EMERGING TECHNOLOGIES

Expression of the affinity tags, glutathione-S-transferaseand maltose-binding protein, in tobacco chloroplasts

Niaz Ahmad • Franck Michoux • James McCarthy •

Peter J. Nixon

Received: 6 October 2011 / Accepted: 16 December 2011 / Published online: 12 January 2012

� Springer-Verlag 2012

Abstract Chloroplast transformation offers an exciting

platform for the safe, inexpensive and large-scale production

of recombinant proteins in plants. An important advantage

for the isolation of proteins produced in the chloroplast

would be the use of affinity tags for rapid purification by

affinity chromatography. To date, only His-tags have been

used. In this study, we have tested the feasibility of

expressing two additional affinity tags: glutathione-S-trans-

ferase (GST) and a His-tagged derivative of the maltose-

binding protein (His6-MBP). By using the chloroplast 16S

rRNA promoter and 50 untranslated region of phage T7 gene

10, GST and His6-MBP were expressed in homoplastomic

tobacco plants at approximately 7% and 37% of total soluble

protein, respectively. GST could be purified by one-step-

affinity purification using a glutathione column. Much better

recoveries were obtained for His6-MBP by using a twin-

affinity purification procedure involving first immobilised

nickel followed by binding to amylose. Interestingly,

expression of GST led to cytoplasmic male sterility. Overall,

our work expands the tools available for purifying recom-

binant proteins from the chloroplast.

Keywords Affinity tags � Chloroplast transformation �Cytoplasmic male sterility � Glutathione-S-transferase �Maltose-binding protein

Abbreviations

CMS Cytoplasmic male sterility

DIG Digoxigenin

GST Glutathione-S-transferase

IMAC Immobilised metal affinity chromatography

MBP Maltose-binding protein

Ni Nickel

PEB Protein extraction buffer

TSP Total soluble protein

UTR Untranslated region

Introduction

Plants possess a number of advantages for the heterologous

expression of proteins including low capital costs, excellent

scalability and the ability to properly fold recombinant

proteins and to perform a number of post-translational

modifications (Dove 2002; Fischer et al. 2004; Watson

et al. 2004; Chakauya et al. 2006). Furthermore, the

existing infrastructure for crop cultivation, processing and

storage can reduce the cost of production of recombinant

proteins significantly. For example, up to 50% of the pro-

duction cost might be reduced by expressing the same

protein in plants rather than in E. coli (Kusnadi et al. 1997).

Transforming the plastid genome is a proven route for

high-level expression of foreign proteins in plants (Daniell

et al. 2002; Maliga and Bock 2011). For example, protein

expression in transplastomic plants (plants with an engi-

neered plastid genome) has been reported to reach more

than 70% of total soluble protein (TSP) (Oey et al. 2009a;

Ruhlman et al. 2010). Problems met with transforming the

nucleus, such as gene silencing and variable expression

levels, have not been observed when transgenes are

N. Ahmad � F. Michoux (&) � P. J. Nixon

Division of Molecular Biosciences,

Wolfson Biochemistry Building, Imperial College London,

South Kensington Campus, London SW7 2AZ, UK

e-mail: franck.michoux@imperial.ac.uk

J. McCarthy

Centre de Recherche Nestle, Notre Dame d’Oe,

Tours 37097, France

123

Planta (2012) 235:863–871

DOI 10.1007/s00425-011-1584-8

inserted in chloroplasts (Maliga 2003). Proteins that are

toxic in the cytosol can also be compartmentalized within

the chloroplast preventing deleterious effects on plant fit-

ness (Sticklen 2008; Oey et al. 2009b). Plastid transfor-

mation is also advantageous in terms of gene containment

due to strong maternal inheritance in most plants (Birky

1995).

Although chloroplast transformation has been used to

express a large number of heterologous proteins (Bock and

Warzecha 2010; Lossl and Waheed 2011), less attention

has been paid to the development of affinity purification

methods for isolating these proteins. Indeed, very few

foreign proteins have been purified from chloroplasts

(Staub et al. 2000; Leelavathi and Reddy 2003) and only

the His-tag has been exploited for affinity purification

(Koya et al. 2005).

Two affinity tags widely used in biotechnology are the

enzyme glutathione-S-transferase (GST) from Schistomo-

soma japonicum (Smith and Johnson 1988) and the malt-

ose-binding protein (MBP) from E. coli encoded by malE

(Kapust and Waugh 1999). GSTs (E.C. 2.5.1.18) are

widely found in nature and catalyse the conjugation of

reduced glutathione to a wide variety of organic molecules

(Douglas 1987). Target proteins tagged with GST can be

purified from cell extracts on the basis of its affinity for

glutathione. MBP binds the disaccharide maltose (4-O-a-D-

glucopyranosyl-D-glucose) and MBP-tagged proteins can

be purified using amylose/dextrin columns. A His-tagged

version of MBP (His6-MBP) has the additional advantage

of allowing twin affinity purification of target proteins

(Nallamsetty et al. 2005).

In this report, we have tested the feasibility of using

plastid transformation techniques to express GST and His6-

MBP in tobacco chloroplasts. Both proteins were expressed

at relatively high levels and could be successfully purified

from tobacco plants by affinity purification. We discovered

that the GST-expressing plants examined in this study

failed to produce viable pollen, which might prove useful

for gene containment. Overall, our work demonstrates the

feasibility of using GST and His6-MBP as affinity tags for

purifying target proteins from higher plant chloroplasts.

Materials and methods

Plant material and growth conditions

Nicotiana tabacum cv Petit Havana was used in this study.

Seeds were grown in magenta boxes on Murashige and

Skoog (MS) medium supplemented with 8 g L-1 agar and

30 g L-1 sucrose (Murashige and Skoog 1962). Seeds were

sterilized using commercial grade bleach solution in the

presence of 0.1% Tween-20 for 15 min at room temperature

and then washed three times for 5 min with distilled water

before sowing. The seeds were germinated in a growth room

at 25�C, 16 h light/8 h dark, photosynthetic photon flux of

50 lmol m-2 s-1 provided by cool white fluorescent bulbs

and at 30% humidity. Three- to four-week-old T0 plantlets

were transferred from MS medium to plastic pots filled with

Levington F2 ? S seed and modular compost pH 5.3–5.7

(www.scotts.com) supplemented with medium sized Ver-

miculite pH 6.0 (2–5 mm, density 100 kg m-3) (Sinclair,

www.william-sinclair.co.uk) at a ratio of 4:1 and grown in a

greenhouse at 25/20�C (day/night) in a 16 h photoperiod at a

photosynthetic photon flux of 120 lmol m-2 s-1 provided

by cool white fluorescent bulbs, and 40% humidity.

Chloroplast transformation vector construction

The DNA sequences coding for GST and His6-MBP were

cloned into the chloroplast transformation vector pHK40,

kindly provided by Dr. Pal Maliga, Rutgers University,

USA (Kuroda and Maliga 2001). The GST sequences were

amplified by PCR from pGEX-6P-3 (GenBank accession

U78874.1; GE Healthcare, Goteborg, Sweden, kindly

provided by Dr. Andrew McCarthy, EMBL, France) using

primers GST-F-NdeI (GCTAACTACATATGTCCCCTAT

ACTAGGTTATTGGAAAA) and GST-R-XbaI (CATA

TCTAGACGGCTTTATCAGTCAGTCACGATG) CCGG

CCGC), whereas, His6-MBP sequences were obtained from

pEDS1-His-MBP plasmid provided by Bart Feys from

Imperial College London, UK; using His6-MBP-F (TAG

CGCATATGAAAATCCATCACCATCACCATCACGA)

and MBP-R-XbaI (TCGGAATCTAGATTATTAGCCCT

GGAAATACAGGTTTTCGGT). To facilitate cloning into

pHK40, NdeI and XbaI restriction sites were added to the

forward and reverse primers, respectively. Both GST and

His6-MBP fragments were first cloned into pGEMTeasy

vector (Promega) and authenticated by sequencing. The

sequences were then excised by double-digestion with

NdeI/XbaI and sub-cloned into pHK40 vector as NdeI/XbaI

fragments, thus creating vectors pGST and pHis6-MBP.

Generation of transplastomic plants expressing GST

and His6-MBP

Transformation of the plastid genome using pGST and

pHis6-MBP was carried out by particle bombardment

according to Svab and Maliga (1993). Bombarded leaves

were selected on RMOP medium supplemented with

500 mg L-1 spectinomycin (Svab et al. 1990). Several

shoots were regenerated in the first round from 4 to 6 weeks

of bombardment. To select against spontaneous mutations,

primary shoots were subjected to double selection by

growing on RMOP plates containing 500 mg L-1 of spec-

tinomycin and 500 mg L-1 of streptomycin. In order to

864 Planta (2012) 235:863–871

123

reach homoplastomy, the surviving shoots were further sub-

cultured two more times on RMOP plates containing spec-

tinomycin only. T0 transformants were rooted to soil and

grown in a greenhouse to produce seed. Southern blot anal-

ysis was employed to determine the homoplastomic state of

transplastomic plants (Maliga 2002).

Evaluation of homoplastomy by Southern blot analysis

Total genomic DNA was extracted from 4- to 6-week-old

leaves using DNeasy Plant Maxi Kit (Qiagen) following the

manufacturer’s protocol. Approximately, 7 lg of genomic

DNA was digested with BglII, electrophoresed in a 1% (w/v)

agarose gel and transferred to a nylon membrane by over-

night capillary transfer. A plastome region containing the

site of integration (rrn16 and rps12/7) was amplified by PCR

from WT tobacco using primer RRN16-F (AATTCA

CCGCCGTATGGCTGACCGGCGA) and RPS12/7-R (GA

TCTTTCTCGATCAATCCCTTTGCCCCTCA), labelled

with DIG High Prime DNA Labelling and Detection Starter

Kit II (Roche Applied Science) and hybridised with digested

genomic DNA from transplastomic plants. The specific

signals were detected by exposing the membrane to X-ray

film after incubating with anti-DIG (digoxigenin) antibodies

and chloro-5-substituted adamantyl-1,2-dioxetane phos-

phate (CSPD) solution as described in Michoux et al. (2011).

Extraction and quantification of soluble proteins,

SDS-PAGE and immunoblotting

TSP was extracted from leaves obtained from 2-month-old

greenhouse-grown plants by grinding leaf tissue into fine

powder with liquid nitrogen following the procedures

described by Oey et al. (2009a) with slight modifications.

Briefly, approximately 100 mg of leaf powder were resus-

pended in 200 lL of protein extraction buffer-A (PEB-A)

(50 mM Hepes/KOH pH 7.5, 1 mM EDTA, 2 mM DTT,

10 mM potassium acetate, 5 mM magnesium acetate, pro-

tease complete inhibitor cocktail (Roche Applied Sciences;

*1 mini tablet added to each 5 mL of buffer) and incubated

for 10 min on ice followed by centrifugation at 18,000g for

2 9 5 min in an accuSpin� Micro Centrifuge (Fischer Sci-

entific). The supernatant was taken as the TSP fraction. The

protein concentration was determined using Bio-Rad DC

protein assay according to the manufacturer’s instructions. A

series of known concentrations of bovine serum albumin

(BSA) were used as a standard.

SDS-PAGE (Laemmli 1970) was performed using a Bio-

Rad (mini) gel electrophoresis system as described in Boehm

et al. (2009). Broad-range pre-stained multicolour molecular

weight standards, SpectraTM

(Fermentas), were run alongside

samples to determine the sizes of protein bands. The gels

were stained with coomassie brilliant blue ‘R-250’.

After electrophoresis, the proteins were transferred to

nitrocellulose membrane using iBlot� Dry Blotting System

(Invitrogen) and were incubated with primary antibodies

(anti-GST from Sigma-Aldrich; anti-His tag from Invitro-

gen, and anti-MBP from NEB, http://www.neb.uk.com)

overnight at 4�C, before being incubated with secondary

antibodies conjugated with horseradish peroxidase (HRP).

The secondary antibodies were detected using Enhanced

Chemiluminescence (ECL) Detection Kit (Amersham

Pharmacia) on an X-ray film (Kodak) as described in

Boehm et al. (2009).

Protein expression levels were estimated by densitom-

etry using Image-J software (Girish and Vijayalakshmi

2004) and comparing the intensity of the recombinant

proteins against all the Coomassie-stained proteins as used

by Petersen and Bock (2011).

Purification of GST by affinity chromatography using

a glutathione resin

400 lL of immobilized glutathione resin (Pierce) was

equilibrated by washing three times with one-column vol-

ume of PEB-A. 500 lL of TSP extract isolated from GST

plant leaves were mixed with resin and incubated for 60 min

at 4�C. The mixture was then passed through a Proteus mini

purification spin column (Generon, http://www.generon.

co.uk) by spinning at 18,000g for 1 min in an accuSpin�

Micro Centrifuge (Fischer Scientific) and the flow-through

(FT) was saved for further analysis. Unbound proteins were

removed by washing (39) with one-column volume of PEB-

A and bound GST was eluted with 500 lL of PEB-A con-

taining 10 mM reduced glutathione.

Purification of His6-MBP by immobilised nickel

affinity chromatography

A similar protocol to that used for GST was followed

except that PEB-B, a variant of PEB-A, containing 20 mM

b-mercaptoethanol (ME) instead of DTT was used; and

that the Ni-IDA metal chelate resin (Generon) was washed

with one-column volume each of PEB-B (wash 1, W1),

PEB-B containing 10 mM of imidazole (wash 2, W2) and

PEB-B containing 20 mM of imidazole (wash 3, W3).

Finally, His6-MBP was eluted with 500 lL of PEB-B

containing 300 mM imidazole.

Purification of His6-MBP by affinity chromatography

with an amylose resin

A similar protocol to that used for GST was followed

except that bound His6-MBP protein was eluted from the

amylose resin (New England Biolabs) with 500 lL of

PEB-A containing 20 mM maltose.

Planta (2012) 235:863–871 865

123

b

c

GST His6-MBP WT

+ Spec

- Spec

GST

WT

His 6-M

BP

7.1

7.5

4.5

kb

GOI TrbcLPrrn rps12/7 aadArrn16 PrrnTpsbAtrnV

7.5 kb

rps12/7 rrn16 trnV

BglIIBglII

BglIIBglII

His6-MBP

4.5 kb

a

T-ptDNA

WT-ptDNA

7.1 kb GST

Fig. 1 Generation of GST and MBP homoplastomic plants.

a Schematic representation of the plastome region of the WT and

the transplastomic plants. Transgenes were fused to a strong

constitutive chloroplast 16S rRNA operon promoter, Prrn, and phage

T7 gene 10 (T7G10) used as 50UTRs for a high transcription rate and

30UTRs from ribulose bisphosphate carboxylase large subunit gene

(TrbcL) for stabilization of the transcripts. aadA cassette was used as

selection marker to select transformants against spectinomycin. The

transgenes in plastid genome were inserted at a site-specific location

between trvnV-rps12/7 inter-genic spacer regions. The dotted linesrepresent the size of the expected fragments to be released from the

GST and the His6-MBP line after restriction and by subsequent

hybridization of the probe. b Total genomic DNA was digested with

BglII and was then hybridized with rrn16/rps12 digoxigenin (DIG)

labelled probe amplified from WT. c Maternal inheritance of GST and

MBP transplastomic plant lines. Seeds were obtained from GST plant

by manual crossing with WT pollen, and by self-pollination in MBP

and WT plants and were grown on MS plates with or without

500 mg L-1 spectinomycin (upper panel with spec and lower panelwithout spec). WT seedlings are bleached on spectinomycin, whereas,

GST and His6-MBP seedlings stay green and healthy

866 Planta (2012) 235:863–871

123

Mendelian inheritance assay

Seeds of His6-MBP and WT plants were obtained by self-

pollination, whereas, in the case of GST plants, seeds were

obtained by manual pollination with healthy WT pollen.

Seeds were grown on MS plates containing 500 mg L-1 of

spectinomycin. Plates were placed on room temperature

and germination occurred from 10 to 15 days. Pictures

were taken after 21 days of sowing.

Pollen morphology

Pollen from wild type tobacco as well as plants expressing

GST and GSTManB, another plant line, which also failed

to produce viable pollen (Michoux 2008), were observed

under an Auxioskop microscope (Zeiss). Images were

captured with an Axiocam camera (Zeiss).

Results

Generation of transplastomic plants expressing

glutathione-S-transferase (GST) and His-tagged

maltose-binding protein (His6-MBP)

Chloroplast transformation vectors were constructed by

cloning sequences encoding GST and His6-MBP into the

pHK40 vector (Kuroda and Maliga 2001). This plasmid

targets transgenes into a region of the tobacco plastome

between rrn16 and rps12/7 and has been developed to drive

high expression of transgenes using a plastid 16S rRNA

promoter, Prrn, and the 50 untranslated region (50UTR) from

gene 10 of bacteriophage T7 (Fig. 1a) (Kuroda and Maliga

2001). After sub-culturing 3–4 times on selective media,

genomic DNA was extracted from GST and His6-MBP

plants, digested with BglII and hybridized with a digoxigenin

(DIG) labelled DNA probe corresponding to the region of the

plastome between rrn16 and rps12/7 (Fig. 1a). As antici-

pated a 4.5-kb band was detected in WT, whereas 7.1 and

7.5-kb bands were present in GST and His6-MBP, respec-

tively (Fig. 1b). These data indicated that the transgenes had

successfully integrated at the predicted site via homologous

recombination and that the vast majority of the copies of the

chloroplast genome, if not all, had been transformed in the

GST and His6-MBP lines.

In order to test further that the GST and His6-MBP

plants were homoplastomic, seeds were germinated on MS

medium either in the presence or absence of spectinomy-

cin. Unlike WT, which bleaches in the presence of spec-

tinomycin, all seeds produced by the GST and His6-MBP

plants grew normally (Fig. 1c). The lack of segregation of

the selectable marker supports the presence of homoplas-

tomic lines.

Accumulation of recombinant proteins in tobacco

chloroplasts

Analysis of TSP by SDS-PAGE revealed the presence of an

additional *30-kDa protein in the GST plant and an extra

42-kDa band in the His6-MBP plant, close to the predicted

masses of GST and His6-MBP, of 28 and 41.5-kDa,

respectively (Fig. 2a). The identities of these additional

bands were confirmed by immunoblotting using anti-GST

(Fig. 2b), anti-His6 tag and anti-MBP antibodies (Fig. 2d).

Expression levels, estimated by densitometry analysis of

the Coomassie-blue stained gel, were determined to be

*7% of TSP for GST and *37% of TSP for His6-MBP.

Using this technique the expression level of the large

subunit of ribulose-1,5-bisphosphate carboxylase/oxygen-

ase (RuBisCO) was estimated to be 35% of TSP in WT in

line with accepted values (Spreitzer and Salvucci 2002).

260 140 100

50

40

35 25

15 10

kDaGST

WT

His 6-M

BP M

arke

r

GST

His

a

b

c

MBP

GST

d MBP

Fig. 2 Detection of GST and His6-MBP proteins from soluble extract

of the transplastomic plants. a Total soluble proteins (TSP) (10 lg per

well) were run on 12.5% (w/v) SDS-PAGE, stained by Coomassie

blue and immunoblotted with antibodies against GST (b 1:10,000),

His (c 1:3,000) and MBP (d 1:10,000) as indicated on the right.Marker sizes are shown on the left hand-side of the gel image

Planta (2012) 235:863–871 867

123

Impact of the expression of GST and His6-MBP

on transplastomic plants

Growth on soil of the GST and His6-MBP T0 plants was

comparable with WT plants under greenhouse conditions

(Fig. 3b). Unexpectedly, the GST plant failed to produce

seeds, apparently due to pollen malformation. The pollen

grains, when studied using a light microscope, appeared

wrinkled and showed a collapsed morphology (Fig. 4h, l), in

marked contrast to WT (Fig. 4d). It was observed that the

anthers were similar to those of WT in terms of shape and

length at their early stage of development (Fig. 4a, e, i).

However, a notable difference was observed at later stage of

their development (Fig. 4b, f, j). The collapsed morphology

of the pollen was also observed in another transplastomic

tobacco line, GSTManB, which expresses a fusion of GST

and a Mannanase B enzyme (Michoux 2008) (Fig. 4k, l). To

obtain seed from these plants, a manual pollination of GST

and GSTManB flowers was performed using pollen from a

WT plant. We tracked the effect of GST on pollen germi-

nation for three generations in both the GST and GSTManB

plant lines and observed that pollen germination failed each

time both in GST and in GSTManB plants. Overall, our data

suggest that abnormal expression of GST in the plastid can

lead to cytoplasmic male sterility.

Purification of GST and His6-MBP proteins

from transplastomic plants

In order to test the feasibility of using the GST and His6-MBP

proteins as affinity tags, experiments were performed to

purify GST using a glutathione column (Fig. 5a) and His6-

MBP in a single step using an amylose column (Fig. 5b); or

in a two-step procedure using immobilised nickel affinity

chromatography to bind the His6-tag (Fig. 5c) followed by

an amylose column to bind MBP (Fig. 5d).

Initial attempts to bind GST to the resin were unsuc-

cessful (data not shown). However, GST binding was sig-

nificantly improved by increasing the concentration of

dithiothreitol (DTT) in the PEB-A buffer from 1 to 5 mM.

Under these conditions, immunoblotting revealed that

approximately 50% of GST could bind to the column and

be eluted (Fig. 5a).

We found that binding of His6-MBP to amylose resin in

a single-step format was poor with only 5–10% of loaded

His6-MBP recovered (Fig. 5b), possibly because of the

presence of competing molecules, such as maltose, in the

TSP extract (Niittyla et al. 2004). Given the low recovery

of His6-MBP, a tandem purification strategy (amylose

followed by Ni2?) was not applied. However, when His6-

MBP was purified first using a Ni column, both the binding

WT His6-MBP

a

b

WT His6-MBP GST

Fig. 3 Phenotypes of GST and

His6-MBP transplastomic

plants. Phenotypes of GST and

His6-MBP transplastomic

plants. a Three-week-old plants.

b At the flowering stage/

maturity

868 Planta (2012) 235:863–871

123

and the subsequent recovery were remarkably high (95%)

(Fig. 5c). The eluted His6-MBP could be further purified in

a second chromatography step involving the amylose col-

umn (Fig. 5d).

Discussion

In this study, we have shown that GST and His6-MBP

proteins can be expressed in tobacco chloroplasts. One of

the salient features of chloroplast transformation is the

potential to produce recombinant proteins at high levels.

For instance levels of expression of 70% TSP or greater

have been reported (Oey et al. 2009a; Ruhlman et al.

2010). Therefore, high expression of His6-MBP at 37%

TSP is not unprecedented. Expression of GST at 7% TSP

is, however, higher than previous attempts to express GST

in tobacco chloroplasts (Le Martret et al. 2011), and might

reflect differences in the regulatory elements used to drive

expression. Importantly, both GST and His6-MBP proteins

could be purified by affinity chromatography and so have

the potential to act as affinity tags from chloroplast

extracts. Besides a purification tool, these tags might also

enhance the solubility of the target protein (Kapust and

Waugh 1999).

Plants expressing GST and His6-MBP grew as well as

WT under our experimental conditions (Fig. 3). However,

the His6-MBP plant showed a marked yellow colouration

of the leaves both at early stage (Fig. 3a) as well as at

maturity (Fig. 3b). One potential explanation of this phe-

notype, to be tested in future work, could be related to

binding of maltose by His6-MBP and its retention in the

stroma, as a similar phenotype was observed in the maltose

excess1 (mex1) mutant of Arabidopsis, which is impaired

in maltose export from the chloroplast (Niittyla et al.

2004). Alternatively, over-expression of His6-MBP might

be placing the plant under a severe metabolic burden,

preventing optimal photosynthetic capacity.

An additional novel aspect of our work is the observa-

tion that plants expressing GST and GSTManB fail to

produce seeds, apparently because of aberrant pollen for-

mation (Fig. 4). Such a link between pollen malformation

Fig. 4 Morphology of the anthers and pollens in flowers produced

by the GST and GSTManB lines. Flowers from WT (a–d), GST

(e–h) and GSTManB (i–l) plants were observed by light microscopy.

Different stages of pollen germination are shown: early-stage flowers

(a, e, i), late-stage flowers (b, f, j), anthers (c, g, k) and single pollen

(d, h, l). The individual pollen are shown at a magnification of 9100;

bar 10 lm. Insets: Individual anthers at early (a, e, i) and late stage of

development (b, f, i) visible to the naked eye

Planta (2012) 235:863–871 869

123

and GST expression in the plastid was not made in earlier

studies, perhaps due to the much lower levels of GST

expression, only 1.7 fold higher than the WT level (Le

Martret et al. 2011). Cytoplasmic male sterility (CMS) has

been observed previously in transplastomic plants

expressing polyhydroxybutyrate (PHB) (Lossl et al. 2003)

and beta-ketothiolase (Ruiz and Daniell 2005). In the case

of beta-ketothiolase, it is thought that plants fail to produce

normal pollen due to an impaired supply of acetyl-CoA,

which limits fatty acid biosynthesis critical for tapetum and

pollen development (Ruiz and Daniell 2005).

Recent studies have shown that glutathione is essential

for pollen germination (Zechmann et al. 2011). Conse-

quently, one possible explanation for the defect observed in

the GST-producing plants described here could be the

lower level of free-glutathione in the plastid (Wachter et al.

2005). Another more speculative reason might be the

impact of GST in the plastid on the levels of auxin, a group

of hormones that regulate anther dehiscence, pollen

development and filament elongation in Arabidopsisis

(Cecchetti et al. 2004, 2008; Cheng et al. 2006). S. ja-

ponicum GST is similar to plant phi-type GSTs, whose

members have been shown to bind auxin (Bilang et al.

1993; Wagner et al. 2002). Furthermore, GST could also

deplete the plastid levels of a specific auxin, indole-3-

acetic acid (IAA), by triggering its degradation (Zettl et al.

1994). Consequently, overexpression of GST in the chlo-

roplast might be reducing the level of available auxin,

leading to aberrant development of the pollen.

In conclusion, we show that GST and His6-MBP can be

expressed in the chloroplast and be isolated by affinity

chromatography. Consequently, they could be used as

affinity tags for the rapid purification of chloroplast-

expressed proteins. In addition, expression of high levels of

GST in the plastid leads to cytoplasmic male sterility (Ruiz

and Daniell 2005) and potentially could provide resistance

to abiotic stress (Le Martret et al. 2011).

Acknowledgments We are thankful to Higher Education Com-

mission (HEC) of Pakistan for the award of a studentship to NA at

Imperial College, London. We are also grateful to Biotechnology and

Biological Sciences Research Council (BBSRC) and Nestle for

funding.

References

Bilang J, Macdonald H, King PJ, Sturm A (1993) A soluble auxin-

binding protein from Hyoscyamus muticus is a glutathione

S-transferase. Plant Physiol 102:29–34

Birky CW Jr (1995) Uniparental inheritance of mitochondrial and

chloroplast genes: mechanisms and evolution. Proc Natl Acad

Sci USA 92:11331–11338

Bock R, Warzecha H (2010) Solar-powered factories for new

vaccines and antibiotics. Trends Biotechnol 28:246–252

Fig. 5 Affinity-purification of GST and His6-MBP proteins from

transplastomic leaves. Total soluble protein from the GST plant was

purified using immobilised glutathione (a) and from the His6-MBP

plant by either an amylose resin (b) or by immobilised Ni2?

(c) followed by application of the pooled fraction (E1*) to an amylose

resin (d). Protein fractions were separated on 12.5% SDS-PAGE gels

and stained with Coomassie blue or immunoblotted using specific

antibodies (relevant blots are shown under each Coomassie stained

gel). Protein marker sizes are shown on the left hand side of the

images. A total of 2% of each fraction (10 lL out of 500 lL volume)

from each step was loaded per well. M protein markers, TSP total

soluble proteins, FT flow-through, W washing, E elution

870 Planta (2012) 235:863–871

123

Boehm M, Nield J, Zhang P, Aro EM, Komenda J, Nixon PJ (2009)

Structural and mutational analysis of band 7 proteins in the

cyanobacterium Synechocystis sp. strain PCC 6803. J Bacteriol

191:6425–6435

Cecchetti V, PomponiM, Altamura MM, Pezzotti M, Marsilio S, DıAngeli

S, Tornielli GB, Costantino P, Cardarelli M (2004) Expression of

rolB in tobacco flowers affects the coordinated processes of anther

dehiscence and style elongation. Plant J 38:512–525

Cecchetti V, Altamura MM, Falasca G, Costantino P, Cardarelli M

(2008) Auxin regulates Arabidopsis anther dehiscence, pollen

maturation, and filament elongation. Plant Cell 20:1760–1774

Chakauya E, Chikwamba R, Rybicki EP (2006) Riding the tide of

biopharming win Africa: considerations for risk assessment.

S Afr J Sci 102:284–288

Cheng Y, Dai X, Zhao Y (2006) Auxin biosynthesis by the YUCCA

flavin monooxygenases controls the formation of floral organs

and vascular tissues in Arabidopsis. Genes Dev 20:1790–1799

Daniell H, Khan MS, Allison L (2002) Milestones in chloroplast

genetic engineering: an environmentally friendly era in biotech-

nology. Trends Plant Sci 7:84–91

Douglas KT (1987) Mechanism of action of glutathione dependent

enzymes. Adv Enzymol Relat Areas Mol Biol 59:103–167

Dove A (2002) Uncorking the biomanufacturing bottleneck. Nat

Biotechnol 20:777–779

Fischer R, Stoger E, Schillberg S, Christou P, Twyman RM (2004)

Plant-based production of biopharmaceuticals. Curr Opin Plant

Biol 7:152–158

Girish V, Vijayalakshmi A (2004) Affordable image analysis using

NIH Image/ImageJ. Indian J Cancer 41:47

Kapust RB, Waugh DS (1999) Escherichia coli maltose binding

protein is uncommonly effective at promoting the solubility of

polypeptides to which it is fused. Protein Sci 8:1668–1674

Koya V, Moayeri M, Leppla SH, Daniell H (2005) Plant-based

vaccine: mice immunized with chloroplast-derived anthrax

protective antigen survive anthrax lethal toxin challenge. Infect

Immun 73:8266–8274

Kuroda H, Maliga P (2001) Complementarity of the 16S rRNA

penultimate stem with sequences downstream of the AUG

destabilizes the plastid mRNAs. Nucleic Acids Res 29:970–975

Kusnadi AR, Nikolov ZL, Howard JA (1997) Production of

recombinant proteins in transgenic plants: practical consider-

ations. Biotechnol Bioeng 56:473–484

Laemmli UK (1970) Cleavage of structural proteins during the

assembly of the head of bacteriophage T4. Nature 227:680–685

Le Martret B, Poage M, Shiel K, Nugent GD, Dix PJ (2011) Tobacco

chloroplast transformants expressing genes encoding dehydro-

ascorbate reductase, glutathione reductase, and glutathione-S-

transferase, exhibit altered anti oxidant metabolism and

improved abiotic stress tolerance. Plant Biotech J 9(66):1–673

Leelavathi S, Reddy VS (2003) Chloroplast expression of His-tagged

GUS-fusions: a general strategy to overproduce and purify

foreign proteins using transplastomic plants as bioreactors. Mol

Breed 11:49–58

Lossl AG, Waheed MT (2011) Chloroplast-derived vaccines against

human diseases: achievements, challenges and scopes. Plant

Biotech J 9:527–539

Lossl A, Eibl C, Harloff HJ, Jung C, Koop HU (2003) Polyester

synthesis in transplastomic tobacco (Nicotiana tabacum L.):

significant contents of polyhydroxybutyrate are associated with

growth reduction. Plant Cell Rep 21:891–899

Maliga P (2002) Engineering the plastid genome of higher plants.

Curr Opin Plant Biol 5:164–172

Maliga P (2003) Progress towards commercialization of plastid

transformation technology. Trends Biotechnol 21:20–28

Maliga P, Bock R (2011) Plastid biotechnology: food, fuel, and

medicine for the 21st century. Plant Physiol 155:1501–1510

Michoux F (2008) Developing new strategies for the production of

foreign proteins in higher plant chloroplast. PhD thesis. Imperial

College, London

Michoux F, Ahmad N, McCarthy J, Nixon PJ (2011) Contained and

high-level production of recombinant protein in plant chloro-

plasts using a temporary immersion bioreactor. Plant Biotechnol

J 9:575–584

Murashige T, Skoog F (1962) A revised medium for rapid growth and

bioassays with tobacco tissue cultures. Plant Physiol 79:197–205

Nallamsetty S, Austin BP, Penrose KJ, Waugh DS (2005) Gateway

vectors for the production of combinatorially-tagged His6-MBP

fusion proteins in the cytoplasm and periplasm of Escherichiacoli. Protein Sci 14:2964–2971

Niittyla T, Messerli G, Trevisan M, Chen J, Smith AM, Zeeman SC

(2004) A previously unknown maltose transporter essential for

starch degradation in leaves. Science 303:87–89

Oey M, Lohse M, Kreikemeyer B, Bock R (2009a) Exhaustion of the

chloroplast protein synthesis capacity by massive expression of a

highly stable protein antibiotic. Plant J 57:436–445

Oey M, Lohse M, Scharff LB, Kreikemeyer B, Bock R (2009b)

Plastid production of protein antibiotics against pneumonia via a

new strategy for high-level expression of antimicrobial proteins.

Proc Natl Acad Sci USA 106:6579–6584

Petersen K, Bock R (2011) High-level expression of a suite of

thermostable cell wall-degrading enzymes from the chloroplast

genome. Plant Mol Biol 76:311–321

Ruhlman T, Verma D, Samson N, Daniell H (2010) The role of

heterologous chloroplast sequence elements in transgene inte-

gration and expression. Plant Physiol 152:2088–2104

Ruiz ON, Daniell H (2005) Engineering cytoplasmic male sterility via

the chloroplast genome by expression of b-ketothiolase. Plant

Physiol 138:1232–1246

Smith DB, Johnson KS (1988) Single-step purification of polypep-

tides expressed in Escherichia coli as fusions with glutathione

S-transferase. Gene 67:31–40

Spreitzer RJ, Salvucci ME (2002) Rubisco: structure, regulatory

interactions, and possibilities for a better enzyme. Annu Rev

Plant Biol 53:449–475

Staub JM, Garcia B, Graves J, Hajdukiewicz PT, Hunter P, Nehra N,

Paradkar V, Schlittler M, Carroll JA, Spatola L, Ward D, Ye G,

Russell DA (2000) High-yield production of a human therapeutic

protein in tobacco chloroplasts. Nat Biotechnol 18:333–338

Sticklen MB (2008) Plant genetic engineering for biofuel production:

towards affordable cellulosic ethanol. Nat Rev Genet 9:433–443

Svab Z, Maliga P (1993) High-frequency plastid transformation in

tobacco by selection for a chimeric aadA gene. Proc Natl Acad

Sci USA 90:913–917

Svab Z, Hajdukiewicz P, Maliga P (1990) Stable transformation of

plastids in higher plants. Proc Natl Acad Sci USA 87:8526–8530

Wachter A, Wolf S, Steininger H, Bogs J, Rausch T (2005)

Differential targeting of GSH1 and GSH2 is achieved by multiple

transcription initiation: implications for the compartmentation of

glutathione biosynthesis in the Brassicaceae. Plant J 41:15–30

Wagner U, Edwards R, Dixon DP, Mauch F (2002) Probing the

diversity of the Arabidopsis glutathione S-transferase gene

family. Plant Mol Biol 49:515–532

Watson J, Koya V, Leppa S, Daniell H (2004) Expression of Bacillusanthracis protective antigen in transgenic chloroplasts of

tobacco, a non-food/feed crop. Vaccine 22:4374–4384

Zechmann B, Koffler BE, Russell SD (2011) Glutathione synthesis is

essential for pollen germination in vitro. BMC Plant Biol 11:54–65

Zettl R, Schell J, Palme K (1994) Photoaffinity labeling of Arabid-opsis thaliana plasma membrane vesicles by 5-azido-[7-3H]

indole-3-acetic acid: identification of a glutathione S-transferase.

Proc Natl Acad Sci USA 91:689–693

Planta (2012) 235:863–871 871

123