Final Copy of Cotton-Mealy Bug PC-I 17-02-08 final draft Cop… · BIOLOGICAL CONTROL OF MAJOR COTTON PESTS INCLUDING MEALY BUG IN PAKISTAN (PC-I) MINISTRY OF FOOD, AGRICULTURE AND

0

BIOLOGICAL CONTROL OF MAJOR COTTON PESTS

INCLUDING MEALY BUG IN PAKISTAN

(PC-I)

MINISTRY OF FOOD, AGRICULTURE AND LIVESTOCK

GOVERNMENT OF PAKISTAN

January, 2008 Revised as per comments made in Pre-CDWP meeting held on 22 April, 2008, subsequently

in CDWP held on 30 April 08 and Consultative Meeting on 17 May 08

1

Code Number for the Project______________

(To be filled in by Planning Commission)

1. Name of the Project: Biological Control of Major Cotton Pests including Mealy

Bug in Pakistan

2. Location: Punjab: (all cotton growing areas)

Sindh: (all cotton growing areas)

Balochistan: (all cotton growing areas)

NWFP: (all cotton growing areas)

Federal: (FCU, NARC, CCRI, NIAB)

International: (CABI South Asia)

3. Authority responsible for:

i. Sponsoring: Government of Pakistan

ii. Execution: Ministry of Food, Agriculture and Livestock, Islamabad:

Government of the Punjab (AARI, Faisalabad)

Government of Sindh (ARI, Tandojam)

Government of Balochistan (ARI, Quetta)

Government of NWFP (ARI, D. I. Khan)

Federal (NARC, Islamabad, CCRI, Multan, CRI, Sakrand,

NIAB, Faisalabad)

International Institute (CABI South Asia, Rawalpindi)

iii. Operation, maintenance and responsibilities

Organization Responsibility

MINFAL, Islamabad Coordination & Monitoring

CABI South Asia,

Rawalpindi

Biological control procedures and methodologies, exploration and introduction of exotic

natural enemies, mass production of endemic and exotic natural enemies of cotton pests at

natural enemy field reservoirs, laboratory, training of farmers, entomopathogens

interventions on model farms in collaboration with AARI, Faisalabad, NIAB and ARI

Tando Jam

Ayub Agri. Res Inst,

Faisalabad

Mass scale rearing of natural enemies for biological control in Punjab and training of

farmers. Establish insectary Establishment of a Model Farm of Biological control for

demonstration in collaboration with CABI

Central Cotton Res

Inst., Multan

Safe use of pesticides, field surveys and study of population development in farmers fields

and project managed farms for control of mealy bug in Punjab

Cotton Research

Institute, Sakrand

Safe use of pesticides, field surveys and study of population development in farmers fields

and project managed farms for control of mealy bug in Sindh.

Agri. Res Institute,

Tandojam

Mass scale rearing of natural enemies for biological control in Sindh and training of

farmers. Establishment of a model farm of Biological control for demonstration in

collaboration with CABI .

National Agri. Res

Center, Islamabad

Mealy bug control through bio-pesticides

Agriculture Res Inst.

D. I. Khan

Pests incidence in cotton and other plants, safe use of pesticides, biological control

interventions

Agriculture Res Inst

Quetta

Mass scale rearing of natural enemies for biological control in Balochistan and training of

farmers and safe use of pesticides for mealy bug control

NIAB, Faisalabad Study biology and ecology of cotton insects. Assist AARI on biological control

interventions at model farm for demonstration plot of biological control in collaboration

with CABI

2

iv. Concerned federal ministry: Ministry of Food, Agriculture and Livestock,

Islamabad

4. Plan Provision

i. If the Project is included in the

medium term/ five years Plan,

Specify actual allocation –

ii. If not included in the current

plan, what warrants its inclusion

and how it is now proposed to be

accommodated

It is continuation of the one year’s on-going

project (costing Rs 26.470 million). Presently

its operations are being financed through ASPL

but its three years phase will be funded out of

PSDP. Total block

provision

Amount

already

committed

Amount

proposed for

the project

Balance

available iii. If the project is proposed to be

financed out of block provision,

indicate: - - - -

5. Project objectives and its relationship with Sector’s objectives

The project objectives are in line with the Sector’s overall objectives. The management

strategy of major pests on cotton will be developed and the knowledge already available on

management of insect pests will be implemented on model farms of 500 acres in one union

council one each in province of Punjab and Sindh. In the first phase, cotton pests will be

addressed on priority as cotton crop is being badly damaged by mealy bug during last two

years (2005-06 & 2006-07). The Experience gained and knowledge generated by the project

will greatly help to enhance productivity of other crops as well by minimizing pest losses and

increase farmer’s income which will directly play effective role in poverty alleviation in rural

areas. The knowledge generated on management of mealy bug and other pests on cotton will

be disseminated through workshops, seminars, farmer gatherings, electronic media, Farmers’

Field Schools approach to create awareness among the researchers, extension workers and

the farmers. The specific objectives of the project are as under:

Specific objectives:

• The project aims at developing and implementing short term and long term biological

control based IPM techniques for controlling major pests on cotton including mealy

bug.

• Protection of natural resources and their utilization in short term and long term

management of mealy bug on cotton.

• Exploration and introduction of exotic natural enemies for control of mealy bug.

• Achieve sustainability in production of cotton crop.

• Establish model farms for others to follow the good agriculture practices in

minimizing insecticides use, capacity building of farmers’ community, extension

workers, researchers in ecological pest management.

3

• Identification of the cotton mealy bug parasitoid complex using molecular markers/

PCR primers.

• Develop and integrate options such as biopesticides and entomopathogenic nematodes with biological control for controlling pests on cotton crop.

6. Description, justification and technical parameters

A) Scope

Cotton plays a pivotal role in Pakistan’s economy. It accounts for about 60% of its export and

over 55% of domestic edible oil production, provides raw materials to about 461 textile mills,

1200 ginning factories (PCCC, 2007) and about 6000 small oil producers. Pakistan ranks fourth

in cotton production and third in cotton consumption.

In view of cotton importance, Government of Pakistan supports all efforts which improve cotton

yield, however, the yield of lint per hectare is much lower compared to other cotton producing

countries like Australia, China, Egypt, Turkey and Syria. Insects and diseases are the main

constraints in cotton production. In cotton alone, pest attack causes a loss of billions of rupees

annually (Ahmed, 1995). It is difficult to estimate correct and scientific data on the losses

caused by insect pests and diseases as many variables and complicated factors are involved. In

monitory terms the loss to crops in Pakistan is estimated around Rs 130 billion annually (Baloch,

1995).

Plant protection in the Pakistan is mostly based on pesticides. The pesticides consumption which

was 665 tons in 1980 has now increased many times more exceeding 45,000 tones annually.

Cotton is the recipient of more than 70% of pesticides used in all crops. The use of pesticides in

Pakistan is so common that it is the second largest consumer of pesticides in Asia. This colossal

increase in pesticide consumption has not led necessarily to increase the yield of crops (Poswal

& Williams, 1998; Ahmed & Poswal, 2000). The most concerning situation is experienced with

the present control strategy of repeated use of insecticides for mealy bug control on cotton that

has made the pest more devastating to fruits, vegetables, fodders, ornamental plants in addition

to cotton.

Contrary to chemical control, biological control based IPM increases the ecological and

economic sustainability of farming systems by reducing both the risk of crop losses and risk of

human health from insecticides use. This approach is not only friendly to human health and the

environment but it is also sustainable and self perpetuating. The benefit - cost ratios are

correspondingly high (Zeddies et al, 2001). Further more the use of insecticides in crops has

resulted in destruction of natural enemies of the pests and pest resurgence is common and more

insecticides have to be applied to save the crop (Abbas and El-Deeb, 1993).

The immediate application of current ecological knowledge and technology to pesticides

dilemma can reduce about 50% use of pesticides. The achievement of complete control by

natural enemies is ideal goal and generally the most practical single approach to pest

management. However, even though its use can be very greatly expanded, this must be based on

increased bio-ecological research. There are refractory pests not amenable to control by natural

enemies and these will require to be addressed with biological control based IPM technologies

where pesticides if used safely may find its place in effective management of pests within

tolerable limits.

4

It is not easy to shift the present chemical control based pest management to biological control

based IPM in agricultural crops in Pakistan especially in cotton which is heavily sprayed with

pesticides. The change to ecological pest management is a practical matter to the farmer and he

is not prepared to suffer any interim financial losses during the change over. Pest control strategy

dependent on heavy spraying and dusting of pesticides can not be merely stopped with the

assurance that biological control will take over. Therefore, there is need to display the biological

control based IPM of pests mainly on cotton the crop greatest recipient of the pesticides used in

the country.

To begin with an area of 500 acres of cotton in a Tehsil/Union in Punjab and Sindh is in view to

be taken as pesticide free area (practically an area where pesticides if at all become necessary

will be used safely on need basis only on a limited quantity for a limited time.) The experience

gained in this area will be transferred at the same time in adjoining areas and then spread country

wide in the second phase of the project. The plant protectionists and farmers need to be trained

on the concept of farmer field school making community aware of advantages of ecological pest

management in achieving sustainability in yields and improvement in quality of produce with

minimum input costs and better profit. The farmers of this area will have access to markets that

pay more for quality produce at the national and international level.

Pest management programs have to be designed for each area by a team of entomologists and

agronomists in consultation with subject specialists. Training for farmers and extensions on the

pattern of farmer field schools are to be arranged and whole community is to be involved in

ecological management of pests in cotton. The plants as alternate hosts of cotton pests are also to

be considered in management schemes.

The basic knowledge of the biology and ecology of insect pests and their natural enemies

associated with cotton in Pakistan is available with CABI SA, CCRI, AARI and other

organizations that can be best utilized in controlling these pests through biological control based

IPM approach. Already foundation on mass production of predators and their conservation have

been laid down for a notorious pest mealy bug by CABI SA and we can move forward for using

them effectively in controlling this pest on cotton and other crops. Classical biological control

has also to be attempted as well for exotic pests like mealy bug on cotton.

The government support to farmers in biological control of pests will help to enhance the

confidence of farming community to rely more on renewable natural resources in perpetual

control of pests than depending on pesticides for timely relief in lowering down pests’ numbers

in their crops.

It is essential that Pakistan build on biological control based IPM research traditions and promote

supervised control of pests than giving free hand to private sector on massive use of pesticides,

strengthen extension services at village level on farmer field school concept in close

collaboration with the research findings immediately transferable to farmers for IPM /organic

farming.

B) Background

i) Major cotton pests other than mealy bug

The spectrum of pests of cotton is broad and the list is long. They are divided in two major

groups. The first group is of sucking pests (white fly, thrips, jassids, aphids and mites) and

5

second group is of bollworms (spotted boll worm, pink bollworm, African bollworm, army worm

etc). So far, white fly, boll worms and army worm have the major pests of cotton crop. All

efforts were focused to control these pests with pesticides ignoring the basic fact that most of

these pests have good natural enemy complexes. Their role had been completely ignored while

deciding for chemical control based plant protection policy. The basic knowledge of the biology

and ecology of insect pests and their natural enemies associated with cotton in Pakistan is

available with CABI SA, CCRI, AARI, NIAB and other organizations and can be best utilized in

controlling these pests with holistic approach through biological control based IPM considering

the whole agro ecosystem.

ii) Mealy bug

Mealy bug is a new pest on cotton in Pakistan. CABI SA had conducted 15 year survey of scale

insects and mealy bugs in Pakistan but this complex of species of Phenacoccus was never

recorded before 2005. Recently, the mealy bug has gained a prime importance. This insect is

highly polyphagous. It has attacked not only cotton but it has engulfed almost whole agriculture

of Pakistan and needs to be addressed on top priority. Its infestation has been observed on about

160 plants by CCRI, Multan during last three years. It has caused a huge economic loss to cotton

crop during last three years. Therefore, this pest needs to be addressed on priority as it has

impacted on whole agricultural flora.

This was first detected damaging cotton and other plants at agriculture research farm Vehari in

2005. It has now been recorded by CCRI on vegetables (tomato, egg plant, okra etc), field crops

(chili, tobacco, wheat, fruits, etc), ornamental plants, weeds, fodders and is serious threat to

agriculture of Pakistan. According to the present study by FAST National University reveals that

this insect is responsible for ruining an estimated 3.1 million bale of cotton. Further more

farmers have to bear additional costs Rs 1500 per acre for its control with insecticides. In most of

cases the pesticides were in effective in controlling it on cotton. It has been noted that these

could suppress mealy bug incidence only to a specific level (DAWN News, 22 October, 2007).

The recent pest status of mealy bug on cotton and other crops demand appropriate control

strategy.

iii) Formulation of One Year Project A one year project titled “Control of Cotton Mealy Bug in Pakistan” was prepared on the

instructions of MINFAL to initiate interventions to combat mealy bug immediately with the view

that preparation and approval of main project on mealy bug may take 6 to 12 months. Any delay

in controlling this pest may cause huge losses to cotton. Therefore, a one year project was

prepared which was approved by DDWP of MINFAL at a cost of Rs 26.470 million and its

funding was give from ASPL project. At that time it was envisaged that the full project (of 3-4

years duration) will be prepared and approved during the implementation of the one year project.

Under this project country wide filed interventions were started according to a planned approach.

The followings are the major out come/achievements of the project:

a) Identification of mealy bug: Two pronged approach was used for the identification of

the insect. On one hand its samples were sent British Natural History Museum and they

tentatively identified as Phenacoccus solani Ferris.

On the other hand its molecular identification was done by NIBGE and CABI scientists.

In this study a set of primers (set1F and set1R) was designed in 18S ribosomal sequence

available in the database (Acc. No. AY426058) and were synthesized by a commercial

company (eoligoes USA). DNA from three individuals collected from Multan, Faisalabad

6

and Rawalpindi each was extracted by protenase K method. PCR was carried out using

primers set1F (GAATTAAGCCATGCATGTCTCAGTGCAA) and Set1R

(CCTGCCTAATTGATCCTCGTGTGACCAAG) in standard conditions and expected

size PCR product were obtained. PCR products were cloned in cloning vector

(pTZ57/RT) and confirmed by restricting with endonucleases EcoRI and PstI. Clones

were sequenced commercially by Macrogen (Korea). Sequences of all three individuals

were checked for identification with the Korean sequence. Blast search showed that all

three genes from local species were 97% identical to Phenacoccus solani. Similarly all

the three sequences of local mealybug genes were aligned and they showed 100%

similarity to one another, which shows that same species (Phenacoccus solani) is found

in those districts on cotton and Hibiscus. Phylogenetic analysis was performed using

thirty three corresponding closest matching sequences in the database (Genbank) which

were aligned using ClustaX. In evolutionary tree all the sequences clearly grouped

according to their genera. Keeping in view the results of sequences and phylogenetic

analysis we are able to suggest that the local species from Pakistan on cotton is same or a

close relative of P. solani and still more sequences from different areas of Pakistan are in

process.

b) Establishment of natural enemies (of mealy bug) field reservoirs: Three field

reservoirs one each of 5 acres at Multan, Tandojam and Lasbela have been established to

develop mass rearing techniques of mealy bug predators and their conservation. Over a

fortnight intervals a capacity was achieved of production of predators in thousands. This

capacity has to be enhanced to their production in millions. This still needs a lot of

improvement to make easier for farmers to adopt the technique at their farms. Studies for

conservation of predators are also going on at these filed reservoirs. Some of the

promising predators have been identified who are density dependent and their population

fluctuates along with the population of mealy bug. In future, with augmentation and their

conservation these predators can be utilized for controlling mealy bug. Such field

reservoirs will turn out into field insectaries for mass production of predators. From

where the predators could collected and released at farmers fields.

c) Biological studies of mealy bug: The biological studies indicate that mealy bug

breeding pattern changes with the season in a year. For example in winter, the mealy bug

started laying eggs with out forming pouch attached to the body, while in summer they

form pouches which are attached to their body. In laboratory it has been found that the

unmated females laid eggs with out any pouch where as the mated females laid eggs /

nymphs in a pouch attached with the body. The mealy bugs have been found breeding

almost through out the year in Sindh where as in Punjab, where winters are cold, its

breeding slowed down. Over wintering behaviors has also been studied. At Mutlan, its

over-wintering second and third instar nymphs were found in the roots of sunflower, and

crumpled leaves of sunflower and Anthorium sp. There may be more over wintering sites

which need to be studied and detected.

d) Identification of natural enemies associated with the mealy bug: Twelve species of

predators were recorded associated with the mealy bug in Pakistan. These include

Coccinellids {Brumus suturalis, Scymnus coccivora, Scymnus sp, Nephus sp, Menochilus

sexmaculatus, Coccinella septempunctata, Hyperaspis spp(2)}, Neuropteran

{Chrysoperla sp}, Ceccidomyid {an unidentified sp) and hemipteran {unidentified

spp(2)} by CCRI Multan, AARI Faisalabad, ARI Tandojam and CABI SA. Some of

these predators such as Brumus suturalis, Scymnus coccivora were promising as they

7

were density dependent and their population fluctuated along with the host mealy bug.

Chrysoperla sp was also recorded in large numbers associated with mealy bug on some

plants like cotton, sunflower and Abutilon. Besides predators, two species of parasitoids

were also reared occasionally from the mealy bug.

e) Introduction of exotic predators: Cryptoleamus montrouizeiri known as mealy bug

destroyer has been imported by CABI SA from California. This species which is of

Australian origin has been introduced in over 50 countries for controlling mealy bug. Its

colony has been well established in the laboratory at Multan. Its both larvae and adults

feed on all development stages of the mealy bug. It has high biotic potential and feeding

rate. Techniques are being developed for its mass production and release in the field for

studies on its role for controlling mealy bug in different climates of cotton growing areas

of Pakistan. Studies are required for identifying the requirements of the predator

necessary for its acclimatization and breeding in harsh summer and winter climates of

Pakistan. This has also been supplied to AARI Faisalabad, CCRI Multan, ARI Tando

Jam and NIAB Faislabad for mass production at their centers.

f) Safe use of pesticides: Several pesticides were regularly studied/tested by the AARI

Faisalabad, CCRI Multan, ARI Tando Jam. Following have been recommended to

farmers to control mealy bug: (i) Profenofos, (ii) Methidathion, (iii) Acetamitrid, (iv)

Methomyl, (v) Carbaryl, (vi) Imidachloprid and (vii) Chlorpyriphos.

g) Developing GMOs for the control of mealy bug: Studies are in progress at NIBGE

for developing genetically modified cotton which would be tolerant / resistant to mealy

bug. They have identified, Hvt gene which is having a gene product effective in killing

mealy bug. Further testing of gene product in cotton plant and its expression at

appropriate time is needed.

h) Formulation of strategy for the control of cotton pests: During the one year project,

mealy bug attack on cotton crop of 2007-08 remained a hot topic of Standing Committee

of National Assembly on Agriculture. This issue was addressed and discussed threadbare

in at least five such meetings. It got top priority of the parliamentarians, government

institutions and farming community in particular. All corners stressed unanimously for

developing a sustainable solution for controlling the menace of the mealy bug. The issue

was also discussed with P & D division in three meetings. During these meetings, P & D

Division suggested to prepare a three years project on biological control of major pests of

cotton with special emphasis on mealy bug. During the year, various strategies were

worked out for the control of the mealy bug and other major insects of cotton. The figure

given below summarizes the major pests and their control options.

8

A brief graphic representation of insect pests of cotton and their control options are given below:

C) Justification

C) Justification

Mealy bug

Whitefly

Jassids

Thrips

Aphid

Boll worms

Army worm

Boll worms Sucking Mass production,

conservation and

augmentation of

endemic predators at

parasitoids at NEFR

& Farmer fields

Integration of other

options such as

entomopathogenic

nematodes,

biopesticides, Hvt

gene product for

controlling mealy

bug.

Cotton (major pests)

Control options for

mealy bug

Classical

biological

control

Import of

parasitoids

from

California

Import of

Cryptolaemus

montrouzieri

Mass

production &

augmentation

Mass

production &

augmentation

Control options for sucking pests other than mealy

bugs on cotton Control options for Boll worms

American

boll

worm

Pink

boll

worm

Earias

spp. Army

worm

Augmentati

on of egg

parasitoids

+

Mass

collection of

larvae &

release back

of

parasitoids

+

Entomopath

ogenic

nematodes

+

Black light

traps

+

Mating

disrupting,

etc

Augmentati

on of Egg

parasitoids

+

Mass

collection of

larvae &

release back

of

parasitoids

+

Entomopat

hogenic

nematodes

Light traps

+

Mating

disrupting,

etc

Augmentat

ion of Egg

parasitoids

+

Mass

collection

of larvae

release

back of

parasitoids

+

Entomopat

hogenic nematodes

Light traps

+

Mating disrupting,

etc

Augmentati

on of Egg

parasitoids

+

Mass

collection of

larvae for

natural enemies &

release of

parasitoids

+

Entomopath

ogenic

nematodes

s

Black light

traps +

Biopesticide

s , etc

Whitefly Jassid

Thrips

Aphids

Conservatio

n of

predators &

parasitoids

+

Cultural

control

+

Other

options

(entomopat

hogenic

nematodes,

biopesticide

s + seed

treatments+

IGRS),

etc)

Conservatio

n of

predators &

parasitoids

+

Cultural

control

+

Other

options

(entomopat

hogenic

nematodes,

biopesticide

s + seed

treatments+

IGRS) ,

etc)

Conservatio

n of

predators

&

parasitoids

+

Cultural

control

+

Other

options

(entomopat

hogenic

nematodes,

biopesticide

s + seed

treatments+

IGRS), etc)

Conserva

tion of

predators

&

parasitoi

ds

+

Cultural

control

+

Other

options

(entomop

athogenic

nematode

s,

biopestici

des + seed

treatment

s+ IGRS),

etc

9

C) Justification

Plant protection in Pakistan is mostly based on pesticides. The failures of the chemical method

for controlling pests are mainly due to adverse effects on natural enemies compounded by

increasing development of resistance by pests to pesticides. Resultantly where farmers had to

spray once to control the pests now they have to spray a crop over 10 times especially on cotton

leaving it not much profitable specially the small farmers who now have started shifting their

priority from cotton to other crops.

Chemical based control program in crops has actually increased pest problems, disturbed the

agro-ecosystem and has affected the non-target and environment friendly organisms such as

parasitoids, predators and birds. Disturbance in an agro-ecosystem led the new pest problems

through resurgence and resistance processes in the naturally occurring pest populations.

Indiscriminate use of pesticides has destroyed the biocontrol agents in agro-ecosystems. The

populations of natural enemies in cotton growing areas have declined up to 90% (Hasnain,

1999). The plant protection policy in Pakistan needs revision and has to be based considering the

basic fact that pests are bio-ecological problems and not the chemical problems and they need to

be dealt with the principles of ecological pest management. World over the trends in crop

protection are shifting from chemical control to ecological pest management whereas Pakistan is

far behind in the correcting its farming systems and production procedures in line with the

international standards set under WTO. We have to comply with the international standards and

reverse all negative trends by 2015 otherwise will face sever set back in trade of farm produce at

national and international level. For achieving this target the present project will play the major

role in setting up a workable system of biological control based IPM which lead Pakistan to

comply with the international standards of Good Agriculture Practices (Euro-Gap & Global-

GAP).

The Project

D. Technical Parameters & Technology Transfer

(i) Project Components S # Components Responsible Institutes

i. Biological control of cotton pests with emphasis on

mealy bug using insect parasitoids and predators

CABI, ARI (TJ,DIK,QT),

CCRI, Multan, AARI (FD) &

CRI, Sakrand

ii. Establish Model farms to demonstrate the biological

control IPM of cotton pests using all techniques and

approaches including Entomopathogenic nematodes

CABI, ARI (TJ), AARI (FD)

& NIAB

iii. Bio-pesticides development, their introduction &

promotion at farm level

NARC

(ii) Institutes involved in implementation of the project

i. MINFAL, Islamabad

ii. CABI South Asia, Rawalpindi

iii. Ayub Agriculture Research Institute, Faisalabad (AARI, FD)

iv. Central Cotton Research Institute, Multan (CCRI)

v. Cotton Research Institute, Sakrand

10

vi. Agriculture Research Institute, Tando Jam (ARI, TJ)

vii. National Agriculture Research Center, Islamabad (NARC)

viii. Agriculture Research Institute, D. I. Khan (ARI, DIK)

ix. Agriculture Research Institute, Quetta (ARI, QT)

x. NIAB, Faisalabad

(iii) Distribution of work and responsibilities for Mealy Bug control

CABI SA, Rawalpindi

a) This center will operate at Rawalpindi, Multan, Las Bela & Tando Jam.

b) Development of IPM of mealy bugs for control on cotton and other economic plants.

c) Identification of the mealy bug complex and their natural enemies associated with cotton

and other plants.

d) Train staff of coordinating units in methodology of sampling, rearing of mealy bugs and

their natural enemies data keeping.

e) Basic research on impact of conservation and augmentation of predators and parasitoids

on controlling the mealy bugs on cotton, weeds and ornamentals at the natural enemies

field reservoirs and farmers fields.

f) Importation of exotic parasitoids and predators.

g) Screening, mass multiplication; release of endemic and exotic natural enemies and asses

their impact on mealy bug populations in collaboration with coordinating units.

h) Maintenance of field reservoir of natural enemies for their mass production and

development of technology for their conservation. For this purpose, five acre plots will be

hired in three cotton growing area (i.e., one each at Multan, Tando Jam & Las Bela )

where preferred host plants of the mealy bug including cotton will be grown over the year

and natural enemies of the mealy bug parasitoids and predators will be continuously

released and conserved. These plots will be left unsprayed. On build up of high

populations of natural enemies they will disperse to adjoining fields and this plot will

serve as a reservoir of the natural enemies of the mealy bug. The population of the mealy

bug and natural enemies will be followed and compared with the farmers managed fields

by coordinating units. This field will also serve as a source of parasitoids for other cotton

pests. The researchers working on cotton pests other than mealy bug can also benefit for

studies and will be a source of obtaining natural enemies for studies and management of

cotton pests. This farm will be sort organic farm. Preferred host plants of mealy bug (egg

plant, rose of China, okra, tomato, cotton, Abutilon, itsit, Amaranthus, din ka raja, wheat,

etc will be grown on farm for studies and technology development of conservation of

natural enemies).

i) Facilitate in holding national and international workshops to share the knowledge gained

in controlling mealy bug on cotton and other plants in different ecological areas of

Pakistan.

j) Collaboration with foreign institutes for collection, screening and supply of natural

enemies in Pakistan.

k) Visit abroad for search of natural enemies of Phenacoccus spp and on site observations of

association of natural enemies with fauna and flora, screening and selection of natural

enemies for introduction in Pakistan.

11

l) Transfer of IPM technology to farmers in collaboration with coordinating extension units

through FFS approach.

m) Molecular studies for confirmation of species identification of Phenacoccus complex .

AARI, Faisalabad

a) This center will operate at Faisalabad, Vehari, Khanewal and other cotton growing areas of

Punjab). b) Study population development of the mealy bugs and their natural enemies on vegetables,

crops and cotton in different seasons of the year.

c) Conduct surveys for endemic natural enemies of the mealy bugs on vegetables, major

crops, weeds, forest and ornamental plants.

d) The knowledge gathered above will be shared with CABI at natural enemy field

reservoirs.

e) Establish insectary at Fiasalabad and supply natural enemies stocks to supporting units at

Vehari, Bahawalpur and Khanewal for mass production and field releases.

f) Asses the impact of biological control based IPM technology for controlling mealy bug

on cotton and other plants.

g) Study safe use of pesticides.

h) Train farmers and extension workers on application of biological control techniques for

controlling mealy bugs on cotton and other plants and promotion of this product on large

scale.

CCRI, Multan

a) This center will operate at Multan, D.G.Khan, Muzaffar Garh and Rajanpur.

b) Study population development of the mealy bug and their natural enemies on malvaceous

plants in different seasons of the year at Multan.

c) Conduct surveys for endemic natural enemies on weeds, malvaceous plants including

cotton.

d) Study phenology and identify weaknesses in the life cycle of the pest and its and natural

enemies at farmers managed farms.

e) The knowledge gathered above will be shared with CABI at natural enemy field

reservoirs.

f) Develop mass rearing techniques and maintain stocks of parasitoids and predators of the

mealy bug at the insectary in collaboration with CABI.

g) Asses the impact of biological control based IPM technology for controlling pest on

weeds and malvaceous plants with special emphasis on cotton.

h) Field and laboratory studies on suitability and preferences of the mealy bug and its

natural enemies for different cotton varieties.

i) Train farmers and extension workers on application of biological control techniques for


scale.

CRI, Sakrand:

a) CRI Sakrand will operate at Nawab Shah, Noshero Feroz, Dadu,, Khair Pur, Sukkur and

Ghotki.

b) To study the pest population dynamics of Mealy bug and their natural enemies on

Malvacious and other plants in different seasons at CCRI Sakrand and other places.

12

c) Survey of weeds, cotton of other similar family plants to record natural enemies of the

pest.

d) To study the phenology and identify the weaknesses in the life cycle of the Mealy bug

and its natural enemies at farmers field.

e) Assess the impact of Biological control based on IPM approach and technology for

controlling pest especially on cotton and other alternate host plants

f) Study safe use of pesticides and role of Biological agents.

g) What so ever have been gathered during the studies will be shared with CABI.

h) Train the farmers, Agriculture extension and NGO’s in biological control techniques for

the control of Mealy bug.

ARI, Tandojam

a) This center will operate at Hyderabad (Tandojam), Tando Mohammad Khan, Badin, Mirpur

Khas and Sanghar of Sindh.

b) Study population development of the mealy bug and their natural enemies on cotton and

other malvaceous plants.

c) Conduct surveys for endemic natural enemies, seasonal abundance on weeds, vegetables,

ornamentals, forests and crops.

d) Study phenology and identify weaknesses in the life cycle of the pest and its natural

enemies.


reservoirs.

f) Asses the impact of biological control based IPM technology for controlling pest on

different crops with special emphasis on cotton.

g) Establish insectary at Tando Jam and supply natural enemies stocks to supporting units at

Sanghar, Sakrand etc, for mass production and field releases.



scale.

i) Study safe use of pesticides.

ARI, Quetta

a) This center will operate at Las Bela, Khuzdar and Dera Murad Jamali.

b) Study biology and ecology of the mealy bugs and their natural enemies.

c) Conduct surveys for endemic natural enemies, seasonal abundance on different plants.


enemies.


reservoirs.

f) Establish insectary at Khusdar and supply natural enemies stocks to supporting units for

mass production and field releases.

13

g) Asses the impact of biological based IPM technology for controlling pest on different

crops with special emphasis on cotton.



scale.


IPM NARC, Islamabad

a) This center will operate through its office at Multan for this project.

b) Conduct studies on repellency of biopesticides to mealy bug and their natural enemies on

cotton and other preferred host plants.

c) Role of use of biopesticides in IPM of the mealy bug sharing knowledge with CABI.

d) Train farmers and extension workers on application of biopesticides for controlling mealy

bugs on cotton and other plants and promotion of this product on large scale.

ARI, D. I. Khan

a) This center will operate at D I Khan and other cotton growing areas of NWFP.

b) Study biology and ecology of the mealy bug and their natural enemies.

c) Conduct surveys for endemic natural enemies, seasonal abundance on different plants.


enemies.

e) Establish insectary at D. I. Khan and supply natural enemies stocks to supporting units

for mass production and field releases.

f) The knowledge gathered above will be shared with CABI at natural enemy field

reservoirs.

g) Asses the impact of biological control based IPM technology for controlling pest on

different crops.



scale.


NIAB, Faisalabad

a) This centre will operate at Faisalabad cotton growing areas and Model Farm in Punjab.

b) Basic research on the biology and ecology of mealy bug and their natural enemies and

identification of weaknesses in the life cycle of the pest and its natural enemies.

c) Conduct surveys for search of endemic natural enemies of mealy bug on different plants.

d) Incorporation of new parasitoids and predators in already functional laboratories with the

help of CABI SA.

e) Increase in the production of natural enemies at NIAB and their release in the Model

Farm in Punjab in coordination with CABI SA and AARI.

f) Development of new mass rearing techniques and maintenance of stocks of parasitoids

and predators at NIAB in collaboration with CABI SA.

g) Training of staff of cooperating units in methodologies of rearing of beneficial insects

and their releases.

h) Development of IPM practices for control of mealy bug on cotton at NIAB.

i) Find out the soft insecticides for the major parasitoids and predators of agricultural pests.

14

j) Study cross resistance spectra of pesticides for pests and their natural enemies.

k) Devise conservation based IPM strategy.

(iv) Distribution of work and responsibilities for establishing Model Farms for

controlling all major cotton pests

CABI SA, AARI, ARI and NIAB will work together in a model farm of 500 acres area which

will be established for the demonstration of biological control based IPM of major cotton

pests in one union council each of Punjab and Sindh. A MOU will be signed between CABI

SA and AARI and ARI Tando Jam to maintain collaborative activities at these Model Farms.

The space for conduction of scientific and administrative activities for CABI SA staff will be

provided by the coordinating units in Sindh and in Punjab. MINFAL will ensure the

provision of these facilities extended to CABI SA by the coordinating units in Punjab and

Sindh

CABI SA, Rawalpindi (Insect Parasitiods & Predators Section)

a) This center will coordinate with AARI, Faisalabad, NIAB, Faisalabad and ARI, Tando

Jam for management of cotton pests at Model farms.

b) Work out management strategies in consultation with coordinating units and specialists

on different insects, diseases composting and other agronomic practices.

c) Maintain field reservoir of natural enemies, studies and development of conservation

technology of natural enemies for controlling cotton pests.

d) Work with AARI, NIAB and ARI for documentation of crop yields per acre and

population levels of pests and natural enemies at Model Farms.

e) Train and assist in mass production of natural enemies (Trichogramma, Chrysopa,

predatory coccinellids and parasitoids of major cotton pests.

f) Conduct farmer participatory training of researchers, extension, farmers to involve whole

community at model farms for management of major cotton pests.

CABI SA, Rawalpindi (Gene and Pathogens Section) a) Cloning of genes for identification of mealy bugs on cotton and other horticultural crops

b) Checking of possible transmission role of cotton mealy bug for some crop pathogens

(bacteria, viruses or fungi) in cotton crop.

c) Molecular identification of variability/races/subspecies in cotton pests, insect parasitoids

and predators.

d) Identification of insect pathogens (viruses, bacteria and fungi) associated with cotton

pests.

e) Maintain pure cultures of Trichogramma and other local and newly introduced bio-

control agents and strains associated with cotton pests and supply for large production to

coordinating teams at model farms.

15

CABI SA, Rawalpindi (Entomopathogenic Nematodes Section) a) Identification of entomopathogenic nematodes (EPNs) associated with cotton pests in

Pakistan.

b) Pathogenecity of EPNs against different cotton pests.

c) Role of EPNs in controlling cotton pests (mealy bug and others).

d) Develop technology for mass production of EPNs for cotton pests.

e) Conduct field assays on efficacy of EPNs attacking cotton pests.

f) Import exotic useful nematodes strains for trials against cotton pests.

AARI, Faisalabad a) Work together with CABI at Model Farm (Bahawal Pur) and will have a proactive

interactive role with farmers through FFS for management of cotton pests.

b) Mass production of Trichogramma, Chrysopa, predatory coccinellids and parasitoids of

mealy bug and other pests for augmentation studies at Model farm.

c) Engage staff and hire labor on daily wages for mechanical control of some of the pests

and other management practices.

d) Arrange extension staff for training and running of FFS at the model farm.

e) Work with CABI for documentation of crop yields and population levels of pests and

natural enemies.

ARI, Tandojam

a) Work together with CABI at Model Farm (in Sindh) and will have a proactive interactive

role with farmers through FFS for management of cotton pests.

b) Mass production of Trichogramma, Chrysopa, predatory coccinellids and parasitoids of

mealy bug and other pests for studies at model farm.

c) Engage staff and hire labor on daily wages for mechanical control of some of the pests

and other management practices.

d) Arrange extension staff for training and running of FFS at the model farm.

e) Work with CABI for documentation of crop yields and population levels of pests and

natural enemies.

E. Technical inputs i) Biological control based IPM Model farms one each in Punjab and Sindh will be established where only safe use of pesticides

will be considered and all IPM options which maximize biological control of pests will be

16

implemented. At these model farms major pests of cotton will be controlled with

implementation of biological control based IPM technologies. Technologies for mass production

of natural enemies, their augmentation and conservation of major cotton pests will be developed.

Classical biological control for exotic pests will also be attempted. Concept of Farmers field

schools will be introduced at model arms for community involvement to control the pests on

cotton.

ii) Molecular Studies for genetic variabilities in biocontrol agents and pests Mealy bugs infect more than 100 host plants including vegetables, fruits, flowering plants and

forests all over the country. They not only feed on plants but also act as vectors in transmission

of many serious pathogens including viruses, bacteria and fungi. Ground breaking work with in

the last fifteen years identified several species of mealy bugs (Hemiptera: Pseudococcidae) as

vector of viruses (Gugerli 2003). Sixteen species of mealy bugs have also been reported to be

involved in transmission of Cocoa swollen shoot disease (CSSVD). Mealy bug wilt of pine apple

(MWP) is associated with a complex of closteroviruses (Rebolledo Martinez et al., 2005). Pine

apple mealy bug wilt associated virus is transmitted by two mealy bug species (Dysmicoccus

spp.) A previously undescribed badnavirus was found to be a causal agent of a disease of black

pepper (Piper nigrum) in Malaysia, Philippines, Sri Lanka and Thailand transmitted by citrus

mealy bug. The mealy bugs recorded on cotton probably transmit some pathogen or toxin that

result in death of the plant. As there is scanty of data about the Phenacoccus solani as vector for

plant pathogens, there is a need for detailed investigation in this regard.

Egg parasitoids have efficient role in controlling Lepidoptrous pests (African boll

worm(Helicoverpa armigera), army worm (Spodoptra litura), boll worm (Earis insulana,

Pectinophora gossypiella)) on cotton. Trichogramma chilonis and Trichogramma brasiliensis

have been described as potential parastoids for described major pests of cotton crop but

apparently a complex has been is found in field conditions. In Pakistan though Trichogramma

attack these pests but failed to produce any results in controlling these pests though elsewhere

they have been successfully used in controlling cotton pests. This failure is primarily the result of

inaccurate identification of strain/race of Trichogramma chilonis associated with pest on cotton.

Using male genitalic characteristics, around 200 species have been described (Pinto 1998).

Determinations of Trichogramma species based on morphological characters are confusing. A

species identified on the basis of morphology obtained from different hosts have different

biological characters, therefore, there may exist a complex of strains and races. So there is a need

for accurate identification and application of those potential strains of Trichogramma chilonis

and other species of Trichogramma by molecular methods to increase the efficiency of bio-

control program.

Maintain pure cultures of Trichogramma and other local and newly introduced bio-control agents

and strains associated with cotton pests and supply for large production to coordinating teams at

model farms.

iii) Entomopathogenic Nematodes in Biological Control System Besides microbial pathogens and arthropod biocontrol agents of insect pests, Entomopathogenic

Nematodes (EPNs) of the families Steinernematidae and Heterorhabditidae have been

successfully used in agricultural systems. Like parasitoids or predators, EPNs have

chemoreceptors and are motile. Like pathogens, they are highly virulent, killing their hosts

quickly and they can be cultured easily in vivo or in vitro (Ehlers, 2001).

These entomopathogenic nematodes in bio control systems are little explored in Pakistan.

Entomopathogenic nematodes are one of the best biocontrol strategies against cotton pests.

17

As far as chewing insects in cotton are concerned, excellent control through entomopathogenic

nematodes have been achieved in the world. These insects usually live or spend a part of their

life in soil. For example cutworms and a complex of bollworms mostly pupate and hibernate in

soil in winter. Soil is a natural reservoir of entomopathogenic nematodes (Akhurst, 1986;

Gaugler, 1988) offering excellent conditions for nematode survival and activity against soil

inhabiting insects. Field experiments have also shown EPNs as an effective biocontrol agent

against different foliage pests in cotton. For example, cutworms feeding on cotton seedlings and

armyworms have been found highly susceptible to EPNs of the families Steinernema sp., a well

known nematode of root grubs (Hussaini et al., 2000). EPNs of the families Steinernema and

Heterorhabditae, as water suspension have successfully been used against cotton bollworms and

cutworms.

Their application through furrow irrigation can give up to 90% mortality of Pink bollworm

Pactinophora gossypiella (Forlow Jech and Henneberry, 1997). Nematodes caused complete

mortality after 48 hours of application. Heterorhabditis bacteriophora gave 100% mortality of

the Spodoptera littoralis larvae in cotton (Abdel Razek, 2006). Nematode applied in a mixture

of anti desiccant Folicote gave 76 and 46% mortality of Spodoptera litura and Earias insulana

respectively(Glazer et al., 1992). Use of EPNs calcium alginate gel formulation can give 100%

mortality against 2nd and 3rd stage larvae of S. litura and Helocovera armigera (Navon et al.,

2002). Similarly, Heterorhabditis sp. has been found highly virulent against Helicoverpa

armigera, one of the serious pests in cotton.

Occurrence and ease in formulation of entomopathogenic nematodes have made it possible to

use them against different sucking insects in cotton. Different soft bodied insects like mealy

bugs, aphids, thirps and jassids have been reported highly susceptible to EPNs. Heterorhabditis

indica, also known from Pakistan, has successfully been used against 2nd

stage nymphs of mealy

bugs in India. Nymphs are usually found sticking to the stem and the nematodes applied through

simple water suspension gave 92% mortality within 48 hours after application (Sharad et al.,

2004). This is a polyphagous strain and has been used against insects (ten Lepidoptera, five

Coleoptera and one each of Orthoptera and Homoptera) in India (Banu and Rajendran, 2002).

Nematodes of both families Steinernematidae and Heterorhabditidae have been found effective

against soil dwelling stages of flower thrips through foliar application (Ebssa, et al., 2004).

F. Project Outputs

• The insect pests and their natural enemies on cotton in Pakistan will be properly

identified.

• Basic data on pest distribution, hosts and host plants seasonal abundance, and phenology

of the mealy bug complex and other cotton pests. IPM model for dealing with cotton

major pests will also become available. It will provide foundation for developing such

models for other crops pests.

• A mass scale insect rearing infrastructure will be established in shape of five insectaries

at AARI, Faisalabad, ARI, Tandojam, Khuzdar under ARI, Quetta, mini-insectary and

lab at ARI, D. I. Khan and NIAB, Faisalabad.

• Three field reservoirs of natural enemies will become available for mealy bug control and

two for all cotton pests .in Punjab, Sindh and Balochistan.

18

• Technology on conservation of natural enemies adaptable to farmers’ fields in different

ecological areas of Pakistan will become available.

• Package to manage the pests on cotton will become available.

• Trained scientific staff and a large number farmers and extensions in ecological pest

management will become available at national level for implementation of biocontrol of

insect pests at commercial scale country wide

F. Civil Work, Equipment, Machinery and Physical Facilities

A sizeable civil work will be undertaken in the project. Office equipment and vehicles

will be purchased for running office affairs and providing mobility to the project staff. The

summary the civil works, office equipment and vehicles is provided below:

i) Number of vehicles of the project

Component Motorcylces Vehicles

Federal Monitoring & Coordination Unit, Islamabad

1 1

CABI South Asia, Rawalpindi 4 0 Ayub Agriculture Research Institute, Faisalabad 4 2

Agriculture Research Institute, Tandojam 4 1

Agriculture Research Institute, D.I.Khan 2 1

Agriculture Research Institute, Quetta 4 1

National Agriculture Research Center, Islamabad 0 0 Central Cotton Research Institute, Multan 0 1

CRI, Sakrand 0 1

NIAB, Faisalabad 1 Total: 19 9

ii) Details of civil works of the project

Component Number

Ayub Agriculture Research Institute, Faisalabad (16,476 sq ft)

Laboratory and Insectary for mass production of friendly/useful insects

Agriculture Research Institute, Tandojam (16,476 sq ft)


Agriculture Research Institute, D. I. Khan (1,100 sq ft)

Laboratory cum mini Insectary for rearing of friendly/useful insects

Agriculture Research Institute, Quetta (8500 sq ft)


NIAB, Faisalabad (2,000 sq ft)

Laboratory and mini Insectary for rearing of friendly/useful insects

G. Financial Discipline

Attempt will be made to provide funds to provincial agricultural departments through the sub-

offices of AGPR at provincial headquarters. For the purpose, NIS for itemized expenditure for

each institution will be prepared by the Project Director and reflected in the budget book each

19

year. In case that was not possible, the budget will be provided through transfer grant. In that

case, the provincial Agricultural Departments will open bank accounts to operate the budget.

Alternately, the provinces may use any other system for the purpose, duly approved by the

Provincial Governments to handle the provincial accounts. Approved cost of Rs 11.615 million

for NARC component of this PC-I as depicted in Annex IX, Tables 1-4, will be born by PARC

out of RADP.

The PCCC and CABI autonomous organizations and do not operate through AGPR system. It

will not be possible to reflect their itemized cost through NIS against AGPR, Islamabad. The

funds for them will be reflected in the budget of Federal Coordination Unit of MINFAL under

the head transfer grants. These grants will be released to PCCC and CABI through AGPR,

Islamabad. To operate these funds, these organizations will open Bank account or use their

existing system to channelise the funds.

- The funds will be provided as a Federal grant to the participating institutions outlined

in the PC-I. On termination of the project, the assets will stand transferred to the

participating institutions. The MINFAL will not entertain any irregular/unauthorized

expenditure; MINFAL will also not pick any liabilities after closure of the project.

- Ministry of Food, Agriculture and Livestock will conduct annual audits and the

external audit will be carried out by the Federal Audit Department.

- The provision of funds to any component program in this PC-I will be conditional on

good performance. The funds to slow moving or not good performing components

will be restricted/close.

- Provincial Government will follow the procedures laid down in the provincial

purchase manual or standing instructions for effecting purchases.

- PCCC and CABI will follow these rules for affecting purchases.

- CABI SA will recruit its staff as per CABI’s guidelines and procedures

H. Risks

There is no major risk involved in achieving the objectives of the project. However, the project

may face two types of remote and minor risks. (i) Non-cooperation of farmers could be the

possible risk. Farmers are inclined to use chemicals to control insect attack which also kills the

friend insects. Therefore, this issue will be addressed by developing field reservoirs of the natural

enemies of the mealy bug under the project. From where these will be released to farmers fields

to promote biological control which is the only way out for the control of this insect. (ii)

Polyphagous nature of the pest is also a possible risk. This insect can feed on several host plant

therefore, its population continue through out the year and could attack cotton crop. Biological

control offers an opportunity of controlling the bug on other plants during winter and spring

season before the planting of cotton. It also sets basis for intensive survey to be carried out for

natural enemies on all host plants to detect the naturally associated parasitoids and predators who

can be mass produced in insectaries for releases in field and redistributed from one to other

areas. Both of these strategies for combating the menace will be used in this project.

7. Capital cost estimates: 368.722 Rs million

◊ Indicate date of estimation of project cost: January, 2008

◊ Basis of determining the capital cost be provided: Market survey was done and latest

cost estimates were collected and used for working out the cost of project.

20

Capital Cost:

i) Component wise capital costs of the project

Component Rs million

Federal Monitoring & Coordination Unit, Islamabad 2.005 CABI South Asia, Rawalpindi 2.873 Ayub Agriculture Research Institute, Faisalabad 19.240 Agriculture Research Institute, Tando Jam 6.290

Agriculture Research Institute, D.I.Khan 3.750 Agriculture Research Institute, Quetta 4.440 Central Cotton Research Institute, Multan 3.310 Cotton Research Institute, Sakrand 3.19 NIAB, Faisalabad 6.120 Total: 51.218

ii) Item wise project costs

Item Rs (million)

Establishment Charges 122.946

Operational Charges 84.180

Sub-total: 207.126

Cost of durable goods

Purchase of Motorcycles 1.0350

Purchase of Vehicles 12.850

Lab & Office Equipment/machinery 37.333

Sub-total: 51.218

Civil works 89.200

Institutional charges 6.579

Contingency 9.599

Out sourcing 5.000

Total 368.722

iii) Component wise establishment costs of the project


Federal Monitoring & Coordination Unit, Islamabad 9.959

CABI South Asia, Rawalpindi 33.385

Ayub Agriculture Research Institute, Faisalabad 30.713

Agriculture Research Institute, Tando Jam 14.692

Agriculture Research Institute, D.I.Khan 3.994

Agriculture Research Institute, Quetta 7.349

Central Cotton Research Institute, Multan 7.914

Cotton Research Institute, Sakrand 8.214 NIAB, Faisalabad 6.726

Total: 122.946

21

iv) Component wise operational costs of the project


Federal Monitoring & Coordination Unit, Islamabad 11.145

CABI South Asia, Rawalpindi 29.540

Ayub Agriculture Research Institute, Faisalabad 8.455

Agriculture Research Institute, Tando Jam 14.790

Agriculture Research Institute, D.I.Khan 3.210

Agriculture Research Institute, Quetta 4.750

Central Cotton Research Institute, Multan 4.410

Cotton Research Institute, Sakrand 4.025

NIAB, Faisalabad 3.855

Total: 84.1800

v) Year wise financial phasing of project cost

Rs (million) Components

Year 1 Year 2 Year 3 Total

Federal Monitoring & Coordination Unit,

Islamabad

13.792 7.194 7.779 28.765

CABI South Asia, Rawalpindi 26.854 22.532 22.991 72.377

Ayub Agriculture Research Institute, Faisalabad 60.475 16.554 17.413 94.442

Agriculture Research Institute, Tando Jam 48.782 11.202 11.490 71.474

Agriculture Research Institute, D. I. Khan 8.391 2.485 2.735 13.611

Agriculture Research Institute, Quetta 26.396 4.159 4.292 34.847

Central Cotton Research Institute, Multan 7.455 4.212 4.352 16.019

Cotton Research Institute, Sakrand 7.167 4.228 4.394 15.789

NIAB, Faisalabad 14.211 3.599 3.588 21.398

Total: 213.523 76.165 79.034 368.722

◊ Provide year-wise estimation of Physical activities as per following:

Summary of the year wise physical activities and targets of the project

CABI SA, Rawalpindi for mealy bug

This unit will play key role in operation of the project in coordination with other units. CABI

will prepare all project technical activities regarding bioecological research and management of

the pest for coordinating units, train staff for survey, conservation, rearing, augmentation,

biology and ecology of pest and natural enemies. CABI will maintain natural enemies field

reservoirs, explore, collaborate with foreign institutes for introduction of natural enemies,

facilitate MINFAL for holding international and national workshops,. Based on research findings

biological control based IPM technology will be developed and tested in cotton at project

maintained farms and farmers fields in collaboration with other coordinating units.

22

Activity Year 1 Year 2 Year 3

Q

1

Q

2

Q

3

Q

4

Q

1 Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4 Development of IPM of mealy bugs for control on cotton and other

economic plants.

Identification of the mealy bug complex and their natural enemies

associated with cotton and other plants

Train staff of coordinating units in methodology of sampling, rearing of

mealy bugs and their natural enemies data keeping.

Foreign exploration of natural enemies Redistribution of natural enemies Screening of exotic natural enemies Evaluation of exotic natural enemies Importation of exotic natural enemies from abroad Augmentation and conservation of natural enemies (exotic and endemic

ones)

Maintenance of Natural enemies field reservoir at farmers field and

conservation of endemic and exotic natural enemies

Impact of IPM package in controlling mealy bug Visit abroad for search of natural enemies of Phenacoccus spp and on site

observations of association of natural enemies with fauna and flora,

screening and selection of natural enemies for introduction in

Collaboration with foreign institutes for collection, screening and supply

of natural enemies in Pakistan.

Establishment of model farms Report writing

CCRI, Multan This center will operate at Multan, D.G. Khan Muzaffar Garh and Rajan Pur, conduct surveys on

natural enemies and study phenology of the pest and natural enemies. The center will also test

the technology of conservation of natural enemies at research farms and farmers fields. The

center will contribute to development and test IPM technology in collaboration with CABI on

cotton and other plants.


Q

1

Q

2

Q

3

Q

4

Q

1

Q

2 Q

3

Q

4

Q

1

Q

2

Q

3

Q

4 Study population development of the mealy bug and their natural

enemies on malvaceous plants in different seasons of the year at

Multan.

Conduct surveys for endemic natural enemies on weeds,

malvaceous plants including cotton.

Study phenology and identify weaknesses in the life cycle of the

pest and its and natural enemies at farmers managed farms. The

knowledge gathered above will be shared with CABI at natural

enemy field reservoirs

Develop mass rearing techniques and maintain stocks of

parasitoids and predators of the mealy bug at the insectary in

collaboration with CABI.

Asses the impact of biological control based IPM technology for

controlling pest on weeds and malvaceous plants with special

emphasis on cotton.

Field and laboratory studies on suitability and preferences of the

mealy bug and its natural enemies for different cotton varieties

Train farmers and extension workers on application of biological

control techniques for controlling mealy bugs on cotton and other

plants and promotion of this product on large scale

Report writing

23

CRI, Sakrand

CRI, Sakrand will operate at Nawab ShahNosheroferoz,Dadu,Khairpur,Sukkur,and Ghotki. This

center will also test the technology of conservation of natural enemies at research farms and

fields. The center will contribute to develop and test IPM technology in collaboration with

CABI on cotton and other plants.

Year 1 Year 2 Year 3

Activity Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4 Study population development of the Mealy bug and

their natural enemies on malvaceous plants in deferent

seasons of the year at Sakrand.

Conduct Surveys for endemic natural enemies on weeds,

malvaceous plants including cotton.

Study phenology and identify weaknesses in the life

cycle of the pest and its natural enemies at farmers

managed farms. The knowledge gathered above will be

shared with CABI at natural enemy field reservoirs.

Develop mass rearing techniques and maintain stocks of

parasitoids and predators of the Mealy bug at the

insectary in collaboration with CABI.

Assess the impact of biological control based IPM

techniques for controlling pest on weeds and malvaceous

plants with special emphasis on cotton.

Field and Laboratory studies on suitability and

preferences of the Mealy bug and its natural enemies for

different cotton varieties.

Train farmers and extension workers on application of

biological control techniques for controlling Mealy bug

on cotton and other plants and promotions of this

product on large scale.

Report writing

AARI, Faisalabad This center will operate at Faisalabad, Sahiwal, Vehari, Khanewal, Bahawalpur, etc, for surveys

of mealy bugs and their natural enemy complex, study phenology of the cotton mealy bug and

natural enemies. They will do studies on safe use of pesticides. The center will also look after

insectary for mass production of natural enemies in collaboration with CABI. The center will

contribute to develop and test IPM technology in collaboration with CABI on cotton and other

plants at research farms. The center will collaborate with extension for implementation of IPM

technology at farmer fields. .


Q

1

Q

2

Q

3

Q

4

Q

1

Q2 Q3 Q

4

Q1 Q

2

Q

3

Q

4

Study population development of the mealy bugs and their natural

enemies on vegetables, crops and cotton in different seasons of the year.

Establish insectary at Fiasalabad and supply natural enemies stocks to

supporting units at Vehari, Bahawalpur and Khanewal for mass

production and field releases.


controlling mealy bug on cotton and other plants.

Study safe use of pesticides. Train farmers and extension workers on application of biological control

techniques for controlling mealy bugs on cotton and other plants and

promotion of this product on large scale.

The knowledge gathered above will be shared with CABI at natural

enemy field reservoirs

Report writing

24

ARI, Tandojam This center will operate at Hydrerabad, Mir Pur Khas, Sanghar, Badin Sanghar etc., conduct

surveys on natural enemies and study phenology of the pest and natural enemies. The center will

do studies on safe use of pesticides. The center will also look after the maintenance of insectary

mass production of natural enemies and field releases, develop IPM technology in collaboration

with CABI and do the studies on conservation of natural enemies. The center will collaborate

with extension for implementation of IPM technology at farmer fields.


Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4 Study population development of the mealy bug and their natural enemies

on cotton and other malvaceous plants.

Conduct surveys for endemic natural enemies, seasonal abundance on

weeds, vegetables, ornamentals, forests and crops.

Study phenology and identify weaknesses in the life cycle of the pest and

its natural enemies.


enemy field reservoirs.


controlling pest on different crops with special emphasis on cotton.

Establish insectary at Tando Jam and supply natural enemies stocks to

supporting units at Sanghar, Sakrand etc, for mass production and field

releases.

Train farmers and extension workers on application of biological control

techniques for controlling mealy bugs on cotton and other plants and

promotion of this product on large scale.

Study safe use of pesticides. Report writing

ARI, Quetta This center will operate at Las Bela, Khuzdar, Dera Murad Jamali etc., conduct surveys on

natural enemies and study phenology of the pest and natural enemies. The center will do studies

on safe use of pesticides. The center will also look after the maintenance of insectary mass

production of natural enemies and field releases, develop IPM technology in collaboration with

CABI and do the studies on conservation of natural enemies. The center will also do studies on

safe use of pesticides. The center will collaborate with extension for implementation of IPM

technology at farmer fields.


Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q


enemies on cotton and other malvaceous plants.



Study phenology and identify weaknesses in the life cycle of the pest

and its natural enemies.





Establish insectary at Khuzdar and supply natural enemies stocks to

supporting units at Sanghar, Sakrand etc, for mass production and field

releases.


control techniques for controlling mealy bugs on cotton and other

plants and promotion of this product on large scale.


25

ARI, D. I. Khan This unit will operate at Dera Ismael Khan and other cotton growing areas of NWFP, conduct

surveys on natural enemies and study phenology of the pest and natural enemies. This unit will

do studies on safe use of pesticides. The center will also look after the maintenance of natural

enemies field reservoir, insectary and development of IPM technology in collaboration with

CABI and do the studies on conservation of natural enemies.


Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q


enemies on cotton and other malvaceous plants.



Study phenology and identify weaknesses in the life cycle of the pest

and its natural enemies.





Establish Lab and mini insectary at D. I. Khan and supply natural

enemies stocks to supporting units at Sanghar, Sakrand etc, for mass

production and field releases.


control techniques for controlling mealy bugs on cotton and other plants

and promotion of this product on large scale.


NARC, Islamabad Activity Year 1 Year 2 Year 3 Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4 Collection of biologically active plant materials at Multan and Islamabad Conduct studies on repellency of biopesticides to mealy bug and their natural

enemies on cotton and other preferred host plants.

Role of use of biopesticides in IPM of the mealy bug sharing knowledge with

CABI.

Evaluation of promising plant extracts against natural enemies of the mealy

bug at Multan on cotton and other host plants

Train farmers and extension workers on application of biopesticides for

controlling mealy bugs on cotton and other plants and promotion of this

product on large scale

Report writing

For Cotton pests at Model farms

CABI SA for cotton pests at Model Farms (for insect parasitoids & Predators for pests

�� anagement


Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4 This center will coordinate with AARI, Faisalabad, NIAB, Faisalabad and

ARI, Tando Jam for management of cotton pests at Model farms.

Work out management strategies in consultation with coordinating units and

specialists on different insects, diseases composting and other agronomic

practices.

Maintain field reservoir of natural enemies, studies and development of

conservation technology of natural enemies for controlling cotton pests.

Work with AARI, NIAB and ARI for documentation of crop yields per acre

and population levels of pests and natural enemies at Model Farms.

Train and assist in mass production of natural enemies (Trichogramma,

Chrysopa, predatory coccinellids and parasitoids of major cotton pests.

Report writing

26

CABI SA for gene studies and entomopathogens for cotton pests control

Year 1 year 2 year3

Activity Q 1

Q 2

Q 3

Q 4

Q 1

Q 2

Q 3

Q 4

Q 1

Q 2

Q 3

Q 4

Collection of mealy bug samples

Cloning of genes

Checking role as vector

Identification of variabilities in cotton pests,insect parasitoids and predators

Identification of entomopathogens associated with cotton pests

Maintain pure cultures of Trichogramma starins associated with cotton pests and supply for large production to team at model farms

CABI SA for EPNs section for management of cotton pests

Activity Year 1 year 2 year3

Q1 Q2 Q3 Q4 Q1 Q2 Q3 Q4 Q1 Q2 Q3 Q4

Survey of the project area for isolation of strains of entomopathogenic nematodes in Pakistan

Investigation of pathogenecity of EPNs against different cotton pests

Determine best EPN use strategy to manage cotton mealy bug

Establishing technology for mass production of EPNs for cotton pests

Conduct field assays on efficacy of EPNs attacking cotton pests

Import exotic useful nematodes strains for trials against cotton pests Training extension officers in EPNs mass rearing and use to assist the implementation of the programme for farmers

CABI SA for cotton pests at Model Farms (Insect parasitoids & Predators for pests management)


Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4 This center will coordinate with AARI, Faisalabad, NIAB, Faisalabad and ARI,

Tando Jam for management of cotton pests at Model farms.

Work out management strategies in consultation with coordinating units and

specialists on different insects, diseases composting and other agronomic

practices.

Maintain field reservoir of natural enemies, studies and development of

conservation technology of natural enemies for controlling cotton pests.

Work with AARI, NIAB and ARI for documentation of crop yields per acre and

population levels of pests and natural enemies at Model Farms.

Train and assist in mass production of natural enemies (Trichogramma, Chrysopa,

predatory coccinellids and parasitoids of major cotton pests.

Report writing

27

AARI and NIAB in Punjab and ARI Tando Jam in Sindh for cotton pests at Model Farms (Insect

parasitoids & Predators for pests management)


Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4

Q

1

Q

2

Q

3

Q

4 Work together with CABI at Model Farm and will maintain a proactive

interactive role with farmers through FFS for management of cotton pests.

Mass production of Trichogramma, Chrysopa, predatory coccinellids and

parasitoids of mealy bug and other pests.

Engage staff and hire labor on daily wages for mechanical control of some

of the pests and other management practices.

Arrange extension staff for training and running of FFS at the model farm. Work with CABI for documentation of crop yields and population levels of

pests and natural enemies.

Report writing

8. Annual operating cost after completion of project

The recurrent cost of operation of the insectaries established under this project will be

picked up by the respective federal/provinces agencies out of their current budget as given

below:

i. AARI Faisalabad

Financial Requirement (Rs million) Particulars

Year 1

Establishment 3.100

Operational 1.700

Total 4.800

ii. ARI Tandojam


Year 1

Establishment 3.100

Operational 1.700

Total 4.800

iii. ARI Quetta/Khuzdar


Year 1

Establishment 1.900

Operational 0.900

Total 2.800

iv. ARI D.I. Khan


Year 1

Establishment 1.200

Operational 0.500

Total 1.700

28

v. CCRI Multan

Financial Requirement (Rs million Particulars

Year 1

Establishment 1.800

Operational 0.600

Total 2.400

vi. CRI Sakrand


Year 1

Establishment 1.200

Operational 0.500

Total 1.700

vii. NIAB Faislabad


Year 1

Establishment 1.600

Operational 0.600

Total 2.200

9. Demand and supply analysis (for Industrial and Agricultural

Production Projects) Description of product/services: N/A

Demand/Supply along with Unit Price for the last five years: N/A

Imports/Exports for the last five years along with unit price N/A

Projected demand/supply for 10 years: N/A

Proposed year-wise production and unit price of the product N/A

Existing and proposed arrangements for marketing: N/A

10. Financial Plan and mode of financing a) Sponsoring own resources: Federal Government (PSDP)

b) Debt: Not Applicable

c) Grants Not Applicable

d) Weighted cost of capital Not Applicable

11. Project benefits and analysis

i. Financial: Not applicable.

ii. Economics: Increase in agriculture productivity by reducing pest losses with effective control

strategies developed and implemented on the basis of the research information

generated in the project will be greatly helpful in enhancing farmer’s produce and

their income. It will assist in establishing cotton industry in the country by providing

29

sufficient quality raw material. The foreign exchange will also increase with the

improvement in cotton production and export of textile products, quantitatively and

qualitatively.

iii. Social benefits with indicators: The effective control strategy developed by the project will enhance the agriculture

productivity by minimizing pest losses. This will ultimately help increase income of

the farmers community and reduce poverty in rural areas.

iv. Employment generation (direct and indirect) Sufficient supply of the raw material to our textile industry, quantitatively and

qualitatively, will improve the standard of the textiles products and enhance price of

the textile products in the market. The increase in the income of the farmers,

manufactures, business community, exporters and the Government will greatly help

establish new textile and related industry and ultimately improve/generate job

opportunities.

v. Environmental impact The Integrated Pest Management (IPM) developed for the effective control of Cotton

Mealy Bug and other cotton pests on the completion of the project, will be greatly

helpful in decreasing pesticides use and their ill-effects on environment and

consequently strengthen renewable resources (population regulating bio-control

agents like parasites, predators of pests), minimize health hazards, etc.

vi. Impact of delay on project cost and validity Delay in project implementation will not only affect the project validity but its costs

may increase due to price escalation. The agriculture productivity is suffering greatly.

The new insect pest is exotic and has invaded almost every agricultural crop,

ornamental, fruit and vegetables. The insect is highly prolific and is spreading fast in

Pakistan and is serious threat to whole agriculture. It is specially devastating to

cotton, the yield is decreasing every year since its invasion in 2005 and farmers

suffered high monetary losses. The insect has to be addressed with holistic approach

every season and every plant has to be considered to manage this insect. There is

urgent need to take immediate actions. Biological control based IPM technology is

the best tool to address this insect. Need is to start studies on its habits relationship

with host plants to identify weaknesses in the life cycle of the pest and to look for

promising natural enemies inland and exotic ones from the area of its native home,

develop conservation techniques for enhancing natural enemies to suppress the pest to

tolerable limits. Delay in action means multiple of losses suffered this year in crops

losses every farm, every season every year. Besides mealy bug other cotton pests

have to be addressed by all available options other than insecticides to minimize the

pesticides use, save environment and build farmers confidence.

vii. Internal Economic Rate of Return:

Project Analysis:

(a) Quantifiable output of the Project:

Quantitative out put of the technologies developed under the project cannot be

qualified. However, the information generated by the project will be utilized by the

farmers for increasing their yield, quantitatively and qualitatively, by averting pest

30

losses. The income of the farmers will not only increase but income of the

Government will also enhance including foreign exchange by exporting quality

textile products. Resultantly, improvement in the cotton production, quantitatively

and qualitatively, will be greatly helpful in establishing textile industry in many

ways including sufficient availability of quality raw material.

a.1 Project investments and returns

All out efforts will be made to bring provincial agriculture extension departments in

loop for the dissemination of biological based IPM interventions on farmers’ fields

for mealy bug control. Applications of these interventions on 40,000 acres each in 5

core cotton growing districts of Punjab and 3 core cotton growing districts of Sindh

is possible with available resources under the project. In this way about 320,000

acres will be directly benefited from project interventions. Benefit cost ratio has

been calculated below based on the assumptions:

(i) Saving on Chemicals About 320,000 acres is the target area of the project for biological control of mealy

bug. At present on average 8 sprays of insecticides are being made over the season

against mealy bug in cotton. This will be reduced to 3 sprays and net saving on

production costs will be gained as per calculations below:

Area directly benefiting by the project interventions = 320,000 acres

Year wise breakup of area

1st year = 1,000 acres

2nd year = 150,000 acres

3rd year = 169,000 acres

Traditional number of average sprays of insecticides = 8

Reduction of sprays through biological control = 5

Cost of 8 sprays @ Rs 600 per spray = Rs 1536.0 million

Cost for 3 sprays = Rs 576.0 million

Gross Saving or benefit = Rs 960.0 million Cost of the project = Rs 368.7 million

Net benefit = Rs 591.3 million

Benefit Cost ratio = 1.60 : 1

(ii) Additional income due to yield increase

Total Area directly benefiting from project = 320,000 acres

Average Increase in Cotton Yield = 2 maunds per acre

Benefit per acre @ Rs 1200 per mnd of phutti = Rs 2,400/ acre

Total benefit in the area = Rs 768.0 million

Benefit cost ratio due to increase in Yield = 2.08 : 1

Net benefit due to both factors: Rs 591 + 768 = 1359.0 million

BC ratio due to savings on chemical cost and yield increase = 3.685 : 1

Note: There will be horizontal effect of the project beyond direct benefited

project area due to knowledge dissemination through extension services,

print media, radio and TV talks.

31

Additional benefits overtime: - Private insectaries will emerge overtime reducing the burden and cost of mass

production of predators on public sector.

- Biological control practices will takeover in plant protection.

- There will be more opportunities for jobs for skilled and unskilled labour at farms and

for plant protectionists engaged in supervised control of pests.

- Promotion of biological based IPM of pests in compliance with international standards

will ensure better price of farms produce in trade.

- Strong natural enemy fauna will result in perpetual control of pests.

- Farmers will have confidence in resource conserving technologies rather than sole

reliance on insecticides for controlling pests. Cotton yield per acre will be optimized.

(b) Unit Cost Analysis: NA

12. Implementation schedule (including starting and completion dates.)

(a) Indicate starting and completion date of the project: Date of commencement: 01-07-2008

Date of completion: 30-06-2011

(b) Item-wise year wise implementation schedule in line charts correlated with the

phasing of physical activities

Please see item No. 7 for this information

32

(c) Result based Monitoring Indicators (RBI) framework indicators in quantitative

Terms:

Out come Input Output

Baseline

indicator

Targets at

completion of

project

Targeted

Impact/measurable

indicators

1.Import of natural enemies

of the cotton mealy bug

The identified natural

enemies associated

with P. solani

imported from

California

Cryptolaemus

montrouzieri has already

been imported from

California in one year

project

Four more natural

enemies introduced

from California

About 300-500

individuals of the

parasitoids

(Acerophagus pallidus,

Coccophagus gurneyi,

Allotropa utilis and

predator Hyperaspis sp)

associated with P.

solani) imported from

California by CABI,

mass produced and

supplied to coordinating

units

2. Mass rearing of imported

natural enemies of mealy

bug

Mass production of

exotic imported

natural enemies at

CABI, AARI Fd, ARI

Tj, CCRI Multan, CRI

Sakrand ARI Q, ARI

DIK, NIAB for release

at farmers fields

Cryptolaemus

montrouzieri imported

from California is already

being mass produced by

CABI, AARI Fd, ARI Tj,

CCRI Multan, NIAB, also

supplied by CABI to UAF

Large numbers of

natural enemies of

the mealy bug will

be available at

different research

centers of the

country .

Above 1000 individuals

of each natural enemy

available all time at each

center. More than

100,000 individuals of

each natural enemy

produced and released

at farmers fields by each

center

3. Establishment of

infrastructure(insectaries)for

mass scale rearing of

natural enemies of cotton

pests

i) Establishment of

large insectaries at:

AARI, Faisalabad,

ARI, Tandojam,

Khuzdar and

ii) small insectaries at

NIAB , Faisalabad,

ARI, D. I. Khan will

be established

At present, mass scale

insect rearing

infrastructure does not

exist.

Mass scale rearing

infrastructure is

built and friendly

insects are mass

produced and

released in cotton

growing areas.

control

3 large insectaries one

each at AARI,

Faisalabad 16476 sq ft),

ARI, Tandojam

(16476)and Khuzdar

(8500)

2 small insectaries one

each at NIAB ,

Faisalabad (2000) and

ARI, D. I. Khan (1100)

4. Mass scale release of

natural enemies of mealy

bug and other cotton pests

in insectaries

The local and exotic

natural enemies of the

mealy bug and other

cotton pests produced

at mass scale and

released at farmers

fields

No regular parasites occur

on mealy bug in Pakistan.

Trichogramma chilonis

and Chrysoperla carnea

are being mass produced at

some places in private and

public sector.

With establishment

of exotic natural

enemies and

increased

population of

endemic natural

enemies

populations of pests

will reduce. .

More than 100,000

individuals monthly

production of the 5

natural enemies and

released at the farmers

fields (May-Nov ) in 2nd

and 3rd year at AARI,

ARI Tj, ARI Q with

technical support from

CABI

5.Training of the project

staff of coordinating units

for mass scale rearing of

natural enemies

Project staff of

coordinating units

trained on rearing of

natural enemies

Very less trained personnel

are in the country on mass

rearing of the natural

enemies of the pests.

More than 100

skilled persons l on

rearing of natural

enemies in public

sector will be

available in the

country

18 trainings for 35

scientists and more than

100 staff/persons of

coordinating units will

be given time to time on

mass rearing of exotic

and endemic parasitoids

and predators by CABI

6.Maintain natural enemy

field reservoirs for their

Five (5) acres plots

one each at Multan,

Data on abundance of

naturally existing predators

Improved

technology on mass

Production of more than

100000 predators at

33

mass production and

conservation

Tandojam and Lasbela

will be maintained

on mealy bug production of

predators and

conservation

monthly intervals

(May.—Dec).

Expectation of

production is in millions

on improvement of

technology. Data

available for monthly

production and release

of predators from the

three field reservoirs by

CABI.

7. Application of

Entomopathogens in cotton

at model farms

1.Entomopathogens

associated with cotton

pests will get

identified

2.Technologies for

mass production EPNs

and their application

will be available

This is a new work not

done before in Pakistan in

cotton

Continue this work

from other sources

of funding for

integration of this

technology with

other control

measures in cotton

3 species of

entomopathogenic

nematodes will be

applied for control of

four major cotton pests.

Isolation and mass

culturing of 5 insect

pathogens and applied

for insect control at

model farms.

Isolation, maintenance

and application of 10

promising parasitoids in

cotton environment for

use in control of cotton

pests.

Data on crop yield, pest

status and reduction in

pesticides use compared

with farmers managed

fields

8. Establish two model

farms for large scale

demonstration of biological

control based IPM

Two model farms of

about 500 acres one

each established at

Bahawalpur and in

Sindh

No such model farms exist

in the country for cotton up

till now on biological

control of cotton pests

Rapid

popularization of

the biological based

IPM technology in

cotton

Data on biocontrol

techniques applied for

control of cotton pests.

pests status at model

farm compared with

farmers managed farms

Enhanced confidence of

farmers and policy

makers on resource

conserving technologies.

Perpetual control of

cotton pests

9. Establish farmer field

school (FFS) for farmers,

training and community

involvement in biological

control based IPM of pests

Framers will be

trained for application

of the pest

management

technology.

Farmers have very little

information and

knowledge about the

season long activities of

biological control based

IPM technology

Agri. Extension

Department will be

in the loop to

further spread the

technology

a). 10 FFS (5 each at

Bahwalpur and Sindh)

established at model

farms

b). 300 farmers and

extension staff will be

trained on season long

activity in FFS

c) 10 Resource persons

engaged, lectures

delivered in sessions

held

50 FFS already

operating in national

program in the districts

of the model farm will

also be involved

10. Training of Agriculture

Officers Extension

Trained Agriculture

Officers of extension

department

AOs little information and

knowledge about the

season long activities of

biological control based

Agri. Extension

Department will be

in the loop to

further spread the

50-60 AOs will be

trained over the year at

Bahawalpur and

Sanghar by AARI, ARI

34

IPM technology technology Tj, ARI Quetta, ARI

DIK,

11. Training of farmers by

field days seminars, farmers

gathering and farmers in

already running FFS at

Bahawalpur and at Sanghar

on biological based IPM

techniques

Some 1300- 1550

farmers per year

trained on applying

IPM techniques by the

components: CCRI

Multan. CRI Sakrand,

NARC Multan , ARI

DIKhan, ARI Quetta.

Tj

Farmers have very little

information on biological

control based IPM

technology for controlling

Agri. Extension

Department will be

in the loop to

further spread the

technology

Farmers per year trained

on applying IPM

techniques. Some 200-

300 each by the

components: CCRI

Multan. CRI Sakrand,

NARC Multan , ARI

DIKhan, and ARI

Quetta

More than 1300 farmers

per year will be trained

by AARI, NIAB and

ARI Tj

12. Study phenology and

population dynamics of

cotton pests

The weakest links

ascertained in the life

cycles of cotton pest

Data on population trends

and insects behavior in

different seasons.

Better understanding

of the pests and

natural enemies

Changes introduced in

agricultural practices.

Increase in population of

natural enemies on

farmers fields (by all

coordinating units ).

These will be base on

findings

13. Conservation of natural

enemies by judicious use of

pesticides for control of

cotton pests

Reduction of

pesticides use in

cotton

Data on toxicity of

different insecticides to

pests and natural enemies

Knowledge on safe

use of insecticides

Data on effectiveness of

application of at defined

timing and special

methodology on use of

soft insecticides on need

basis only.

Availability of extension

materials with the

recommendations of use

of safe pesticides (all

centers except CABI for

this study )

14. Study the bio-

pesticides for control of

mealy bug

9. Study the bio-

pesticides for

control of mealy

bug

Work has already been

started in first phase of the

project

The mass

production of new

products will be

ensured through

involving private

sector

This is NARC specific

activity.

5 formulations of the

biopesticides will be

tested

NARC will maintain

cultures of natural

enemies for testing of

biopesticides

Data on compatibility of

neem sprays on cotton

with use natural enemies

in cotton.

9 trainings given to

staff of coordinating

units on application of

the biopesticides.

15. Reports:

(quarterly and annual

reports produced

12 quarterly and 3

annual reports

produced of the

project

project activities,

experiments results

Comprehensive

information on

possibilities of

control of cotton

pests

Numbers of reports

produced

35

13. Management structure and manpower requirements including specialized skills

during construction, execution and operational phases

The present proposed project is continuation of the already on going 15 months project

titled “Control of cotton mealy bug in Pakistan”. The expanded project will be

implemented under the administrative and financial rules/instructions of the Government

of the Pakistan under the administrative control of Ministry Food, Agriculture and

Livestock. An independent Project Director will head the project and would organize

annual planning meetings, review meetings, annual reports from the respective units will

be submitted to PD who will produce the final report annually and terminal report at the

termination of the project. The Project Manager/Incharge of different units will be Insect

Bio-control Specialist (IBS) at CABI SA Rawalpindi; Provincial Project Director

Entomology at AARI, Faisalabad; Entomologist at ARI, Tandojam; Director Agriculture

Research at ARI, Quetta; Deputy Director General at NARC; Senior Scientific Officer at

CCRI, Multan; Director at CRI Sakrand, Deputy Chief Scientists at NIAB, Faisalabad;

Entomolgist/Director at ARI, D I Khan.

Manpower requirements during execution and operation of the project: The project would require scientists, skilled and semi-skilled personnel for laboratories,

skilled field technician for greenhouses, field reservoirs and insect rearing facilities. The

provincial institutes will create the project posts in their system which will be paid

through this project during project life and later on will be sustained by provincial current

budget after completion of the project. The project staff will be hired from open market

or through transfer posting, hiring on deputation, contract basis or as daily paid

labour/contingent paid staff as and when needed. Manpower required for the project is

given below:

i) Number of staff of project, “Biological Control Of Major Cotton Pests”

Component No of Scientists

No of supporting staff

Federal Monitoring & Coordination Unit, Islamabad

3 5

CABI South Asia, Rawalpindi 11 12 Ayub Agriculture Research Institute, Faisalabad

11 28

Agriculture Research Institute, Tando Jam 8 1 Agriculture Research Institute, D.I.Khan 2 1 Agriculture Research Institute, Quetta 4 1 Central Cotton Research Institute, Multan 4 3 CRI, Sakrand 3 3 NIAB, Faisalabad 6 2 Total: 52 56

36

Project Organization Administrative

Administrative and Institutional Arrangements for implementation of Project:

i. Monitoring and Coordination The project would have monitoring system at federal and provincial levels. At

federal and provincial levels, National Steering Committees will be constituted. These

committees will have an advisory role and would deal with high-level policy matters and

review annual action plans. These will meet twice during each project year to discuss

issues, monitor progress and review the latest action plan and achievements for overall

monitoring of the project and providing policy guidelines. The P&D Division has its own

system of monitoring which will also be in effect simultaneously during the execution of

the project. However, overall monitoring and guidelines for running of the project will be

supervised by the Agriculture Development Commissioner of the MINFAL.

a) National Steering Committee (NSC): The committee will be headed by the

Secretary, Ministry of Food, Agriculture and Livestock (MINFAL). Other

members of the committee will be from finance and planning of the Federal

Government and the provincial secretaries for agriculture and any other related

department. It will oversee the progress of project and provide policy guidance

and resolve policy and financial issues recurring from the field situation and also

will be authorized to do restructuring of the project objectives, scope, re-

allocation of funds within project components at its own level/end without being

referred to P&D Division and the project approving authority. It will also oversee

the formulation of next phase of the project for further replication of productivity

model/project on a wide range of areas in the country. They constitution of the

committee will be as follows:

• Secretary, MINFAL (Chairman)

• Secretary, Finance

• Secretary, P & D

• Chairman, PARC

Project Director

CABI

SA

NARC AARI ARI

TJ

CCRI

& CRI

ARI

Quetta

NIAB

ARI

D.I.K

37

• Cotton Commissioner, MINFAL

• Secretary Agriculture, Punjab

• Secretary Agriculture, Sindh

• Secretary Agriculture, NWFP

• Secretary Agriculture, Balochistan

• Director, CABI SA

• Director NIAB

• Director CRI

• Project Director/Member Secretary

b) Provincial Implementation Committee (PIC): The Provincial Implementation Committee

will be headed by the respective Secretary (Agriculture). The D. Gs. Research and Extension,

concerned provincial project incharge will be its members. This Committee at provincial level,

will resolve policy and financial issues related to the project implementation, performance and

progress in close collaboration with the Federal Coordination Unit (FCU)

14. Additional projects/decisions required to maximize socio-economic benefits from the

proposed project

--

38

39

Annexure I I. Entomology Section, Ayub Agricultural Research Centre, Faisalabad

Table 1. Budget Summary of AARI, Faisalabad

Table 2. Pay of Staff at AARI, Faisalabad (Cotton Mealy Bug) Particulars Rs (million)

PAY OF OFFICERS

Pay Scale equivalent

No. of posts 2008-09 2009-10 2010-11 Total

Provincial Project Director @ Rs 75,000 pm 19 1 0.9 0.945 0.992 2.837

Asstt. Entomologist @ Rs.45,000/-p.m 17+150 2 1.080 1.134 1.190 3.404

Asstt. Res. Officer (Ento.) @ Rs. 30,000/-p.m 17 4 1.440 1.512 1.587 4.539

Contingent paid staff - - 0.500 0.500 0.500 1.500

Sub-Total: 7 3.92 4.091 4.269 12.28

PAY OF OTHER STAFF

Office Assistant @ Rs 15,000/pm 14 1 0.180 0.189 0.198 0.567 Laboratory Assistant @ Rs 10,000/pm 06 4 0.480 0.504 0.529 1.513

Driver on contract @ Rs 10,000/pm 05 1 0.120 0.126 0.132 0.378 Laboratory Attendant @ Rs 6,000/pm 01 4 0.288 0.302 0.317 0.907

Field-man @ Rs 6,000/pm 01 1 0.072 0.075 0.078 0.225

Chowkidar @ Rs 6,000/pm 01 1 0.072 0.075 0.078 0.225 Sweeper @ Rs 6,000/pm 01 1 0.072 0.075 0.078 0.225 Sub-Total of support staff: 13 1.284 1.346 1.41 4.040 Total of establishment for AARI, FD: 20 5.204 5.437 5.679 16.320

Note: All above staff will be hired on contract basis at the given Lump Sum Salary

Table 3. Pay of Staff at Model Farm, Bahawalpur Particulars Rs (million)

PAY OF OFFICERS

Pay Scale equivalent

No. of posts 2008-09 2009-10 2010-11 Total

Asstt. Entomologist @ Rs.45,000/-p.m 17+150 1 0.540 0.567 0.595 1.702

Asstt. Res. Officer (Ento.) @ Rs. 30,000/-p.m 17 3 1.080 1.134 1.190 3.404

Honorarium - - 0.050 0.050 0.050 0.150

Contingent paid staff - - 0.500 0.500 0.500 1.500

Sub-Total: 4 2.170 2.251 2.335 6.756

PAY OF OTHER STAFF

Senior Clerk @ Rs 15,000 pm 09 1 0.180 0.189 0.198 0.567

Field Assistants @ Rs 15,000 pm 06 4 0.720 0.756 0.793 2.269 Laboratory Assistant @ Rs 10,000/pm 06 4 0.480 0.504 0.529 1.513

Driver on contract @ Rs 7,000/pm 05 1 0.084 0.088 0.092 0.264

Field-man @ Rs 6,000/pm 01 5 0.360 0.378 0.396 1.134 Sub-Total of support staff: 15 1.824 1.915 2.008 5.747

Total of establishment for Model Farm, Bahawalpur: 19 3.994 4.166 4.343 12.503 Note: All above staff will be hired on contract basis at the given Lump Sum Salary

Rs (million) Particulars


Establishment cost for AARI, Faisalabad 5.204 5.437 5.679 16.320

Establishment cost of Model Farm, Bahawalpur 3.994 4.166 4.343 12.503 Sub-total: 9.424 10.212 11.077 30.713

Durable goods 13.040 3.200 3.000 19.240 Civil Works at AARI, FD 33.000 0.000 0.000 33.000 Sub-total of Capital & Civil Works: 46.04 3.200 3.000 52.240 Operating Expenses at AARI, Faisalabad 1.535 1.575 1.430 4.540

Operating Expenses at Model Farm, Bahawalpur 1.045 1.265 1.605 3.915 Sub-total of operating cost: 2.580 2.840 3.035 8.455

Total: 58.044 16.252 17.112 91.408

Contingency /unforeseen/escalating cost @ 5% 2.431 0.302 0.301 3.034

Grand total: 60.475 16.554 17.413 94.442

40

Table 4. Capital cost estimates, AARI, Faisalabad Particulars Rs (million)

Vehicles & Motorcycles Qty 2008-09 2009-10 2010-11 Total

Vehicle 1 with AC (single cabin customized) 4x2 1 1.500 0.000 0.000 1.500

Motor Cycles (70 CC) 2 0.110 0.000 0.000 0.110 Sub-Total: - 1.61 0.000 0-000 1.61

Machinery & Equipment

Refrigerators (12/14 cubic feet each) 8 0.200 0.000 0.000 0.200

Split Type A/C (2 tonnes) 20 0.900 0.000 0.000 0.900

Dissecting Microscopes 2 0.300 0.000 0.000 0.300

Pocket Weather Monitor 6 0.300 0.000 0.000 0.300

Humidifier with accessories 5 0.750 0.000 0.000 0.750

Computers with accessories 6 0.420 0.000 0.000 0.420

Lap Tops with accessories 1 0.095 0.000 0.000 0.095

Multimedia Projector with Screen 1 0.200 0.000 0.000 0.200

Phase Contrast Microscope with Photomicrography Unit 1 0.500 0.000 0.000 0.500

Oil Heaters 20 0.200 0.000 0.000 0.200

Incubators 4 1.000 0.000 0.000 1.000

Colour Laser Printer 1 0.080 0.000 0.000 0.080

Fume Hood 1 0.650 0.000 0.000 0.650

Stereo Microscope with Digital Camera 1 0.350 0.000 0.000 0.350

Power Generator 40KV with accessories 1 1.200 0.000 0.000 1.200 Sub-total: - 7.145 0.000 0.000 7.145

Purchase Of Furniture & Fixture (office and lab) Various 0.700 0.100 0.000 0.800 Sub-total: - 0.700 0.100 0.000 0.800

Durable Goods Total at AARI, FD: 9.455 0.100 0.000 9.555

Building & Structure (Civil Works)

Laboratory & Insectary building with complete necessary equipment, fittings, furniture at AARI, Faisalabad (16,476 sq ft)

- 33.000 0.000 0.000 33.000

Sub-total for civil works: - 33.000 0.000 0.000 33.000

Durable Goods & Civil Works Total: - 42.455 0.100 0.000 42.555

Table 5. Capital cost estimates, Model Farm, Bahawalpur Particulars Rs (million)

Vehicles & Motorcycles Qty 2008-09 2009-10 2010-11 Total

Vehicle 1 with AC (single cabin customized) 4x2 1 1.500 0.000 0.000 1.500

Motor Cycles (70 CC) 2 0.110 0.000 0.000 0.110 Sub-Total: - 1.61 0.000 0.000 1.61



Split Type A/C (2 tonnes ) with accessories 2 0.090 0.000 0.000 0.090

Dissecting Microscopes 2 0.300 0.000 0.000 0.300

Lap Top 1 0.095 0.000 0.000 0.095

Multimedia Projector with Screen 1 0.200 0.000 0.000 0.200

Computers with Accessories 1 0.070 0.000 0.000 0.070

Oil Heaters 2 0.010 0.000 0.000 0.010

Power Sprayers 1 0.050 0.000 0.000 0.050

Hand Sprayers 2 0.010 0.000 0.000 0.010

Stereo Microscope 1 0.350 0.000 0.000 0.350

Power Generator 20KV with accessories 1 0.600 0.000 0.000 0.600 Sub-total: - 1.875 0.000 0.000 1.875

Purchase of Furniture & Fixture Various 0.100 0.100 0.000 0.200

Farmer’s incentive - 0.0 3.000 3.000 6.000 Sub-total: - 0.100 3.100 3.000 6.200

Durable Goods for Model Farm, Bahawalpur: 3.585 3.100 3.000 9.685

41

Table 6. Operating expenses of AARI, Faisalabad

Rs (Million) Particulars

2008-09 2009-10 2010-11 Total

Communications

Postage & Telegraph 0.005 0.005 0.005 0.015

Telephone Trunk Calls 0.020 0.020 0.020 0.060 Sub-total: 0.025 0.025 0.025 0.075

Utilities

Electricity 0.095 0.095 0.095 0.285

Hot and cold weather charges 0.005 0.005 0.005 0.015 Sub-total: 0.100 0.100 0.100 0.300

Occupancy cost

Rent & Taxes 0.020 0.010 0.010 0.040 Sub-total: 0.020 0.010 0.010 0.040

Travel & Transportation

Traveling Allowance 0.300 0.300 0.300 0.900

P.O.L. Charges 0.400 0.400 0.400 1.200 Sub-total: 0.700 0.700 0.700 2.100

General

Stationery 0.100 0.100 0.100 0.300

Newspaper Periodicals & Book 0.150 0.150 0.000 0.300

Advertisement & Publicity 0.025 0.025 0.025 0.075

Cost of Other Stores 0.300 0.300 0.300 0.900

Others 0.050 0.050 0.050 0.150 Sub-total: 0.625 0.625 0.475 1.725

Entertainment & gifts

Entertainment & Gifts 0.005 0.015 0.020 0.040 Sub-total: 0.005 0.015 0.020 0.040

TOTAL OPERATING EXP:- 1.475 1.475 1.330 4.280

Repairs & maintenance of durable goods

Transport 0.030 0.050 0.050 0.130

Machinery & Equipment 0.015 0.030 0.030 0.075

Furniture & Fixture 0.015 0.020 0.020 0.055 Sub-total: 0.060 0.100 0.100 0.260

Total: 1.535 1.575 1.430 4.540

42

Table 7. Operating expenses of Model Farm, Bahawalpur Rs (million)

Particulars 2008-09 2009-10 2010-11 Total

Communications

Postage & Telegraph 0.005 0.015 0.015 0.035

Telephone Trunk Calls 0.040 0.050 0.050 0.140 Sub-total: 0.045 0.065 0.065 0.175

Utilities

Electricity 0.100 0.125 0.150 0.375

Hot and cold weather charges 0.005 0.005 0.005 0.015 Sub-total: 0.105 0.130 0.155 0.390

Occupancy Cost

Rent & Taxes 0.050 0.020 0.025 0.095 Sub-total: 0.050 0.020 0.025 0.095

Travel & Transportation

Traveling Allowance 0.200 0.250 0.300 0.750

P.O.L. Charges (Vehicle + Motor Cycles) 0.200 0.300 0.400 0.900 Sub-total: 0.400 0.550 0.700 1.650

General

Stationery 0.100 0.120 0.150 0.370

Newspaper Periodicals & Book 0.100 0.050 0.050 0.200

Advertisement & Publicity 0.050 0.050 0.100 0.200

Others 0.150 0.150 0.175 0.475 Sub-total: 0.400 0.370 0.475 1.245

Entertainment & Gifts

Entertainment & Gifts 0.010 0.025 0.030 0.065 Sub-total: 0.010 0.025 0.030 0.065

Repairs & Maintenance of Durable Good:

Transport 0.020 0.050 0.100 0.170

Machinery & Equipment 0.010 0.050 0.050 0.110

Furniture & Fixture 0.005 0.005 0.005 0.015 Sub-total: 0.035 0.105 0.155 0.295

Total: 1.045 1.265 1.605 3.915

43

Annexure-II II. CABI SA, Rawalpindi (mealy bug section) Table 1. Budget Summary of CABI SA, Rawalpindi

Table 2. Pay of Staff at CABI, Rawalpindi (Cotton Mealy Bug) Particulars Rs (million)

PAY OF OFFICERS

No. of posts 2008-09 2009-10 2010-11 Total

Insect Biocontrol Specialist @ Rs 140,000 pm 1 1.680 1.764 1.852 5.296

Project Officer @ Lump sum Rs 45,000 pm 4 2.160 2.268 2.381 6.809

Sub-Total: 5 3.840 4.032 4.233 12.105

PAY OF OTHER STAFF

Technical Assistant @ Rs 15,000 pm 6 1.080 1.188 1.306 3.574

Senior Clerk @ Rs 15,000 pm 1 0.180 0.198 0.218 0.596

Accountant @ Rs 15,000 pm 1 0.180 0.198 0.218 0.596

Contingent paid skilled and unskilled labour - 0.300 0.300 0.300 0.900 Sub-total of support staff: 8 1.740 1.884 2.042 5.666

Total of establishment for CABI, Rwp 13 5.580 5.916 6.275 17.771

Table 3. Pay of Staff at Model Farms in Punjab & Sindh Particulars Rs (million)

PAY OF OFFICERS

No. of posts 2008-09 2009-10 2010-11 Total

Entomologist @ lump sum Rs 45,000 pm 2 1.080 1.134 1.190 3.404

Expert Field Facilitator @ lump sum Rs 45,000 pm 2 1.080 1.134 1.190 3.404

Entomopathogens scientist @ Rs 50,000 pm 1 0.600 0.630 0.661 1.891

Molecular scientist @ lump sum Rs 50,000 pm 1 0.600 0.630 0.661 1.891 Sub-total for officers: 6 3.360 3.528 3.702 10.59

PAY OF OTHER STAFF

Technical Assistant @ Rs 15,000 pm 4 0.720 0.756 0.793 2.269

Contingent skilled and unskilled labour - 0.500 0.500 0.500 1.500 Sub-total for support staff 4 1.220 1.256 1.293 3.769 Total of establishment for farms: 10 4.580 4.784 4.995 14.359



Establishment cost for CABI SA, Rawalpindi 5.580 5.916 6.275 17.771

Establishment cost of Model Farms in Punjab & Sindh 4.700 5.120 5.579 15.399 Sub-total: 10.160 11.104 12.121 33.385

Durable Goods Total for CABI SA, Rawalpindi 2.873 0.000 0.000 2.873 Sub-total of Capital 2.873 0.000 0.000 2.873 Operating Expenses at CABI, Rawalpindi 6.880 4.680 4.180 15.740 Operating Expenses at Model Farms in Punjab & Sindh 4.500 4.700 4.600 13.800 Sub-total of operating cost: 11.380 9.380 8.780 29.540 Total: 24.413 20.484 20.901 65.798

Institutional charges 10% 2.441 2.048 2.090 6.579

Grand total: 26.854 22.532 22.991 72.377

44

Table 4. Capital cost estimates of CABI for two model farms in Punjab & Sindh

Rs (million) Particulars Qty

2008-09 2009-10 2010-11 Total

Vehicles/Motorcycles

Motorcycle (70 CC) Honda 4 0.210 0.000 0.000 0.210 Sub-total: 0.210 0.000 0.000 0.210


Refrigerator 1 with accessories (12/14 cu.ft) 1 0.040 0.000 0.000 0.040

Split AC 1 with accessories (2 tonnes) 2 0.090 0.000 0.000 0.090

Dissecting microscope 1 1 0.150 0.000 0.000 0.150

Lap top with colored laser printer 1 0.140 0.000 0.000 0.140

Digital camera (with close up lens) 1 0.050 0.000 0.000 0.050

Computer with printer 2 0.150 0.000 0.000 0.150 Sub-total: - 0.620 0.000 0.000 0.620

For Entomopathogenic nematodes

Granulator 1 0.010 0.000 0.000 0.010

Lab vacuum pump with multiple funnels 1 0.028 0.000 0.000 0.028

Incubators ( 70 to 100 lit) 3 0.200 0.000 0.000 0.200

Sprayer 2 2 0.010 0.000 0.000 0.010

Electric balance ( measuring up to 30kg) 1 0.020 0.000 0.000 0.020 Purification, mass production of biocontrol agents (insects and pathogens)

Table top centrifuge 1 0.400 0.000 0.000 0.400

Gel documentation system 1 0.400 0.000 0.000 0.400

Water distillation apparatus and deionizer 1 0.150 0.000 0.000 0.150

Digital autoclave 1 0.400 0.000 0.000 0.400

Thermo mixer compact 1 0.125 0.000 0.000 0.125 Sub total - 1.743 1.743

Furniture & Fixture (office cum lab furniture) Various 0.150 0.000 0.000 0.150

Racks & Cages Various 0.150 0.000 0.000 0.150 Sub-total: - 0.300 0.000 0.000 0.300

Total D/Goods for CABI, Rawalpindi: - 2.873 0.000 0.000 2.873

45

Table 5. Operating expenses of CABI SA, Rawalpindi


2008-09 2009-10 2010-11 Total

Operating expenses

Travel and perdiem (TA/DA) 0.500 0.500 0.500 1.500

Vehicle mobility charges 0.400 0.400 0.400 1.200

Car hiring/fares 0.300 0.300 0.300 0.900

POL for motorcycles 0.200 0.200 0.200 0.600

Communication charges 0.050 0.050 0.050 0.150 Utilities 0.100 0.100 0.100 0.300 Sub-total 1.550 1.550 1.550 4.650

Other expenses

Supplies and materials 0.300 0.300 0.300 0.900

Stationery 0.100 0.100 0.100 0.300

Advertisement publication 0.050 0.050 0.050 0.150

Technical, reprints, journals & other printed matter 0.050 0.050 0.050 0.150

Operation expenses of three natural enemy (NE) field reservoirs (3) at farmer’s field

s

2.000 2.000 2.000 6.000

Insect Identification charges 0.050 0 0 0.050

Entertainment 0.030 0.030 0.030 0.090 Importation of known predators and parasitoids 0.100 0 0 0.100 Collaboration with foreign institutes for survey and host specificity studies and importation of parasitoids of P. solani

2.000 0 0 2.000

Travel abroad by IBS for appraisal of parasitoids of cotton mealy bug from California and other countries

0.500 0.500 0 1.000

Sub-total 5.18 3.03 2.53 10.74

Repair and maintenance

Transport , machinery and furniture 0.050 0.050 0.050 0.150 Sub-total 0.050 0.050 0.050 0.150

Books 0.050 0 0 0.050 Sub-total: 0.050 0 0 0.050

Unforeseen expense

Miscellaneous (Customs, duties taxes etc) 0.050 0.050 0.050 0.150 Sub-total 0.050 0.050 0.050 0.150

Total 6.880 4.680 4.180 15.74

B = Costs of the three field insect reservoirs, includes their maintenance, land rent, cultivation, watching, Mali, sanitation, irrigation, fertilizers, insecticides, DPL, roof provision on farm, transportation, parasites predators production, their distribution and release at farmers fields and experimentation expenses.

46

Table 6. Operational expenses two model farms in Punjab and Sindh

Item Rs (million)

Operating expenses 2008-09 2009-10 2010-11 Total

Travel and subsistence 0.300 0.300 0.300 0.900

Vehicle mobility charges 0.300 0.300 0.300 0.900

Car hiring/fares 0.400 0.400 0.400 1.200

POL for motor cycles 0.200 0.200 0.200 0.600

Communication s 0.050 0.050 0.050 0.150 Sub-total: 1.250 1.250 1.250 3.750

Lab supplies

Supplies and materials for insets rearing, etc 0.300 0.300 0.300 0.900

Supplies for molecular studies 0.500 0.700 0.700 1.900

Chemicals & glass wares (Bio-pesticides, neem extracts, lures etc) for Entomopathogen studies

0.300 0.300 0.300 0.900

Sub-total: 1.100 1.300 1.300 3.700

Other Supplies

Stationery 0.100 0.100 0.100 0.300

Advertisement publication, printing 0.200 0.200 0.200 0.600

Technical, reprints, journals, other printed matter 0.050 0.050 0.050 0.150

Operation cost for two field reservoir at farmer field

B

1.000 1.000 1.000 3.000

Insect Identification charges by British Museum 0.200 0.200 0.100 0.500

FFS (5) all expenses 0.500 0.500 0.500 1.500 Sub-total: 2.050 2.050 1.950 6.050

Unforeseen expense

Miscellaneous (Customs, duties taxes etc) 0.050 0.050 0.050 0.150 Sub-total: 0.050 0.050 0.050 0.150


Transport , machinery and furniture 0.050 0.050 0.050 0.150 Sub-total: 0.050 0.050 0.050 0.150

Grand total: 4.500 4.700 4.600 13.8

B = Operational charges includes all maintenance costs, land rent, cultivation, watching, Mali, sanitation, irrigation, fertilizers, insecticides, DPL, roof provision on farm, transportation, parasites predators production ,their distribution and release at farmers fields, etc), and experimentations expense

47

Annexure-III III. Central Cotton Research Institute, Multan

Table 1. Budget Summary of CCRI, Multan

Table 2. Pay of Staff at CCRI, Multan Particulars Rs (million)

PAY OF OFFICERS

No. of posts

2008-09 2009-

10 2010-11 Total

Honorarium (Project incharge SSO) 0.120 0.120 0.120 0.360

Senior Scientific Officer (MB Management Expert) @ Rs 50,000 pm

1 0.600 0.630 0.661 1.891

Assistant Scientific Officer @ Rs 30,000 pm 3 1.08 1.134 1.190 3.404

Sub-Total: 4 1.800 1.884 1.971 5.655

PAY OF OTHER STAFF

Office Assistant @ Rs 15,000 pm 1 0.180 0.189 0.198 0.567

Senior Clerk @ Rs 10,000 pm 1 0.120 0.126 0.132 0.378

Driver @ Rs 7,000 pm 1 0.084 0.088 0.092 0.264

Contingent paid staff ( skilled & unskilled labour) - 0.400 0.450 0.500 1.350 Sub-total: 3 0.684 0.753 0.822 2.259 Total cost of establishment: 7 2.484 2.637 2.793 7.914

Table 3. Capital cost estimates of CCRI, Multan

Rs (million) Particulars Qty

2008-09 2009-10 2010-11 Total


Vehicle 1 with AC (single cabin customized) 4x2 1 1.500 0.000 0.000 1.500 Sub-total: 1.500 0.000 0.000 1.500


Oil Heaters 4 0.040 -- -- 0.040

Humidifier 2 0.200 -- -- 0.200

Laptop with Color Printer 1 0.150 -- -- 0.150

UPS (Un-interrupted Power Supply) 1 0.050 -- -- 0.050

Refrigerator 2 0.080 -- -- 0.080

Split AC 2 0.090 -- -- 0.090

Microscope with auto photo-system 1 1 0.350 -- -- 0.350

Pocket weather tracker 2 0.100 -- -- 0.100

Aluminum racks &cages Various 0.300 -- -- 0.300

Incubator 1 0.100 -- -- 0.100 Sub-total: - 1.46 - - 1.46

Furniture & Fixture (Office cum lab) Various 0.350 0 0 0.350 Sub-total: - 0.350 0.000 0.000 0.350

Total of D/Goods for CCRI, Multan: - 3.310 0 0 3.310


2008-09 2009-10 2010-11 Total

Establishment cost for CCRI, Multan 2.484 2.637 2.793 7.914

Durable Goods 3.310 0.000 0.000 3.310

Operating Expenses 1.425 1.500 1.485 4.41 Total: 7.219 4.137 4.278 15.634


Grand total: 7.455 4.212 4.352 16.019

48

Table 4. Operational expenses for CCRI, Multan

Particulars Rs (million)

Operating expenses 2008-09 2009-10 2010-11 Total


POL charges 0.300 0.400 0.400 1.100

Communications 0.050 0.050 0.050 0.150

Utilities 0.100 0.100 0.100 0.300 Sub-total: 0.750 0.850 0.850 2.450

Other expenses

Consumable stores 0.350 0.350 0.350 1.050

Stationery 0.100 0.100 0.100 0.300


Technical books 0.050 0.025 0.010 0.085

Miscellaneous 0.050 0.050 0.050 0.150 Sub-total: 0.575 0.550 0.535 1.660


Transport , machinery and furniture , etc 0.100 0.100 0.100 0.300 Sub-total: 0.100 0.100 0.100 0.300

Total: 1.425 1.500 1.485 4.41

49

Annexure-IV IV. Cotton Research Institute, Sakrand

Table 1. Budget Summary of CCRI, Sakrand Rs. (million)


Establishment Cost for CCRI, Sakrand 2.584 2.737 2.893 8.214

Durable Goods 3.190 - - 3.190

Operational Expenses 1.175 1.420 1.430 4.025

Total 6.949 4.157 4.323 15.429


Grand total: 7.167 4.228 4.394 15.789

Table 2. Pay of Staff at CCRI, Sakrand Rs. (million)

Particulars No. of

Posts 2008-09 2009-10 2010-11 Total

Pay of Officers:

Honorarium project incharge 0.120 0.120 0.120 0.360

Principal Scientific Officer

(Entomology Expert) @ Rs. 75,000/- pm 1 0.900 0.945 0.992 2.837

Assistant Scientific Officer @ Rs.30,000/- pm 2 0.72 0.756 0.793 2.269

Sub Total 3 1.74 1.821 1.905 5.466

Pay of Staff

Accountant @ Rs. 15,000/- pm 1 0.180 0.189 0.198 0.567 Computer Operator @ Rs. 15,000/- pm 1 0.180 0.189 0.198 0.567 Driver @ Rs. 7,000/- pm 1 0.084 0.088 0.092 0.264

Contingent paid staff 0.400 0.450 0.500 1.350 Sub Total 3 0.844 0.916 0.988 2.748

Total Cost of Establishment 2.584 2.737 2.893 8.214

Table 3. Capital Cost Estimates of CCRI, Sakrand Rs. (million)

Particulars Qty. 2008-09 2009-10 2010-11 Total


Vehicle 1 with AC (single cabin customized) 4x2

1 1.500 - - 1.500

Sub Total 1.500 - - 1.500


Oil Heaters 2 0.030 - - 0.030

Humidifier 2 0.300 - - 0.300

Laptop with Colour Printer 1 0.150 - - 0.150

UPS (Un-interrupted Power Supply) 1 0.050 - - 0.050

Split AC 2 0.090 - - 0.090

Microscope with Auto Photo-system 1 1 0.350 - - 0.350

Pocket weather tracker 1 0.050 - - 0.050

Aluminum racks & cages Various 0.300 - - 0.300

Incubator 1 0.100 - - 0.100

Sub Total 1.420 - - 1.420

Furniture & Fixture Various 0.270 - - 0.270

Sub Total 0.270 - - 0.270

Total D/Goods of CCRI, Sakrand 3.190 - - 3.190

50

Table 4. Operational Expenses for CCRI Sakrand Rs. (million)


Operating Expenses

Traveling & Subsistence 0.280 0.300 0.300 0.880

POL Charges 0.290 0.380 0.380 1.050

Communications 0.050 0.060 0.060 0.170

Sub Total 0.620 0.740 0.740 2.100

Other Expenses

Stationary 0.070 0.090 0.090 0.250

Advertisement / Publication 0.035 0.040 0.050 0.125

Consumable Stores 0.300 0.350 0.400 1.050

Technical books 0.050 0.050 0 0.100

Miscellaneous 0.050 0.050 0.050 0.150

Sub Total 0.505 0.580 0.590 1.675

Repair & Maintenance

Transport, Machinery and Furniture etc. 0.050 0.100 0.100 0.250

Sub Total 0.050 0.100 0.100 0.250

Total 1.175 1.420 1.430 4.025

51

Annexure-V V. Agriculture Research Institute, Tandojam

Table 1. Budget Summary of ARI, Tandojam

Table 2. Pay of Staff at ARI, Tandojam (Cotton Mealy Bug) Particulars Rs (million)

PAY OF OFFICERS

No. of posts

2008-09 2009-

10 2010-11 Total

Honoraria for Entomologist Incharge Unit - 0.120 0.120 0.120 0.360

Scientific Officers @ 45,000 pm 2 1.080 1.134 1.190 3.404

Research Associate @ 30,000 pm 2 0.720 0.756 0.794 2.270

Sub-Total: 4 1.920 2.010 2.104 6.034

PAY OF OTHER STAFF

Driver @ Rs 7000 PM 1 0.084 0.088 0.092 0.264

Contingent paid staff ( skilled & unskilled labour) - 0.300 0.350 0.400 1.050 Sub-total: 1 0.384 0.438 0.492 1.314

Total cost of establishment: 5 2.304 2.448 2.596 7.348

Table 3. Pay of Staff at Model Farm, Sindh

Particulars Rs (million)

PAY OF OFFICERS

No. of posts

2008-09 2009-

10 2010-11 Total


Research fellow @ 30,000 pm 2 0.720 0.756 0.794 2.270

Sub-Total: 4 1.800 1.944 2.100 5.844

PAY OF OTHER STAFF

Contingent paid staff ( skilled & unskilled labour) - 0.500 0.500 0.500 1.500 Sub-total: - 0.500 0.500 0.500 1.500




Establishment cost for ARI, T-Jam 2.304 2.448 2.596 7.348

Establishment cost of Model Farm in Sindh 2.300 2.444 2.600 7.344 Sub-total: 4.604 4.892 5.196 14.692

Durable goods, vehicles, civil works 39.290 0 0 39.290

Operating cost

Operating Expenses at ARI, T-Jam 1.255 1.430 1.415 4.100

Operating Expenses at Model Farms in Sindh 1.530 4.580 4.580 10.690 Sub-total of operating cost: 2.785 6.010 5.995 14.790

Total: 46.679 10.902 11.191 68.772 Contingency /unforeseen/escalating cost @ 5% 2.103 0.300 0.299 2.702 Grand total: 48.782 11.202 11.490 71.474

52

Table 4. Capital cost estimates for ARI, Tandojam and model farm in Sindh Rs (million) Particulars Qty

2008-09 2009-10 2010-11 Total

Vehicles

Vehicle 1 with AC (single cabin customized) 4x2 1 1.500 0 0 1.500

Motorcycle for ARI, TJ 4 0.220 0 0 0.220 Sub-total: - 1.720 0 0 1.720

Lab equipment for ARI,T Jam



Dissecting microscope 2 0.300 0 0 0.300

Pocket weather tracker 2 0.100 0 0 0.100

Humidifier with accessories 1 0.100 0 0 0.100

Oil heaters 4 0.040 0 0 0.040

Incubator 1 0.075 0 0 0.075

Stereomicroscope with digital camera and other attachments

1 0.350 0 0 0.350

Power generator 20KV with accessories 1 0.600 0 0 0.600

Desk top Computer w/ colored laser printer 1 0.130 0 0 0.130

Lap top computer 1 0.095 0 0 0.095

Photocopier 1 1 0.200 0 0 0.200 Sub-total: - 3.090 0 0 3.090

Total: - 4.810 0 0 4.810

Lab equipment for Model Farm in Sindh

Refrigerator with stabilizer 1 0.040 0 0 0.040

Split AC with accessories 2 0.080 0 0 0.080



Computer with printer 1 0.070 0 0 0.070

Oil heaters 4 0.040 0 0 0.040

Power generator 20KV with accessories 1 0.600 0 0 0.600 Sub-total: - 1.080 0 0 1.080

Furniture & Fixture

Furniture Various

0.200 0 0 0.200

Racks and cages Various

0.200 0 0 0.200

Sub-total: - 0.400 0 0 0.400

Civil work

Laboratory & Insectary building with complete necessary equipment, fittingsat ARI, Tando Jam (16,476 sq ft)

1 33.000 0 0 33.000

Sub-total: - 33.000 0 0 33.000

Total: - 39.290 0 0 39.290

53

Table 5. Operational expenses for ARI, Tandojam


2008-09 2009-10 2010-11 Total

Operating expenses


POL charges 0.300 0.400 0.400 1.100

Communications 0.050 0.050 0.050 0.150

Utilities 0.100 0.100 0.100 0.300 Sub-total: 0.750 0.850 0.850 2.450 Other expenses


Stationery 0.100 0.100 0.100 0.300


Technical books 0.050 0.025 0.010 0.085



Transport , machinery and furniture - 0.100 0.100 0.300 Sub-Total - 0.100 0.100 0.200

Total for ARI, TJ 1.255 1.430 1.415 4.100

Table 6. Operational expenses for Model Farm, Sindh


2008-09 2009-10 2010-11 Total

Operating expenses


POL for motor cycles 0.200 0.200 0.200 0.600

Communications 0.050 0.050 0.050 0.150

Office cum lab building rent 0.180 0.180 0.180 0.540


Other expenses

Supplies and materials 0.200 0.200 0.200 0.600

Stationery 0.100 0.100 0.100 0.300

Advertisement publication, printing 0.050 0.050 0.050 0.150

Training to farmers 0.300 0.300 0.300 0.900 Sub-total: 0.650 0.650 0.650 1.950

Unforeseen expense

Miscellaneous (Customs, duties taxes etc) 0.050 0.050 0.050 0.150 Sub-total: 0.050 0.050 0.050 0.150


Transport , machinery and furniture - 0.050 0.050 0.100 Sub-total: - 0.050 0.050 0.100

Incentives for farmers (compensation for any unexpected losses to crops)

0 3.000 3.000 6.000

Grand Total 1.530 4.580 4.580 10.690

54

Annexure-VI

VI. Agriculture Research Institute, Quetta

Table 1. Budget Summary of ARI, Quetta

Table 2. Pay of Staff at ARI, Quetta Particulars Rs (million)

PAY OF OFFICERS

No. of posts

2008-09 2009-

10 2010-11 Total

Honoraria for Entomologist/Director Incharge Unit - 0.120 0.120 0.120 0.360



Sub-Total: 4 1.920 2.010 2.104 6.034

PAY OF OTHER STAFF

Driver @ Rs 7,000 pm 1 0.084 0.088 0.093 0.265



Table 3. Operational expenses for ARI, Quetta


2008-09 2009-10 2010-11 Total

Operating expenses


POL charges 0.300 0.400 0.400 1.100

Communications 0.050 0.050 0.050 0.150


Other expenses


Stationery 0.100 0.100 0.100 0.300


Technical books 0.050 0.025 0.010 0.085

Training of farmers cost 0.200 0.200 0.200 0.600




Total: 1.505 1.630 1.615 4.750



Establishment cost for ARI, Quetta 2.304 2.448 2.597 7.349 Sub-total: 2.304 2.448 2.597 7.349

Durable goods, vehicles and civil work 21.440 0 0 21.440 Sub-total: 21.440 0 0 21.440

Operating cost

Operating Expenses at ARI, Quetta 1.505 1.630 1.615 4.750

Total: 25.249 4.078 4.212 33.539 Contingency /unforeseen/escalating cost @ 5% 1.147 0.081 0.080 1.308

Grand total: 26.396 4.159 4.292 34.847

55

Table 4. Capital cost estimates for ARI, Quetta Rs (million) Particular Qty

2008-09 2009-10 2010-11 Total

Vehicles


Motorcycle (70 cc) 4 0.220 0 0 0.220 Sub-total: 1.720 0 0 1.720

Lab Equipment




Pocket weather tracker 2 0.100 0 0 0.100 Humidifier with accessories 1 0.100 0 0 0.100

Oil heaters 2 0.020 0 0 0.020

Incubator 1 0.075 0 0 0.075

Stereomicroscope with digital camera and attachments

1 0.350 0 0 0.350

Power generator 20 Kv with accessories 1 0.600 0 0 0.600

Desk top computer with colored laser printer 1 0.130 0 0 0.130

Lap top computer 1 0.095 0 0 0.095 Sub-total - 2.320 0 0 2.320

Furniture & Fixture

Furniture (office cum lab furniture) Various 0.200 0.0 0.0 0.200

Racks & cages Various 0.200 0.0 0.0 0.200 Sub-total: - 0.400 0 0 0.400

Civil work Laboratory & Insectary building with complete necessary equipment, fittings, at Khuzdar

8,500 Sq ft

17.000 0 0 17.000

Sub-total: 17.000 0 0 17.000

Total: 21.440 0 0 21.440

56

Annexure-VII

VII. Agriculture Research Institute, D. I. Khan

Table 1. Budget Summary of ARI, D. I. Khan

Table 2. Pay of Staff at ARI, D. I. Khan Particulars Rs (million)

PAY OF OFFICERS

No. of posts

2008-09 2009-

10 2010-11 Total

Honoraria for Entomologist/Director Incharge Unit - 0.120 0.120 0.120 0.360



Sub-Total: 2 1.020 1.092 1.167 3.279

PAY OF OTHER STAFF

Driver @ Rs 7,000 pm 1 0.084 0.088 0.093 0.265



Table 3. Operational expenses for ARI, D. I. Khan


2008-09 2009-10 2010-11 Total

Operating expenses


POL charges 0.200 0.230 0.260 0.690

Communications 0.050 0.050 0.050 0.150


Other expenses


Stationery 0.040 0.050 0.060 0.150


Technical books 0.050 0.025 0.010 0.085

Training of farmers cost 0.100 0.150 0.150 0.400




Total: 0.895 1.100 1.215 3.210



Establishment cost for ARI, D.I.Khan 1.204 1.330 1.460 3.994 Durable goods & vehicles &civil work 5.950 0 0 5.950 Operating cost 0.895 1.100 1.215 3.210 Total: 8.049 2.430 2.675 13.154 Contingency /unforeseen/escalating cost @ 5% 0.342 0.055 0.060 0.457 Grand total: 8.391 2.485 2.735 13.611

57

Table 4. Capital cost estimates for ARI, D. I. Khan Rs (million) Particular Qty

2008-09 2009-10 2010-11 Total

Vehicles


Motorcycle (70 cc) 2 0.110 0 0 0.110 Sub-total: 1.61 0 0 1.61

Lab Equipment

Refrigerator (14/16 cu ft) with accessories 2 0.080 0 0 0.080

Split AC with accessories 2 0.090 0 0 0.090


Pocket weather tracker 2 0.100 0 0 0.100


Oil heaters 2 0.020 0 0 0.020

Incubator 1 0.075 0 0 0.075

Stereomicroscope with digital camera and attachments

1 0.350 0 0 0.350

Power generator 20 Kv with accessories 1 0.600 0 0 0.600

Desk top computer with colored laser printer 1 0.130 0 0 0.130

Lap top computer 1 0.095 0 0 0.095 Sub-total - 1.940 0 0 1.940 Furniture & Fixture

Furniture (Office cum lab furniture) Various 0.100 0.0 0.0 0.100

Racks & cages Various 0.100 0.0 0.0 0.100 Sub-total: - 0.200 0 0 0.200

Civil work Mini Laboratory & Insectary building with complete necessary equipment, fittings, air conditioning, furniture & racks cages in D I Khan

11,00 Sq ft

2.200 0 0 2.200

Sub-total: 2.200 0 0 2.200

Total: 5.950 0 0 5.950

58

Annexure-VIII

VIII. Agriculture Research Institute, NIAB, Faisalabad Table 1. Budget Summary of NIAB, Faisalabad

Table 2. Pay of Staff at NIAB, Faisalabad Particulars Rs (million)

PAY OF OFFICERS

No. of posts

2008-09 2009-

10 2010-11 Total

Project allowance for Dy. Chief Sc (bio-control) (PI) - 0.120 0.120 0.120 0.360

Honorarium for Sub-unit for Insect resistance - 0.120 0.120 0.120 0.360

Research Associate @ Rs 30,000 pm 2 0.720 0.756 0.793 2.269

Scientific Assistants @ Rs 15,000 pm 4 0.720 0.756 0.793 2.269

Sub-Total: 6 1.680 1.752 1.826 5.258

PAY OF OTHER STAFF

Clerk @ Rs 10,000 pm 1 0.120 0.126 0.132 0.378

Driver @ Rs 7,000 pm 1 0.084 0.088 0.093 0.265


Total cost of establishment: 2.084 2.266 2.376 6.726

Table 3. Operational expenses for NIAB, Faisalabad Rs (million) Particulars

2008-09 2009-10 2010-11 Total

Operating expenses


POL charges 0.130 0.150 0.180 0.460

Communications 0.070 0.070 0.070 0.210

Stationary 0.080 0.080 0.080 0.240

Utilities 0.050 0.050 0.050 0.150

Books and journals 0.100 0.050 0.050 0.200 Sub-total: 0.580 0.600 0.680 1.860

Other expenses


Advertisement, publication, printing 0.100 0.050 0.050 0.200

Miscellaneous (unforeseen, duties, taxes etc.) 0.200 0.150 0.125 0.475 Sub-total: 0.800 0.550 0.325 1.675 Repair and maintenance

Transport, machinery and furniture 0.050 0.120 0.150 0.320 Sub-total: 0.050 0.120 0.150 0.320

Total: 1.430 1.270 1.155 3.855



Establishment cost for NIAB, Faisalabad 2.084 2.266 2.376 6.726 Sub-total: 2.084 2.266 2.376 6.726

Durable goods, civil works & vehicles 10.120 0.000 0.000 10.120

Operating cost

Operating Expenses at NIAB, Faisalabad 1.430 1.270 1.155 3.855 Total 13.634 3.536 3.531 20.701 Contingency /unforeseen/escalating cost @ 5% 0.577 0.063 0.057 0.697

Grand total: 14.211 3.599 3.588 21.398

59

Table 4. Capital cost estimates for NIAB, Faisalabad Rs (million) Particulars Qty

2008-09 2009-10 2010-11 Total

Vehicles

Vehicle 1 with AC (single cabin customized) 4x2 1 1.500 0 0 1.500 Sub-total: - 1.500 0 0 1.500

Equipment and machinery

Incubators 1 0.250 0 0 0.250

Deep freezers 1 0.025 0 0 0.025

Refrigerators 2 0.075 0 0 0.075

Analytical balance 1 0.200 0 0 0.200

Digital camera and accessories 1 0.050 0 0 0.050

Computers with printers 2 0.140 0 0 0.140

Stereomicroscope with camera and attachments 1 0.350 0 0 0.350

Diet preparation kettle 1 0.200 0 0 0.200

Power generator 20KV with accessories 1 0.600 0 0 0.600

Photocopier 1 0.200 0 0 0.200

Oven heavy duty for sterilizing rearing equipments 1 0.300 0 0 0.300

Microwave oven for sterilizing diet ingredients 1 0.010 0 0 0.010

Rearing cages, stands, fixtures 1 0.500 0 0 0.500

Heating and cooling system for rearing labs 1 1.000 0 0 1.000

Humidifiers 1 0.150 0 0 0.150

Thermometers Various 0.020 0 0 0.020

Dust and chemical masks with filters for rearing 4 0.100 0 0 0.100

Storage kits for transportation of natural enemies Various 0.050 0 0 0.050

Research equipment/ machinery for IRM labs Various 0.200 0 0 0.200 Sub-total: - 4.420 0 0 4.420

Furniture & Fixture

Furniture and fixtures (office cum lab furniture) Various 0.200 0 0 0.200 Sub-total: - 0.200 0 0 0.200

Civil Works

Lab building expansion/construction for establishing Insectary with complete necessary equipment, fittings, air conditioning, furniture & racks cages etc.

2000 sq ft

4.000 - - 4.000

Sub-total 4.000 - - 4.000

Total 10.120 - - 10.120

60

Annexure-IX

IX. National Agriculture Research Centre, Islamabad

Table 1. Budget Summary of NARC, Islamabad

Table 2. Pay of Staff at NARC, Islamabad Particulars Rs (million)

PAY OF OFFICERS

No. of posts

2008-09 2009-

10 2010-11 Total

Honoraria/Project allowance for Principla Investigator - 0.120 0.120 0.120 0.360

Scientific Officer @ Rs 45,000 pm 1 0.540 0.594 0.650 1.784

Scientific Assistants @ Rs 15,000 pm 1 0.180 0.189 0.198 0.567

Sub-Total: 2 0.84 0.903 0.968 2.711

PAY OF OTHER STAFF

Honoraria for support staff - 0.060 0.070 0.080 0.210

Contingent paid staff ( skilled & unskilled labour) - 0.180 0.200 0.240 0.620

Stipend/internship - 0.180 0.180 0.240 0.600 Sub-total: 2 0.420 0.450 0.560 1.430


Table 3. Operational expenses for NARC, Islamabad

Rs (million) Particulars 2008-09 2009-10 2010-11 Total

Operating expenses


POL charges 0.300 0.310 0.320 0.930

Communications 0.085 0.095 0.100 0.280

Stationary 0.050 0.070 0.080 0.200

Utilities 0.000 0.020 0.020 0.040

Books and journals 0.100 0.050 0.050 0.200 Sub-total: 0.835 0.875 0.940 2.650

Other expenses


Advertisement, publication, printing 0.080 0.090 0.100 0.270

Miscellaneous (unforeseen, duties, taxes etc.) 0.080 0.090 0.090 0.260

Seminar/Workshop 0.030 0.050 0.050 0.130 Sub-total: 0.440 0.530 0.590 1.560


Transport, machinery and furniture 0.100 0.190 0.245 0.535 Sub-total: 0.100 0.190 0.245 0.535

Total: 1.375 1.595 1.775 4.745



Establishment cost for NARC, Islamabad 1.260 1.353 1.528 4.141 Sub-total: 1.260 1.353 1.528 4.141

Durable goods & vehicles

Vehicle 1.500 0 0 1.500

Research equipments 0.260 0.515 0.000 0.775

Furniture & Fixture 0.100 0 0 0.100 Sub-total: 1.860 0.515 0 2.375

Operating cost

Operating Expenses at NARC 1.375 1.595 1.775 4.745 Sub-total: 1.375 1.595 1.775 4.745

Total: 4.495 3.463 3.303 11.261 Contingency /unforeseen/escalating cost @ 5% 0.161 0.105 0.088 0.354

Grand total: 4.656 3.568 3.391 11.615

61

Table 4. Capital cost estimates for NARC, Islamabad Rs (million) Particulars Qty

2008-09 2009-10 2010-11 Total

Vehicles

Vehicle 1 with AC (single cabin customized) 4x2 1 1.500 0 0 1.500 Sub-total: - 1.500 0 0 1.500

Equipment and machinery

Desk top Computer with printer 1 0.060 0 0 0.060

Research equipment/ machinery Various 0.200 0.515 0.000 0.715 Sub-total: - 0.260 0.515 0.000 0.775

Furniture & Fixture

Furniture and fixes Various 0.100 0 0 0.100 Sub-total: - 0.100 0 0 0.100

Total - 1.860 0.515 0 2.375

62

Annexure-X

X. Federal Monitoring & Coordination Unit, Islamabad Table 1. Budget Summary of FMCU

Rs (million) Particulars 2008-09 2009-10 2010-11 Total

Establishment charges 3.096 3.315 3.548 9.959

Operating cost 3.420 3.695 4.030 11.145 Sub-total: 6.516 7.010 7.578 21.104

Durable goods

Vehicle cost 0.850 0 0 0.850

Motorcycle cost 0.055 0 0 0.055

Office equipment 0.700 0 0 0.700

Furniture 0.400 0 0 0.400 Sub-total: 2.005 0 0 2.005

Total: 8.521 7.010 7.578 23.109 Contingency /unforeseen/escalating cost @ 5% 0.271 0.184 0.201 0.656 Outsourcing 5.000 5.000

Grand total: 13.792 7.194 7.779 28.765

Table 2. Staff Requirement for FMCU Designation Pay Scale No.

Officers

National Project Director (NPD) 20 1

Assistant Project Director 18 1

Accounts and Admin Officer 17 1

Sub-total: 3 Supporting staff

Personal Assistant (PA) w/Computer skills 16 1

Office Assistant w/Computer skills 11 1

Assistant Accounts officer 12 1

Driver 4 1

Naib Qasid 1 1

Sub-total: 5

Total: - 8

Table 3. Pay of Staff for FMCU

Rs (million) Particulars # of posts 2008-09 2009-10 2010-11 Total

National Project Director (NPD) @ Rs 100,000 pm

1 1.200 1.260 1.323 3.783

Assistant Project Director @ Rs 50,000 pm 1 0.600 0.660 0.726 1.986

Accounts Officer @ Rs 45,000 1 0.540 0.567 0.595 1.702 Sub-total (Rs million): 3 2.340 2.487 2.644 7.471

Supporting staff

Private Assistant (PA) @ Rs 20,000 pm 1 0.240 0.264 0.290 0.794

Accounts Assistant @ Rs 15,000 pm 1 0.180 0.198 0.217 0.595

Office Assistant @ Rs 15,000 pm 1 0.180 0.198 0.217 0.595

Driver @ Rs 7,000 1 0.084 0.088 0.093 0.265

Naib Qasid @ Rs 6,000 pm 1 0.072 0.080 0.087 0.239 Sub-total: 5 0.756 0.828 0.904 2.488

Grand Total: 8 3.096 3.315 3.548 9.959

63

Table 4. Operational expenses for FMCU Rs (million) Particulars

2008-09 2009-10 2010-11 Total

TA/DA 0.400 0.450 0.500 1.350

POL for vehicles 0.300 0.350 0.400 1.050

POL for motor cycles (1) 0.050 0.060 0.070 0.180

Repair and maintenance of M/cycles (1) 0.020 0.025 0.030 0.075

Repair and maintenance for vehicles (1) 0.050 0.060 0.080 0.190

Repair and maintenance of Office equipment 0.030 0.030 0.040 0.100

Postage/Courier 0.040 0.050 0.050 0.140

Telephone/fax 0.080 0.090 0.100 0.270

Publicity charges 0.050 0.060 0.070 0.180

Stationery 0.100 0.080 0.090 0.270

Utility bills 0.100 0.120 0.130 0.350

Office Rent 1.400 1.500 1.600 4.500

Rent of residence 0.400 0.450 0.500 1.350

Taxes and royalties 0.050 0.020 0.020 0.090

Printing 0.050 0.050 0.050 0.150

Meetings/workshops/seminars 0.200 0.200 0.200 0.600

Others 0.100 0.100 0.100 0.300 Total : 3.420 3.695 4.030 11.145

Table 5. Capital cost estimates for FMCU Item Qty Unit price (Rs) Total amount

(Rs million)

Vehicles 1000 cc w/CNG fitting 1 850,000 0.850

Motor cycles 1 55,000 0.055

Computer with printer 2 70,000 0.140

Lap tops 1 95,000 0.095

Scanner 1 30,000 0.030

Photo-copier 1 200,000 0.200

Fax 1 35,000 0.035

Multimedia with screen 1 200,000 0.200

Furniture - - 0.400 Total: - - 2.005

64

Annexure XI

Component wise total costs of the project Component Rs million Federal Monitoring & Coordination Unit, Islamabad 28.765 CABI South Asia, Rawalpindi 72.377

Ayub Agriculture Research Institute, Faisalabad 94.442 Agriculture Research Institute, Tandojam 71.474

Agriculture Research Institute, D. I. Khan 13.611 Agriculture Research Institute, Quetta 34.847 Central Cotton Research Institute, Multan 16.019 Cotton Research Institute, Sakrand 15.789 NIAB, Faisalabad 21.398 Total: 368.722

PARC to provide funding for NARC component of this project out of RADP

National Agriculture Research Center, Islamabad 11.615

65

Annexure-XII

Cost Summary of the project “Biological control of the cotton pests including mealy bug”

Items

FMCU ARI

FD

ARI

TJ

ARI

DIK

ARI

Qta

CCRI Multan

CABI

Rwp

NIAB

FD

CRI

Sakrand

Total

Establishment Charges 9.959 30.713 14.692 3.994 7.349 7.914 33.385 6.726 8.214 122.946 Operational Charges 11.145 8.455 14.790 3.210 4.750 4.410 29.540 3.855 4.025 84.1800 Sub-total: 21.104 39.168 29.482 7.204 12.099 12.324 62.925 10.581 12.239 207.126 Cost of durable goods Purchase of Motorcycles 0.055 0.220 0.220 0.110 0.220 0.000 0.210 0.000 0.000 1.0350 Purchase of Vehicles 0.850 3.000 1.500 1.500 1.500 1.500 0.000 1.500 1.500 12.850 Lab & Office

Equipment/machinery 1.100 16.020 4.570 2.140 2.720 1.810 2.663 4.620 1.690 37.333

Sub-total: 2.005 19.240 6.290 3.750 4.440 3.310 2.873 6.120 3.190 51.218 Civil works 0.000 33.000 33.000 2.200 17.000 0.000 0.000 4.000 0.000 89.200 Contingency 0.656 3.034 2.702 0.457 1.308 0.385 0.000 0.697 0.360 9.599 Institutional charges 0.000 0.000 0.000 0.000 0.000 0.000 6.579 0.000 0.000 6.579 Outsourcing 5.000 5.000 Total: 28.765 94.442 71.474 13.611 34.847 16.019 72.377 21.398 15.789 368.722

66

Annexure-XIII

References:

Abdel Razek, A. S. (2006). Infectivity prospects of both nematodes and bacterial symbionts

against cotton leaf worm, Spodoptera littoralis (Biosduval) (Lepidoptera: Noctuidae).

Journal of Pest Science 79, 11-15.

Abbas, M. S. T. and El-Deeb, A. A. (1993). On the natural enemies of the major pests infesting

cotton in Egypt. Egyptian Journal of Agricultural Research. 71: 131-138.

Ahmed, Z. (1991) Integrated pest management in Pakistan in the Asia Pacific Region. Proc.

Conf. IPM in the Asia Pacific region ,23-27 September 1991, Kuala Lumpur

Ahmed, Z. (2000). Integrated pest management in Pakistan. The NEWS, August 1, 2000.

Ahmed, Z. (1999). Pest problems of cotton-A regional perspective. Proc. ICAC-CCRI regional

consultation insecticide resistance management in cotton. CCRI, Multan,Pakistan,5-20.

Ahmad, I. and Poswal,A.2000. Cotton integrated pest management in Pakistan: Current status.

Country report presented in cotton IPM planning and curriculum workshop

organized by FAO, Bankok, Thailand, February 28-March 2,2000.

Akhurst, R.J. (1986). Controlling insects in soil with entomopathogenic nematodes. In: Samson,

R.A. Vlak, J.M. & Peters, D. (Eds). Fundamental and applied aspects of invertebrate

pathology. Proceedings 4th International Colloquium of Invertebrate. Pathology, pp.

265-267.

Amornsak, W., G. Gordh & G. Graham. 1998. Detecting parasitised eggs with polymerase chain

reaction and DNA sequence of Trichogramma australicum Girault (Hymenoptera:

Trichogrammatidae). Austr. J. Entomol. 37: 174-179.

Baloch, U. K. (1995). Pesticide monitoring programme. Paper presented for WWF-Pakistan,

Lahore.

Banu, J. G. & Rajendran, G. (2002). Host records of an entomopathogenic nematode,

Heterorhabditis indica. Insect Environment 8, 61-63.

Clausen ,C.P. (1978). Introduced parasites and predators of arthropod pests and weeds: A world

review. Agriculture Handbook No 480 USDA pp 545.

Ebssa, L., Borgemeister, C. & Poehling, H.M. (2004). Effectiveness of different species/strains

of entomopathogenic nematodes for control of western flower thrips (Frankliniella

Occidentalis) at various concentrations, host densities, and temperatures. Biological

Control 29, 145-154.

Ehlers, R.-U. (2001). Mass production of entomopathogenic nematodes for plant protection.

Applied Microbiology and Biotechnology 56, 623-633.

67

Flanders, S. E. (1944). Biological control of the potato mealy bug. J. Econ. Ent.37; 365-371.

Forlow Jech, L. & Henneberry, T. J. (1997). Pink bollworm larval mortality following

application of Steinernema riobravis entomopathogenic nematodes in cotton furrow

irrigation. Proceedings Beltwide Cotton Conferences 2, 6-10.

Gaugler, R. (1988). Ecological considerations in the biological control of soil-inhabiting insects

with entomopathogenic nematodes. Agriculture Ecosystems and Environment 24,

351-360.

Glazer, I., Nakache, Y. & Klein, M. (1992).Use of entomopathogenic nematodes against foliage

pests. Hassadeh 72, 351-354.

Gugerli, P. (2003). Grapevine leafroll and related viruses. In Extended Abstracts of the XIV

Meeting of the International Council for the Study of Virus and Virus-like Diseases

of the Grapevine, Locorotondo, Italy, 12–17

Hasnain, T. (1999) Pesticide –use and its impact on crop ecologies: issues and options. SDPI

working paper series. SDPI, Islamabad, pp73.

Hoy, M. 1994. Insect molecular genetics. An introduction to principles and applications.

Academic Press, Inc. San Diego, California, 546.

Hopkins, D.L., Purcell, A.H., 2002. Xylella fastidiosa: cause of Pierce’s disease of grapevine and

other emergent diseases. Plant Dis. 86, 1056–1066.

Hussaini, S.S., Singh, S.P., Parthasarathy, R. & Shakeela, V. (2000). Virulence of native

entomopathogenic nematodes against black cutworms, Agrotis ipsilon (Hufnagel) and

A. segetum (Noctuidae : Lepidoptera). Indian Journal of Nematology 30, 103-105.

Inayatullah, C. (1997). Re-thinking the cotton pesticide link. The NEWS, January 4,1997.

Inayatullah, C. and Haseeb,M. (1996). Poisoning by pesticides. Pakistan J. of Medical Res. , 35

(20): 57-58.

Mahmood, R., Mohyuddin, A. I.& Kazimi, S. (1980). Rastrococcus spinosus (Robinson)

(Homoptera: Pseudococcidae) and its natural enemies in Pakistan. Proceedings 1st

Pakistan Congress of Zoology Islamabad, 291-294.

Martinez, Andrés Rebolledo, Del Angel-Perez, Ana Lid, Becerril-Roman, Alberto E. 2005.

Growth analysis for three pineapple cultivars grown on plastic mulch and bare soil.

INCI, 30, 758-763.

Navon, A., Nagalakshmi, V.K., Shlomit, Levski., Salame, L. & Glazer, I. (2002). Effectiveness

of entomopathogenic nematodes in an alginate gel formulation against lepidopterous

pests. Biocontrol Science and Technology 12, 737-746.

Pimental, D. (1992). Assessment of environment and economic impact of pesticide use. A paper

appeared in the monograph (The pesticides Question: Environment, Economics and

ethics Chapman and Hall, New York.

68

Pinto, J. D., R. Stouthamer & G. R. Platner. 1997. A new cryptic species of Trichogramma

(Hymenoptera Trichogrammatidae) from the Mojave desert of California as

determined by morfological, reproductive and molecular data. Proc. Entomol. Soc.

Wash. 99: 238-247.

Poswal, M. A. and Williamson, S. (1998). Stepping off then cotton pesticide treadmill.

Preliminary findings from a farmers’ participatory cotton IPM training project in

Pakistan. CABI Bioscience Center, Rawalpindi..

Qasmi,F. (1997) Pesticides and existing policies in Pakistan. Paper presented during workshop

on “Environment friendly use of pesticides.” Organized by the Environmental

Protection Department, Government of Punjab, March 29, 1997, Lahore.

Qureshi, A. H. and Khan M. A. (2001). Policy and strategy for rational use of pesticides in

Pakistan. United Nations System in Pakistan Publication No UN-

PAK/FAO/2001/002: 55-72.

Sharad, M., Anil, S. & Gaur, H. S. (2004). Successful management of mango mealy bug,

Drosicha mangiferae by Photorhabdus luminescens, a symbiotic bacterium from

entomopathogenic nematode Heterorhabditis indica. International Journal of

Nematology14, 195-198.

Van Steenwyk, A.aR. Toscano, N.C., Bollmer, G.R., K. Kido and H.T. Andreynolds, (1975).

Increases of Heliothis spp. In Cotton under various insecticide treatment regimes.

Environ. Ent., 4: 993-996.

Zeddies, J.; Schaab, R.P.; Neuenschwander, P.; Herren, H.R. (2001)Economics of biological

control of cassava mealybug in Africa. Agricultural Economics, 24, 209–219.

69

Annex XIV

Justification/ ToR for each post in the project “Biological control of the cotton pests

Including mealy bug

Post Justification /TOR

FMCU,

Islamabad

National Project

Director

Will be overall project inchagre and coordinator to look after all

administrative, technical and accounts matters, of the project at national level,

arrange meetings, collect reports from the coordinating units and compile the

quarterly /six monthly report/annual/ final report,

Assistant Project

Director

Will assist the National Project Director in execution of the project

Accounts Officer Will be responsible to maintain the accounts of the project at national level

CABI SA

Rawalpindi

Insect Biocontrol

Specialist (IBS)

Will be overall incharge of the project of CABI Unit. With assistance of project

staff will be responsible for the following:

Collect baseline data on population levels of mealy bug and its natural enemies

on cotton and other plants in different ecological areas as mentioned in work

plan.

Contact scientists abroad and develop program for search and importation of

natural enemies

Develop monitoring protocol for quality assessment of contents and process of

studies in progress on biology and ecology of the pest and natural enemies.

Will give design and requirements for insectary, train the staff of coordinating

units in addressing entomological issues, assist in establishing insectaries at

provincial levels, guide and train in mmaintaining pure insect parasitoids and

predators cultures, their mass production, methods of releases and recovery

surveys. Collect quantitative and qualitative data on impact of natural enemies (exotic

and endemic ones) on mealy bug.

Organize workshops and field days for farmers training and implementation of

mealy bug and other cotton pests management strategies at model farms in

Sindh and Punjab.

Write progress reports and other related documents, brochures for farmers for

technology transfer

Project Officers Will work under guidance of IBS and maintain natural enemy field reservoirs

and do field and laboratory studies assigned by the project incharge

Entomologists They will work at model farms for management of all cotton pests under the

guidance of the IBS

Expert Field

Facilitators

They will work at model farms for conducting FPTR activities for management

of all cotton pests under the guidance of the IBS. They will conduct FFS to

involve the community at model farms for controlling all cotton pests.

Molecular

Scientist

Will be responsible for studies on molecular identification of mealy bugs and

other pests of cotton; checking of possible transmission role of cotton mealy

70

bug for some crop pathogens (bacteria, viruses or fungi) in cotton crop,

molecular identification of variability/races/subspecies in cotton pests, insect

parasitoids and predators; identification of insect pathogens (viruses, bacteria

and fungi) associated with cotton pests; maintain pure cultures of

Trichogramma and other local and newly introduced bio-control agents and

strains associated with cotton pests and supply for large production to

coordinating teams at model farms.

Entomopathogens

Scientist

Will do studies on identification of entomopathogenic nematodes (EPNs)

associated with cotton pests in Pakistan; pathogenecity of EPNs against

different cotton pests; role of EPNs in controlling cotton pests (mealy bug and

others); develop technology for mass production of EPNs for cotton pests;

conduct field assays on efficacy of EPNs attacking cotton pests and import

exotic useful nematodes strains for trials against cotton pests.

AARI,

Faisalabad

Provincial project

Director

Will be incharge of the project unit, design studies and supervise the unit

activities for controlling mealy bug and other pests on cotton in the specified

area.

Asstt

Entolmologists

and Asstt Res

Officers (Ento)

Will be responsible for conducting all studies assigned in the project plan for

controlling mealy bug on cotton in their project area and all other cotton pests

at the model farm in the Punjab. Their duties will be assigned by the incharge

of the unit

CCRI, Multan Senior Scientific Officer (MB Management Expert)


activities for the staff for studies on controlling mealy bug on cotton in the

specified area.

Assistant

Scientific Officer

Will work under the guidance of the unit incharge for studies in controlling

mealy bug on cotton in the specified area

CCRI, Sakrand

Principal

Scientific Officer


activities for the staff for studies on controlling mealy bug on cotton in the

specified area.

Assistant

Scientific Officer



ARI, Tando Jam

Scientific

Officers


mealy bug on cotton in the specified area and at the model farm for controlling

all major cotton pests

Research Fellows Will work under the guidance of the unit incharge for studies in controlling

mealy bug on cotton in the specified area and at the model farm for controlling

all major cotton pests.

ARI, Quetta

Scientific

Officers



Research Fellows Will work under the guidance of the unit incharge and assist SOsfor studies in

controlling mealy bug on cotton in the specified area.

ARI, DI Khan

Scientific Will work under the guidance of the unit incharge for studies in controlling

71

Officers mealy bug on cotton in the specified area

Research Fellows Will work under the guidance of the unit incharge and assist SOs for studies in

controlling mealy bug on cotton in the specified area.

Scientific Officer Will do studies on biopesticides under guidance of the unit incharge for

controlling mealy bug on cotton, train farmers on application of the

biopesticides for controlling mealy bug on cotton

Scientific

Assistants

Will assist Scientific Officer in conducting studies on biopesticides

NIAB,

Faisalabad

Research

Associate


mealy bug on cotton in the specified area, maintaining insect parasitoids and

predators cultures of the all cotton pests, assist AARI in providing natural

enemies cultures and conducting studies at the model farm at Bahawalpur

Scientific

Assistant

Will assist Scientific Officer in conducting studies on controlling mealy bug

and other cotton pests

Supporting Staff

Provided in each

project unit

Supporting staff provided in each project unit will assist the scientists and the

officers in execution of the project and conducting scientific experiments

72

Annex XV

Insectary site, needs and designs

In principle area of temperate climate offers the best location. Climatic area chosen should be

cool.

Location:

Consideration should be given to location away from immediate vicinity of agriculture area.

Minimum buffer zone is a kilometer to reduce chances of:

1. insecticidal drift from a crop

2. contaminant species of parasites or hosts

3. pest moving from insectary to crop area

Avoid locating an insectary where urban and industrial atmospheric contamination (smog) is a

problem

Greatest length of the building be arranged east-west direction

The wall on the sunny side be shaded by an over hanging roof or louvers and only the short west

wall is exposed to greatest heat source and can therefore be shaded by awnings ,louvers, or trees

Landscaping in the vicinity should exclude plant species which serve as hosts of phytophagous

insects

Building specifications

Local materials, construction regulations, and architecture decide the exterior features of the

permanent insectary

Temporary facilities are decided project wise and as the need basis

Primary insectary problem is climate control. Other aspects of design revolve around this

necessity regardless of permanent or temporary status of the insectary, therefore, appurtenances

such as coolers, louvers on windows and reflective roofs are expected to alter somewhat the

exterior of appearance of the insectary from the conventional buildings

Interior design

1. Main lab room with sufficient natural day light portioned into smaller rooms as needed

2. Floor plan: Minimum 20x40 ft to meet the basic requirement of mass rearing and some

experiments as per needs. Provide ample space for maneuvering bulky items such as carts

and racks, corridors are at least 4 feet wide and doors 3 feet wide. Concrete floor is a

source of dust from the scuffing of its surface. Painting and waxing are adequate if they

are maintained properly. Covering floor with linoleum or asphalt –vinyl tile is a

satisfactory solution. Windows should consist of rigidly fixed inner pane which is of

large dimension and free of cross bars and flush with interior wall surface and a

removable (for cleaning) but weather tight outer pane. Approximately 2 inches of space

73

of air space should separate the panes. . Ledges around windows, fixtures or ducts can be

eliminated by flush design.

3. Ceiling height recommended is 7 feet, this reduces costs of cooling and better

maintenance of room temperature control

4. For mealy bug and their parasitoids mass rearing the room temperature should be

maintained in the range 24-26 degree centigrade. It is the primary requirement. As cotton

growing areas are mostly dry and hot special attention is to be given to meet the basic

requirements of atmospheric humidity and temperature maintenance.

5. Sufficient provision of light with cool white fluorescent tubes, sufficient electrical

outlets below and at working table heights. Ensure cooling and heating provisions and

control on fluctuations of temperature. There should be provision of light traps in hall

ways, wash rooms, and anterooms to attract and escaped natural enemies or hosts and

reduce the chances of contaminations in rearing rooms. Since light traps will operate

constantly must be fixed against walls away from doors and windows.

6. 7. Provision of tap water and sink for washing dishes glass wares and other needs. Drains

should have dirt –tight covers. Toilets and lavatory facilities should be located away from

propagation rooms.

7. A small quarantine area for sorting and screening of field collections.

8. Small stores for equipment and temporary storage.

9. Staff room, office, Furnishing and equipment: In the beginning requirements are working

tables, racks storage cabinets, chairs stools insect rearing cages for insect adults, refrigerator,

microscopes, fans. Split AC , heaters ; miscellaneous (glass vials , Petri dishes, Plastic jars small

and large rearing dishes with covers tubes small and large, buckets, brushes, of different size.

Knife , hand lens, Sieve small and large as per need , large steel trays for rearing mealy bug and

predators, honey, cloth, rubber bands, parasitoids small dishes blower, blender, table lamps,

measuring cylinder , funnels , scissors, forceps, cavity blocks, spoons, steel can artificial diet

ingredients, etc.

Documents

Final Copy of Cotton-Mealy Bug PC-I 17-02-08 final draft Cop… · BIOLOGICAL CONTROL OF MAJOR COTTON PESTS INCLUDING MEALY BUG IN PAKISTAN (PC-I) MINISTRY OF FOOD, AGRICULTURE AND