Upload
kaitlyn-mccurdy
View
218
Download
3
Tags:
Embed Size (px)
Citation preview
FIGURE 1: Inflammasome and Behçet’s Disease
Functional Studies of Cryopyrin V200M Mutation Identified in Behçet’s Disease PatientsElif Eren, Yetiş Gültekin, Şahru Yüksel and Nesrin Özören
Boğaziçi University, Department of Molecular Biology and Genetics, Kuzey Park Binası, 34342 Bebek Istanbul-TURKEY
Phone: + 90 212 359 76 29 Fax: + 90 212 287 24 68, e-mails: [email protected], [email protected]
ABSTRACT
The inflammasome is a cytoplasmic complex composed of ASC, NALP3 (cryopryrin) and caspase-1, which are assembled in response to pathogens. This assembly leads to caspase-1 cleavage. Active caspase-1 then cleaves pro-IL1β into mature IL-1β that can be secreted and can initiate innate responses against the pathogen. Active inflammasomes can also activate the NF-κB pathway. It has been previously shown that mutations in components of this complex cause auto-inflammatory diseases such as familial cold autoinflammatory syndrome (FACS), Muckle-Wells syndrome (MWS), and neonatal-onset multiple-system inflammatory disease (NOMID). Behçet’s disease is also an auto-inflammatory disease of unknown etiology characterized by recurrent inflammatory episodes. Aberrant secretion of cytokines is observed in Behçet’s disease. Thus, we hypothesized that mutations in inflammasome components may result in a constitutively active complex. We have identified cryopyrin V200M mutation in a higher frequency (3/103 patients, not found in 50 controls) than previously reported. To test if cryopyrin V200M mutation results in a constitutively active inflammasome, we have cloned the mutation into vector and we are investigating whether this mutation over-activates NF-κB pathway with luciferase reporter gene assays.
FIGURE 2: Genetic Studies
CONCLUSIONS
Cryopyrin V200M mutation was found in 3/103 Behcet’s disease patients.
Many polymorphisms were identified in Cryopyrin exon 3 in the general Turkish population.
Preliminary results show that NF-kB activity increases 2 fold with V200M Cryopyrin compared to WT.
Experiments are ongoing to test if mutant protein’s interaction with its partners ASC and caspase-1 increases by co-ip.
Inflammasome: cryopyrin + ASC + pro-caspase-1
Pathogens infection: pro-caspase-1 caspase-1 IL1β secretion inflammation
Homo_sapiens GCAAGACCAAGACGTGTGAGAGCCCCGTGAGTCCCATTAAGATGGAG Macaca_mulatta GCAAGACCAAGACGTGGGAGAGCCCCGTGAGTCCCATTAAGATGGAG Oryctolagus_cuniculus GCAGGACCCACGTGTGGGACAGCCCCGCAAGCCCAGTCCGGGTGGAG Bos_taurus CCTGGGCCAAGATACAGGATAGCCCTGTGAGTTCTGTGAACTTGGAA Mus_musculus GCCGGACTAAAATGCGGGACAGCCCCATGAGTTCCCTTAAGCTGGAG Rattus_norvegicus TGGCAGGACTAAGATGTGGGACAGCCATGAGCTCCCTTAAGCTGGAG
Behçet’s disease: auto-inflammatory disease
Activation of inflammasome even in absence of pathogens.
Hypothesis: Mutation in inflammasome component
over-activation of inflammasome
Screening of Behçet’s patients cryopyrin and ASC genes for mutations.
Identification of cryopyrin V200M mutation in 3 patients among 103. Not found in 50 controls.
Nucleotide conserved among species
important role for protein function
1344 GA G/A heterozygote
200 GTG ATG Valine Methionine
Pedigree analysis:
HETEROZYGOTE HOMOZYGOTE TOTAL HETEROZYGOTE HOMOZYGOTE TOTAL HETEROZYGOTE HOMOZYGOTE TOTALp.E197E 0% (0/104) 0% (0/104) 0% (0/104) 1,98% (2/101) 0% (0/101) 1,98% (2/101) 0,976% (2/205) 0% (0/205) 0,976% (2/205) p.T221T 15,4% (16/104) 0,962% (1/104) 16,346% (17/104) 17,822% (18/101) 0,99% (1/101) 18,81% (19/101) 15,122% (34/205) 0,976% (2/205) 17,56% (36/205)p.A244A 50,96% (53/104) 28,85% (30/104) 79,80% (83/104) 51,49% (52/101) 18,81% (19/101) 70,30% (71/101) 50,73% (105/205) 23,90% (49/205) 75,12% (154/205)p.H260H 0% (0/104) 0% (0/104) 0% (0/104) 0,99% (1/101) 0% (0/101) 0,99% (1/101) 0,49% (1/205) 0% (0/205) 0,49% (1/205)p.R262R 2,88% (3/104) 17,31% (18/104) 20,19% (21/104) 5,94% (6/101) 34,65% (35/101) 40,59% (41/101) 4,39% (9/205) 25,85% (53/205) 30,24% (62/205)p.D302D 0% (0/104) 0% (0/104) 0% (0/104) 0% (0/101) 0,99% (1/101) 0,99% (1/101) 0% (0/205) 0,49% (1/205) 0,49% (1/205)p.D312D 2,78% (3/108) 0% (0/108) 2,78% (3/108) 0,98% (1/102) 0% (0/102) 0,98% (1/102) 1,91% (4/210) 0% (0/210) 1,91% (4/210)p.P342P 1,85% (2/108) 0% (0/108) 1,85% (2/108) 0,98% (1/102) 0% (0/102) 0,98% (1/102) 1,43% (3/210) 0% (0/210) 1,43% (3/210)p.L346L 1,85% (2/108) 0% (0/108) 1,85% (2/108) 0% (0/102) 0,98% (1/102) 0,98% (1/102) 0,95% (2/210) 0,48% (1/210) 1,43% (3/210)p.L413L 0,93% (1/108) 0% (0/108) 0,93% (1/108) 0% (0/102) 0% (0/102) 0% (0/102) 0,48% (1/210) 0% (0/210) 0,48% (1/210)p.S436S 27,78% (30/108) 8,33% (9/108) 36,11% (39/108) 32,35% (33/102) 4,9% (5/102) 37,25% (38/102) 30% (63/210) 6,67% (14/210) 36,67% (77/210)p.H465H 0,93% (1/108) 0% (0/108) 0,93% (1/108) 0% (0/102) 0% (0/102) 0% (0/102) 0,48% (1/210) 0% (0/210) 0,48% (1/210)p.A501A 0% (0/108) 0% (0/108) 0% (0/108) 0,98% (1/102) 0% (0/102) 0,98% (1/102) 0,48% (1/210) 0% (0/210) 0,48% (1/210)
PATIENTS CONTROLS TOTAL POPULATIONNucleotide changes
FIGURE 3: Transfection of HEK293FT cells with different plasmids
ACKNOWLEDGMENTS
This project was supported by TÜBA-GEDIP award, EMBO-YIP-SDIG 1468 to N.Ö and BAP-06HB103 to Ş.Y.Y.G is supported by Turkish Education Foundation Scholarship (T.E.V)
Congress attendance was partly funded by Boğaziçi University Arts and Science Faculty and The Institute of Science.
FIGURE 5: Effect of V200M Mutation on Inflammasome Assembly and Function
PP-078-10
Polymorphism analysis of cryopyrin exon 3
Highly polymorphic exon
No mutation found in
healthy family members.
From Mariathasan S., ASC, Ipaf and Cryopyrin/Nalp3: bona fide intracellular adapters of caspase-1 inflammasome,
Microbes and Infection 9 (2007) 664-671.
FIGURE 4: The effect of V200M mutation on NF-kB activity- Preliminary Results
HEK293FT cells were transfected via Ca3(PO4)2 with 70% efficiency
Interaction with ASC Caspase-1 Activation
In order to determine if V200M mutation affects interaction between
Cryopyrin and ASC, HEK293T cells are transfected with different plasmids expressing these proteins and co-immunoprecipitation is performed.
Caspase-1 activation is compared by Western blot between HEK293T cells transfected with Caspase-1, ASC and
WT or mutant Cryopyrin.
Cryo WT 10 ng
Cryo V200M 10 ng 10 ng
ASC 200 ng 200 ng
Nod 1 100 ng