Upload
lamnguyet
View
218
Download
0
Embed Size (px)
Citation preview
Volume 16 Number 16 1988 Nucleic Acids Research
Fast purification of a functional etongator tRNA"1 expressed from a synthetic gene in vivo
Thierry Meinnel, Yves Mechulam and Guy Fayat
Laboratoire de Biochimie, Ecole Polytechnique, UA DO. 240 du CNRS, 91128 Palaiscau Cedex,France
Received June 30, 1988; Accepted July 18, 1988
To study the interaction of an aminoacyl-tRNA synthetase with its cognate tRNAs, it is of interest to beable to design synthetic tRNA mutant genes, and to rapidly purify sufficient amounts of the corresponding tRNAs.A prerequisite is to show that the synthetase retains fall specificity towards a wild type tRNA expressed from asynthetic gene. For this purpose, we have used an expression vector to overproduce and purify elongator tRNA1116*.To date, the most widely used rapid purification procedure, extraction from polyacrylamide gels, does not provideenough pure material to achieve fine characterizations, such as affinity constants measurements by the analysis ofthe intrinsic enzyme fluorescence quenching (1). We propose a rapid method for the purification of a functionaltRNA1™ based on the construction of a synthetic gene, the obtention of an overproducing E. coli strain and atwo-step FPLC driven purification from a crude extract
A shuttle vector, pBSTNAV, (derived from Btuescript M13+KS) carrying a multisite cloning sequenceEcoRl/Smal/Pstl flanked upstream with a synthetic lipoprotein promoter and downstream with the rrnCtranscription terminator, both prepared from the pGFIB-I phasmid (2), was designed (figure 1). The syntheticelongator tRNAmet gene was constructed by assembling six different overlapping oligonucleotides (figure 1)synthetised with the Pharmacia gene assembler and purified on a Mono Q column. A mixture of the 6oligonucleotides (l.S uM each) was heated to 95 °C, slowly cooled and submitted to ligation during 1 hour at 37°C.Oligonucleotides 1 and 4 were kept unphosphorylated, to avoid the concatemerization of assembled genes duringligation. Agarose gel electrophoresis showed that the major ligation product corresponded to the tRNA gene.Cloning between the EcoV.1 and Pst\ sites of the shuttle vector was realised by performing ligation at 14°C, underthe conditions defined by Dardel (3). To eliminate reconstructed vector molecules, the ligation mixture was thenrestricted by Sml. After transformation of JMlOlTr cells (4), the screening of overproducing clones was achievedby determining the methionine accepting specific activity in crude tRNA minipreparations (5). Among the 20clones randomly tested, 8 displayed a 10- to 20-fold higher activity, corresponding to a 30 to 50-fold overproductionof elongator tRNA, since initiator tRNA accounts for 70% of the total methionine accepting capacity in E. coli.Sequencing of the corresponding single-stranded DNAs showed that in each case, the construction was exactly asexrjected.
lpp rrnCpromoter t a n d m t o i
(Hccl)/(»«rl) EaofI ! • • ! FvnII F.tl BUuJIIIpBSIN&V
CCCCATCCATCGAOTCA«CAATCTC(;TGTACTGACTATTACTACCCCAGTOTCCAAGCTTACCCCACCATCGGTCCTC
T T
rigura 1
Crude stripped tRNA was prepared from a 1 liter culture of the overproducing cells in LB medium(50ng/ml ampicillin), according to Zubay (6). 500 Awn were usually obtained, with a specific activity of 370 to600 pmoie tRNAmet/A260 ""'• 0- e. 22 to 35 % purity). It was then loaded on a DEAE-Trisacryl M coiumn (1.1x 5 cm) equilibrated with i 0.2 M NaCl, 20 mM Tris-HCl (pH = IS), 8 mM MgCl2. tRNA was eluted byperforming a 0.2 to 0.4 M NaCl linear gradient (2 ml/min; 0.24 M/h). The methionine accepting fraction contained120 to 240 A26<) units with a specific activity of 670 to 1050 pmote/A2fio units (70* yield). After ethanol
© IRL Press Limited, Oxford, England. 8 0 9 5
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
precipitation, 60 A250 units were dried, redissolved in 0.S ml 10 mM ammonium acetate (pH =• 6.6), 1.8 Mammonium sulfate, 10 mM MgCl2 ""d loaded on a TSK-phenyl column (7.5 x 0.75 cm). tRNAs were eluted byperforming 1 1.58 M to 1.22 M reverse ammonium sulfate gradient (0.54 M/h; 0.7 ml/min). A typicalchroenstogram is shown below.
- 8 , 5
0 - m10 20
Elution TOIUMI* (Ml)
The pooled fractions were desalted by filtration through a GF05M-Trisacryl column (2.5 x 25 cm; 4 ml/min)equilibrated in 10 mM Tris-HCl (pH=7_5).
The total procedure allows purification of 1 to 2 mg tRNA"101 (overall yield=56%) to a more than 1400pmote/A26o u n ' t specific activity in less than 48 hours (bacteria as starting material). The overproduced tRNA wasfully aminoacylatable, as demonstrated by the methionine acceptance profile of the TSK-phenyl eluate. Indeed, thefraction corresponding to the maximal absorbance reached 1800 pmoley^go The Michaelis constant i s well as thedissociation constant (1) of the final product for mooomeric methionyl-tRNA synthctase have been determined(Km=0.8 jiM; KQ=0A (iM) and compared to those of elongator tRNA"161 purified from a non-overproducing strain(Km=0.25 nM: KD=0.1 |jM)). In spite of the slight differences, possibly reflecting undermodification of theoverproduced specie*, these results confirmed that methionyl-tRNA synthetase has retained full ipecificity towardsthe tubstrate of synthetic origin.
ACKNOWLEDGEMENTS
Dr J-M MASSON is acknowledged for the gracious gift of pGFIB-I.
REFERENCESOLANQUET S., IWATSUBO M. and WALLER JP. (1973) Eur. J. Bwchem. 36, 213-2262.NORMANLY J., MASSON J-M, KLEINA L.G., ABELSON J. and MILLER J.H. (1986) Proc. NatL Acad. Sci.(USA) 83. 6548-65523.DARDEL F. (1988) Nucleic Acids Res. 16, 1767-17784.MREL P. H., LEVEQUE F , MELLOT P., DARDEL F., PANVERT M., MECHULAM Y. and FAYAT G.(1988) Biochimie in press
5JAYAT G., FROMANT M., KALOGERAXOS T. and BLANQUET S. (1983) Biochimie 65,221-2256.ZUBAY G. (1962) J. MoL Biol. 4, 347-356
8 0 9 6
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Volume 16 Number 16 1988 Nucleic Acids Research
Extranudear gene expression in yeast: evidence for a plasmid-encoded RNA polymerase ofunique structure
Duncan W.Wilson"1" and Peter A.Meacock*
Leicester Biocentre, University of Leicester, Leicester, LEI 7RH, UK
Received June 24, 1988; Revised and Accepted July 26, 1988 Accession DO. X07946
ABSTRACTStrains of the yeast Kluyveroayces lactis that produce killer-toxin have beenfound to contain two linear dsDNA plasaids, kj (8.9 Kb) and k2 (13.4 8b). Thefour transcribed open reading fraaes of plasaid kj contain no recognisableyeast nuclear expression signals. Moreover, a toxin subunit gene fused withthe lacZ gene of Bscherichia coli is not detectably expressed when introducedto K.lactia or Saccharoaycea cerevlalae on a nuclear vector, even when nativek} and k2 are present in the cell. This and other evidence is consistent withthe hypothesis that kj and k2 reside in an extranuclear location, and do notutilise the nuclear RNA polyaerases I, II or III for transcription of theirgenes. Sequencing of plasaid k2, which is thought to encode factors necessaryfor the Maintenance or expression of kj, reveals an open reading fraaepredicted to encode a 974 aaino acid polypeptide with hoaology to severalDHA-directed RNA polyaerases. He suggest that this is a component of a novelplasaid-specific extranuclear gene expression system.
INTRODUCTION
Many strains of the budding yeast Kluyyeroaycea lactis contain two linear
double-stranded A/T rich DNA plasaids, kx (8.9 Kb) and k2 (13.4 Kb)1 that are
associated with secretion of a aulti-subunit protein toxin2 which inhibits
the growth of certain sensitive yeast species. Structurally, the plasaids
belong to a class of extrachroaoaoaal linear eleaents which includes
adenovirus3, bacteriophage phi 29* plasaids of Streptoaycea rochel^ and the
Sl/82 aitochondrial plasaids associated with Bale sterility in Baize6- All of
these aolecules have inverted terminal repeat sequences (2OZbp and 184bp in
the case of k} and k27) and proteins covalently attached to the 5' end of
each DNA strand (for kj and k 2 terminal proteins see reference 8). These Bay
function as priaers in the initiation of terminal DNA replication. In support
of this hypothesis one of the four transcribed open reading fraaes of k}9>10
encodes a product with hoaology to the DNA polyaerases of adenovirus and phi
29, and to a protein encoded by an ORF of the aaixe plasaid SI11.
Plasaids kj and k2 can be transferred to p° (rho zero) strains of
© IR L Press Limited, Oxford, England. 8°97Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
Bwyharoayces cerevisiae (which lack aitochondrial DNA) where they are
maintained and express the killer phenotype12'13. However, they do not becoae
eatabliahed in the presence of aitochondrial DNA14. These observations,
together with the high A/T content of the plasaid DNA, fluorescence staining
of S.cerevisiae P° derivatives containing the plasaids 13 and fractionation of
yeast nuclei and cytoplasa by centrifugation techniques (reference 15, D.H.
Wilson and P.A. Meacock unpublished observations) are all consistent with a
cytoplassie location for the plasaids. Plasaid curing experiments have shown
that plasaid k2 can be maintained in the absence of k^, but plasaid k^ is
unable to exist independentIyl6 suggesting dependence upon k2-encoded
products. Such factors aay be concerned with the replication or segregation
of kj, or for the expression of k^-encoded genes essential for kj aaintenance.
A variety of data suggest that these plasaids say utilise a novel systea
for gene transcription; viz. none of the ORFs of )q is preceded by
recognisable yeast nuclear promoter eleaents, although all four are preceded
by a actif identical with, or closely related to, the sequence
ACT(A/T)AATATATQA. This has been teraed the Upstreaa Conserved Sequence or
XXXP, and transcription is initiated approxiaately 14 bp downstreaa of this
eleaent (Roaanos and Boyd, aanuscript subaitted). Toxin production cannot be
detected froa p° strain? of S.cerevisiae which have been transforaed with the
coding region of plasaid kj cloned into yeast 2 fM (aicron)-based vectors
(D.H. Wilson and P.A. Meacock, unpublished observations, reference 15).
Furthermore, Northern blotting reveals that when kj DNA is introduced into
K.lactis on nuclear vectors transcription of the kj gene ORF2 (which encodes
two toxin subunita) is initiated at a nuaber of sites distinct froa those
used by native linear k\, and the transcript is preaaturely terainated
(Rcmanos and Boyd, aanuscript subaitted). Thus it appears that the yeast
nuclear UNA polyaerases I, II and III are unable to recognise and correctly
transcribe the genes of these plasaids.
Here we demonstrate that expression of an 0HF2/lacZ fusion gene, cloned
into a yeast nuclear vector, cannot be detected in cells of K.lactis or
S.cerevisiae which contain plasaids kj and k2- This suggests that
transcription of 0RF2, and probably all plasaid-borne genes, occurs in an
extranuclear cellular compartment. The provision of novel cytoplasaic
expression factors could be one of the aaintenance functions of kj, and to
investigate this we have begun to determine the nucleotide sequence of this
plasaid. The predicted product of one of the OBFs encoded by k2 has hoaology
to two different subunits found within DNA-directed RNA polyaerases, whilst
8098
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
another has homology to a vaccinia virus hellease necessary for specific
viral transcription.
MATERIALS AND METHODS
Strains and Media
Kluyveromyces lactis IFO1267 (prototrophic [lq+k2+)) was obtained from the
National Collection of Yeast Cultures, Food Research Institute, Colney Lane,
Norwich, UK. K.lactis SDH (K. lactis Iac4 trpl [kj^*]) was kindly provided
by Prof. C.Hollenberg, and K.lactis ABK802 (prototrophic, [k1°,k2+]) by Dr.
A.Boyd. Saccharosiyces cerevlslae SPK103 (3 hl»3-A tn>l-289 ura3~52 leu2-3
[k\+ k2+ L+] p°) was prepared by cytoduction of a p° derivative of strain
S15O-2B (obtained froa J.Hicks, Cold Spring Harbor Laboratory, New York) with
JC25K (a ade2-l hla4-15 karl-1 [kj+.kg*]) obtained fro* Dr. M.A.Romanos.
Yeast were propagated at 30'C using either YPD Bedim (1 X yeast extract, 2 *
peptone, 2 X glucose) or in minimal aediua (0.67 * yeast nitrogen base, 2 X
glucose) supplemented with nutrients as required. Plasmid constructions,
bacterial assays for />-galactosidase activity, and saperinfection for
preparation of single stranded DNA made use of B.coli NM622 Adac-proAB) thl~
BUPE hsdA5 [II proAB lacIQ £ZM15117 (provided by Dr. A.Mileham), maintained
on M9 minimal medium^ supplemented with 0.001 X thiamine, in order to ensure
maintenance of the F' episome and susceptibility to N13 amd M13K07 phage
infection. N13K07 helper phage was from Pharmacia, Uppsala, Sweden.
Bngymea
The Klenow fragment of DNA polymerase I, exonuclease III, exonuclease VII,
and all restriction endonucleases used in this study were purchased from
Bethesda Research Laboratories (BRL), Bethesda, Maryland, USA. T4 DNA ligase
was purchased from Pharmacia, and Proteinase K from Boehringer (BCL),
Mannhelii, FRQ. Zymolyase 100-T was from the Kirin brewery, Tokyo, Japan. All
ensymes were used as recommended by the supplier.
Materials for Sequence Analysis
Deoxynucleotides and dideoxynucleotides were purchased from BCL. Acrylamide
and bisscrylamide were "Eloctran" grade, purchased from BDH chemicals, Poole,
UK. Ultrapure enzyme grade urea was from BRL. Slgmacote and
N,N,N',N'-Tatramethylethylenediamine (TEMED) were obtained from Sigma, St
Louie, Missouri, USA. Sequencing primers were 17 bp "universal primer"
supplied by Pharmacia and custom-synthesised 17 bp oligodeoxynucleotides
prepared by J.Keyte, Biochemistry department, Leicester University, using an
Applied Biosystems DNA synthesiser. [of-^JdATP, at 10 iCi /il~l and 660 Ci
8099
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
•Mol-1 wore obtained from Anershom International, UK.
Preparation of Plasmid k; DMA
K.loctia ABK802 was grown in 1 litre of YPD broth to a density of 3xlO7 cells
•1~1, cells were pelleted and washed once in water, then resuspended in 50 ml
of 3RD buffer (1.2 M Sorbito 1, 20 sM BDTA, 50 mM Dithiothreitol) and
incubated at 37'C for 20 sins. To the suspension was added 1 ml of 10 mg ml"1
ZymoLyase 100-T in 3RD buffer and incubation continued until spheroplasting
was complete. Sphaeroplasts were pelleted and resuspended in 20 nl 10 nM
BDTA, 50 »M Tris.BCl pfi 8.0, then Sodium N-lauryl Sarcosinate added to a
final concentration of 2 X. To the lysate was added 1 ml of 10 mg al"1
Proteinase K, th« mixture incubated at 37'C for 1 h, then the lysate chilled
on ice, mixed with 5 ml of 5 H NaCl and left on ice for 1 h. After
centrifugation at 18000 rpm for 30 mins at 4'C in a Sorvall SS34 rotor the
supernatant was extracted three tines with an equal volume of phenol, then
twice with chloroform. Extracted supernatant was mixed with 2 ml 3 M sodium
acetate pH 5.5 and 50 ml absolute ethanol, placed at -80'C for 30 mins,
nucleic acid pelleted and the pellet rinsed with 10 ml of 70 * ethanol. The
pellet was briefly dried under vacuum, resuspended in 5 ml TB buffer (1 mM
KDTA, 10 mM Tris.BCl pH 7.6) then nucleic acid fractionated according to site
in a 10 K-40 * sucrose gradient, containing 1 H NaCl, 5 mM KDTA, 20 mM
Tris.BCl pB 8.0, by centrifugation at 26000 rpm for 24 h at 26'C in a Sorvall
ABB27 rotor. Fractions containing plasmid k2 were identified by agarose gel
electrophoresIs, pooled and diluted with 2 volumes of water. DNA of plasmid
k2 was precipitated for 1 h at -80'C after the addition of l/10th volume of
3 H sodium acetate pH 5.5 and 2.5 volumes of absolute ethanol, then pelleted,
the pellet rinsed with 0.6 ml of 70 * ethanol, briefly vacuum dried and
reauspended in 200 Ml TB buffer.
Yeast transformants were grown to between 1x10? and 5x10? cells ml"1 in 25 ml
minimal medium, imposing selection for presence of plasmid-boroe markers.
Optical density of the cultures at 600 nm was determined, and cultures placed
on ice for 20 miss. An aliquot was removed and plated onto complete media in
order to determine, by subsequent replica plating onto complete and selective
media, the percentage of cells within the population which contained
plasmids. Chilled cells were pelleted and resuspended in 1 ml 60 mM KHjP04.
To 0.4 ml of the suspension was added an equal volume of
60 mM NasHP04, 40 mM MaHaP04, 10 mM KC1, 1 mM MgSO4, 60 mM P mercaptoethanol
pB 7.0, then 10 id 1 * SDS and Phenylmethylsulphonyl fluoride (FWSF) to a
8100
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
final concentration of 0.5 aM. The Mixture Mas vortexed for 5 sees, incubated
at 28'C for 10 Bins then 30 ul chlorofora added, the aixture vortexed again
and incubation continued at 28'C for 10 Bins. A 200 Ul aliquot of 4 ag al"1
ONPQ (freshly dissolved in 100 aM KH2P04) was waned to 28'C then nixed with
the treated cells, a tiner started and incubation continued at 28'C. At the
first appearance of a yellow colour within the Mixture the reaction was
stopped, by addition of 0.5 ml I N NajCO,, and tiae of incubation recorded.
Cells were removed frcsi the mixture and optical density of the supernatant
recorded at a wavelength of 420 na. Units of 0-galactoaidase activity were
expressed as 0D42O ain~l OD^o"1, then Multiplied by a factor of 1000. When
the percentage of plasBid-containing yeast cells was known, assay values were
corrected to that expected if 100 * of cells had contained plasaid at the
tiae of assay. Bacterial transforaants were assayed in exactly the sane
•anoer, but using 10 al cell cultures. Since bacterial transforaants were
grown under antibiotic selection, all cells contained plasaids.
Generation of Nested Overlapping Deletions Froa Cloned ky DMA
DMA (5 Ug) of a plasaid containing the 7.7 Kb gas M.S3Q I fragaent of k2
cloned within p&(BL19+ was linearised by digestion with the restriction
endonuclease* Baa 31 and Kpn I- The aixture was extracted with equal voluaes
of phenol and chlorofora, and ethanol precipitated. The fragaent was
resuspended in TE buffer to a concentration of 1 Ug DNA (Jl"1-
For deletion of the 3'recessed strand, 5 All of linearised plasaid fragaent
were aixed with 27 ul water, 4 Ul lOxBxoIII buffer (10 aH NgCl2, 660 aM
Tris.HCl pH 8.0) and brought to reaction temperature by incubating at 37'C
for 5 ains. Then 4 Ul of 10 units ul~* exonuclease III were added. A 2 Ul
saaple was iaaediately reaoved and aixed with 2 ul IOXBXOVII buffer (300 aH
KC1, 100 aM BDTA, 100 BM Tris.HCl pH 7.5) on ice. Samples were siailarly
taken at 30 second intervals for 5 Bins, at which tiae 20 ul of prewaraed
IXBXOIII buffer containing 40 units Bxonuclease III were added to the
incubation. Ten subsequent samples of 4 ul each were reaoved at 30 a
intervals into 2 Ul of ice-cold IOxBxoVII buffer. The twenty samples were
each diluted to 19 ul with water and aixed with 1 ul exonuclease VII diluted
to 1.5 units ul~l in lxBxoVII buffer. The reactions were incubated at 37'C
for 2 h to remove single-stranded regions of DNA. Samples were phenol
extracted, chlorofora extracted and ethanol-predpitated, resulting pellets
were drained, vacuum dried and resuspended in 15 ul of 10 aH MgCl,, 10 aM
Dithiothreitol, laM ATP, 100 Ug al"1 Bovine Serua Albumin, 50 aM
Trifl.BCl pH 7.4, 50 Urn dATP, 60 Urn dTTP, 50 urn dCTP, 60 Ua dOTP, 3 units T4
8101
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
DNA Ligase, 0.5 unit Klenow fragment. Ligation was allowed to proceed
overnight at 30'C. Twenty aliquots of competent B.coll IM522 were transformed
with 6 ill of each ligation dilated by addition of 100 *d of 0.1 N CaCl,.
Transforaeuts were picked and plasaid DNA prepared froa 1.6 ml cultures by
•tandard methods. Degree of deletion within each plasaid was determined by
agaroae gel electrophoresis of restriction digestion products.
Buperlofoctioo of POCBL—containing K.coli
A 111 aliquot of M9 asdia, suppleaanted with 0.001* thiaaine, 50 Hg al"1
aapicillin, 0.2 % glucose, was inoculated with 10 Ml of stationary phase
culture of K.coli NH522 transforaod with a deletion-derivative of a pEHBL/k2
clone. The culture was grown at 37'C overnight, and a 20 Ml aliquot used to
inoculate 2 al of 2xYT broth, 0.001 * thiaaine, 150 MS al"1 aapicillin
prewaraed to 37'C. This culture was shakes at 37'C until reaching an optical
density of between 0.6 and 1.0 at a wavelength of 660 na. A 1 al aliquot of
this culture was infected with N13K07 helper-pbage at a Multiplicity of 10
M13K07 plaque foraing units/bacterial cell. The cell/phage mixture was shaken
at 37'C for 1 h, then 400 Ml added to 10 al prewaraed 2xYT broth, containing
0.001 * thiaaine, 150 Mg ml"1 aapicillin, 70 Ug "I" 1 kanaaycin. The culture
was grown overnight at 37'C, cells pelleted and cell-free supernatant* stored
until required for template preparation.
PWA Sequencing
Sequencing was by the dideoxy aethod19 but using [er-35s]dATP. All reactions
were carried out at 50'C. Dideoxy-terminated fragaents were electrophoresed
upon a 6 k polyacrylaaide/urea sequencing gel, in lxTBB buffer (5.5 g 1~1
boric acid, 0.93 g I"1 KDTA, 10.8 g I"1 Tris base). Blectrophoresis was for
2.5 h or up to 7.5 h and gels dried under vacuua (without prior fixing) at
80'C for 90 Bins then exposed to Kodak XAR-5 fila for at least 12 h.
RESULTS AND DISCP38IOH
Killer Plasaid Penes Are Rot Expressed Within The Yeast Nucleus
Previous studies (reference 15. Wilson and Meacock, unpublished
observations) have shown that kj toxin genes, cloned in circular autonomously
replicating vectors, do not confer a killer phenotype upon their host.
However, none of these experiaents could be perforaed with yeast strains that
also contained both kj and k2 as native linear plassdds. Thus plasaid-encoded
factors necessary for lq toxin gene expression aay have been absent. In order
to test, quantitatively, whether linear plasaid encoded genes contained
within nuclear vectors can be expressed when the endogenous plasaids k\ and
8102
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
•iiiniiiiiiMiM.i
Aap Thr Atp Pro V»l V«l L«u
OAC ACT Q AT CCC QTC QTT TTA
*b,,
<V/ A amp
Fig. 1. Structure of tbe plasaid YHpOBFZ2. Regions of tbe plaaaid which arederived froa plaaaida k\ and YRp7 are indicated. The fusion junction betweenthe saino-terainal coding region of 0BF2 and lacZ is shown. Solid box: IncZcoding region. Hatched box: Reaainder of 0HF2 coding region. Open box: k\genes and TBP1 gene of YHp7. Curved arrows: Bacterial genes. Arrow headsindicate direction of transcription of genes. A (delta): Partial gene.Bacterial origin of replication, ori. is also shown.
kg are also present in the cell, we assayed expression of a cloned kj gene
using a gene fusion.
A translational fusion was Bade between tbe aaino-terainal 36 codons of
ORF2 and the lacZ gene of Escherlchia coll. As the predicted lacZ-fusion
product retains the ORF2 signal sequence it aay becoae aeabrane associated.
However analogous gene fusions between lacZ and the QAL2 peraease of
S.cerevlsiae have been successfully assayed in yeast^O. The 0BF2-lacZ gene
fusion retained 1.8 Kb of k} DHA noraally upstrean of 0RF2 and 1.5 Kb of k}
DNA noraally downstreaa of the 0BF2 carboxy terainus. The fusion gene was
transferred to the S.cereyislae vector YHp721, to fora plasaid TRpOBFZ2. See
Figure 1. During construction of plasaid YRpOBFZ2, the AHS1 sequence,
necessary for autonoaous replication of YHp7 in S.cerevisiae. was reaoved.
However the A/T rich kj-derived DNA fortuitously provides eleaents22 enabling
8103
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
Table 1. Expression of an 0RF2-lecZ fusion gene in yeast and B.coli
Plaamid
pUC19
pOCOBFZ2
PL0669Z
pPA13
YHpOBFZ2
YHp7
KHp2
—
B.coliM622
2.67
3.14
11.4
0.04
0.43
0.01
—
—
S.cerev;LsiaeSPK103
—
—
776.88
39.20
0.71
0.49
—
—
I-lfffftt*8011 IFO1287
— —
— —
— —
— —
0.68 —
— —
0.62 —
— 8.36
Units of 0-galactosidase activity expressed by various plasmids in strains ofyeast and B.coli.. For calculation of activity values, and genotypes of•trains, see materials and sethods. SD11 carries an inactivating lesionwithin the endogenous K.1actla 0-galactosidase, IF01267 does not, but wasgrown under conditions which would not induce expression of the enzyme beyondbasal levels. Plasaid pOCOR!Z2 carries the 0RF2-lacZ fusion expressed fromthe lac promoter of pUC19. YRpORFZ2 carries the 0RF2-lacZ fusion cloned intothe yeast high copy nuaber vector YRp7. pLQ669Z expresses the lacZ gene tramthe S.cerevisiae CYC1 nuclear promoter. pPA13 expresses lacZ from thecauliflower mosaic virus 19S promoter. TRp7 t> KHp2 are, respectively,S.cerevisiae and K.lactie autonomously replicating plasmids which carry nolacZ gene.
autonomous replication of the plasaid in both S.cerevlsiao and K.lactis.
Planid YRpOBFZ2 was transformed into strains of E.lactie and
S.cerevisiae which harboured linear planids k^ and k2> using a whole-cell
transformation procedure^. Transformed cells were permeabilised with
chlorofora, and 0-galactosidaae activity measured by spectrophotometrlc assay
of the rate of hydrolysis of o-nitrophenyl-# (beta)-D-galactoside (ONPQ). No
ensyae activity could be detected in either yeast (Table 1). Detection of
activity in B.coli strain W622, when transformed with YHpOHFZ2 or with
P000RFZ2 (which expresses the gene fusion from the lac promoter) confirmed
that, when expressed, the fusion protein did retain normal 0-galactosidase
activity. Also, other controls indicated that, under these conditions, it was
8104
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
DCS
OBF 1 ACTATAATA-TATCA AAAATQ
ORF 2 ACT-TAATA-TATGA AAAAIO
OBF 3 ACT-AAATA-TATOA AAAATO
ORF 4 lAAAATAATCTCA AAAATO.
ORF 9 7 4 TA-TATOA AAAATC
OHF 5 7 9 TA-TCTOA AAAATO
ORF 3 3 6 AAAATATOA ATAATO
ORF 1 5 8 ATATTTTOA AATATO
ORF 1 3 2 TA-TOTOA AAAATO
ORF 112 TA-TTTOA ATTATO
ORF 103 AAATA-TATGA AAAATQ
C o o » « i » u * TAATATGAA T T
- C
a
Fig. 2. Comparison of the upstream conserved sequence (UCS) found before eachof the OHFs of plasaid Iq with upstreaa regions of plasaid Ic2 OBFs identifiedduring this study. The predicted initiation codon (ATG) and three precedingnucleotides are shown in each case. Bach intervening micleotide isrepresented by a dot (.). Note the requirement for an adenine residue at the-3 position, and preference for an AAAATQ initiation context. A consensus UCSis shown.
possible to detect 0-galactosidase activity in yeast when expressed at high
(plasaid pIA669Z) or low (plasaid pPA13 and noo-induced IFO1267) levels.
He suggest that expression of at least OHF2, and probably all of the k}
genes, therefore requires factors unavailable within the nuclear coapartaent,
even when native linear kj and kg are also present in the cell.
Plasaid k; Encodes a Product With Boaology to Two HHA Polyaeraae Subunits
In order to investigate the novel extranuclear expression systea which
aay be encoded by kg we are determining the coaplete nucleotide sequence of
this plasaid. ONA of plasaid kg was prepared froa K.lactis ABK802 [k1°,k2+]
and digested to coapletion with the restriction endonucleases Baa HI and
Xho I. This yielded two Baa HI-Kfea I fragments, of 7.7 Kb and 5.5 Kb, which
after aodification of terainal restriction sites were cloned in both possible
orientations into the sequencing vector pEMBIl?1". An overlapping series of
deletion-derivatives were prepared froa the 7.7 Kb fragaent, in both
directions, using the exooucleose Ill/exonuclease VII deletion aethod^.
Deletion-derived clones were sequenced, and sequence data asseabled aanually
using the University of Wisconsin genetics coaputer group (UHQOQ)
Analysis of 7688 bp of continuous sequence data obtained froa plasaid kg
reveals seven OBFs, with potential to encode products of 974, 579, 33B, 158,
8105
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
ZQD
ySKt*uC^
M»fivtanmyMiU*IhittaftxiMnMD9iilyrUumyl4Will6«nU«tB^^
J J
TmmrnnnirniM M I U M I I I * mum w BIMX m
U.QyOji^^
Min*/Miri nu ft
as
Fig. 3. Sequence of the OBF 974 coding region aligned with that of itspredicted product, showing upatreaa DNA. The OBF waa translated using theuniversal genetic code.
132, 112 and 103 smino acids. All seven ORFs exhibit the saae codon usage as
the ORFs of plasaid kj, all are preceded by UCS-like elements and the
initiation codon of all OBFs is in a similar context (figure 2). He suggest
that this indicates a i: o—un expression Bechanisa for the genes of plasaids
k} and l<2- Alignment of lq and k2 UCS eleaents leads to definition of a new
•inijul consensus DCS; (A/T)A(A/T/-)TNTQA, where - indicates the possible
absence of a base, and N Bay be any base.
8106
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
aa
Ala
Arg
Asn
Asp
Cys
Gin
Glu
Gly
His
He
ftcodon
usage
GCTGCCOCAGCG
COTCOCCOACOGAOAAOGAATAACGATGAC
TOTTOC
CAACAG
GAAGAG
GOTGOCGGAGOG
CATCAC
ATTATCATA
Table 2.
kj ORFs
538372
4160882
8515
8713
8911
946
8614
523413
9010
40357
Codon Usage
ORF 974
480484
00008812
8812
8911
8813
7624
928
330644
8119
14185
of ORF
aa
Leu
Lys
Met
Phe
Pro
Ser
Thr
Trp
Tyr
Val
974 and k
ftcodon
usage
TTATTGCTTCTCCTACTG
AAAAAG
ATGTTTTTCCCTCCCCCACCG
TCTTCCTCATCGAGTAOC
ACTACCACAACG
TOG
TATTAG
GTTGTCOTAGTG
I ORFs
kx ORFs
64913194
8515
100
8317
657271
444210300
484462
100
8812
486388
OHF 974
579120175
919
100
7327
388468
389162295
457480
100
7723
392572
Percentage codon usage. Average codon usage of the four open reading frasesof plaanid k^ are shown, compared with codon usage of OHF 974.aa: Aaino acid.
The complete sequence of this region of k2 has been deposited within the
EMBL database under accession nuaber X07946. Analysis of the OBFs contained
within it will be reported elsewhere (D.M.W., PhD thesis, University of
8107
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
I-ali. •« rf1 »
r f i l s p » i T I T T I M I H r n i | T | p i | u L » D D I I H B » f l ] i T [ 5 1 I T I i r c T l o r a T H or i g P i n o I | P r I I L I I I L I I I O I D I I I I i t i 1 0 1 r i u i T O O F I Ir I o p i t i i i i ! H | L ] I | L | ] i g i i i n i » l » l i i l o l p r i I T T O O F I IL I I ) » I i i T | O » l c L T I L I I I L I E I I O T D P I | T O r | j i ] » o | o j » i o I I T T I I I Q P | T •
13001019
• i|L|i|a|r|o|r m i O|I|H L T I I > I B|I|I A IOIOa e i|Lji|o|i.!alA m i i|t|i n u n I[J|I i 662
r n ilqlnlB t p
o D rT O P l l l t C t l
M I I Q C O L
11 i 11 inU N i l 374I I H 1 I 403
Q A H 1 B03
530soo4T960S
Fig. 4. Horologies between product of ORF 974 and several RNA polyseraaesubunits. Origin of subunits abbreviated aa follows: Nt chl, Nicotianatabacw chloroplast. Mp chl, Marchantin polyorpha cnloroplaat. Sc,Saccfaarowyccg cereviaae. Da, Drosophila aelanogaater. Ninbers refer tolocation of final residue of nosology region within correspondingpolypoptide. Boxes and asterisks, respectively, indicate where a residue ofthe ORF 974 product is identical to, or conservatively different froa,corresponding aaino acids within two or •ore aligned RNA polyaerase subunits.By this criterion, region A of ORF 974 product has 36.3 * identity withregion A of the other polypeptides. This rises to 53.8 % if conservativesubstitutions are also taken into account. Region II shows 43.2 % identityrising to 56.8 *. Region III shows 48.3 * identity rising to 58.3 X.
Leicester). Using the algorithm of Lipaan and Pearson26 to search the
National Bioaedical Research Foundation (NBRF) protein sequence database, we
have found significant nosologies between the predicted ORF 974 product and
the sub units of several DNA-directed RNA polyaerasea. The sequence of the
predicted ORF 974 product is shown in figure 3. The codon usage of ORF 974 is
shown in table 2.
Cosrputer-assisted comparison of the predicted protein sequences of
several RNA polyaerase subunits with the ORF 974 product reveals an 80 aaino
acid region of hoaology (which we have teraed region A) in coaaon with the P
subunits of RNA polyaerases froa f.coli27, the chloroplasts of tobacco
Nicotiana tabacuu28 and the chloroplasts of the liverwort Marchantja
polyorpha^. This region ia also homologous to one of nine conserved regions
shared between the /J-subunit of B.coli RNA polyaerase and the 140 M> subunit
of S. cerevisioe HNA polyaerase 11^0. Additionally there are two other
regions, of 43 aaino acids and 59 aaiino acids, with hoaology to regions of
the B.coli RNA polyaerase $' subunit3! the M.polyorpha chloroplast RNA
8108
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
* ii in
• DD
, r I II III If f fl
«c polll/pollll
Ic 0
Fig. 5. Structure of predicted ORF 974 product arid several RNA polyaerasesubunits. Abbreviations as in Figure 4 legend. Hoaology regions A and I to VIare boxed. Dotted line; carboxy terminal repeat region of Sc Pol II32.
polyaerase />' •ubunit29, the 215 kD subunits of S.cerevisiae32 and Drosophila
aelanogaster33 HNA polyaeraae II and the 160 Kd subunit of S.cerevisiae HNA
polyaerase III32. These latter two regions of hoaology correspond to the RNA
polys*rane large subunit conserved regions II and III defined by Allison and
coworkers3^. See Figure 4. However regions A, II and III are arranged
differently within the ORF 974 product, as is shown in Figure 5.
He have been unable to detect any nosology between the ORF 974 product
and regions I.IV.V and VI cu—IUU to S.cerevisiae HNA Pol II, Pol III and
B.coli subunit P'. We have also failed to detect hoaology between the aaino
terminal 570 residues of the OBF 974 product and other HNA polyajerase
sutranits. The ORF 974 product bears no primary sequence nosology with the
•itochondrial RNA polyaerase of S.carevisiae34. This enzyme resembles the HNA
polyaerases of bacteriophage T3 and T7, and the predicted product of an ORF
within the •itochondrial linear plaanid 82 of Zea aays35. That the ORF 974
product is unrelated to this class of polymerases is consistent with an
extraaitocbondrial location for the killer plasaids, as would be expected
froa their maintenance and expression within P° strains ot S.cerevisiae. and
their capacity to encode proteins which enter the secretory pathway.
The apparent cytoplasaic location of k} and kj and their lack of
recognisable expression signals implies that an RNA polyaeraae of novel
properties say be required to transcribe their genes. We suggest that the ORF
974 polypeptide has a role in this task, perhaps via recognition of the UCS
elements found 5' to all kj and k2 genes. There may of course be additional
plasmid-encoded or cellular proteins required for the process of
transcription. In this regard we have detected hoaology between the product
of a second k2 ORF, ORF 579 (which is able to encode a polypeptide of 579
amino acid residues), and proteins D-669 and C-637 of the poxvirus vaccinia.
8109
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
Vaccinia la a cytoplasaic DNA virus which carries its own gene expression
system, and product D-569 has been identified aa the DNA-dependent ATPase36
which aay unwind the vaccinia duplex during transcription37. Perhaps the
product of ORF 579 perform a similar function for the killer plasoids. Like
ORF 974, OBF 579 is preceded by a UCS-like sequence and its predicted
initiation codon lies in an AAAATQ context (figure 2). We note that a
consequence of our interpretation of this data is that ORF 974 and ORF 679
products would be required for their own expression.
The roles performed by the various subunits of prokaryotic or eukaryotic
HNA polyserases are poorly understood, although there is soae evidence to
suggest that the P' subunit of B.coli HNA polyaerase nay have a role in DNA
binding^ whilst the P subunit may bind nucleotides^. Because the product of
OSF 974 shares nosology with soae of the regions found in both types of
subunit, its structure is unique. Comparison of its biological activity with
known UNA polyaerases of conventional structure will lead to an increased
understanding of the roles of each subunit and the conserved regions within
the*.
ACIHOWLBDQBMKNTS
We thank Michael Rcaanos and Alan Boyd for coasounicating OBF2 transcript
data prior to publication, and Michael Stark and Michael Pocklington for
advice concerning interpretation of hoaology data. Plasaid pPA13 was a gift
frost Jennifer Richardson. This work was supported by the core research
progi niii of the Leicester Biocentre, and the award of an SERC studentship to
D.W.W.
"•"Present address: Department of Molecular Biology, Lewis Thomas Laboratory, Princeton, NJ 08544,USA
•To whom correspondence should be addressed
BBMiKBM/'KS1. Ounge, N., Tanaru, A., Ozawa, F., Sakaguchi, K. (1981). J. Bact. 14C.
382-3902. Stark, M.J.R., Boyd, A. (1986). H4BO J. 5, 1995-20023. Challberg, M.D., Kelly, T.J. (1979). J. Mol. Biol. 131, 999-10124. Garcia, J., Penalva, M., Blanco, L., Salas, M. (1984). Proc. Natl.
Acad. Sci. USA. §1, 80-845. Hirochika, H., Sakaguchi, K. (1982). Plasmid 7, 59-656. Kesfcle, R.J., Thompson, R.D. (1982). Nucl. Acids. Res. 10, 8181-81907. Sor, F., Wesolowski, M., Fukuhara, H. (1983). Nucl. Acids. Res. H ,
6037-5044
8110
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
8. Kikucfai, Y., Hirad, K., Hishinuaa, F. (1384). Noel. Acids. Res. 12,5685-6692
9. Stark, M.J.R., Milehaa, A.J., Roaanos, N.A., Boyd, A. (1984). Kucl.Acids. Res. 12, 6011-6030
10. Sor, F., Fukuhara, H. (1985). Curr. Genet. 9, 147-15511. Jung, 0., Loavitt, N.C., Ito, J. (1987). Nucl. Acids. Res. 15, 908812. Gunge, N., Sakaguchi, K. (1981). J. Bact. 141, 155-16013. Gunge, N., Murata, K., Sakaguchi, K. (1982). J. Bact. 151, 462-46414. Gunge, N., Yaaane, C. (1984). J. Bact. 159, 533-53915. Staa, J.C., Kwakaan, J., Meijer, M., Stuitje, A.R. (1988). Nucl.
Acids. Res. 14. 6871-688416. Niwa, 0., Sakaguchi, K., Gunge, N. (1981). J. Bact. 148, 988-99017. Gough, J.A., Murray, N.B. (1983). J. Mol. Biol. 166, 1-1918. Naniatis, T., Fritsch, B.F., Saabrook, J. (1982). Molecular Cloning.
A Laboratory Manual. Cold Spring Harbor Laboratory, Cold SpringHarbor, New York
19. Sanger, F., Nicklen, S., Coulson, A.R. (1977). Proc. Natl. Acad. Sci.USA. 74, 5463-5476
20. Tscfaopp, J.F., Enr, S.D., Field, C., Schekaan, R. (1986). J. Bact.166. 313-318
21. Struhl, K., Stinchcoab, D.T., Scherer, S., Davis, R.W. (1979). Proc.Natl. Acad. Sci. USA. 76, 1035-1039
22. Thoapson, A., Oliver S.G. (1986). Yeast, g, 179-19123. Ito, H., Fukuda, Y., Murata, K., Kiaura, A. (1983). J. Bact. 153.
163-16824. Henikoff, S. (1984). Gene 25, 351-35925. Devereux J., Haeberli, P., Snithies, 0. (1984). Nucl. Acids. Res. 12,
387-39526. Lipnan, D.J., Pearson, H.R. (1985). Science g Z . 1435-144127. Ovcfainnikov, Y.A., Monastyrskaya, G.S., Gubanov, V.V., Guryev, S.O.,
Chertov, O.Y., Modyanov, N.N., Grinkevich, V.A., Makarova, I.A.,Marcfaenko, T.V., Polovnikova, I.N., Lipkin, V.M., Sverdlov, B.D.,(1981). Bur. J. Biochea. H 6 , 621-629
28. Shinosaki, K., Ohae, M., Tanaka, M., Nakasugi, T., Hayashida, N.,Matsubayashi, T., Zaita, N., dnumongse, J., Obokata, J.,YaBagucfai-Shinozaki, K., Ohto, C., Torazawa, K., Meng, B.Y., Sugita,M., Deno, H., Kaaogashira, T., Yaoada, K., Kusuda, J., Takaiwa, F.,Kato, A., Tohdoh, N., Shinada, H., Sugiura, M. (1986). EMBO J. 5,2043-2049
29. Ohyaaa, K., Fukuzawa, H., Kohchi, T., Shirai, H., Sano, T., Sano, S.,Oaesona, K., Shiki, Y., Takeuchi, M., Chang, Z., Aota, S., Inokuchi,H., Oseki, H. (1986). Nature 322, 572-574
30. Sweetaer, D., Nonet, M., Young, R.A. (1987). Proc. Natl. Acad. Sci.USA. 24. 1192-1196
31. Ovchinnikov, Y.A., Monastyrskaya, G.S., Oubanov, V.V., Guryev, S.0.,Saloaatina, I.S., Shuvaeva, T.M., Lipkin, V.M., Sverdlov, B.D.(1982). Nucl. Acids. Res. 10, 4035-4044
32. Allison, L.A., Moyle, M., Shales, M., Ingles, C.J. (1986). Cell 42.,599-610
33. Biggs, J., Searlea, L.L., Greenleaf, A.L. (1985) Cell 42, 611-62134. Masters, B.S., Stohl L.L., Clayton D.A. (1987). Cell 51, 89-9935. Kuzain, B.V., Levchenko I.V., Zaitseva G.N. (1988). Nucl. Acids. Res.
!g. 417736. Broyles, S.S., Moss, B. (1987). J. Virol, gl, 1738-174237. Broyles, S.S., Moss, B. (1987). Molec. Cell. Biol. 2. 7-1438. Fukuda, H., Ishihaaa, A. (1974). J. Mol. Biol. 87, 523-540
8111
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018
Nucleic Acids Research
39. Armstrong, V.H., Sternbacfa, H., Bckstein, F. (1976). Biochemistry 15,2086-2091
MOTK ADDED IN PROOFSince submission of this manuscript Touasino et al. published the
complete nucleotide sequence of plasmid k2 (Nucl.Acids.Res. 16, 5863-5878).Their predictions concerning the genetic organisation of k2 ORFs are in goodagreement with our own, except that they have found ORFs 112 and 336 to bejoined into a single ORF of 453 amino acids.
8112
Downloaded from https://academic.oup.com/nar/article-abstract/16/16/8095/2378352by gueston 13 February 2018