth instars. (B) A 20x maginified image shows that these closed
endocrine cells are only present along the outer layer of longitudinal muscle fibers of the
anterior midgut. Nuclei with each cell is devoid of staining. (C) A 10x and (D) 20x stacked
image showing differential staining along the hindgut of fifth instars where stained cells are
more abundant on the anterior end and than the posterior end of the hindgut. Scale bars for
confocal images represent 100 µm.
235
236
Discussion
Only present in eukaryotes, G-protein coupled receptors have been associated with
several diseases and have been a critical target for over 40% of the pharmacological
medicinal drugs to date (see Overington et al., 2006). GPCRs also play a role in a plethora of
physiological processes since they are host to a broad range of ligands, including but not
limited to, odour molecules, hormones, light-sensitive compounds, neuropeptides, etc. (see
Granier and Kobilka, 2012).
NPFR has been classified as a rhodopsin-like GPCR receptor (see Nässel and
Wegener, 2011). Although NPFR has been predicted in silico within many genomes, the NPF
receptor gene has only been cloned in 2 insect species to date: D. melanogaster (Garczynski
et al., 2002) and the African malaria mosquito, A. gambiae (Garczynski et al., 2005).
RhoprNPFR has an ORF comprised of 3 exons and 2 introns, where the fourth and sixth
transmembrane domains span two different exons. The ClustalW alignment of RhoprNPFR
with other NPF receptors shows that the N-linked glycosylation region is predominantly
conserved across species and is identified by an NxS/T domain (Arey, 2012). After the
translation of the nascent GPCR at the endoplasmic reticulum, certain enzymes covalently
attach carbohydrate molecules at these specific motifs to overall aid in protein folding and
the formation of the correct 3D biologically active conformation (Arey, 2012). All 7
hydrophobic transmembrane domains are also well conserved across arthropods and are
modeled to form α-helical secondary structures that arrange in a final barrel conformation
(see Iismaa and Shine, 1992; Granier and Kobilka, 2012). Two cysteine residues that are
100% conserved in arthropods are present on the first two extracellular loops (before the 3rd
and 5th
transmembrane domains) and form a disulfide bond that is not only another classic
237
identifier of GPCRs but is also critical for the stabilization of the receptor’s structure (see
Iismaa and Shine, 1992). On the cytosolic end of the third transmembrane domain there is a
highly conserved DRY motif that is important for signaling (protein-protein interaction with
G-subunits) and intracellular trafficking (receptor internalization) (Kim et al., 2008). This
motif was similarly characterized in other GPCRs such as the crustacean cardioactive
receptor (CCAPR) in R. prolixus (Lee et al., 2013). Kim et al. (2008) defined the importance
of the DRY motif by mutating the asparagine (D) and arginine (R) residues of a dopamine
receptor and found that ligand-receptor interactions were abolished and that receptor
internalization was effected differently based on the mutation (Kim et al., 2008). The
presence of (R/K)x(S/T) motifs in the cytosolic C-terminal chain allude to the use of either
protein kinase C (PKC) or G-protein coupled receptor kinase (GRK) for the phosphorylation
of said residues when receptor internalization is required (Marchese et al., 2003).
Phosphorylation of said residues results in the recruitment of β-arrestin which binds to other
transport components such as clathrin and leads to endocytosis (Marchese et al., 2003). A
classic 8th
α-helix is also defined in RhoprNPFR after the 7th
transmembrane domain and is a
key identifier of rhodopsin receptors (Granier and Kobilka, 2012). Movement of the 7th
transmembrane domain and 8th
α-helix was also found to be critical for β-arrestin to maintain
an active state and proceed with receptor endocytosis when desensitization occurs (Granier
and Kobilka, 2012).
Evolutionarily speaking, both the NPF gene as well as its receptor form a
monophyletic group with other hemipterans (A. gossyppi, A. pisum and N. lugens) and are
sister taxa to mollusc species (such as L. gigantean and A. californica respectively). Similarly
all Dipteran species form monophyletic groups when looking at the evolution of RhoprNPF
238
(A. mellifera, A. florea, and A. dorsata) and RhoprNPFR (A. aegypti, A. gambiae, C.
capitata, M. domestica, and D. melanogaster). It was also observed that for both peptide and
receptor, Diptera is a sister group to species of the Hymenoptera order (N. vitripennis, A.
rosae and A. mellifera). These findings hint to a potential ligand-receptor co-evolution,
which is a popular and well-studied model (Moyle et al., 1994).
Spatial expression of the NPFR transcript has been observed in the African malaria
mosquito across multiple developmental stages (Garczynski et al., 2005). Using RT-PCR
showed greater expression of the receptor in female adults compared to males, implying a
possible role in egg production or ovulation (Garczynski et al., 2005). Receptor transcript
was also more localized to the head and abdomen and notably absent in the thorax. This was
similarly observed for the transcript of the Ang-NPF (Garczynski et al., 2005). This present
study was able to quantify RhoprNPFR transcript levels in fifth instar and adult R. prolixus.
We also found similar expression patterns between fifth instars and adults, where a greater
amount of RhoprNPFR mRNA was found in the CNS and digestive tract. FISH experiments
were also able to show staining of receptor mRNA within closed endocrine-like cells of the
fifth instar anterior midgut. Only the CNS exhibited differential expression of the receptor,
where there was 10-fold increase in transcript levels in adults when compared to fifth instars.
RNA was extracted from a mixture of males and females; therefore differential expression
between the sexes could not be inferred. However, expression of the receptor mRNA
throughout the male and female reproductive tract strengthens the hypothesis of NPF being a
regulator of reproduction.
Only one paper previously reported expression of NPFR in the brain of invertebrates,
and this study is the second to do so. Garczynski et al. (2002) used in situ hybridization and
239
localized DrmNPFR1within neurons of third instar larval D. melanogaster CNS, where
numerous cells were detected in the brain lobes as well as the ventral nerve cord.
RhoprNPFR was also localized in dorsal MNSCs in the brain of fifth instars and adults.
RhoprNPFR transcript was also observed in cells of the fifth instar hindgut, and these cells
were differentially distributed along the hindgut. There is a greater density of labelled cells in
the anterior portion of the hindgut (analogous to the ileum of other insects) and more sparse
labelling on the posterior portion of the hindgut (similar to the rectum). Previous studies have
already shown that DrmNPF inhibits R. prolixus hindgut contraction of fifth instars
(Gonzalez and Orchard, 2009). The differential cell density between the anterior and
posterior regions of the hindgut may indicate the importance of muscle relaxation in the
anterior hindgut compared to the posterior hindgut.
In a previous study, we proposed that RhoprNPF is capable of controlling certain
aspects of reproduction since injection of the biologically active truncated RhoprNPF
resulted in a depletion of eggs present in the ovaries and an increase in the total number of
eggs laid in R. prolixus (Chapter 5). This suggests that truncated RhoprNPF was responsible
for facilitating ovulation. We also found the presence of the RhoprNPF transcript within cells
of the lateral oviducts (Chapter 5). Furthermore, other studies have been able to show that
trNPF was responsible for oocyte maturation and development in female locusts (Cerstiaens
et al., 1999; Van Wielendaele et al., 2013b). To further verify the importance of NPF in
female reproduction, we used FISH to localize the presence of RhoprNPFR transcript
throughout the female reproductive tract. Putative pre-follicular cells within the germarium
express RhoprNPFR mRNA, and it is only present in the cytoplasm of these cells and not
within the nuclei. Nurse cells within the germarium may contain RhoprNPFR transcript
240
however, this would be difficult to observe since all nurse cells share a common trophic core,
and the signal could be diffuse. This mRNA is also transported to each developing oocyte via
a nutritive cord that undergoes degeneration at the end of vitellogenesis (Huebner, 1981).
Each oocyte experiencing either pre-vitellogenesis or vitellogenesis is connected to nurse
cells via a nutritive cord. The terminal oocyte possesses a nutritive cord that is thicker in
diameter when compared to other developing oocytes (Huebner, 1981). Pre-follicular cells
between the developing oocyte possess all the necessary machinery for high levels of RNA
synthesis (Lutz and Huebner, 1980). They are substantially smaller in size than follicle cells
and possess a prominent nucleus (Lutz and Huebner, 1980). After mitosis they differentiate
into follicle cells that form a layer around the growing oocyte. The RhoprNPFR may play a
role in pre-follicular cell differentiation. RhoprNPFR mRNA can also be supplied to the
developing oocyte from these follicular cells via gap junctions (Lutz and Huebner, 1980).
The role of the mRNA for RhoprNPFR within the oocyte is not known, but it might be an
important signaling pathway necessary during early embryogenesis. Since RhoprNPFR is not
only expressed in cells above the terminal oocyte but between each oocyte within the
ovariole, we hypothesize that these cells are not degenerating follicular cells that are shed
post-chorionation. Further work is needed to discover what role the NPF signaling pathway
plays in development of the oocyte or the embryo.
In conclusion, in this chapter we cloned the cDNA of the RhoprNPF receptor and
classified it as a G protein-coupled receptor. RhoprNPFR contained many of the defining
characteristics of rhodopsin-type GPCRs, including N-terminal glycosylation sites, 7
hydrophobic transmembrane domains, two extracellular cysteine residues forming a
structurally important disulfide bond, a highly conserved DRY motif at the third
241
transmembrane domain and slightly hydrophobic 8th
α-helix. RhoprNPFR is highly
conserved among insect species, and most likely the receptor co-evolved with its ligand NPF
across invertebrates. The RhoprNPF receptor is predominantly expressed in the CNS and gut
of R. prolixus, and there is a 10-fold increase in the expression of the receptor from fifth
instars to adults. The mRNA transcript of RhoprNPFR was localized in 6 bilaterally-paired
MNSCs in the brain. RhoprNPFR was also expressed in putative pre-follicular cells within
the germarium of the developed telotrophic ovarioles of R. prolixus, and mRNA from nurse
cells most likely is supplied to the growing oocytes via nutritive cords. Therefore,
RhoprNPFR most likely is a regulator of oogenesis in R. prolixus.
242
References
Arey, B.J. (2012). The role of glycosylation in receptor signaling. In: Glycosylation. InTech:
http://dx.doi.org/10.5772/50262.
Biasini, M., Bienert, S., Waterhouse, A., Arnold, K., Studer, G., Schmidt, T., Kiefer, F.,
Cassarino, T.G., Bertoni, M., Bordoli, L. and Schwede, T. (2014). SWISS-MODEL:
modeling protein tertiary and quaternary structure using evolutionary information.
Nucleic Acids Research, 42: doi: 10.1093/nar/gku340.
Blom N., Sicheritz-Pontén, T., Gupta, R., Gammeltoft, S. and Brunak, S. (2004). Prediction
of post-translational glycosylation and phosphorylation of proteins from the amino
acid sequence. Proteomics, 4: 1633-1649.
Blom, N., Gammeltoft, S. and Brunak, S. (1999). Sequence and structure-based prediction of
eukaryotic protein phosphorylation sites. Journal of Molecular Biology, 294: 1351-
1362.
Cerstiaens, A., Benfekih, L., Zouiten, H., Verhaert, P., De Loof, A. and Schoofs, L. (1999).
Led-NPF-1 stimulates ovarian development in locusts. Peptides, 20: 39-44.
Chapman, R.F. (2013). Reproductive system: Female. In: The insects: structure and function,
New York: Cambridge University Press; p. 319-321.
Davey, K. (2007). The interaction of feeding and mating in the hormonal control of egg
production in Rhodnius prolixus. Journal of Insect Physiology, 53: 208-215.
Fredriksson, R., Höglund, P.J., Gloriam, D.E.I., Lagerström, M.C. and Schiöth, H.B. (2003).
Seven evolutionarily conserved human rhodopsin G protein-coupled receptors lacking
close relatives. FEBS Letters, 554: 381-388.
243
Garczynski, S.F., Brown, M.R., Shen, P., Murray, T.F. and Crim, J.W. (2002).
Characterization of a functional neuropeptide F receptor from Drosophila
melanogaster. Peptides, 23: 773-780.
Garczynski, S.F., Crim, J. W. and Brown, M. R. (2005). Characterization of neuropeptide F
and its receptor from the African malaria mosquito, Anopheles gambiae. Peptides, 26:
99-107.
Gonzalez, R. and Orchard, I. (2009). Physiological activity of neuropeptide F on the hindgut
of the blood-feeding hemipteran, Rhodnius prolixus. Journal of Insect Science, 9: 1-
14.
Granier, S. and Kobilka, B. (2012). A new era of GPCR structural and chemical biology.
Nature Chemical Biology, 8: 670-673.
Huebner, E. (1981). Nurse cell-oocyte interaction in the telotrophic ovarioles of an insect,
Rhodnius prolixus. Tissue and Cell, 13: 105-125.
Huebner, E. and Anderson, E. (1972a). Cytological study of the ovary of Rhodnius prolixus:
The ontogeny of the follicular epithelium. Journal of Morphology, 136: 459-494.
Huebner, E. and Anderson, E. (1972b). Cytological study of the ovary of Rhodnius prolixus:
Cytoarchitecture and development of the trophic chamber. Journal of Morphology,
138: 1-40.
Iismaa, T.P. and Shine, J. (1992). G protein-coupled receptors. Current Opinion in Cell
Biology, 4: 195-202.
Kim, J.-H., Cho, E.-Y., Min, C., Park, J.H. and Kim, K.-M. (2008). Characterization of
functional roles of DRY motif in the 2nd
intracellular loop of dopamine D2 and D3
receptors. Archives of Pharmacal Research, 31: 474-481.
244
Lange, A.B. (2009). The female reproductive system and control of oviposition in Locusta
migratoria migratorioides. Canadian Journal of Zoology, 87: 649-661.
Lee, D. Vanden Broeck, J. and Lange, A.B. (2013). Identification and expression of the
CCAP receptor in the Chagas’ disease vector, Rhodnius prolixus, and its involvement
in cardiac control. PLoS ONE, 8: e68897.
Lutz, D.A. and Huebner, E. (1980). Development and cellular differentiation of an insect
telotrophic ovary (Rhodnius prolixus). Tissue and Cell, 12: 773-794.
Marchese, A., Chen, C., Kim, Y.-M. and Benovic, J.L. (2003). The ins and outs of G protein-
coupled receptor trafficking. TRENDS in Biochemical Sciences, 28: 369-376.
Middleton, C.A., Nongthomba, U., Parry, K., Sweeney, S.T., Sparrow, J.C. and Elliott, C.J.
(2006). Neuromuscular organization and aminergic modulation of contractions in the
Drosophila ovary. BMC Biology, 4: 17.
Moyle, W.R., Campbell, R.K., Myers, R.V., Bernard, M.P., Han, Y. and Wang, X. (1994).
Co-evolution of ligand-receptor pairs. Nature, 368: 251-255.
Nässel, D. R. and Wegener, C. (2011). A comparative review of short and long neuropeptide
F signaling in invertebrates: any similarities to vertebrate neuropeptide Y signaling?
Peptides 32: 1335-1355.
Nässel, D.R. and Winthner, A.M.E. (2010). Drosophila neuropeptides in regulation of
physiology and behaviour. Progress in Neurobiology, 92: 42-104.
Overington, J.P., Al-Lazikani, B. and Hopkins, A.L. (2006). How many drug targets are
there? Nature Reviews, 5: 993-996.
Patchin, S. and Davey, K.G. (1968). The histology of vitellogenesis in Rhodnius prolixus.
Journal of Insect Physiology, 14: 1815-1820.
245
Reese, M. G., Eeckman, F. H., Kulp, D. and Haussler, D. (1997). Improved splice site
detection in Genie. Journal of Comparative Biology, 4: 311-323.
Sedra, L. and Lange, A.B. (2014). The female reproductive system of the kissing bug,
Rhodnius prolixus: arrangements of muscles, distribution and myoactivity of two
endogenous FMRFamide-like peptides. Peptides, 53: 140-147.
Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S. (2013). MEGA6: molecular
evolutionary genetics analysis version 6.0. Molecular Biology and Evolution, 30:
2725-2729.
Tensen, C.P., Cox, K.J.A., Burke, J.F., Leurs, R., van der Schors, R.C., Geraerts, W.P.M.,
Vreugdenhil, E. and van Heerikhuizen, H. (1998). Molecular cloning and
characterization of an invertebrate homologue of a neuropeptide Y receptor.
European Journal of Neuroscience, 10: 3409-3416.
Van Wielendaele, P., Dillen, S., Zels, S., Badisco, L. and Vanden Broeck, J. (2013a).
Regulation of feeding by neuropeptide F in the desert locust, Schistocerca gregaria.
Insect Biochemistry and Molecular Biology, 43:102-114.
Van Wielendaele, P., Wynant, N., Dillen, S., Zels, S., Badisco, L. and Vanden Broeck, J.
(2013b). Neuropeptide F regulates male reproductive processes in the desert locust,
Schistocerca gregaria. Insect Biochemistry and Molecular Biology, 43:252-259.
Wigglesworth, V.B. (1972). Reproductive System. In: The principles of insect physiology,
New York: Halsted Press; p. 700-707.
246
Acknowledgments
We would like to thank Nikki Sarkar for maintaining the insect colony and Meet
Zandawala for training in molecular biology.
247
Chapter 7:
General Discussion
248
Linking the Parts
The female insect reproductive tract is made up of visceral organs that are entirely
composed of striated muscle fibers but function in a manner similar to smooth muscle in
vertebrates (Chapman, 2013). The muscle fibers of these visceral organs are organized into a
variety of arrangements with the muscle fibers being assembled in layers (longitudinal or
circular) or in syncytial sheets. These arrangements vary based upon the type of contractions
that the organ needs to perform. All visceral organs exhibit their own rhythmic spontaneous
contraction. Within the context of the reproductive system, these contractions facilitate the
movement of spermatozoa within the female during mating to be stored in the spermatheca,
the movement of vitellogenic eggs along the ovariole to be ovulated into the lateral oviducts
and then the egg passes along the common oviduct followed by strong bursal contractions
resulting in oviposition of the egg (Lange, 1990; Middleton et al., 2006; Sedra and Lange,
2014). Visceral tissue does not only exhibit its own spontaneous activity but is often also
under neural and hormonal control. Many neuropeptides have been implicated in the
regulation of muscle contraction in the female insect reproductive tract – including members
of the FMRFamide-like peptides (FLPs) (Orchard et al., 2001; Nässel, 2002). Neuropeptides
can also be involved in the regulation of egg production and growth (Ruegg et al., 1981;
Sevala et al., 1992). Effects of FLPs have been studied in many insects including Locusta
migratoria (Lange et al., 1990; Sevala et al., 1993; Cerstiaens et al., 1999); however,
knowledge is sparse with respect to the obligatory hematophagous vector of Chagas disease,
Rhodnius prolixus. This dissertation addresses the following aspects in R. prolixus: (1) An
exploratory first time description of the muscle arrangement and spontaneous muscle activity
of the adult female reproductive tract; (2) Localization of FLPs in the female adult
249
reproductive system; (3) Examination of the effects of various FLPs on female reproductive
muscle contraction; (4) Identification and characterization of neuropeptide F (NPF) and the
NPF receptor (NPFR) in the kissing bug; (5) Determining the transcript expression profile of
NPF and NPFR in female adult R. prolixus; and (6) Screening FLPs from every subfamily
and determining whether they play a role in egg production and egg laying in R. prolixus.
The research presented in this thesis provides a thorough background to the role of
FLPs in egg production, egg movement and egg laying in R. prolixus. Defining the
importance of FLPs in female insect reproduction can aid in identifying strong inhibitors of
oogenesis. This thesis also provides the first egg-laying assay for Rhodnius prolixus that can
be used to screen for the physiological effects of other neuropeptides or amines on oogenesis,
vitellogenesis and oviposition. This general discussion covers the major findings of this
dissertation followed by future directions and concluding remarks.
Muscle arrangement and spontaneous activity of the female reproductive
tract of R. prolixus
The neuromuscular arrangement of the female reproductive system in R. prolixus is
described for the first time in Chapter 2 of this thesis (Sedra and Lange, 2014). This
publication also describes normal spontaneous activity of all the reproductive structures
together (in vivo), and when isolated (in vitro).
The R. prolixus female reproductive system is composed of paired ovaries and lateral
oviducts that unite into a common oviduct with paired spermathecae and an ectodermal bursa
that attaches to the ventral cuticle. Phalloidin F-actin staining and imaging was able to show
that all of these structures are composed of striated muscle fibers (Sedra and Lange, 2014;
Chapter 2). Each R. prolixus ovary possesses 7 telotrophic ovarioles that are made up of fine
250
criss-crossing muscle fibers and a terminal muscular filament at the apex that connects to the
body wall. All 7 ovarioles are surrounded by a muscle fiber network that also exhibits
contractile qualities (Sedra and Lange, 2014; Chapter 2). Although observed in hemipterans
and dipterans (Middleton et al., 2006), ovarioles did not exhibit any myogenic activity in
locusts (Lange, personal communication). Telotrophic ovaries can have simultaneous egg
development in all 7 ovarioles, and trophocytes present in the germarium at the apex of the
ovariole provide nutrients (that include mRNA and protein neuropeptides) through nutritive
chords to each developing oocyte (Chapter 4). The lateral oviducts are composed of inner
longitudinal muscle fibers and outer circular muscle fibers that coordinate their spontaneous
contractions resulting in rhythmic bursts (Sedra and Lange, 2014; Chapter 2). Passage of the
mature egg from the terminal egg chamber of the ovariole through the calyx and into the
lateral oviduct is a physiological process known as ovulation, and several neuropeptides and
hormones can affect the rate of ovulation (Chapter 4 and Chapter 5). Lateral oviduct
peristaltic contractions move the egg into the common oviduct where it remains and awaits
fertilization (if the female has been mated). Mated females need only mate once and store
their spermatozoa in their muscular spermathecae (Sedra and Lange, 2014; Chapter 2); this is
also where they synthesize their own ‘mating factor’ that drives an increase in egg production
when compared to virgin females (Davey, 1964; Chapter 4). The twisting spermathecal
contractions facilitate sperm movement to allow sperm access to the micropyles at the
anterior pole of the egg, resulting in fertilization (Davey, 1958). A strong bursal contraction
with shortening of the dense chevron-arranged muscle fibers results in the ejection of the
egg, which simultaneously occurs with the release of fluid secretions from the cement gland
that are synthesized in the non-muscular distal end and released through the muscular
251
proximal end (Sedra and Lange, 2014; Chapter 2). This secretion fixes the egg onto a
substrate.
When isolated from the remainder of the reproductive tract, the ovaries, lateral
oviducts and common oviduct retain their spontaneous muscle activity. Both the
spermathecae and the bursa almost completely lose their myogenic activity after isolation
(Sedra and Lange, 2014; Chapter 2). This suggests that both of these tissues require electrical
signals from the other tissues, i.e. pacemaker type signals.
Although all of the previously described visceral tissues display their own
spontaneous activity, these contraction patterns can be altered by hormones circulating in the
haemolymph as long as the target tissue possesses the correct receptor (Sedra and Lange,
2014; Chapter 2; Sedra et al., 2015; Chapter 3; Chapter 5). These reproductive tissues are
also under neural control (see below). Neurotransmitters can be provided directly to the
muscle of interest and alter contraction physiology (Sedra and Lange, 2014; Chapter 2).
Moreover, sensory cells/endocrine cells can be present in the muscle that synthesize and
locally release a specific neuropeptide that can modulate muscle contraction (Chapter 5).
Presence of FLPs in the adult female R. prolixus
Tsang and Orchard (1991) have already described the distribution of FLPs within Vth
instar R. prolixus. This thesis focuses solely on the presence and distribution of FLPs in
adults, particularly in the central nervous system (CNS) as well as the female reproductive
tract (Sedra and Lange, 2014; Chapter 2). This work was done using immunohistochemistry
with an RFamide antibody. It is important to note that this technique detects all FLPs
including N-terminally extended FM/L/IRFamides, myosuppressins, sulfakinins (or
252
HMRFamides), long neuropeptide F (NPF) and short neuropeptide F (sNPF). Thus, the
results do not necessarily indicate the spatial distribution of one particular peptide (Orchard
et al., 2001; Ons et al., 2011). To overcome this dilemma, fluorescent in situ hybridization
(FISH) was used to determine the spatial distribution of the mRNA for NPF and its receptor
(Chapter 5 and Chapter 6).
FMRFamide-like immunoreactive (FLI) staining was observed in over 100 cell
bodies in the adult brain (Sedra and Lange, 2014; Chapter 2); however, NPF was only found
in 12 dorsally bilaterally-paired cell bodies, most likely median neurosecretory cells
(MNSCs) (Chapter 5). Therefore, NPF is synthesized in a subset of the MNSCs. Six of the 24
MNSCs identified are approximately the same size as the MNSCs Kriger and Davey (1983)
found to contain material that stimulates ovarian motility and increases the rate of ovulation.
Over 100 FLI stained neurons were also found in the mesothoracic ganglionic mass (MTGM)
(Sedra and Lange, 2014; Chapter 2), whereas only 8 clusters of 4 dorsal neurons contained
NPF mRNA, as well as one ventral pair (Chapter 5). These results are similar to previous
findings that suggested that RhoprNPF is found in cells within the Vth
instar CNS using a
polyclonal DrmNPF antiserum (pre-absorbed in GDRARVRFamide) (Gonzalez and Orchard,
2008). Only three other studies examined the spatial expression of the NPF transcript in the
CNS and other peripheral tissues (in Anopheles gambiae, Reticulitermes flavipes and
Schistocerca gregaria), and NPF was predominantly found to be a brain-gut peptide, where
maximal expression was found in the head as well as the digestive tract (Garczynski et al.,
2005; Nuss et al., 2010; Van Wielendaele et al., 2013a). Numerous FLI axons are present at
the corpus cardiacum (CC) and also along the aorta, indicating that FLPs can be synthesized
in MNSCs and released via the CC at the aorta and into the haemolymph as a neurohormone
253
with the ability to affect the physiology of many peripheral targets (Chapter 2; Sedra and
Lange, 2014).
FLPs are not just neurotransmitters in the CNS but are also neurotransmitters at target
tissues. FLI staining was found in two axons within each trunk nerve (which innervates the
oviducts and distal end of the bursa as well as the ventral side of the hindgut) (Sedra and
Lange, 2014; Chapter 2). FLI stained blebs were also seen on the 3rd
and 4th
abdominal
nerves, suggesting that the neuropeptides are locally secreted from this neurohaemal area
along the nerves (Sedra and Lange, 2014; Chapter 2). Similarly results were reported by
Gonzalez and Orchard (2008), who examined the distribution of RhoprNPF using a pre-
absorbed antibody (preabsorbed to make it specific for NPF). The 3rd
and 4th
abdominal
nerves branch out under the fat body (adipose tissue) and the third and fourth abdominal
sternum, respectively, in Triatoma infestans, a fellow hemipteran (Insausti, 1994). Supply of
FLPs and RhoprNPF in particular to fat body suggests that these neuropeptides may
contribute to the regulation of vitellogenin synthesis and release from fat body stores, which
would facilitate vitellogenesis, egg growth and egg development.
FLI stained axons directly innervate muscle fibers of the lateral oviducts, common
oviducts, spermathecae and bursa of the adult female R. prolixus (Sedra and Lange, 2014;
Chapter 2). RhoprNPF transcript is also synthesized in cells of the lateral oviducts (Chapter
5). Egg movement through the lateral oviducts causes stretching of the oviducts, and
RhoprNPF within these cells might signal an increase in fluid secretion within the oviduct
lumen to aid in egg movement. This was seen in D. melanogaster where octopamine has
been shown to influence fluid secretion within the oviducts (Lee et al., 2009). RhoprNPFR
transcript was also localized using FISH to cells in the CNS as well as cells in the ovarioles
254
of R. prolixus (Chapter 6). Moreover, RhoprNPFR mRNA was found in pre-follicular cells
between the developing oocytes. The pre-follicular cells undergo mitosis and differentiate
into follicle cells that form a monolayer around the developing oocyte (Chapter 6; Lutz and
Huebner, 1980). This suggests that RhoprNPFR may play a role in pre-follicular cell
differentiation, and the transcript might be supplied to the egg from the follicular cells. Very
little is known as yet about the role of NPF in oogenesis and/or vitellogenesis; however, this
is the only study that looks at the expression of either NPF or NPFR in the insect
reproductive system. Only one study to date has used in situ hybridization and localized
NPFR in the larval Drosophila melanogaster CNS and found numerous neurons expressing
DrmNPFR1 in the brain and ventral nerve cord (Garczynski et al., 2002).
Effect of FLPs on R. prolixus reproductive tissue myoactivity
The effect of various FMRFamide-like peptides on muscle contraction has been
studied in several insect species, where structure activity bioassays were conducted to
determine the importance of each amino acid residue in the peptide for successful ligand-
receptor binding (Orchard et al., 2001; Chapter 1, Table 1). Chapter 2 assesses the role of two
stimulatory FLPs, whereas Chapter 3 looks at the effects of various myoinhibitors (Sedra and
Lange, 2014; Sedra et al., 2015).
After discovering that FLPs are supplied to the lateral oviducts of R. prolixus via both
neural and hormonal means, I decided to test their physiological effects on muscle
contraction (Chapter 2; Sedra and Lange, 2014). Ons et al. (2011) previously identified seven
N-terminally extended FM/L/IRFamides in the RhoprFMRFa gene in silico (see Chapter 1 –
Table 1). Both GNDNFMRFa and AKDNFIRFamide increased the rate of spontaneous
255
contractions of ovarioles, and the increased force of muscle contraction of ovaries, oviducts
and bursa (Chapter 2; Sedra and Lange, 2014). In every scenario AKDNFIRFamide was a
more effective stimulator of muscle contraction than GNDNFMRFa, suggesting that the
isoleucine substitution in place of the methionine results in a secondary structure that allows
for better receptor-ligand binding (Chapter 2; Sedra and Lange, 2014). The extended
FM/L/IRFamides have been found to be on one gene in numerous insects including D.
melanogaster, the blowfly, Calliphora vomitoria, and the cockroach, Periplaneta americana
(Schneider and Taghert, 1988; Duve et al., 1992; Predel et al., 2004). Moreover, only one
extended FM/L/IRFamide receptor has ever been identified in insects and it is a common
conception that the majority of these neuropeptides activate this one receptor (Cazzamali and
Grimmelikhuijzen, 2002; Meeusen et al., 2002; Duttlinger et al., 2003). FLPs from other
subfamilies such as the myosuppressins, sulfakinins and sNPF also cross-react with this G-
protein coupled receptor (GPCR), although they each have their own specific receptor
(Cazzamali and Grimmelikhuijzen, 2002; Meeusen et al., 2002). This suggests that this
receptor can tolerate multiple substitutions to its preferred ligand and therefore is perhaps one
of the reasons that many FLPs can activate many peripheral tissues, leading to its
multifunctional properties, i.e. many FLPs working on the same target. These findings also
explain why the R. prolixus myosuppressin (RhoprMS – pQDIDHVFMRFamide; Chapter 1,
Table 1) results in an increase in oviduct basal tension when the dose exceeds 10-6
M, since
RhoprMS most likely not only binds to the myosuppressin GPCR but to the extended
FMRFamide receptor as well (Chapter 3; Sedra et al, 2015). Even at lower doses, RhoprMS
did not inhibit R. prolixus lateral oviduct muscle contraction, although the myosuppressin
was shown to be inhibitory on locust oviducts (Chapter 3; Sedra et al., 2015). SchistoFLRFa
256
(PDVDHVFLRFamide) has been isolated from the locusts Schistocerca gregaria and
Locusta migratoria and results in a complete inhibition of spontaneous Locusta migratoria
oviduct contractions (Robb et al., 1989; Peeff et al., 1993; Lange et al., 1994). The
administration of SchistoFLRFa to R. prolixus oviducts also exhibited no effect on muscle
contraction, indicating that the methionine substitution in place of the highly conserved
leucine residue seen for other myosuppressins is likely not necessary for successful binding
to the receptor (Chapter 3; Sedra et al., 2015; Lee et al., 2012). Other myoinhibitors such as
allatostatin (RhoprAST-2 and RhoprMIP-4) resulted in a dose-dependent decrease in lateral
oviduct muscle contraction (Chapter 3; Sedra et al., 2015). Therefore RhoprMS most likely
plays another physiological role at the lateral oviduct and does not affect muscle tension. It is
also possible that the myosuppressin GPCR is only affiliated with the circular muscle fibers
and not the longitudinal muscle fibers of the lateral oviduct. This would imply that RhoprMS
is strictly responsible for retaining/releasing eggs from the lateral oviducts and not affecting
the overall tension of the muscle. The combinatorial effect of all these neuropeptides allow
for a very complex and versatile control and regulation of egg movement along the lateral
oviducts. Lastly, RhoprNPF did not have any effect on oviduct muscle contraction,
suggesting that this neuropeptide is important for other physiological processes (see below).
Characterization of NPF and its receptor in R. prolixus
NPF has been cloned and characterized in several invertebrates including Monieza
expansa, Aplysia californica, Lymnaea stagnalis, A. gambiae and R. flavipes (Maule et al.,
1991; Rajpara et al., 1992; de Jong-Brink et al., 2001; Garczynski et al., 2005; Nuss et al.,
2010). Chapter 5 describes cloning of the RhoprNPF gene. In most scenarios, NPF sequences
257
share a common RPRFamide C-terminus (Nässel and Wegener, 2011). Similar to other NPFs
that range from 28-45 amino acids, RhoprNPF is 42 amino acids in length. Mass
spectrometry has shown that the last 8 amino acids, AVAGRPRFamide (truncated
RhoprNPF) are present in R. prolixus (Ons et al. 2011), and work on locusts has shown that
the active form of NPF resides in the cleaved C-terminal portion of the peptide (Chapter 5;
Van Wielendaele et al., 2013a).
The NPF receptor (NPFR) has only been cloned in three invertebrates: the pond snail
L. stagnalis (Tensen et al., 1998), the fruitfly D. melanogaster (Garczynski et al., 2002) and
the mosquito A. gambiae (Garczynski et al., 2005). In all three cases NPFR has been
characterized as a GPCR. Chapter 6 describes cloning of the RhoprNPFR gene and
identification of several properties that are common to GPCRs. As in other GPCRs,
RhoprNPFR contained 7 hydrophobic transmembrane domains that are well conserved
among arthropods (Chapter 6). It also contains 3 extracellular loops and 3 intracellular
(cytosolic) loops. When aligned with other insects, the two N-linked glycosylation sites are
conserved; these sites bind to carbohydrate molecules that aid in the protein folding and
barrel formation of the receptor within the membrane (Chapter 6). As in other rhodopsin type
receptors, RhoprNPFR contains two 100% conserved cysteine residues on the first and
second extracellular loops that form a disulfide bond necessary for structure stability, as well
as a DRY motif on the cytosolic end of the third transmembrane that is essential for receptor
internalization (Chapter 6; Kim et al., 2008). Predicted phosphorylation sites on the
intracellular loops also aid in receptor internalization via endocytosis (Marchese et al., 2003).
A phylogenetic analysis of RhoprNPF and RhoprNPFR shows that hemipterans and
dipterans form their own monophyletic groups and that they are both sister taxa to each other
258
and hymenopteran species (Chapter 6). The similar phylogenetic branching suggests that
NPF and NPFR co-evolved, which is a popular model to date (Moyle et al., 1994; Goh et al.,
2000).
FLPs regulate Oogenesis
This thesis demonstrates that not all FLPs (i.e. RhoprMS and truncated RhoprNPF)
play a role in regulating oviduct contraction. However, transcripts of these peptides are
present in the R. prolixus female reproductive tract and, therefore, one assumes that these
peptides must play another role in this system (Chapter 3; Sedra et al., 2015; Chapter 5;
Chapter 6). Chapter 4 establishes an egg-laying biological assay that would allow anyone to
screen various FLPs and determine whether they play a role in egg production or egg laying.
Chapter 5 shows the results obtained using this assay.
Previous studies have shown that daily injections of truncated NPF (trNPF) resulted
in an increase in vitellogenin uptake and ovarian ecdysteroid release in S. gregaria (Van
Wielendaele et al., 2013b). Injection of truncated RhoprNPF into adult mated R. prolixus
resulted in an increase in the total number of eggs laid as well as depletion of eggs in the
ovarioles; this means that truncated RhoprNPF increases the rate of ovulation in this bioassay
(Chapter 5). Moreover, myostimulators such as GNDNFMRFa and AKDNFIRFamide
caused a significant increase in the number of eggs produced, i.e. increased the rate of
oogenesis. It is interesting to note that short NPF has been identified as a myoinhibitor of
lateral oviducts in Tenebrio molitor and Zophobas atratus (Marciniak et al., 2013). However,
short NPF has also been identified as a stimulator of ovarian development and oocyte growth
in L. migratoria (Cerstiaens et al., 1999), and now is shown to increase the rate of egg
259
production in R. prolixus (Chapter 5). On the other hand, injections of known myoinhibitors
like RhoprMS and RhoprAST-2 significantly decreased the number of eggs produced and,
thus, act as inhibitors of oogenesis (Chapter 5). Therefore, although RhoprMS did not
regulate muscle contraction in R. prolixus, it has an inhibitory effect on egg production
(Chapter 3; Sedra et al., 2015). Lastly, sulfakinins (RhoprSK) exhibited no effect on
oogenesis or egg laying in R. prolixus.
Mated R. prolixus females synthesize a ‘mating factor’ in the spermathecae and this
factor removes the allatostatic inhibition on juvenile hormone (JH) synthesis and release
from the corpus allatum (CA) which is present in virgin females (see Figure 1; Davey, 1964).
In support of this I found FGLa/AST-like immunoreactive axons innervating the CC/CA
complex via the NCCII. Moreover, Chiang (1998) found that severing the NCCII drastically
increased egg-laying in virgin females; however, this change was not substantial in mated R.
prolixus females. Injection of RhoprAST-2 inhibits egg production in the egg-laying
bioassay, possibly due to inhibiting JH release and/or inhibiting oviduct muscle contraction
(Chapter 3; Sedra et al. 2015; Chapter 5). Increased JH levels in the haemolymph increase
vitellogenin mobilization and facilitate the uptake of vitellogenin by the oocyte via receptor-
mediated endocytosis (see Davey, 2000; Figure 1). Similarly, trNPF injection into locusts
increased oocyte size as well as haemolymph and ovarian ecdysteroid levels, leading to
increases in vitellogenin synthesis (Van Wielendaele et al., 2013b). The presence of
RhoprNPF release sites on the abdominal nerves near the fat body (Gonzalez and Orchard,
2008; Chapter 2; Sedra and Lange, 2014) could also indicate that RhoprNPF might be
involved in the stimulation of synthesis of vitellogenin (Figure 1). Follicle cells can also
synthesize vitellogenin and directly supply it to the growing oocyte, and RhoprNPFR is
260
present in pre-follicular cells and may aid in their differentiation into mature follicle cells
(Chapter 6). Lastly, the ‘mating factor’ also results in an increase in ovarian ecdysteroid
release, which signals the ovary that it possesses mature eggs (see Davey 2007; Figure 1).
These effects are also inducedby trNPF in S. gregaria (Van Wielendaele et al., 2013b). An
increase in ecdysteroid in the haemolymph results in the release of a neuropeptide from the
median neurosecretory cells (MNSCs) called ‘myotropin’, which is responsible for the
increase in the rate of ovulation and ovarian muscle contraction (Ruegg et al., 1981; Kriger
and Davey, 1983; Figure 1). Around the same time there is a fluctuation in FLP levels in the
haemolymph (Sevala et al., 1992). Lastly, the presence of RhoprNPF in the cells along the
lateral oviduct can possibly signal the release of fluid secretions within the oviduct lumen
and aid in the sliding of the egg along the muscular tube (Chapter 5). Many factors contribute
in the physiological process of egg production within mated R. prolixus females.
261
Figure 1: Schematic overview of the endocrinological regulation of the ‘mating factor’ in a
mated female on vitellogenesis and ovulation in R. prolixus. The presence of the ‘mating
factor’ in the spermathecae results in three different pathways. (1) The ‘mating factor’ likely
leads to the release of RhoprNPF from the medial neurosecretory cells of the brain and the
third and fourth abdominal nerves in the MTGM to stimulate vitellogenin synthesis in the fat
body (purple). (2) The ‘mating factor’ also removes the allatostatic inhibition on JH release
from the corpus cardiacum/corpus allatum complex (CC/CA) which mobilizes vitellogenin
from the fat body into the haemolymph and JH aids in vitellogenin uptake by the oocyte
(vitellogenesis) (tan). (3) Lastly, the ‘mating factor’ signals the release of ecdysteroids from
the ovary which increases vitellogenin synthesis and uptake by the oocyte (vitellogenesis).
Increase in haemolymph ecdysteroids also signals the release of ‘myotropin’ from the 10
bilaterally-paired MNSCs in the brain resulting in an increase of ovarian contraction and
facilitates ovulation (turquoise). Abbreviations: CC/CA, corpus cardiacum/corpus allatum
complex; SOG, sub-oesophageal ganglion; MTGM, mesothoracic ganglionic mass; AST,
allatostatin; JH, juvenile hormone; NPF, neuropeptide F.
262
263
Future Directions
Determine if other FLPs activate the RhoprNPF receptor
All members of FLPs possess a common RFamide C-terminus (see Orchard et al.,
2001). The FMRFamide gene in insects encodes for 10-18 N-terminally extended
FMRFamide peptides as well as extended FL/IRFamide peptides, some of which are
redundant (Schneider and Taghert, 1988; Duve et al., 1992; Predel et al., 2004; see Orchard
et al., 2001). Seven N-terminally extended FM/L/IRFamides have been identified in R.
prolixus in silico (Ons et al., 2011). Therefore, these neuropeptides are transcribed and
translated together and are co-released from the same cell or neurohaemal organ, as
neurotransmitters, neurohormones and/or neuromodulators. Studies show that the
FMRFamide GPCR is quite promiscuous in that it also accepts FLPs from other subfamilies,
such as sNPF, sulfakinin and myosuppressin (Cazzamali and Grimmelikhuijzen, 2002;
Meeusen et al., 2002). Since many of these FLPs have a lot of sequence similarity, it would
be interesting to see if this is a characteristic of the RhoprNPF receptor. The expression and
localization of RhoprNPF are quite limited in the female reproductive tract (Chapter 5),
whereas FLPs in general are quite abundant (Chapter 2; Sedra and Lange, 2014). If
RhoprNPFR can be activated by several FLP ligands, then many different FLPs can regulate
contraction and egg production in the mature telotrophic ovaries of R. prolixus since the
receptor is present.
These experiments can be done by expressing the receptor in a stable cell line and
then using a bioluminescent receptor assay where ligand binding to the receptor can be
quantified through the release of light (Bronstein et al., 1994). Using this assay, we can
264
determine if more than one peptide can activate the RhoprNPF receptor, and by applying
these peptides at different concentrations we can determine the binding efficiency.
Knockdown RhoprNPF and RhoprNPFR
To determine the importance of long neuropeptide F in the endocrinology of egg
production and egg-laying, we must remove the signaling pathway from the system and then
assess the effects. By injecting RhoprNPF and/or RhoprNPFR double stranded RNA
(dsRNA) into the organism, we can allow the cells own machinery to break down the
RhoprNPF and RhoprNPFR mRNA and, therefore, stop gene expression (Fire et al., 1994).
We can knockdown both genes and then determine if there is any effect on egg production or
the rate of ovulation using the egg-laying assay from Chapter 4. Moreover, using anti-
vitellogenin serum or anti-vitellin serum, we can use immunoprecipitation techniques to
quantify the amount of vitellogenin in the haemolymph or vitellin in the ovaries at specific
time points of the gonadotrophic cycle (de Bianchi et al., 1985). We can quantify the levels
of vitellogenin in the haemolymph of saline-injected females (control) and females injected
with truncated NPF. I would hypothesize that injections of RhoprNPF should increase the
concentration of vitellogenin circulating in the haemolymph and the amount of vitellin in the
mature ovaries of R. prolixus. Conversely, injecting females with dsNPF and/or dsNPFR
female (RNAi knock down) should result in a decrease in vitellogenin synthesis and,
therefore, a significantly slower rate of vitellogenesis and an overall lower number in the
total eggs laid.
265
Determine whether RhoprNPF regulates ecdysteroid release
RhoprNPF is present in the neurohaemal sites on the third and fourth abdominal
nerves which project to fat body stores in the third and fourth abdominal segments (Chapter
2; Sedra and Lange, 2014; Insausti, 1994). Moreover, RhoprNPFR mRNA is in pre-follicular
cells associated with each developing oocyte that will eventually differentiate into follicle
cells surrounding the growing oocyte (Chapter 6). Sevala et al. (1992 and 1993) were able to
show that RFamide titers in the haemolymph peak around the time of vitellogenesis and then
plummet after oviposition is complete. However, it is still unclear what signals the release of
RhoprNPF and what its involvement is in increasing the rate of vitellogenesis. Van
Wielendaele et al. (2013b) showed that daily injections of trNPF resulted in an increase in
ecdysteroid titers in the ovaries of adult female S. gregaria. The opposite effect was also
observed when the Schgr-NPF precursor was knocked down in adult females (Van
Wielendaele et al., 2013b). Therefore, I hypothesize that the presence of RhoprNPF signals
the release of ecdysteroids in mated ovaries to increase the synthesis of vitellogenin at the
adipose tissue, resulting in the increase of vitellogenesis at the ovarioles. In order to prove
that RhoprNPF is indeed involved in controlling ecdysteroid production by the ovaries, we
can perform knockdown experiments similar to those reported by Van Wielendaele et al.
(2013b), and quantify ecdysteroid levels in the mature ovaries using an enzyme
immunoassay (with a specific antibody against ecdysteroids). If the presence of RhoprNPF
results in an increase in ecdysteroid levels in the ovaries and haemolymph, then it will be
safe to say that RhoprNPF regulates ecdysteroid release form the mature ovaries.
266
Identifying the ‘mating factor’
Many studies have addressed a ‘mating factor’ that is transferred from the male to the
female during mating in insects; however, no study to date in R. prolixus has isolated or
characterized the composition of this compound. It is important to note that Davey (1964)
was able to conclude that the ‘mating factor’ is synthesized within the female spermatheca
and not transferred from the male during mating in R. prolixus. The role of the ‘mating
factor’ is to signal the mature ovaries to release ecdysteroids and to release the allatostatic
inhibition of the CC leading to JH release, resulting in an increase in vitellogenesis (Davey,
2007). It is hard to avoid the similar observations recently reported by Van Wielendaele et al.
(2013b), that injections of trNPF increased ecdysteroid levels in the haemolymph and the
ovaries and also resulted in an increase of oocyte size in the ovarioles. Moreover, I found
(Chapter 5) that there was elevated expression of RhoprNPF transcript in the oviduct and
spermatheca of adult female R. prolixus. One cannot just simply conclude that the long-time
elusive ‘mating factor’ is neuropeptide F without more evidence. The contents within mated
spermatheca need to be extracted and sent for matrix assisted laser desorption/ionization time
of flight (MALDI/TOF) mass spectroscopy. In doing so, we can define and isolate candidate
peptides, i.e. those that increase circulating levels of JH in the haemolymph that could
possibly be the ‘mating factor’.
Concluding Remarks
Rhodnius prolixus are blood-feeding hemipterans and only need to mate once in order
to fertilize more than 600 eggs in their lifetime. There are many factors that play important
roles in controlling the synthesis of vitellogenin, oogenesis, vitellogenesis, ovulation, egg
267
movement and oviposition. This thesis demonstrates the importance of FMRFamide-like
peptides and defines many of their roles in the regulation of muscle contraction in the
reproductive tract, as well as egg production and egg laying. Although there is substantial
redundancy in members of the FLP, it is clear that they play an important role in the
reproductive system of this vector of Chagas disease.
268
References
Bronstein, I., Fortin, J., Stanley, P.E., Stewart, G.S.A.B. and Kricka, L.J. (1994).
Chemiluminescent and bioluminescent reporter gene assays. Analytical Biochemistry,
219: 169-181.
Cazzamali, G. and Grimmelikhuijzen, C.J.P. (2002). Molecular cloning and functional
expression of the first insect FMRFamide receptor. PNAS, 99: 12073-12078.
Cerstiaens, A., Benfekih, L., Zouiten, H., Verhaert, P., De Loof, A. and Schoofs, L. (1999).
Led-NPF-1 stimulates ovarian development in locusts. Peptides, 20: 39-44.
Chapman, R.F. (2013). Reproductive system: female. In: The insects: Structre and function.
New York: Cambridge University Press, 295-301.
Chiang, R.G. (1998). Partial localization of a brain factor inhibiting egg production in the
blood-feeding insect, Rhodnius prolixus. Archives of Insect Biochemistry and
Physiology, 39: 126-131.
Davey, K.G. (1958). The migration of spermatozoa in the female of Rhodnius prolixus Stal.
Journal of Expreimental Biology, 35: 694-701.
Davey, K.G. (1964). Copulation and egg-production in Rhodnius prolixus: the role of the
spermathecae. Journal of Experimental Biology, 42: 373-378.
Davey, K.G. (2000). The modes of action of juvenile hormones: some questions we ought to
ask. Insect Biochemistry and Molecular Biology, 30: 663-669.
Davey, K. (2007). The interaction of feeding and mating in the hormonal control of egg
production in Rhodnius prolixus. Journal of Insect Physiology, 53: 208-215.
de Bianchi, A.G., Coutinho, M., Pereira, S.D., Marinotti, O. and Targa, H.J. (1985).
Vitellogenin and vitellin of Musca domestica. Insect Biochemistry, 15: 77-84.
269
269
de Jong-Brink, M., ter Maat, A. and Tensen, C.P. (2001). NPY in invertebrates: molecular
answers to altered functions during evolution. Peptides, 22:309-315.
Duttlinger, A., Mispelon, M. and Nichols, R. (2003). The structure of the FMRFamide
receptor and activity of the cardioexcitatory neuropeptide are conserved in mosquito.
Neuropeptides, 37: 120-126.
Duve, H., Johnsen, A.H., Sewell, J.C., Scott, A.G., Orchard, I., Rehfeld, J.F. and Thorpe, A.
(1992). Isolation, structure, and activity of –Phe-Met-Arg-Phe-NH2 neuropeptides
(designated calliFMRFamides) from the blowfly Calliphora vomitoria. PNAS USA,
89: 2326-2330.
Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E. and Mello, C.C. (1998).
Potent and specific genetic interference by double-stranded RNA in Caenorhabditis
elegans. Nature, 391: 806-811.
Garczynski, S.F., Brown, M.R., Shen, P., Murray, T.F. and Crim, J.W. (2002).
Characterization of a functional neuropeptide F receptor from Drosophila
melanogaster. Peptides, 23: 773-780.
Garczynski, S.F., Crim, J.W. and Brown, M.R. (2005). Characterization of neuropeptide F
and its receptor from the African malaria mosquito, Anopheles gambiae. Peptides,
26:99-107.
Goh, C.-S., Bogan, A.A., Joachimiak, M., Walther, D. and Cohen, F.E. (2000). Co-evolution
of proteins with their interaction partners. Journal of Molecular Biology, 299: 283-
293.
270
270
Gonzalez, R. and Orchard, I. (2008). Characterization of neuropeptide F-like
immunoreactivity in the blood-feeding hemipteran, Rhodnius prolixus. Peptides,
29:545-558.
Insausti, T.C. (1994). Nervous system of Triatoma infestans. Journal of Morphology,
221:343-359.
Kim, J.-H., Cho, E.-Y., Min, C., Park, J.H. and Kim, K.-M. (2008). Characterization of
functional roles of DRY motif in the 2nd
intracellular loop of dopamine D2 and D3
receptors. Archives of Pharmacal Research, 31: 474-481.
Kriger, F.L. and Davey, K.G. (1983). Ovulation in Rhodnius prolixus Stål is induced by an
extract of neurosecretory cells. Canadian Journal of Zoology, 61: 684-686.
Lange, A.B. (1990). The presence of proctolin in the reproductive system of Rhodnius
prolixus. Journal of Insect Physiology, 36: 345-351.
Lange, A.B., Orchard, I. and Te Brugge, V.A. (1990). Evidence for the involvement of a
SchistoFLRF-amide-like peptide in the neural control of locust oviduct. Journal of
Comparative Physiology A, 168: 383-391.
Lange, A.B., Peeff, N.M. and Orchard, I. (1994). Isolation, sequence, and bioactivity of
FMRFamide-related peptides from the locust ventral nerve cord. Peptides, 15: 1089-
1094.
Lee, D., Taufique, H., da Silva, R. and Lange, A.B. (2012). An unusual myosuppressin from
the blood-feeding bug, Rhodnius prolixus. Journal of Experimental Biology, 215:
2088–2095.
271
271
Lee, H.-G., Rohila, S. and Han, K.-A. (2009). The octopamine receptor OAMB mediates
ovulation via Ca2+
/calmodulin-dependent protein kinase II in the Drosophila oviduct
epithelium. PloS One, 4: e4716.
Lutz, D.A. and Huebner, E. (1980). Development and cellular differentiation of an insect
telotrophic ovary (Rhodnius prolixus). Tissue and Cell, 12: 773-794.
Marchese, A., Chen, C., Kim, Y.-M. and Benovic, J.L. (2003). The ins and outs of G protein-
coupled receptor trafficking. TRENDS in Biochemical Sciences, 28: 369-376.
Marciniak, P., Szymczak, M., Rogalska, L. and Rosinski, G. (2013). Developmental and
myotropic effects of the Led-NPF-I peptide in tenebrionid beetles. Invertebrate
Reproduction and Development, 57: 309-315.
Maule, A.G., Shaw, C., Halton, D.W., Thim, L., Johnston, C.F., Fairweather, I. and
Bunchanan, K.D. (1991). Neuropeptide F: a novel parasitic flatworm regulatory
peptide from Moniezia expansa (Cestoda: Cyclophyllidea). Parasitology, 102:309-
316.
Meeusen, T., Mertens, I., Clynen, E., Baggerman, G., Nichols, R., Nachman, R.J.,
Huybrechts, R., De Loof, A. and Schoofs, L. (2002). Identification in Drosophila
melanogaster of the invertebrate G protein-coupled FMRFamide receptor. PNAS, 99:
15363-15368.
Middleton, C.A., Nongthomba, U., Parry, K., Sweeney, S.T., Sparrow, J.C. and Elliott, C.J.
(2006). Neuromuscular organization and aminergic modulation of contractions in the
Drosophila ovary. BMC Biology, 4:17.
272
272
Moyle, W.R., Campbell, R.K., Myers, R.V., Bernard, M.P., Han, Y. and Wang, X. (1994).
Co-evolution of ligand-receptor pairs. Nature, 368: 251-255.
Nässel, D.R. (2002). Neuropeptides in the nervous system of Drosophila and other insects:
multiple roles as neuromodulators and neurohormones. Progress in Neurobiology, 68:
1-84.
Nässel, D.R. and Wegener, C. (2011). A comparative review of short and long neuropeptide
F signaling in invertebrates: any similarities to vertebrate neuropeptide Y signaling?
Peptides, 32:1335-1355.
Nuss, A.B., Forschler, B.T., Crim, J.W., TeBrugge, V., Pohol, J. and Brown, M.R. (2010).
Molecular characterization of neuropeptide F from the eastern subterranean termite
Reticulitermes flavipes (Kollar) (Isoptera: Rhinotermitidae). Peptides, 31:419-428.
Ons, S., Sterkel, M., Diambra, L., Urlaub, H. and Rivera-Pomar, R. (2011). Neuropeptide
precursor gene discovery in the Chagas disease vector Rhodnius prolixus. Insect
Molecular Biology, 20: 29-44.
Orchard, I., Lange, A.B. and Bendena, W.G. (2001). FMRFamide-related peptides: a
multifunctional family of structurally related neuropeptides in insects. Advances in
Insect Physiology, 28: 267-329.
Peeff, N.M., Orchard, I. and Lange, A.B. (1993). The Effects of FMRFamide-related
peptides on an insect (Locusta migratoria) visceral muscle. Journal of Insect
Physiology, 39: 207-215.
Predel, R., Neupert, S., Wicher, D., Gundel, M., Roth, S. and Derst, C. (2004). Unique
accumulation of neuropeptides in an insect: FMRFamide-related peptides in the
273
273
cockroach, Periplaneta americana. European Journal of Neuroscience, 20: 1499-
1513.
Rajpara, S.M., Garcia, P.D., Roberts, R., Eliassen, J.C., Owens, D.F., Maltby, D., Myers,
R.M. and Mayeri, E. (1992). Identification and molecular cloning of neuropeptide Y
homolog that produces prolonged inhibition in Aplysia neurons. Neuron, 9:505-513.
Robb, S., Packman, L.C. and Evans, P.D. (1989). Isolation, primary structure and bioactivity
of SchistoFLRF-amide, a FMRFamide-like neuropeptide from the locust,
Schistocerca gregaria. Biochemical and Biophysical Research Communications, 160:
850-856.
Ruegg, R.P., Kriger, F.L., Davey, K.G. and Steel, C.G.H. (1981). Ovarian ecdysone elicits
release of a myotropic ovulation hormone in Rhodnius (Insecta: Hemiptera).
International Journal of Invertebrate Reproduction, 3: 357-361.
Schneider, L.E. and Taghert, P.H. (1988). Isolation and characterization of a Drosophila
gene that encodes multiple neuropeptides related to Phe-Met-Arg-Phe-NH2
(FMRFamide). PNAS USA, 85: 1993-1997.
Sedra, L. and Lange, A.B. (2014). The female reproductive system of the kissing bug,
Rhodnius prolixus: arrangements of muscles, distribution and myoactivity of two
endogenous FMRFamide-like peptides. Peptides, 53: 140-147.
Sedra, L., Haddad, A.S. and Lange, A.B. (2015). Myoinhibitors controlling oviduct
contraction within the female blood-gorging insect, Rhodnius prolixus. General and
Comparative Endocrinology, 211: 62-68.
274
274
Sevala, V.L., Sevala, V.M., Davey, K.G. and Loughton, B.G. (1992). A FMRFamide-like
peptide is associated with the myotropic ovulation hormone in Rhodnius prolixus.
Archives of Insect Biochemistry and Physiology, 20: 193-203.
Sevala, V.M., Sevala, V.L. and Loughton, B.G. (1993). FMRFamide-like activity in the
female locust during vitellogenesis. The journal of Comparative Neurology, 337: 286-
294.
Tensen, C.P., Cox, K.J.A., Burke, J.F., Leurs, R., van der Schors, R.C., Geraerts, W.P.M.,
Vreugdenhil, E. and van Heerikhuizen, H. (1998). Molecular cloning and
characterization of an invertebrate homologue of a neuropeptide Y receptor.
European Journal of Neuroscience, 10: 3409-3416.
Tsang, P.W. and Orchard, I. (1991). Distribution of FMRFamide-related peptides in the
blood-feeding bug, Rhodnius prolixus. Journal of Comparative Neurology, 311:17-
32.
Van Wielendaele, P., Dillen, S., Zels, S., Badisco, L. and Vanden Broeck, J. (2013a).
Regulation of feeding by neuropeptide F in the desert locust, Schistocerca gregaria.
Insect Biochemistry and Molecular Biology, 43:102-114.
Van Wielendaele, P., Wynant, N., Dillen, S., Badisco, L., Marchal, E. and Vanden Broeck, J.
(2013b). In vivo effect of neuropeptide F on ecdysteroidogenesis in adult female
desert locusts (Schistocerca gregaria). Journal of Insect Physiology, 59:624-630.