1

Figure S2 - Neighbor joining phylogenetic analysis of the NRT1/PTR family. The tree was rooted using an A. thaliana NRT2 gene as an outgroup. Percent bootstrap values from 1,000 replicates are given. All C. canephora genes are placed in clades with >50% of bootstrap support. Taxonomic groups are differentially colored based in supergroups identiﬁed for monocots and eudicots. Accession numbers are shown. Codes were retrieved from the Coffee Genome Hub for C. canephora sequences and Phytozome for all other species. Phylogenetic groups were based in von Wittgenstein et al. (2014).

Figure S2 - Neighbor joining phylogenetic analysis of the ......Figure S2 - Neighbor joining phylogenetic analysis of the NRT1/PTR family. The tree was rooted using an A. thaliana

Download PDF Report

Upload
others
View
5
Download
0

Embed Size (px)

Citation preview

Page 1: Figure S2 - Neighbor joining phylogenetic analysis of the ......Figure S2 - Neighbor joining phylogenetic analysis of the NRT1/PTR family. The tree was rooted using an A. thaliana

Figure S2 - Neighbor joining phylogenetic analysis of the NRT1/PTR family. The tree was rooted using an A. thaliana NRT2 gene as an outgroup. Percent bootstrap values from 1,000 replicates are given. All C. canephora genes are placed in clades with >50% of bootstrap support. Taxonomic groups are differentially colored based in supergroups identified for monocots and eudicots. Accession numbers are shown. Codes were retrieved from the Coffee Genome Hub for C. canephora sequences and Phytozome for all other species. Phylogenetic groups were based in von Wittgenstein et al. (2014).

The Neighbor-joining Method: A New Method for ...matilde/NeighborJoinMethod.pdf · The new, neighbor-joining method and Sattath and Tversky’s method are shown to be generally better

The Neighbor-joining Method: A New Method for ...matilde/NeighborJoinMethod.pdf · The new, neighbor-joining method and Sattath and Tversky’s method are shown to be generally better

Documents

Rubidibacter lacunae strain KORDI 51-2T...Rubidibacter lacunae strain KORDI 51-2T 198 Standards in Genomic Sciences Figure 1.Neighbor-joining tree showing the phylogenetic position

Rubidibacter lacunae strain KORDI 51-2T...Rubidibacter lacunae strain KORDI 51-2T 198 Standards in Genomic Sciences Figure 1.Neighbor-joining tree showing the phylogenetic position

Documents

Author version - microbialbiofilms.files.wordpress.com · with the neighbor-joining algorithm by using the CLC Sequencer Viewer 7.6. The tree was resampled with 1000 bootstrap replications

Author version - microbialbiofilms.files.wordpress.com · with the neighbor-joining algorithm by using the CLC Sequencer Viewer 7.6. The tree was resampled with 1000 bootstrap replications

Documents

Phylogenetic trees Tutorial 6. Distance based methods UPGMA Neighbor Joining Tools Mega phylogeny.fr DrewTree Phylogenetic Trees

Phylogenetic trees Tutorial 6. Distance based methods UPGMA Neighbor Joining Tools Mega phylogeny.fr DrewTree Phylogenetic Trees

Documents

Time-Based Joining Method for Generating Phylogenetic ...big.yonsei.ac.kr/pdf/Publications_Patents/1. Journal(INT'L)/37.Time... · Phylogenetic Trees of Architectural Plans Sungil

Time-Based Joining Method for Generating Phylogenetic ...big.yonsei.ac.kr/pdf/Publications_Patents/1. Journal(INT'L)/37.Time... · Phylogenetic Trees of Architectural Plans Sungil

Documents

More on neutral theory OEB 192 – 10.09.15. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA

More on neutral theory OEB 192 – 10.09.15. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA

Documents

OUTLINE Phylogeny UPGMA Neighbor Joining Method Phylogeny Understanding life through time, over long periods of past time, the connections between all

OUTLINE Phylogeny UPGMA Neighbor Joining Method Phylogeny Understanding life through time, over long periods of past time, the connections between all

Documents

Diversity of endophytic fungi associated with some …reference sequences were retrieved from the GenBank in NCBI. The phylogenetic tree was constructed by neighbor-joining (NJ) method

Diversity of endophytic fungi associated with some …reference sequences were retrieved from the GenBank in NCBI. The phylogenetic tree was constructed by neighbor-joining (NJ) method

Documents

Large-scale neighbor-joining with NINJA · 2016. 5. 8. · Large-scale neighbor-joining with NINJA Travis J. Wheeler twheeler@cs.arizona.edu Department of Computer Science The University

Large-scale neighbor-joining with NINJA · 2016. 5. 8. · Large-scale neighbor-joining with NINJA Travis J. Wheeler [email protected] Department of Computer Science The University

Documents

Interception of ‘Candidatus Phytoplasma solani’ in Brazil ... · reported (DUDUK et al., 2010). ... Phylogenetic tree inferred from 16S rDNA sequences using the neighbor-joining

Interception of ‘Candidatus Phytoplasma solani’ in Brazil ... · reported (DUDUK et al., 2010). ... Phylogenetic tree inferred from 16S rDNA sequences using the neighbor-joining

Documents

Analysis of Y-DNA Simple Tandem Repeats (STRs) For The ...€¦ · aligned in MEGA using MUSCLE with Neighbor Joining clustering method. Phylogenetic analysis was done in MEGA of

Analysis of Y-DNA Simple Tandem Repeats (STRs) For The ...€¦ · aligned in MEGA using MUSCLE with Neighbor Joining clustering method. Phylogenetic analysis was done in MEGA of

Documents

Tropical japonica - ScienceSocieties.org · tropical japonica rice accessions developed by cluster analysis following Nei 1973 distance and neighbor-joining methods based on 36 SSR

Tropical japonica - ScienceSocieties.org · tropical japonica rice accessions developed by cluster analysis following Nei 1973 distance and neighbor-joining methods based on 36 SSR

Documents

Università degli Studi di Palermo - iris.unipa.it · bassa differenziazione genetica e bassi livelli di consanguineità all’interno delle razze e tra esse. Il dendrogramma Neighbor-Joining,

Università degli Studi di Palermo - iris.unipa.it · bassa differenziazione genetica e bassi livelli di consanguineità all’interno delle razze e tra esse. Il dendrogramma Neighbor-Joining,

Documents

Analysis of Gene Expression Data Spring Semester, 2004 ...rshamir/ge/04/scribes/lec05.pdf · 5.2.2 Neighbor Joining Algorithm A simple algorithm, based on neighbor merging, is due

Analysis of Gene Expression Data Spring Semester, 2004 ...rshamir/ge/04/scribes/lec05.pdf · 5.2.2 Neighbor Joining Algorithm A simple algorithm, based on neighbor merging, is due

Documents

Constructing Phylogenetic Trees - Shodorshodor.org › ... › calvin_cbbe11 › d2s1 › D2-2_Constructing_Phylogene… · Phylogenetic Tree Reconstruction PTR. Phylogenetic Tree

Constructing Phylogenetic Trees - Shodorshodor.org › ... › calvin_cbbe11 › d2s1 › D2-2_Constructing_Phylogene… · Phylogenetic Tree Reconstruction PTR. Phylogenetic Tree

Documents

Optimality of the Neighbor Joining Algorithm and Faces of the Balanced Minimum Evolution Polytope Ruriko Yoshida

Optimality of the Neighbor Joining Algorithm and Faces of the Balanced Minimum Evolution Polytope Ruriko Yoshida

Documents

Phylogenetic Analysis of Potato Virus Y (PVY) Isolate from ...-NTN form South Africa (Figure 1). Similar results were obtained when neighbor joining tree was constructed from aa sequences

Phylogenetic Analysis of Potato Virus Y (PVY) Isolate from ...-NTN form South Africa (Figure 1). Similar results were obtained when neighbor joining tree was constructed from aa sequences

Documents

Neighbor Joining Algorithms for Inferring …moran/r/PS/dlca_journal_010507.pdfdistance-based reconstruction by the ›(n4) ADDTREE algorithm [34]. Later, Saitou and Nei proposed the

Neighbor Joining Algorithms for Inferring …moran/r/PS/dlca_journal_010507.pdfdistance-based reconstruction by the ›(n4) ADDTREE algorithm [34]. Later, Saitou and Nei proposed the

Documents

Figure S1 Evolutionary relationships of RBG subclasses in Arabidopsis (a) and B. rapa (b). Optimal neighbor-joining trees with sum of branch lengths =

Figure S1 Evolutionary relationships of RBG subclasses in Arabidopsis (a) and B. rapa (b). Optimal neighbor-joining trees with sum of branch lengths =

Documents

SUPPLEMENTARY INFORMATION - Gut · Web viewS2. Phylogenetic tree (neighbor-joining from a jukes-cantor matrix) of the main taxonomic groups which varied between the two test groups,

SUPPLEMENTARY INFORMATION - Gut · Web viewS2. Phylogenetic tree (neighbor-joining from a jukes-cantor matrix) of the main taxonomic groups which varied between the two test groups,

Documents

Large-scale neighbor-joining with NINJA - Wheeler Labwheelerlab.org/software/ninja/files/NINJA_preprint.pdf · Large-scale neighbor-joining with NINJA Travis J. Wheeler twheeler@cs.arizona.edu

Large-scale neighbor-joining with NINJA - Wheeler Labwheelerlab.org/software/ninja/files/NINJA_preprint.pdf · Large-scale neighbor-joining with NINJA Travis J. Wheeler [email protected]

Documents

BNFO 602 Phylogenetics Usman Roshan. Summary of last time Models of evolution Distance based tree reconstruction –Neighbor joining –UPGMA

BNFO 602 Phylogenetics Usman Roshan. Summary of last time Models of evolution Distance based tree reconstruction –Neighbor joining –UPGMA

Documents

GENETIC CHARACTERIZATION OF HAEMONCHUS …journal.usm.my/journal/18-02-05Wahab.pdfGenetic Characterization of Haemonchus Contortus The ITS-2 Neighbor-Joining tree clearly separated

GENETIC CHARACTERIZATION OF HAEMONCHUS …journal.usm.my/journal/18-02-05Wahab.pdfGenetic Characterization of Haemonchus Contortus The ITS-2 Neighbor-Joining tree clearly separated

Documents

NJM (Neighbour-Joining Method) A.METODI FILOGENETICI CON MATRICI DI DISTANZA NEIGHBOR-JOINING clustering method, crea un albero con il minimo valore di

NJM (Neighbour-Joining Method) A.METODI FILOGENETICI CON MATRICI DI DISTANZA NEIGHBOR-JOINING clustering method, crea un albero con il minimo valore di

Documents

Acinetobacter pakistanensis sp. nov. - PARC · Neighbor-joining phylogenetic tree showing inter-relationship of strain NCCP-644T with the closely related type species of genera Acinetobacter

Acinetobacter pakistanensis sp. nov. - PARC · Neighbor-joining phylogenetic tree showing inter-relationship of strain NCCP-644T with the closely related type species of genera Acinetobacter

Documents

Phylogeny taxa(Acari: Ixodida) 16S rDNA · mum-parsimony, and maximum-likelihood methods were used in phylogeny reconstruction. Fordistance analysis, a neighbor-joining tree (18)

Phylogeny taxa(Acari: Ixodida) 16S rDNA · mum-parsimony, and maximum-likelihood methods were used in phylogeny reconstruction. Fordistance analysis, a neighbor-joining tree (18)

Documents

Phylogenetic Trees Tutorial 6. Measuring distance Bottom-up algorithm (Neighbor Joining) –Distance based algorithm –Relative distance based Phylogenetic

Phylogenetic Trees Tutorial 6. Measuring distance Bottom-up algorithm (Neighbor Joining) –Distance based algorithm –Relative distance based Phylogenetic

Documents

WHY NEIGHBOR-JOINING WORKS · 2017. 3. 7. · WHY NEIGHBOR-JOINING WORKS 3 This means that if the distance estimates are at most half the minimal edge length of the tree away from

WHY NEIGHBOR-JOINING WORKS · 2017. 3. 7. · WHY NEIGHBOR-JOINING WORKS 3 This means that if the distance estimates are at most half the minimal edge length of the tree away from

Documents

Susquehanna Universitycomenius.susqu.edu/biol/312/centralia metagenomics case... · Web viewfrom your filtered alignments using FastTree, a modified Neighbor-Joining method (uses

Susquehanna Universitycomenius.susqu.edu/biol/312/centralia metagenomics case... · Web viewfrom your filtered alignments using FastTree, a modified Neighbor-Joining method (uses

Documents

IP8800/S6700 IP8800/S6600 IP8800/S6300 ソフト …...neighbor ebgp-multihop neighbor maximum-prefix neighbor next-hop-self neighbor password neighbor peer-group (assigning members)

IP8800/S6700 IP8800/S6600 IP8800/S6300 ソフト …...neighbor ebgp-multihop neighbor maximum-prefix neighbor next-hop-self neighbor password neighbor peer-group (assigning members)

Documents