Expression line approach to recombinant human epidermalgrowth factor into the yeast, Pichia pastoris from Huh-7 cell line

Mohsin Ahmad Khan • Faidad Khan •

Nadeem Ahmad • Muhammad Islam Khan •

Ahmad Usman Zafar • Tayyab Husnain

Received: 17 December 2012 / Accepted: 24 December 2013 / Published online: 12 January 2014

� Springer Science+Business Media Dordrecht 2014

Abstract Beta-urogastrone also known as human epi-

dermal growth factor is a key member of epidermal growth

factor family having role in cell proliferation and differ-

entiation in vivo as well as in vitro. Human epidermal

growth factor gene has been isolated from different tissues

but the method of isolation is technically difficult and

complicated as it deals with biopsies. Here we isolated

mature partial human epidermal growth factor gene from

Huh-7 cell line, amplified and abridged toward mature

coding region with three steps PCR, sequenced for

homology with wild type human epidermal growth factor

gene, inbuilt with sites of interest and cloned in Pichia

pastoris for expression study. Isolated mature human epi-

dermal growth factor gene from Huh-7 cell line showed

100 % sequence homology to wild type human epidermal

growth factor gene and gives the native expression for

human epidermal growth factor peptide. In this study we

report that Huh-7 cell line is an easy source for the par-

ticular gene of human epidermal growth factor isolation

and we are also suggesting P. pastoris is an expression

system to produce recombinant human epidermal growth

factor of the therapeutic importance resembling to the

natural human system.

Keywords Human epidermal growth factor �Human hepatoma cell line � Pichia pastoris �Polymerase chain reaction

Introduction

Human epidermal growth factor (hEGF), a single poly-

peptide chain is a 53 amino acid residues globular protein

of 6.2 kDa molecular weight [1]. hEGF has wide signifi-

cance in clinical and cosmetic areas as it regulates the

growth of different cell types in vitro and in vivo [2].

Epidermal growth factor proteins are evolutionary clo-

sely conserved with *70 % homology among species [3].

The cysteine relative positions among EGF polypeptides of

different species are conserved [4].

The human EGF gene is located on locus 4q25 (Gene/

Locus MIM number 131530) of about 110 kbp of 24 exons.

It codes for the synthesis of long preproprotein of 1,207

amino acids from which the mature 53 amino acids hEGF

factor (970–1023aa) is proteolytically cleaved [5].

Human EGF has many biological activities both in vitro

and in vivo. These biological actions of EGF are not spe-

cies specific [6]. It acts as a strong mitogen for different

cells of ectodermal, mesodermal and endodermal origin

[7]. hEGF has a role in controlling and stimulation of

epidermal cells, epithelial cells, including fibroblasts, kid-

ney epithelial cells, embryonic cells and thyroid cells

in vitro [8]. It promotes differentiation of different cell

types [9] and inhibits gastric acids secretion [10]. A num-

bers of hormones are modulated by hEGF including cho-

rion gonadotropin from chorion carcinoma cells and

prolactin secretion from pituitary tumors [11]. Bone

resorption is promoted and increased by hEGF [12]. It has

Chemoattractant property for epithelial and fibroblasts cells

[13] and mediate wound healing [14]. In several cell types

hEGF activities are indirect [15].

Mounting body of evidence demonstrates the isolation of

hEGF gene from biopsy samples of kidney and liver [16].

The isolation from biopsy, however, requires clinical and

M. A. Khan � F. Khan (&) � N. Ahmad �M. I. Khan � A. U. Zafar � T. Husnain

National Centre of Excellence in Molecular Biology, University

of the Punjab, 87-West Canal Bank Road, Thokar Niaz Baig,

Lahore, Pakistan

e-mail: foodokhan@gmail.com

123

Mol Biol Rep (2014) 41:1445–1451

DOI 10.1007/s11033-013-2989-1

technical expertise. Also, quite a few studies have described

human EGF production using synthetic gene [17].

Huh-7 cell line used for different studies [18–21]

including mRNA isolation for various genes their sequenc-

ing and cloning [22]. However, no study is available on

isolation of the partial mature hEGF gene from Huh-7 cell

line, sequencing and its cloning and expression in Pichia

pastoris. Herein the present study proved that Huh-7 cell line

is an easy source for partial hEGF gene isolation with 100 %

sequence homology to wild type hEGF gene and P. pastoris

is a good expression system. As Huh-7 cell line has high

hEGF expression [23] thus extraction for that particular

mRNA is straight forward and simple.

Materials and methods

Cell culture

Dulbecco’s Modified Eagle’s Medium (DMEM) was used

for culturing Huh-7 cells, containing 10 % fetal bovine

serum (FBS), penicillin and streptomycin at 37 �C in pre-

sence of 5 % CO2.

RNA isolation

RNA from Huh-7 cell line extracted using Trizol �

Reagents (InvitrogenTM) [24]. Extracted RNA treated with

DNase (Fermentas) to digest any residual DNA present in

the sample that could interrupt results. The quality and

quantity of extracted RNA assessed by NanoDrop� ND-

1000 (Spectrophotometer) and gel electrophoresis.

Complementary DNA (cDNA) synthesis

Human EGF cDNA synthesized from extracted RNA using

reverse transcription (RT) PCR in a 20 ll total reaction

volume. The reaction volume containing 4 ll RT Buffer

(59), 2.0 ll Nuclease free water, 2.0 ll (10 mM) dNTPs,

1.0 ll (10 pM) oligo dT primer, 0.5 ll (5U/ll) RNase

Inhibiter (InvitrogenTM), 0.5 ll DTT (0.1 mM), 1 ll

(200 U/ll) M-MLV (RNA dependent DNA polymerase)

(InvitrogenTM), 9.0 ll template (eluted mRNA). Cycle

conditions for cDNA synthesis were as follow: 42 �C

incubation for one hour followed by 94 �C for 2 min.

Amplification

The reverse transcribed cDNA amplified by three steps PCR.

Three sets of primer pairs were designed using Primer-3

Software [25] for hEGF gene from known sequence avail-

able on GenBank NCBI [26] (Human EGF mRNA variant

3 ref/NM_001178131.1) and synthesized from GenelinkTM.

There annealing temperatures and reagents concentrations

were optimized and the amplification of target region was

carried out. First round PCR amplified targeted cDNA, 2nd

round amplified internally the 1st round PCR amplicon,

increased its specificity and 3rd round amplified our targeted

cloning, coding part of the gene with inherited cloning sites

(Table 1; Fig. 1).

First round amplification with external primers

First round PCR performed using a total volume of 15 ll in

a 0.2 ml sterile PCR tubes using ABI Thermal Cycler

(GeneAmp� PCR System 9700) containing 5.7 ll Nuc-

leases free water, 1.5 ll (109) Buffer, 1.5 ll (25 mM)

MgCl2, 1.0 ll (0.5 mM) dNTPs, 1.0 ll (10 pM) external

forward and reverse primers each (Table 1; Fig. 1), 0.3 ll

(5 U/ll) Platinum� Taq DNA polymerase (InvitrogenTM)

and 3 ll of template DNA (cDNA).

Reactions were performed under the following PCR

conditions.

First denaturation (94 �C for 2 min), 30 cycles (94 �C

for 35 s, 53 �C for 35 s, 72 �C for 35 s), final extension

(72 �C for 10 min) followed by incubation at 4 �C. Quality

and quantity of amplified DNA was assessed using Nano-

Drop� ND-1000 Spectrophotometer, and on gel (stained

with ethidium bromide) electrophoresis using 2 % agarose

gel in 19 TAE buffer, and photographed.

Second round amplification with internal primers

Second round PCR carried using a final volume of 15 ll in

a 0.2 ml sterile PCR tubes using ABI Thermal Cycler

(GeneAmp� PCR System 9700) containing 6.7 ll Nuc-

leases free water, 1.5 ll 109 Buffer, 1.5 ll (25 mM)

MgCl2, 1.0 ll (0.5 mM) dNTPs, 1.0 ll (10 pM) internal

forward and reverse primers each (Table 1; Fig. 2), 0.3 ll

(5 U/ll) Platinum� Taq DNA polymerase (InvitrogenTM)

and 2 ll of template DNA (1st round product/amplicon).

Reactions were kept for the following PCR conditions.

First Denaturation (94 �C for 2 min), 30 cycles (94 �C

for 30 s, 54 �C for 30 s, 72 �C for 30 s), final extension

(72 �C for 10 min) followed by incubation at 4 �C.

The amplified DNA was checked with NanoDrop� ND-

1000 Spectrophotometer, and also on gel (stained with ethi-

dium bromide) electrophoresis using 2 % agarose gel in 19

TAE buffer, and photographed. DNA fragment excised from

gel and purified with gel extraction kit (Silica Bead DNA Gel

Extraction Kit # K0513, Fermentas) for sequencing.

Third round amplification with cloning specific primers

Third round PCR performed using a final volume of 15 ll

in a 0.2 ml sterile PCR tubes using ABI Thermal Cycler

1446 Mol Biol Rep (2014) 41:1445–1451

123

(GeneAmp� PCR System 9700) containing 6.7 ll Nucleases

free water, 1.5 ll 109 Buffer, 1.5 ll (25 mM) MgCl2,

1.0 ll (0.5 mM) dNTPs, 1.0 ll (10 pM) cloning specific

forward and reverse primers each (Table 1; Fig. 1), 0.3 ll

(5 U/ll) Platinum� Taq DNA polymerase (InvitrogenTM)

and 2 ll of template DNA (2nd round product/amplicon).

Reactions were performed having following PCR

conditions.

First denaturation (94 �C for 2 min), 30 cycles (94 �C

for 30 s, 54 �C for 30 s, 72 �C for 30 s), final extension

(72 �C for 10 min) followed by incubation at 4 �C.

The amplified DNA was analyzed on agarose gel electro-

phoresis, excised/purified from gel and quantified by Nano-

Drop� ND-1000 Spectrophotometer for sequencing.

TA cloning and transformation

TA Cloning carried out by TA cloning kit protocol

(pCR�2.1, Catalog #. K2020-20, InvitrogenTM).

Transformation brought in chemically competent E. coli

(One Shot� chemically competent E. coli cells (Catalog. no.

C610-00, InvitrogenTM) used Sambrook and Russell [27]

protocol. Transformation was checked and screened for con-

firmation by media selection. Positive colonies were selected,

cultured, preserved and was proceed to plasmid extraction.

Cloning into pPICZaA and transformation

pPICZaA is 3.6 kb expression vectors used to express

recombinant protein in P. pastoris. Cloning into pPICZaA

carried out by pPICZaA cloning kit protocol (Catalog #.

V195-20, InvitrogenTM).

Human EGF gene is propagated in E. coli strains TOP10

(Catalog #. C610-00) and transfer to P. pastoris (KM71H)

followed kit (Catalog no.V195-20) protocol. Transforma-

tion carried out by electroporation. The pPICZaA vectors

contain the ZeocinTM resistance gene to allow selection of

the plasmid using ZeocinTM both in E. coli and in P.

pastoris [28]. Transformation was checked and screened

for confirmation by media selection and finally by

expression study.

pPICZaA plasmid purification and confirmation

pPICZaA plasmid was purified from transformed culture

with plasmid extraction kit (Fermentas, GeneJETTM Plas-

mid Miniprep Kit # K0502) and confirmed on gel with

specific band length.

Ligated hEGF gene confirmed on restriction site

digestion with EcoRI & NotI [29], PCR amplification,

sequencing and finally on expression study.

Table 1 Primers information

S.No. Primers Sequence Start (bp) Tm Size

1 External forward primer 50-TCACCTCAGGGAAGATGACC-30 3,199 60.05 20

2 External reverse primer 50-ATCCCATCCTCAGTGTCAGC-30 3,595 60.08 20

3 Internal forward primer 50-CAGGGAAGATGACCACCACT-30 3,205 59.96 20

4 Internal reverse primer 50-TGCGACTCCTCACATCTCTG-30 3,570 60.14 20

5 Cloning forward primer 50-AAGAATTCAATAGTGACTCTGAA-30 3,236 – 23

6 Cloning reverse primer 50-GCGCGGCCGCGCGCAGTTCCCACCA-30 3,395 – 25

GGGGAGCACAGCTGTGGAGAGAATGCCAGCTGCACAAATACAGAGGGAGGCTATACCTGCATGTGTGCTGGACGCCTGTCTGAA

CCAGGACTGATTTGCCCTGACTCTACTCCACCCCCTCACCTCAGGGAAGATGACCACCACTATTCCGTAAGAAATAGTGACTCTG

AATGTCCCCTGTCCCACGATGGGTACTGCCTCCATGATGGTGTGTGCATGTATATTGAAGCATTGGACAAGTATGCATGCAACTG

TGTTGTTGGCTACATCGGGGAGCGATGTCAGTACCGAGACCTGAAGTGGTGGGAACTGCGCCACGCTGGCCACGGGCAGCAGCA

GAAGGTCATCGTGGTGGCTGTCTGCGTGGTGGTGCTTGTCATGCTGCTCCTCCTGAGCCTGTGGGGGGCCCACTACTACAGGACT

CAGAAGCTGCTATCGAAAAACCCAAAGAATCCTTATGAGGAGTCGAGCAGAGATGTGAGGAGTCGCAGGCCTGCTGACACTGAG

GATGGGATGTCCTCTTGCCCTCAACCTTGGTTTGTGGTTATAAAAGAACACCA

1) EFP External Forward Primer 2) ERP External Reverse Primer 3) IFP Internal Forward Primer 4) IRP Internal Reverse Primer 5) CFP Cloning Forward Primer 6) CRP Cloning Reverse Primer

EFP

IFP CFP

CRP

IRP

ERP

5 -

- 3

Fig. 1 Diagrammatically presentation of three steps amplification and their primers binding sites in human EGF mRNA variant 3 (GenBank,

NCBI, ref/NM_001178131.1)

Mol Biol Rep (2014) 41:1445–1451 1447

123

DNA sequencing

DNA purification

Purified DNA followed a Shrimp alkaline phosphatase

(SAP) [30] and exonuclease I treatment [31] to removed

excess primers and dNTPs for sequencing PCR. The

Exonuclease I digested single stranded DNA into free

dNTPs and SAP removed the phosphate groups from

dNTPs to deactivate.

Sequencing reaction

Sequencing reaction is carried using sequencing kit pro-

tocol as described in BigDye� Terminator v3.1 cycle

Sequencing Kit and proceeded to the Automated DNA

Sequencer (Applied Biosystems 3730 DNA Analyzer).

Sequencing cycle consisted of an asymmetric amplification

of one strand of the DNA product.

All DNA sequences confirmed both in forward and

reverse direction by using Basic Local Alignment Search

Tool (BLAST) http://www.ncbi.nlm.nih.gov/blast.cgi).

Culturing of Pichia transformants

Pichia pastoris transformants obtained by electroporation

and were then selected on YPD medium (1 % yeast extract;

2 % bacto peptone; 2 % dextrose) followed vector manual

(InvitrogenTM). Transformants strains expressing hEGF

were grown in BMMY medium (1 % yeast extract; 1 %

methanol; 2 % bacto peptone; 100 mM potassium phos-

phate buffer of pH 6.0; 1.34 % YNB (yeast nitrogen base);

4 9 10–5 % biotin) in a 6 litre glass bioreactor at 30 �C

and aeration (0.1–1.0 vvm). The pH was maintained at 5.0

throughout fermentation process.

Biomass was measured as cell wet weight. The super-

natant was stored at -70 �C until needed for assays.

Expression study

The transformants of P. pastoris containing the integration

of the hEGF vector (pPICZaA—hEGF) in the genome

analyzed for hEGF expression. The cultured supernatants

from both transformed and untransformed strains were

analyzed by electrophoresis on a Tricine-SDS polyacryl-

amide gel (PAGE) gel. Western-blot analysis of the protein

performed according to standard procedure [32].

Proteins separated on a 15 % Tricine-SDS-PAGE gel

stained with Coomassie Brilliant Blue R250 and photo-

graphed. Protein electrophoresis identified the presence of

band, at about 6 kDa in the transformants, this roughly

showed standard hEGF. For further confirmation blotted

the gel onto the nitrocellulose membrane (cat. no. LC2000,

InvitrogenTM) using kit procedure. The blot was then

developed with the rabbit-anti-hEGF sera and mouse-anti-

rabbit immunoglobulin-G conjugated alkaline phosphatase.

Secretions of hEGF protein from the P. pastoris transfor-

mants assayed with an indirect enzyme-linked Immuno-

sorbent assay (ELISA).

Results

Huh-7 is a human hepatoma cell line that has numerous

uses [18–21]. In the current study we isolated Human EGF

gene from Huh-7 cell line followed by cDNA formation,

three steps PCR amplification of human EGF gene. Gene

sequencing was performed to verify the amplicon. More-

over the gene was cloned in pPICZaA and over- expressed

in P. pastoris.

Human EGF gene is 100 kb long coding gene, tran-

scription for 5,474 bases mRNA (NCBI, GenBank, Human

EGF mRNA variant 3, ref/NM_001178131.1). Which then

translated into 1,207 amino acid preproprotein and modi-

fied eventually into 53 amino acid mature single chain

polypeptide protein.

Total mRNA was isolated from Huh-7 cell line, reverse

transcribed into cDNA with oligo dT primer. A short

sequence of 560 bases of hEGF gene including mature

protein region was taken and designed three sets of primers

using Primer 3 software (http://frodo.wi.mit.edu/primer3/)

(Table 1; Fig. 1).

First amplification was performed from cDNA with

designed external primers set from 3,199 to 3,595 bp

(ref|NM_001178131.1) (Table 1; Fig. 1) and results for

expected amplicon size 396 bp checked by gel electro-

phoresis (Fig. 2).

The first PCR product was further amplified from 3,205

to 3,570 bp (365 bp) with internal primers for more spec-

ificity (Table 1; Fig. 1). Obligated amplicon size (365 bp)

checked by gel electrophoresis (Fig. 3). DNA fragment

Fig. 2 Gel electrophoresis for first round amplification, lane 1 shows

expected amplicon (396 bp), lane 2 is 100 bp DNA marker and lane 3

is negative control

1448 Mol Biol Rep (2014) 41:1445–1451

123

excised from gel and was purified. The sequencing was

carried out and sequencing results showed 100 % sequence

homology with wild-type human EGF gene sequence

(ref|NM_001178131.1|).

Second round amplicon further abridged (3,236–3,395 bp)

with specially designed cloning primers (Table 1; Fig. 1)

inherent with two restriction enzyme sites EcoRI and NotI

(GAATTC & GCGGCCGC respectively) for restriction site

digestion and appropriate cloning, Kex2 site, stop codon, AA

and GC regions were also incorporated for further expression

study in P. pastoris. Third round PCR product (Fig. 4) eluted

from gel and quantified by NanoDrop� (Spectrophotometer)

(ND-1000). Purified fragment was sequenced and found

required results (EMBL/EBI JQ346088).

Third round PCR product ligated in TA plasmid vector

(pCR� 2.1) (Fig. 5) by ligation reaction and transferred to

TOP10 competent cells. Extraction made for TA plasmid

and ligation results assured by excised fragment analysis

done by restriction site digestion with EcoRI/NotI,

sequencing and also by PCR amplification (Figs. 6, 7).

TA clone sequencing reaction was carried out with M13

primers as discussed above to confirm the sequence. Fur-

ther, we verified the active gene sequence homology with

BLAST, as the respective sequence is available at Gen-

Bank under the accession number (EMBL/EBI JQ346088).

Human EGF gene was ligated in pPICZaA plasmid by

ligation reaction and transferred to TOP10 competent cells

and P. pastoris (Fig. 8). Extraction made for pPICZaA

plasmid and ligation results assured by excised fragment

analysis done by restriction site digestion with EcoRI/NotI,

sequencing, PCR amplification and finally confirmed by

expression study.

pPICZaA plasmid has AOX1 promoter at 50 for tightly

regulation and methanol-induced expression of the gene of

interest [33]. As our cloned gene has a stop codon and

Fig. 3 Second round gel electrophoresis, lanes 1, 2, 3, 5, 6 and 7

show 365 bp amplicon size and lane 4 is 100 bp DNA marker

Fig. 4 Gel electrophoresis for third round PCR, lanes 3, 4, 5, 6 show

cloning amplicon (186 bp) lanes 1 and 2 indicate negative control and

100 bp DNA marker respectively

Fig. 5 TA clone restriction site digestion with EcoRI and NotI, lanes

1, 2 and 4 show excised fragments from TA plasmid (pCR� 2.1) and

lane 3 is 100 bp DNA marker

Fig. 6 PCR amplification of TA clone with cloning specific primers,

lanes 1 and 3 show amplified fragments (186 bp) and lane 2 is 100 bp

DNA marker

AAGAATTCAAAAGA Mature Human Epidermal Growth Factor TAAGCGGCCGCGC

Fig. 7 Cloning map of mature hEGF gene with inbuilt sites

(Restriction sites, Kex2 site, stop codon and AA/GC) into pCR�

2.1 (adopted from invitrogen, life technologies)

Mol Biol Rep (2014) 41:1445–1451 1449

123

Kex2 site for proper cleavage so protein expressed without

the C-terminal peptide and has native N-terminus.

Western blotting for the protein was carried out. Total

protein was separated on a 15 % Tricine-SDS-PAGE gel

stained with Coomassie Brilliant Blue R250 (Fig. 9) and

transferred to nitrocellulose membrane (cat. no. LC2000,

InvitrogenTM). Protein electrophoresis of the gel identified

the presence of band, at about 6 kDa in the transformants,

this correspond roughly to the standard hEGF (Fig. 9).

Blotted gel onto the nitrocellulose membrane hybridized

with anti-hEGF antibody showed the positive signals for the

standard hEGF while the minor bands of transformants fer-

mentative supernatant in the Tricine-SDS-PAGE gel did not

express a detectable hybridization with the antibody (Figure

not provided). Moreover, secretions of hEGF protein from

the P. pastoris transformants were detected with an indirect

enzyme-linked immunosorbent assay (Figure not provided).

Discussion

Human epidermal growth factor has importance in its

family as it regulates the growth of different cell types

in vivo as well as in vitro. Epidermal growth factor is in

high demand due to its frequent jobs and has been pro-

duced in various heterologous hosts like bacteria and yeast,

using recombinant DNA technology [33, 34].

Previous studies provided hEGF gene isolation, cloning

and expression where we find difficulties especially in gene

isolation. So our primary approach was to find out easy and

significant source for that particular gene of hEGF isolation.

Huh-7 cell line has used for different studies including mRNA

isolation for various genes cloning and expression [18–21].

Secondary approach was to find out an expression sys-

tem where our gene of interest manipulated and expressed

with highly native expression. P. pastoris is an alternative

expression system (InvitrogenTM) an easier, less expensive

and faster to use than other eukaryotic expression systems

such as mammalian tissue culture and baculovirus and

generally gives higher expression levels. As an eukaryote,

P. pastoris has many advantages of higher eukaryotic

expression systems such as protein processing, post trans-

lational modification and protein folding, while being as an

easy to manipulate. As P. pastoris is yeast, so it shares the

advantages of genetic and molecular manipulations with

Saccharomyces and has the added advantage of 10–100

fold higher heterologous protein expression levels. These

features make P. pastoris very useful as a protein expres-

sion system (InvitrogenTM).

In this study, hEGF partial gene is isolated from Huh-7 cell

line and amplified its mature coding part by three steps PCR

amplification which was subsequently cloned in P. pastoris

expression vector pPICZaA (InvitrogenTM).Three sets of

primers were designed for hEGF gene using Primer 3 soft-

ware. Extraction made for mRNA from Huh-7 cell line and

synthesized cDNA with oligo dT primer. First round amplified

396 bp fragment (3,199–3,595 bp) and was further modified

to 365 bp (3,205–3,570 bp). The 365 bp fragment abridged to

159 bp (3,236–3,395 bp) with specially designed cloning

primers inherited with two restriction enzyme sites (EcoRI

and NotI), Kex2 site, stop codon, AA and GC regions.

Alignment studies of the Huh-7 cell derived mature hEGF

with reported wild type showed 100 % homology.

Human EGF gene was cloned in expression vector,

pPICZaA plasmid and used in transformation of P. pas-

toris. Expression studies showed successful extracellular

expression of 6.2 kDa hEGF protein.

AAGAATTCAAAAGA Mature Human Epidermal Growth Factor TAAGCGGCCGCGC

A

Fig. 8 Cloning map of mature hEGF gene in pPICZ a A (adopted

from invitrogen, life technologies)

Fig. 9 15 % Tricine-SDS-PAGE (stained with coomassie blue)

analysis of extract taken from P. pastoris cultures expressing secreted

hEGF, lanes 1–3, samples from hEGF-expressing P. pastoris and lane

M, molecular weight marker (seeblue� Plus2, invitrogen, life

technologies)

1450 Mol Biol Rep (2014) 41:1445–1451

123

To our knowledge it is the first report of hEGF partial

mature gene from Huh-7 cell line and its expression in

P. pastoris.

Acknowledgments We thank to Molecular Medicine Lab (CEMB)

for providing Huh-7 cell line. Thanks to Ahmad Usman Zafar, Na-

deem Ahmad, Muhammad Islam Khan and Tayyab Hussnain for

thoughtful discussions and critical reading of the manuscript.

Conflict of interest The authors declare that they have no com-

peting interests.

References

1. Cohen S, Carpenter G (1975) Human epidermal growth factor:

isolation and chemical and biological properties. PNAS 72:

1317–1321

2. Fraser JK, Zhu M, Wulur I, Alfonso Z (2008) Adipose-derived

stem cells. Methods Mol Biol 449:59–67

3. Mark JK, Mourad M, Ole M, Walter P, Yong YW, Ronald EB,

Peter JH, Robert MH, Jorg H (2006) An unusual mode of con-

certed evolution of the EGF-TM7 receptor chimera EMR2.

FASEB J 20(14):2582

4. Engler DA, Hauser MR, Cook JS, Niyogi SK (1991) Aromaticity

at position 37 in human epidermal growth factor is not obligatory

for activity. Mol Cell Biol 11(5):2425

5. Graeme IB, Noel MF, Michelle MS, Mary AW, Daniel C, Lailing

K, Mickey SU, Leslie BR, Ray SP (1986) Human epidermal

growth factor precursor: cDNA sequence, expression in vitro and

gene organization. Nucleic Acids Res 14(21):8427–8446

6. Carpenter G, Cohen S (1979) Epidermal growth factor. Annu Rev

Biochem 48:193–216

7. Anna MW (2005) Prospects for developmental biology and cell

therapy. Physiol Rev 85:635–678

8. Strutz F, Michael Z, Fuad NZ, Chang-Qing Y, Raghu K, Gerhard AM,

Eric GN (2002) Role of basic fibroblast growth factor-2 in epithelial

mesenchymal transformation. Kidney Int 61(5):1714–1728

9. Schuldiner MO, Joseph IE, Douglas AM, Nissim B (2000)

Effects of eight growth factors on the differentiation of cells

derived from human embryonic stem cells. Proc Natl Acad Sci

97(21):11307–11312

10. Robert MC, Anthony JW, Martin B, Annalisa P, Michael JT, Lain

DC, Harry G, Brian S (1987) The solution structure of human

epidermal growth factor. Nature 327:339–341

11. Umeoka K, Naoko S, Kenichi O, Tahara S, Reiko K, Shoichiro I,

Manabu N, Takeshi W, Yoshiyuki OAT (2001) Immuno histo-

chemical analysis of RCAS1 in human pituitary adenomas. Mod

Pathol 14(12):1232–1236

12. Adams JC (2001) Review cell-matrix contact structures. Cell Mol

Life Sci 58(3):371–392

13. Chung KF (2001) Cytokines in chronic obstructive pulmonary

disease. Eur Respir J 18(34):50–59

14. Philip JA, Michael BC, Cherie MC, Kenneth H (2009) Method of

using cytokine assay to diagnose, treat and evaluate inflammatory

and autoimmune diseases. Google Patents

15. Mieko K, Shigeaki T (1989) Topographic analysis of human epi-

dermal growth factor by monospecific antibodies and synthetic

peptides. Oxford Journals. Life Sciences. J Biochem 106(1):87–89

16. Beat MS, Anna F, Eric F, Albert J (1994) Liver expression of

epidermal growth factor RNA. J Biol Chem 269(31):9667–9670

17. John S, Cook E, Ian F, Sally P, Roger D, Michael AW, Mike D,

David MJ, John FP, Thakor P, Hilary L, Leslie DB (1982)

Chemical synthesis and cloning of a gene for human urogastrone.

Nucleic Acids Res 10(15):4467–4482

18. Patil MA, Zhang J, Ho C, Cheung ST, Fan ST, Chen XP (2006)

Hedgehog signaling in human hepatocellular carcinoma. Cancer

Biol Ther 5(1):111–117

19. Brett DL, Matthew JE, Andrew JS, Benno W, Timothy LT,

Christopher CL, Toshiaki M, Richard OH, Dennis RB, Jane AM,

Charles MR (2005) Complete replication of hepatitis c virus in

cell culture. Science 309(5734):623–626

20. Takimoto R, Kato J, Terui T, Takada K, Kuroiwa G, Wu J,

Ohnuma H, Takahari D, Kobune M, Sato Y, Takayama T,

Matsunaga T, Niitsu Y (2005) Augmentation of antitumor effects

of p53 gene therapy. Cancer Biol Ther 4(4):421–428

21. Jie L, Lilianna S, Ruben MB, Jan N, Liping H, Natascha N,

Steven D, Liegang L, Ulrich S, Andreas KN (2012) Comparative

analysis of phase I and II enzyme activities in 5 hepatic cell lines

identifies Huh-7 and HCC-T cells with the highest potential to

study drug metabolism. Arch Toxicol 86(1):87–95

22. Bao-Zhu Y, Mark JM, Catherine LK, Drazen BZ, Snorri ST,

Nicholas CP (1998) Cloning, characterization and chromo-

somal localization of a gene frequently deleted in human liver

cancer (DLC-1) homologous to Rat RhoGAP. Cancer Res

58:2196

23. Tanabe KK, Lemoine A, Finkelstein DM, Kawasaki H, Fujii T,

Chung RT, Lauwers GY, Kulu Y, Muzikansky A, Kuruppu D,

Lanuti M, Goodwin JM, Azoulay D, Fuchs BC (2008) Epidermal

growth factor gene functional polymorphism and the risk of

hepatocellular carcinoma in patients with cirrhosis. JAMA

299(1):53–60

24. Chomczynski P, Mackey K (1995) Modification of the trizol

reagent procedure for isolation of RNA from polysaccharide and

proteoglycan-rich sources. Biotechniques 19(6):942–945

25. Steve R, Helen JS (2000) Primer 3, http://frodo.wi.mit.edu/pri

mer3/ Bioinformatics methods and protocols methods in molec-

ular biology, 365–386

26. Benson DA, Karsch-Mizrachi I, Clark K, Lipman DJ, Ostell J,

Sayers EW (2012) GenBank. Nucleic Acids Res 40:D48–D53

27. Sambrook J, Russell DW (2006) Preparation and transformation

of competent E. coli using calcium chloride. Cold Spring Harb

Protoc. doi:10.1101/3932

28. Baron M, Reynes JP, Stassi D, Tiraby G (1992) A selectable

bifunctional b galactosidase: phleomycin-resistance fusion pro-

tein as a potential marker for eukaryotic cells. Gene 114:239–243

29. Plyler TR, Vallejos CE (2000) Method for cloning restriction

fragments containing the termini of BAC Inserts. Biotechniques

28(5):1012–1016

30. Kerri AK, Helen SH, Douglas RD, Constance LC, Budowle B

(2002) An improved method for post-PCR purification for

mtDNA sequence analysis. J Forensic Sci 47(4):811–818

31. Watanabe K, Emoto N, Sunohara M, Kawakami M, Kage H,

Nagase T, Ohishi N, Takai D (2010) Treatment of PCR products

with exonuclease I and heat-labile alkaline phosphatase improves

the visibility of combined bisulfate restriction analysis. Biochem

Biophys Res Commun 399(3):422–424

32. Frederick MA, Roger B, Robert EK, David DM, Seidman JG,

John AS, Kevin S (1999) Short protocols in molecular biology,

4th edn. Wiley, New York

33. Takanori O, Shunji S, Ken-Ichi M, Toru F, Koji Y, Makari Y,

Gakuzo T, Tetsuo M (1985) Synthesis and secretion of human

epidermal growth factor by Escherichia coli. Proc NatI Acad Sci

82(21):7212–7216

34. John MC, Graham HC, Mickhael JP, Mark ER (1991) Secretion

of human epidermal growth factor from S. cerevisiae using

synthetic leader sequences. Gene 106(2):267–271

Mol Biol Rep (2014) 41:1445–1451 1451

123