Evolution Presented by: Mrs. Carmen Knopke FUHS Science Dept. Biology

EvolutionEvolution

Presented by:Presented by:

Mrs. Carmen KnopkeMrs. Carmen Knopke

FUHS Science Dept.FUHS Science Dept.

BiologyBiology

Major Concepts: ReviewMajor Concepts: Review Alleles - Alternate versions of a geneAlleles - Alternate versions of a gene Gene - A discrete unit of hereditary information consisting Gene - A discrete unit of hereditary information consisting

of a specific nucleotide sequence in DNA (or RNA, in some of a specific nucleotide sequence in DNA (or RNA, in some viruses).viruses).

Genotype - the genetic make-up of an organism.Genotype - the genetic make-up of an organism. Heterozygous - Having two different alleles for a given Heterozygous - Having two different alleles for a given

genetic character. genetic character. Homozygous - Having two identical alleles for a given trait.Homozygous - Having two identical alleles for a given trait. Locus - A particular place along the length of a certain Locus - A particular place along the length of a certain

chromosome where a given gene is located.chromosome where a given gene is located. Phenotype - The physical and physiological traits of an Phenotype - The physical and physiological traits of an

organism.organism.

EvolutionEvolution

What is it?What is it?

EvolutionEvolution

Simply stated, evolution Simply stated, evolution is a change in a lineage is a change in a lineage

of organisms through of organisms through time.time.

What was early Earth like? Some What was early Earth like? Some scientists suggest that it was probably scientists suggest that it was probably very hot. The energy from colliding very hot. The energy from colliding meteorites could have heated its meteorites could have heated its surface, while both the compression of surface, while both the compression of minerals and the decay of radioactive minerals and the decay of radioactive materials heated its interior.materials heated its interior.

Early History of EarthEarly History of Earth

Volcanoes might Volcanoes might have frequently have frequently spewed lava and spewed lava and gases, relieving gases, relieving some of the some of the pressure in Earth’s pressure in Earth’s hot interior. These hot interior. These gases helped form gases helped form Earth’s early Earth’s early atmosphere.atmosphere.

Early History of EarthEarly History of Earth

Evidence for EvolutionEvidence for Evolution

The Fossil RecordThe Fossil Record

Homologous StructuresHomologous Structures

Molecular EvidenceMolecular Evidence

About 95 percent of the species that About 95 percent of the species that have existed are extincthave existed are extinct——they no longer they no longer live on Earth.live on Earth.

Fossils-Clues to the pastFossils-Clues to the past

Among other techniques, scientists study Among other techniques, scientists study fossils to learn about ancient species.fossils to learn about ancient species.

A A fossilfossil is is evidence of evidence of an organism an organism that lived that lived long ago long ago that is that is preserved preserved in Earth’s in Earth’s rocks.rocks.

Fossils-Clues to the pastFossils-Clues to the pastTypes of Fossils

Fossils Types Formation

Trace fossils

Casts

Molds

Petrified/Permineralized

fossils

Amber-Preserved orfrozen fossils

A trace fossil is any indirect evidenceleft by an animal and may include afootprint, a trail, or a burrow.

When minerals in rocks fill a space left by a decayed organism, they makea replica, or cast, of the organism.

A mold forms when an organism isburied in sediment and then decays,leaving an empty space.

Petrified-minerals sometimes penetrateand replace the hard parts of an organism. Permineralized-void spacesin original organism infilled byminerals.At times, an entire organism was quickly trapped in ice or tree sap thathardened into amber.

Paleontologists, scientists who study Paleontologists, scientists who study ancient life, are like detectives who use ancient life, are like detectives who use fossils to understand events that fossils to understand events that happened long ago.happened long ago.

Paleontologists-Detectives to the pastPaleontologists-Detectives to the past

They use fossils to determine the kinds They use fossils to determine the kinds of organisms that lived during the past of organisms that lived during the past and sometimes to learn about their and sometimes to learn about their behavior.behavior.

Paleontologists also study fossils to gain Paleontologists also study fossils to gain knowledge about ancient climate and knowledge about ancient climate and geography.geography.

Paleontologists-Detectives to the pastPaleontologists-Detectives to the past

By studying the condition, position, and By studying the condition, position, and location of rocks and fossils, geologists location of rocks and fossils, geologists and paleontologists can make and paleontologists can make deductions about the geography of past deductions about the geography of past environments.environments.

For fossils to form, For fossils to form, organisms usually organisms usually have to be buried in have to be buried in mud, sand, or clay mud, sand, or clay soon after they die.soon after they die.

Fossil formationFossil formation

Most fossils are found in sedimentary rocks. Most fossils are found in sedimentary rocks. These rocks form at relatively low These rocks form at relatively low temperatures and pressures that may temperatures and pressures that may prevent damage to the organism.prevent damage to the organism.

Fossils are not usually found in other Fossils are not usually found in other types of rock because of the ways those types of rock because of the ways those rocks form. For example, the conditions rocks form. For example, the conditions under which metamorphic rocks form under which metamorphic rocks form often destroy any fossils that were in the often destroy any fossils that were in the original sedimentary rock.original sedimentary rock.

Fossil formationFossil formation

Few organisms become fossilized Few organisms become fossilized because, without burial, bacteria and because, without burial, bacteria and fungi immediately decompose their dead fungi immediately decompose their dead bodies. Occasionally, however, bodies. Occasionally, however, organisms do become fossils in a process organisms do become fossils in a process that usually takes many years.that usually takes many years.

The Fossilization ProcessThe Fossilization Process

The Fossilization ProcessThe Fossilization Process• A Protoceratops drinking at a river falls into the water and drowns• Sediments from upstream

rapidly cover the body, slowing its decomposition. Minerals from the sediments seep into the body.

• Over time, additional layers of sediment compress the sediments around the body, forming rock. Minerals eventually replace all the body’s bone material.

• Earth movements or erosion may expose the fossil millions of years after it formed.

Scientists use a variety of methods to Scientists use a variety of methods to determine the age of fossils. One method determine the age of fossils. One method is a technique called relative dating.is a technique called relative dating.

Relative datingRelative dating

If the rock If the rock layers have layers have not been not been disturbed, the disturbed, the layers at the layers at the surface must surface must be younger be younger than the than the deeper layers.deeper layers.

FossilsFossils

Although the fossil record provides Although the fossil record provides evidence that evolution occurred, the evidence that evolution occurred, the record is incomplete.record is incomplete.

Although paleontologists do not Although paleontologists do not have fossils for all the changes have fossils for all the changes that have occurred, they can still that have occurred, they can still understand the overall picture of understand the overall picture of how most groups evolved.how most groups evolved.

FossilsFossils

Fossils are found throughout the Fossils are found throughout the world.world.

As the fossil record becomes more As the fossil record becomes more complete, the sequences of evolution complete, the sequences of evolution become clearer.become clearer.

For example, you can see how For example, you can see how paleontologists have charted the paleontologists have charted the evolutionary path that led to today’s evolutionary path that led to today’s camel after piecing together fossil skulls, camel after piecing together fossil skulls, teeth, and limb bones.teeth, and limb bones.

FossilsFossilsCamel EvolutionCamel EvolutionAgeAge

OrganisOrganismm

Skull andSkull and teethteeth

Paleocene Paleocene 65 million 65 million years agoyears ago

Eocene Eocene 54 million 54 million years agoyears ago

Oligocene Oligocene 33 million 33 million years agoyears ago

LimbLimb bonesbones

Miocene Miocene 23 million 23 million years agoyears ago

Present Present

FossilsFossils Fossils are an important source of Fossils are an important source of

evolutionary evidence because they evolutionary evidence because they provide a record of early life and provide a record of early life and evolutionary history.evolutionary history.


The fossils in the top layer must also be The fossils in the top layer must also be younger than those in deeper layers.younger than those in deeper layers.

Relative datingRelative dating

Using this principle, scientists can Using this principle, scientists can determine relative age and the order of determine relative age and the order of appearance of the species that are appearance of the species that are preserved as fossils in the layers.preserved as fossils in the layers.

Scientists try Scientists try to determine to determine the the approximate approximate ages of rocks ages of rocks by comparing by comparing the amount of the amount of a radioactive a radioactive isotope and isotope and the new the new isotope into isotope into which it which it decays.decays.

Radiometric datingRadiometric dating





Evidence for Evolution, cont’dEvidence for Evolution, cont’d

Homologous StructuresHomologous Structures Teach us that evolution works primarily by modifying Teach us that evolution works primarily by modifying

PREEXISTING structuresPREEXISTING structures

In the same light, as organisms “lose” structures (hind In the same light, as organisms “lose” structures (hind limbs in marine mammals), often have remnant of limbs in marine mammals), often have remnant of those structuresthose structures

Are often “nested”Are often “nested”More common in closely related organismsMore common in closely related organisms


Structures arising Structures arising from the same from the same embryonic embryonic structuresstructures Human arms and Human arms and

Whales “pectoral” Whales “pectoral” flippersflippers

NOT Bird and Insect NOT Bird and Insect wingswings

AnatomyAnatomy Structural features with a common Structural features with a common

evolutionary origin are called evolutionary origin are called homologous homologous structuresstructures..

Homologous Homologous structures can be structures can be similar in similar in arrangement, in arrangement, in function, or in both.function, or in both.

Whale Whale forelimbforelimb

CrocodileCrocodileforelimbforelimb

BirdBirdwingwing

AnatomyAnatomy

The body parts of organisms that do not The body parts of organisms that do not have a common evolutionary origin but have a common evolutionary origin but are similar in function are called are similar in function are called analogous analogous structuresstructures..

Although analogous structures don’t shed Although analogous structures don’t shed light on evolutionary relationships, they do light on evolutionary relationships, they do provide evidence of evolution.provide evidence of evolution.

AnatomyAnatomy For example, insect and bird wings For example, insect and bird wings

probably evolved separately when their probably evolved separately when their different ancestors adapted independently different ancestors adapted independently to similar ways of life.to similar ways of life.

The fangs of these organisms are analogous structures. They share the same function in each organism, to deliver venom, but the organisms do not share a common evolutionary origin.

Another type of body feature that Another type of body feature that suggests an evolutionary relationship is a suggests an evolutionary relationship is a vestigial structurevestigial structure—a body structure in a —a body structure in a present-day organism that no longer present-day organism that no longer serves its original purpose, but was serves its original purpose, but was probably useful to an ancestor.probably useful to an ancestor.

A structure becomes vestigial when the A structure becomes vestigial when the species no longer needs the feature for its species no longer needs the feature for its original function, yet it is still inherited as original function, yet it is still inherited as part of the body plan for the speciespart of the body plan for the species

AnatomyAnatomy

Many organisms have vestigial structures.Many organisms have vestigial structures.

Vestigial structures, Vestigial structures, such as pelvic such as pelvic bones in the baleen bones in the baleen whale, are evidence whale, are evidence of evolution of evolution because they show because they show structural change structural change over time.over time.

AnatomyAnatomy

An An embryoembryo is the earliest stage of growth is the earliest stage of growth and development of both plants and and development of both plants and animals.animals.

The embryos of a fish, a reptile, a bird, and The embryos of a fish, a reptile, a bird, and a mammal have a tail and pharyngeal a mammal have a tail and pharyngeal pouches.pouches.

FishFish ReptileReptile BirdBird MammalMammal

PharyngeaPharyngeall

pouchespouches


pouchespouches

TailTail TailTail

EmbryologyEmbryology

It is the shared features in the young It is the shared features in the young embryos that suggest evolution from a embryos that suggest evolution from a distant, common ancestor.distant, common ancestor.

FishFish ReptileReptile BirdBird MammalMammal


pouchespouches


pouchespouches

TailTail TailTail

EmbryologyEmbryology





BiochemistryBiochemistry

Biochemistry also provides strong Biochemistry also provides strong evidence for evolution.evidence for evolution.

Nearly all organisms share DNA, ATP, Nearly all organisms share DNA, ATP, and many enzymes among their and many enzymes among their biochemical molecules.biochemical molecules.


One enzyme, cytochrome c, occurs in One enzyme, cytochrome c, occurs in organisms as diverse as bacteria and organisms as diverse as bacteria and bison.bison.

Biologists compared the differences Biologists compared the differences that exist among species in the amino that exist among species in the amino acid sequence of cytochrome c.acid sequence of cytochrome c.

The data show the number of amino The data show the number of amino acid substitutions in the amino acid acid substitutions in the amino acid sequences for the different organisms.sequences for the different organisms.

Biochemical Similarities of OrganismsBiochemical Similarities of Organisms

Comparison of OrganismsComparison of OrganismsPercent Substitutions Percent Substitutions

of Amino Acids in of Amino Acids in Cytochrome c ResiduesCytochrome c Residues

Two orders of mammalsTwo orders of mammals

Birds vs. mammalsBirds vs. mammals

Amphibians vs. birdsAmphibians vs. birds

Fish vs. land vertebratesFish vs. land vertebrates

Insects vs. vertebratesInsects vs. vertebrates

Algae vs. animalsAlgae vs. animals

5 and 105 and 10

8-128-12

14-1814-18

18-2218-22

27-3427-34

5757


Organisms that are biochemically Organisms that are biochemically similar have fewer differences in their similar have fewer differences in their amino acid sequences.amino acid sequences.

Biochemical Similarities of OrganismsBiochemical Similarities of Organisms

Comparison of OrganismsComparison of OrganismsPercent Substitutions Percent Substitutions

of Amino Acids in of Amino Acids in Cytochrome c ResiduesCytochrome c Residues

Two orders of mammalsTwo orders of mammals

Birds vs. mammalsBirds vs. mammals

Amphibians vs. birdsAmphibians vs. birds

Fish vs. land vertebratesFish vs. land vertebrates

Insects vs. vertebratesInsects vs. vertebrates

Algae vs. animalsAlgae vs. animals

5 and 105 and 10

8-128-12

14-1814-18

18-2218-22

27-3427-34

5757


Since Darwin’s time, scientists have Since Darwin’s time, scientists have constructed evolutionary diagrams that constructed evolutionary diagrams that show levels of relationships among show levels of relationships among species.species.

In the 1970s, some biologists began In the 1970s, some biologists began to use RNA and DNA nucleotide to use RNA and DNA nucleotide sequences to construct evolutionary sequences to construct evolutionary diagrams.diagrams.



Today, scientists combine data from Today, scientists combine data from fossils, comparative anatomy, embryology, fossils, comparative anatomy, embryology, and biochemistry in order to interpret the and biochemistry in order to interpret the evolutionary relationships among species.evolutionary relationships among species.



Genetic VariationGenetic Variation

Causes of Genetic Variation Causes of Genetic Variation in a Populationin a Population

RecombinationRecombination

Gene FlowGene Flow

Genetic DriftGenetic Drift

MutationsMutations



Gene FlowGene Flow


MutationsMutations

Gene FlowGene Flow

The loss or gain of alleles in a The loss or gain of alleles in a population due to the migration of population due to the migration of fertile individuals or gametes fertile individuals or gametes between populations.between populations. If too much gene flow, populations If too much gene flow, populations

become homogeneousbecome homogeneous

Gene FlowGene Flow

10 Red : 0 White6 Red : 4 White6 Red : 4 White

Gene FlowGene Flow

10 Red : 2 White10 Red : 0 White10 Red : 0 White



Gene FlowGene Flow


MutationsMutations


Changes in the gene pool of a small Changes in the gene pool of a small population due to chance. population due to chance.

Important to small populations.Important to small populations.The Founder EffectThe Founder Effect

New colony being populated by a few New colony being populated by a few individualsindividuals

Important on islandsImportant on islands

The BottleneckThe Bottleneck Diseases or other catastrophes cause the Diseases or other catastrophes cause the

population to dramatically decrease in population to dramatically decrease in numbersnumbers



A change in a population’s allele A change in a population’s allele frequency due to chance. Important frequency due to chance. Important to small populations.to small populations.The Founder EffectThe Founder Effect

New colony being populated by a few New colony being populated by a few individualsindividuals

Important on islandsImportant on islands

The BottleneckThe Bottleneck Natural catastrophes cause the population Natural catastrophes cause the population

to dramatically decrease in numbersto dramatically decrease in numbers

The BottleneckThe Bottleneck


Flood kills Flood kills most of most of the the individualsindividuals




Gene FlowGene Flow


MutationsMutations

MutationsMutations

Mutations:Mutations: Any change in the genetic Any change in the genetic

sequence of DNAsequence of DNA

Most Mutations are NeutralMost Mutations are NeutralReplicational repair Replicational repair Redundancy in genetic codeRedundancy in genetic codeIntron/Exon formation in mRNAIntron/Exon formation in mRNAMasked by dominant geneMasked by dominant gene

On average, mutations occur 1 out of a On average, mutations occur 1 out of a billion base pairs; thus we carry 3 billion base pairs; thus we carry 3 mutations in our genetic codemutations in our genetic code




Genetic RedundancyGenetic Redundancy

Genetic RedundancyGenetic Redundancy

MetSerValStopMetSerValStop

AUGUCAGUUUAGAUGUCAGUUUAG

MutationsMutations

AUGUCAGUAUGUCAGUAAUAUAAA

MetSerValStopMetSerValStop




Introns/ExonsIntrons/Exons




Dominant Masks RecessiveDominant Masks Recessive

A - flower opens up at A - flower opens up at noonnoon

a - flower opens up at a - flower opens up at 11:00 AM11:00 AM

““aa11” mutation causes the ” mutation causes the flower to open up at flower to open up at nightnight

AA - opens up at noonAA - opens up at noonAa - opens up at noonAa - opens up at noonAaAa1 1 - opens up at noon- opens up at noon

Sickle-cell AnemiaSickle-cell Anemia First described by a Chicago First described by a Chicago

MD in the early 1900’s.MD in the early 1900’s. Caused by a Caused by a SINGLESINGLE

mutation (change second mutation (change second base of the codon from uracil base of the codon from uracil to adenine – from valine to to adenine – from valine to glutamate) at the sixth glutamate) at the sixth position of the beta chain.position of the beta chain.

Causes the hemoglobin Causes the hemoglobin molecule to lose their molecule to lose their flexibility and become rigid.flexibility and become rigid.

Under low oxygen condition, Under low oxygen condition, the RBC will become sickle in the RBC will become sickle in shape.shape.

These sickled RBC are then These sickled RBC are then destroyed.destroyed.

Sickle-cell AnemiaSickle-cell Anemia A recessive gene that A recessive gene that

follows “Mendelian follows “Mendelian Inheritance”.Inheritance”.

Homozygous recessive Homozygous recessive condition is “Sickle-cell condition is “Sickle-cell Anemia” with only a Anemia” with only a 20% chance of 20% chance of surviving to puberty.surviving to puberty.

Heterozygous condition Heterozygous condition is “Sicklemia” and is “Sicklemia” and individuals will only individuals will only become ill under become ill under extreme conditions, e.g. extreme conditions, e.g. high altitudes, exertion.high altitudes, exertion.

Humans Impact on Natural Humans Impact on Natural SelectionSelection

Pesticide usePesticide use

Industrial MelanismIndustrial Melanism

From Ricklefs, R.E. 2001. The Economy of Nature. W.H. Freeman. New York.

From Ricklefs, R.E. 2001. The Economy of Nature. W.H. Freeman. New From Ricklefs, R.E. 2001. The Economy of Nature. W.H. Freeman. New York.York.

What is a Species?What is a Species?

Biological (Isolation) Species ConceptBiological (Isolation) Species Concept

Group of interbreeding organisms Group of interbreeding organisms (whether actually or potentially) producing (whether actually or potentially) producing fertile offspring that are reproductively fertile offspring that are reproductively isolated from other such groups (Mayr, isolated from other such groups (Mayr, Dobzansky, Harrison).Dobzansky, Harrison).

What is a Species?What is a Species?

Evolutionary (Phylogenetic) Evolutionary (Phylogenetic) Species ConceptSpecies Concept

A single lineage of ancestral-descendant A single lineage of ancestral-descendant populations (monophyletic group) that populations (monophyletic group) that maintains its identity from other such maintains its identity from other such lineages and that has its own lineages and that has its own evolutionary tendencies and historical evolutionary tendencies and historical fate evolving separately from others fate evolving separately from others and with its own unitary evolutionary and with its own unitary evolutionary role and tendencies (Cracraft, Simpson).role and tendencies (Cracraft, Simpson).

Modes of SpeciationModes of Speciation

Allopatric - populations Allopatric - populations geographically separatedgeographically separated

Sympatric - populations occur Sympatric - populations occur togethertogether

Parapatric – populations at the Parapatric – populations at the peripheryperiphery

Allopatric SpeciationAllopatric Speciation


The Evolution of SpeciesThe Evolution of Species

• When geographic isolation divides a population of tree frogs, the individuals no longer mate across populations.

• Tree frogs are a single population.


• The formation of a river may divide the frogs into two populations.


• Over time, the divided populations may become two species that may no longer interbreed, even if reunited.

Geographic isolation has helped to keep the islands’ species unique.

Sympatric SpeciationSympatric Speciation

Rhagoletis pomonellaRhagoletis pomonella Prior to 1864 fed on Prior to 1864 fed on

Hawthorn fruitsHawthorn fruits In 1864 apples were In 1864 apples were

introduced introduced In 1960 cherry trees In 1960 cherry trees

were introducedwere introduced Single mutation alters Single mutation alters

the host choice by the host choice by femalesfemales

Second mutation Second mutation required for larvae to required for larvae to survive on new hostsurvive on new host

Sympatric SpeciationSympatric SpeciationPolyploidyPolyploidy

Parapatric SpeciationParapatric Speciation


What happens when 2 “new” What happens when 2 “new” species come in contact species come in contact

again?again? Post-zygotic BarriersPost-zygotic Barriers

Pre-zygotic BarriersPre-zygotic Barriers

Which ones happen are a function of timeWhich ones happen are a function of time

Once these types of barriers are in place, Once these types of barriers are in place, two species can overlap in space, and two species can overlap in space, and remain true biological speciesremain true biological species

Post-zygotic barriersPost-zygotic barriers

Hybrid sterility - hybrids can't Hybrid sterility - hybrids can't produce functional gametes produce functional gametes

Hybrid Hybrid breakdownbreakdown - hybrids - hybrids never reach sexual maturity. never reach sexual maturity.

Hybrid Hybrid inviabilityinviability - offspring - offspring of hybrids are inviable.of hybrids are inviable.

Time Time IncreasingIncreasing

Pre-zygotic BarriersPre-zygotic Barriers

Gametic isolation - gametes Gametic isolation - gametes fail to unitefail to unite

Structural isolation - mating is Structural isolation - mating is physically impossiblephysically impossible

Behavioral isolation - mates Behavioral isolation - mates recognize species specific recognize species specific sexual signalssexual signals

Temporal isolation - mating Temporal isolation - mating occurs at different times. occurs at different times.

Habitat isolation - mating Habitat isolation - mating occurs in different places occurs in different places

Time Time IncreasingIncreasing

Rates of SpeciationRates of Speciation

GradualismGradualismSpeciation events happen over long Speciation events happen over long

periods of timeperiods of timePunctuated EquilibriumPunctuated Equilibrium

Speciation events happen very quickly Speciation events happen very quickly and over short periods of timeand over short periods of time

An individual cannot evolve a new phenotype (in this case, changing the color of its fur) within its lifetime in response to its environment.

Rates of Speciation – African Rates of Speciation – African Rift Valley LakesRift Valley Lakes

Over 700 species in one Over 700 species in one family of fishes (Cichlidae)family of fishes (Cichlidae)

Speciation occurred within Speciation occurred within the last 10,000 yearsthe last 10,000 years

Documents

Evolution Presented by: Mrs. Carmen Knopke FUHS Science Dept. Biology