Upload
ngonhu
View
216
Download
0
Embed Size (px)
Citation preview
Gang BaoDepartment of Biomedical Engineering
Georgia Institute of Technology and Emory UniversityAtlanta, GA 30332
Fluorescent Probes for Live-Cell Gene Detection
Gene Expression Dynamics in Live Cells
• Recent studies confirm that mechanical forces can alter almost all cellular processes, including cell growth, differentiation, movement, signal transduction, protein production/secretion and gene expression• An example is altered gene expression in endothelial cells under shear flow. We found that eNOS mRNA increased its level by ~4.5 fold under laminar shear for 24 hr, while Klf2 mRNA level increased more than 25 fold with just 2 hr of laminar shear. No change in eNOS and Klf2 mRNA level under oscillatory shear
ST LS 2h LS 8h LS 24h OS 2h OS 8h OS 24h
Rel
ativ
e hK
lf2 m
RN
A a
mou
nt
(nor
mal
ized
by
18S
rRN
A)
0
10
20
30
40Shear Stress-induced Changes in KLF2 mRNA Level in EC
Shear Stress-induced Changes in eNOS mRNA Level in EC
Experimental Challenges in Studying the Dynamics of Live Cells under Mechanical Forces
How to visualize the dynamics of proteins, protein complexes and subcellular structures in living cells in real time?
How to quantify changes in gene express in living cells in real time?
How to monitor changes in protein-protein, protein-DNA, protein-RNA interactions in living cells in real time?
Live-cell Imaging MethodsOptical microscopy is one of the most widely used imaging methods
in biomedical research due to its molecular specificity and fast image acquisition. Optical microscopy methods include Bright field, Dark field, Phase contrast, Differential interference contrast (DIC), Fluorescence, Confocal laser scanning, and Deconvolution microscopy
However, the spatial resolution of conventional optical microscopy, classically limited by the diffraction of light to ~250 nm, is substantially larger than typical molecular length scales in cells
Advanced optical microscope technologies, including STED-4pi, stochastic optical reconstruction microscopy (STORM), photo-activated localization microscopy (PALM), and structured illumination (SI) have been developed recently to overcome the diffraction limit
Stochastic Optical Reconstruction Microscopy (STORM)
STORM uses photo-switchable fluorescent probes to temporally separate the otherwise spatially overlapping images of individual molecules, allowing the construction of high-resolution images.
STORM can achieve three-dimensional, multicolor fluorescence imaging of molecular complexes, cells, and tissues with ~20 nm lateral and ~50 nm axialresolutions.
Xiaowei Zhuang
Tagging Methods for Live-cell Imaging of Proteins
Fluorescent ProteinsOrganic FluorophoresQuantum Dots FlAsH, ReAsHSNAP, HaLo
No existing method that can be used for imaging endogenous proteins in living cells
Study the Assembly and Disassembly of HR and NHEJ Machines that Repair DNA Double Strand Break
HR NHEJ• NHEJ and HR have different features in repairing DSBs. However, HR is likely more accurate than NHEJ in DSB repair• Not clear what controls pathway choice (role of cell-cycle stage)
• Need to understand both NHEJ and HR pathways
• Similarities and differences in design principles
• Foci structures
Tagging NHEJ with Fluorescent Proteins
Dynan Lab
Orthogonal Protein Tagging/targeting
• Fluorescent protein (FP) and quantum dot (QD) based approaches each has its pros and cons:
- FP based tagging is highly specific and easy to color-multiplex, but it’s difficult to visualize the formation of a single NHEJ in a living cell. Low signal level, photobleaching, and possible interference are major issues
- QDs have high signal intensity and photostability, and the advantage of color multiplexing. But functionalized QDs are large (12-20 nm), may interference with complex assembly, and have low signal-to-noise ratio
• There is a need to develop better probes and tagging strategies with small size and using organic fluorophores
SNAP tag and Tetra-cysteine Tag
SNAP tag Benefits:1. Stable covalent labeling2. One tag, multiple
substrates, flexible color choice
3. Higher signal intensity4. Better photostability
ReAsH Labeling Molecule ReAsH – TC complex (Non-Fluorescent) (Fluorescent)
ReAsH Labeling Molecule ReAsH – TC complex (Non-Fluorescent) (Fluorescent)
ReAsH-EDT2 tag
Orthogonal Tagging Strategies
enzyme catalyst
NH2biotin
biotin ligase
NH2 HN lipoatelipoic acidligase
Simultaneous labeling and imaging of two receptors in HEK cells. HEK cells coexpressing a LAP-LDLR fusion and either AP-EGFR (a) or AP-EphA3 (b) were labeled by first treating with LplA, biotin ligase, azide 7 and biotin, followed by cyclooctyne-Cy3 to derivatize the azide, followed by monovalent streptavidin-Alexa Fluor 488 to detect the biotin.
Ting Lab
Alice Ting
Major Issues and Challenges in Imaging Protein Machines in Live Cells
Visualizing low-copy-# proteins in a single cellular machine
Requires orthogonal tagging and multi-color imaging
Need high signal intensity and low photobleaching to increase signal-to-noise
Potential issues with interference and spatial resolution
Tagged proteins vs. endogenous proteins, free components vs. assembled components, bound probes vs. unbound probes
The Central ‘Dogma’ of Biology
Imaging Gene Expression in Living Cells• The need to detect gene expression in vivo
– Monitor in real-time the changes in mRNA expression level due to disease states, toxic assaults, stimuli, drug leads, etc
– Study mRNA processing, localization, and transport, and quantify the knock-down effect of siRNA
– Perform disease detection and diagnosis
• In vitro methods such as real time PCR, Northern blotting and DNA microarrays rely on the use of cell lysates and therefore cannot obtain temporal & spatial information• FISH (fluorescence in situ hybridization) assays require washing to achieve specificity, cannot be used for live cells • GFP and other reporter systems cannot measure endogenous mRNA expression in living cells
Fluorescent Probes for Live-cell RNA Detection
Cellular Delivery of Probes
SLO CCP
SLO + NLS
How to Design a Molecular BeaconSurvivin cDNA: total 429a tgggtgcccc gacgttgccc cctgcctggc agccctttct caaggaccac
cgcatctcta cattcaagaa ctggcccttc ttggagggct gcgcctgcac cccggagcgg atggccgagg ctggcttcat ccactgcccc actgagaacg agccagactt ggcccagtgt ttcttctgct tcaaggagct ggaaggctgggagccagatg acgaccccat agaggaacat aaaaagcatt cgtccggttg cgctttcctt tctgtcaaga agcagtttga agaattaacc cttggtgaat ttttgaaact ggacagagaa agagccaaga acaaaattgc aaaggaaacc aacaataaga agaaagaatt tgaggaaact gcgaagaaag tgcgccgtgccatcgagcag ctggctgcca tggattga
• Select sequences of 15-20 bases that are unique to the target gene
• Add stem sequences and determine the melting temperature
• Perform solution studies to determine signal-to-noise ratio
• Perform cellular studies to check the target accessibility
Different mRNA localization in Living Cells
Survivin mRNA in MiapaCa-2 β1-integrin mRNA in MG63 AR mRNA in LNCaP
Target accessibility
• In designing molecular beacons it is necessary to avoid targeting sequences that are double-stranded, or occupied by RNA binding proteins
• It is often necessary to select multiple(3-12) unique sequences along the target mRNA, and have correspondingmolecular beacons synthesized, testedand validated
Rhee et al, NAR, 2008
A molecular beacon design issue
Molecular Beacon Designs for Targeting BMP-4 mRNA
All target sequences are unique to BMP-4
MB1: Start codon regionMB4: FISH probe binding siteMB2, 6: siRNA binding sitesMB7, 8: Anti-sense oligo
binding sitesMB3, 5: Loop region based
on mFOLD
Rhee et al, NAR, 2008
Live-cell Imaging of BMP-4 mRNA
Rhee et al, NAR, 2008
MB8b
GFP
MB8a
GFP
5’ GTTGAAAAATTATCAGGAGATGGTGGTAGAGGGGTGTGGAT 3’MB8b
MB8
MB8a
MB8
GFP
Rhee et al, NAR, 2008
Viral Infection Detection
Molecular Beacons targeting the genome of RSV
White-light image of lung epithelial cells
Fluorescence image of viral genome (red) and viral protein (green)
Background signal of non-infected cells
Santangelo et al, JVI 80, 682 (2006)
Spreading of RSV infection
xzdtdx βλ −=
xzdtdy β=
zydtdz γα −=
Santangelo et al, JVI 80, 682 (2006)
Day2 post infection
Dynamics of Filamentous Vital Particles
Santangelo and Bao, NAR, 2007
Detection of Nuclear RNAs
• Understand the dynamics of RNA synthesis
• Localization and co-localization of nuclear RNAs
• Study nuclear RNA transport
Nitin & Bao, Bioconj Chem. 2009
U3 Small Nucleolar RNA U1 Small Nuclear RNA
Detection of U3 snoRNA and U1 snRNA
Nitin & Bao, Bioconj Chem. 2009
U2 snRNA and U1-U2 Colocalization
U2 small nuclear RNA U1/U2 colocalization
Nitin & Bao, Bioconj Chem. 2009
A New Model of Cancer Development
Reya et al, Nature 414:105, 2001
Need to isolate cancer stem cells from tumor and analyze them in order to develop new drug molecules
Surface marker protein
Fluorescence sorting/detection
Intracellular marker protein/mRNA
Limited to surfacemarker proteins
Flow cytometer
stem cell of interest
Magnetic sorting
Detection and Isolation of Cancer Stem Cells
• Typically only 1-10 cancer stem cells per 1,000,000 cancer cells. To have very sensitive detection, we need to target multiple cancer stem cell markers• Stem cell surface markers (e.g. SSEA-1) can be used to detect stem cells but they are very limited• Need to keep cells alive and minimize perturbation to cell biology• Many genes are highly expressed in stem cells, including Oct3/4, Sox2 and Nanog. Therefore, targeting mRNAs of these genes is very attractive• We target both mRNA and protein markers and use FACS to process cells
Targeting Oct 4 mRNA in Cancer Stem Cells Using Molecular Beacons
PCR results of Oct4 mRNA expression 4 days after retinoic acid treatment in mouse P19 embryonal carcinoma cells
Immunocytochemistry of Oct-4 protein (Red) before (UD) and after (RA) differentiation
WJ Rhee & G Bao, 2009
close to termination codon
Location of Target Sequences
WJ Rhee & G Bao, 2009
Signal from Oct-4 Targeting Molecular Beacons
Only MB3 and MB4 gave high signal levels, indicating good target accessibility, whereas all other MBs (MBs1-2, MB5-12) had low signal due to poor target accessibility
MB3 MB4
UD Differentiated UD Differentiated
WJ Rhee & G Bao, 2009
UD Differentiated
UD Differentiated
Total mRNA
Red: Oct-4 mRNA, Green: mitochondria, Blue: Nucleus
Fluorescence Imaging of Oct-4 mRNAand Total mRNA in live P19 Stem Cells
Green: total mRNAs, Blue: Nucleus
Control experiment using total RNA staining dye
WJ Rhee & G Bao, 2009
no probe with probes
UD Differentiated
Total mRNA
Sig Oct4 mRNA (red) and SSEA-1protein (green)
Oct
-4 M
B
Ran
dom
MB
Diff
eren
tiate
d
UD
Flow Cytometry Assay
Detection of Oct-4 mRNA and SSEA-1 Protein in Live P19 Stem Cells
SSEA
-1
Oct-4 mRNA
Mixed population
WJ Rhee & G Bao, 2009
Acknowledgements
Dr. Andrew Tsourkas (beacon solution studies)Dr. Phil Santangelo (viral infection studies)Dr. Wonjong Rhee (cancer stem cell studies) Dr. Nitin Nitin (nuclear RNA & beacon dynamics studies)Dr. Yiyi Zhang and Dr. Steve Dublin (NHEJ tagging using SNAP & ReAsH)
Dr. William Dynan (NHEL tagging using fluorescent proteins)Dr. Alice Ting (Orthogonal tagging)
NIH (PEN, CCNE, BRP, NDC), NSF