The Veterinary Journal 191 (2012) 108–114

Contents lists available at ScienceDirect

The Veterinary Journal

journal homepage: www.elsevier .com/ locate / tv j l

Evaluation of the prognostic significance of BCL6 gene expression in caninehigh-grade B-cell lymphoma

Masahiko Sato a, Hideyuki Kanemoto a, Yumiko Kagawa b, Tetsuya Kobayashi c, Yuko Goto-Koshino a,Hiroyuki Mochizuki a, Masashi Takahashi a, Yasuhito Fujino a, Koichi Ohno a, Hajime Tsujimoto a,⇑a Department of Veterinary Internal Medicine, Graduate School of Agricultural and Life Science, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japanb North LaB, 2-10 Atsubetsu-Nishi2-4, Atsubetsu-ku, Sapporo 004-0062, Japanc Japan Small Animal Cancer Center, 2-27-4 Nakatomi-Minami, Tokorozawa, Saitama 359-0003, Japan

a r t i c l e i n f o a b s t r a c t

Article history:Accepted 6 December 2010

Keywords:DogLymphomaBCL6Diffuse large B-cell lymphomaOncology

1090-0233/$ - see front matter � 2010 Elsevier Ltd. Adoi:10.1016/j.tvjl.2010.12.006

⇑ Corresponding author. Tel.: +81 3 5841 5403.E-mail address: atsuji@mail.ecc.u-tokyo.ac.jp (H. T

The clinical usefulness of BCL6 gene expression was evaluated as a prognostic indicator in dogs with high-grade B-cell lymphoma. Forty-four dogs were diagnosed with centroblastic or B-cell immunoblastic typelymphoma according to the updated Kiel classification. BCL6 mRNA expression was measured by real-time PCR and its relationship with prognosis was analyzed. Progression-free and overall survival wasnot significantly different between the high BCL6 expression group (higher than the median) and thelow BCL6 expression group (lower than the median) (P = 0.99 and P = 0.61, respectively). No correlationbetween BCL6 and prognosis was observed in this study, which is inconsistent with findings reportedfor human diffuse large B-cell lymphoma.

BCL6 protein expression was not detected in the 11 dogs evaluated by immunohistochemistry. Further-more, BCL6 protein expression was assessed in 13 archived paraffin-embedded high-grade canine lym-phoma tissues and all were also negative. The results suggest that most canine high-grade B-celllymphomas correspond to human diffuse large B-cell lymphoma with no immunohistochemical expres-sion of BCL6.

� 2010 Elsevier Ltd. All rights reserved.

Introduction

Lymphoma is one of the most common malignant tumors indogs accounting for 7–24% of all canine neoplasms and approxi-mately 83% of all hematopoietic tumors (Kaiser, 1981; Jacobset al., 2002). Since canine lymphoma bears many similarities to hu-man non-Hodgkin’s lymphoma (NHL), it is an attractive model forhuman studies (Jamadar-Shroff et al., 2009; Vail et al., 2009).

According to the World Health Organization (WHO) classifica-tion, the most common type of human NHL is diffuse large B-celllymphoma (DLBCL), which accounts for 30–40% of adult NHLs(Jaffe, 1998). Although DLBCL falls within a single classification, itencompasses heterogeneous clinical and molecular geneticfeatures (Harris et al., 1994). Gene expression profiling data iden-tified two molecularly distinct forms of DLBCL: germinal center-like DLBCL, which is characterized by the expression of genesnormally expressed in germinal center (GC) B cells (GCB-like),and activated B-cell-like (ABC-like) DLBCL, which is characterizedby the expression of genes normally induced during in vitro activa-tion of B cells (Alizadeh et al., 2000). Moreover, GCB-like DLBCL has

ll rights reserved.

sujimoto).

significantly better overall survival (OS) rates than ABC-like DLBCL(Alizadeh et al., 2000).

The BCL6 gene encodes a 95-kD nuclear sequence-specific tran-scriptional repressor (Deweindt et al., 1995; Chang et al., 1996;Seyfert et al., 1996). BCL6 is expressed by GC B cells, where it neg-atively regulates plasma cell differentiation and is essential for GCformation (Reljic et al., 2000; Schebesta et al., 2002). Therefore,BCL6 expression is considered to be one of the hallmarks of GCB-like DLBCL. Furthermore, BCL6 expression has been reported tostrongly predict survival in patients with DLBCL (Lossos et al.,2001). Since BCL6 negatively regulates NF-jB activation (Perez-Rosado et al., 2008), it is conceivable that anti-apoptotic effectsin lymphoma cells, caused by NF-jB activation, might be sup-pressed by BCL6; this would be one of the reasons for the betterprognosis of GCB-like DLBCL.

Similar to human pathology, several classification systems fordomestic animal lymphoid tumors have been developed duringthe last few decades. The Kiel classification and its updated versionbased on immunocytological criteria can be applied to samples col-lected by fine needle aspiration (FNA) (Fournel-Fleury et al., 1997).There are some correlations between the updated Kiel and WHOclassifications (Uppenkamp and Feller, 2002; Ponce et al., 2010;Vezzali et al., 2010). Centroblastic and B-cell immunoblastic type

Table 1Sequences of primers and probes used for real-time PCR to detect BCL6 and RPL13A mRNA expression.

Gene Accession number Forward primer (50–30) Reverse primer (50–30) Probe (FAM 50–30 TAMRA)

BCL6 HM008708 CCGGCACCTT CGTGCTTCT TGCATTTCCGTCCAGACTCTGA GGCGCAAGT ACAAAAGCCAGC

RPL13A AJ388525 GCCGGAAGG GGAGGAAGG TGTGAAGGCATCTTGTAGTCGT CCAGGTAATTC AACATTTCTGGCA

Table 2Characteristics of the 13 archived DLBCL samples evaluated for BCL6 expression byimmunohistochemistry.

Breed Sampleacquisition

Biopsy site (lymphnode)

Previoustreatment

Bernese Mountaindog

Surgical Popliteal No

Chihuahua Tru-cut Mandibular NoGolden Retriever Tru-cut Cervical NoMaltese Tru-cut Cervical NoMix Surgical Mandibular NoMix Tru-cut Inguinal NoMix Surgical Popliteal NoShetland Sheepdog Surgical Popliteal NoShih Tzu Surgical Popliteal Yesa

Welsh Corgi Surgical Popliteal NoWelsh Corgi Tru-cut Cervical NoWelsh Corgi Tru-cut Cervical NoWest Highland White

terrierSurgical Cervical Yesb

a Biopsy was conducted at relapse after complete remission was achieved bychemotherapy.

b Biopsy was conducted during a partial remission phase achieved bychemotherapy.

M. Sato et al. / The Veterinary Journal 191 (2012) 108–114 109

lymphomas according to the updated Kiel classification—the mostcommon types of canine lymphoma (Fournel-Fleury et al., 1997)—are basically identical to DLBCL according to the WHO classifica-tion (Uppenkamp and Feller, 2002; Ponce et al., 2010; Vezzaliet al., 2010).

Several prognostic factors have been reported in canine lym-phoma, including gender (MacEwen et al., 1987), bodyweight (Garrettet al., 2002), presence of anemia (Miller et al., 2009), clinical stage(Hosoya et al., 2007), sub-stage (Greenlee et al., 1990; Garrett et al.,2002), and immunophenotype (Greenlee et al., 1990). However, agood understanding of tumor cell biology to elucidate the underlyingcause of a poorer prognosis in canine lymphoma is still lacking.

Although most of the canine high-grade B-cell lymphomas havebeen considered to correspond to DLBCL in humans, there has beenno report on molecular prognostic factors in canine lymphoma. Thepresent study aimed to address whether BCL6 expression was cor-related with prognosis in canine high-grade B-cell lymphoma.Since we do not usually carry out surgical resection of lymph nodes

Table 3Characteristics of the 44 dogs with high-grade B-cell lymphoma enrolled in this study.

Dogs with high-grade B-cell lymphoma (n = 44)Breed 19 breeds: Welsh Corgi (8), Golden Retriever (7), Miniature Dac

Bernese Mountain dog (2), Pug (2), Shetland Sheepdog (1), ScotSheepdog (1), Yorkshire terrier (1), Bulldog (1), Standard Poodle

Age 2–14 years (median: 8 years)Bodyweight 3.0–36.3 kg (median: 12.4 kg)Gender Male: 24 (8 were castrated), Female: 20 (14 were spayed)Clinical stage (II) 1 (2%), (III) 7 (16%), (IV) 23 (52%), (V) 13 (30%)Clinical sub-stage (a) 21 (48%), (b) 23 (52%)Prior prednisolone 3 dogs (7%), prednisolone (0.2–0.5 mg/kg) was administered for

in dogs with high-grade lymphoma, BCL6 gene expression levelwas measured by quantitative real-time PCR in cytology samplesdiagnosed with high-grade B-cell lymphoma according to the up-dated Kiel classification (Fournel-Fleury et al., 1997) and PCR forantigen receptor gene rearrangement (Burnett et al., 2003; Tamuraet al., 2006). In addition, immunohistochemical detection of BCL6was carried out in tissue samples classified into DLBCL accordingto the WHO classification (Valli et al., 2002).

Materials and methods

Normal canine lymph nodes

Two adult healthy Beagles were euthanased for reasons unrelated to this study.Two mesenteric lymph nodes from each dog were obtained right after euthanasia.This procedure was conducted in accordance with the guidelines of the Animal CareCommittee of the Graduate School of Agricultural and Life Sciences, the Universityof Tokyo (approval number 1818S0007).

Lymphoma cases

Previously untreated dogs with high-grade B-cell lymphoma (except for lowdose prednisolone), including both centroblastic and immunoblastic types accord-ing to the updated Kiel classification were included. The other inclusion criteriawere as follows: (1) multicentric anatomic form of the lymphoma and (2) the useof CHOP (vincristine, cyclophosphamide, doxorubicin, and prednisolone)-basedchemotherapy for treatment.

B-cell type was confirmed by the presence of clonal immunoglobulin heavychain (IgH) gene rearrangement, and lymphocyte lineage marker expression wasconfirmed by flow cytometry. Rearrangement of the IgH gene was detected byPCR using primers as previously described (Burnett et al., 2003; Tamura et al.,2006).

Flow cytometric analysis was performed using the following monoclonal anti-bodies: CD3-biotin (clone CA17.2A12, Leukocyte Antigen Biology Laboratory),CD79a-Phycoerythrin (PE) (clone HM57, Dako), and CD21-PE (clone MCA1781PE,Serotec). All antibodies were previously titered to define correct working dilutions.Isotype-matched controls were included for each labeling. Cells were incubatedwith biotin-conjugated mouse anti-canine CD3 monoclonal antibody followed bystreptavidin-PerCP-Cy 5.5 conjugate (eBioscience Inc). For CD79a, a staining kit(BD Cytofix/Cytoperm, BD bioscience) was used according to the manufacturer’sprotocol. Analysis was performed using a flow cytometer and its software (BD FAC-SCuliber, BD bioscience). B-cell immunophenotype was determined as CD79a+ orCD21+, and CD3�.

Both the PCR and flow cytometric analyses for identification of B-cell lineagewere performed in 11 dogs. Since the results of the PCR completely agreed withthe results of the flow cytometric analysis, the B-cell lineage in the other dogs asidentified by the presence of clonal IgH gene rearrangement using PCR.

hshund (4), Miniature Schnauzer (4), Shih Tzu (3), Shiba (2), Border Collie (2),ish terrier (1), Maltese (1), Australian Kelpie (1), Beagle (1), Polish Lowland

(1), Mix breed (1).

2–7 days prior to diagnosis

Fig. 1. BCL6 mRNA expression. BCL6 mRNA was evaluated in two normal caninelymph nodes and 44 high-grade B-cell lymphomas.

Table 4Comparison of characteristics between high and low BCL6 mRNA groups.

Variable High BCL6 (n = 22) Low BCL6 (n = 22) P

Gendera 0.36Male 14 (63.6%) 10 (45.5%)Female 8 (36.4%) 12 (54.5%)Clinical stage Va 7 (31.8%) 6 (27.3%) 0.74Clinical sub-stage ba 12 (54.5%) 11 (50.0%) 0.76Anemiaa 4 (18.1%) 3 (13.6%) 0.68CR ratea 21 (95.5%) 20 (90.9%) 0.55Age (95% CI)b 8 (6–10) 8 (7–10) 0.67Bodyweight (95% CI)b 13.8 (9.7–17.9) 17.4 (11.8–24.8) 0.25

a Gender, clinical stage V, clinical sub-stage b, anemia (PCV < 35%), and CR raterepresented by the number of dogs and percentage value.

b Age (years) and bodyweight (kg) represented by the median and 95% CI.

Fig. 2. (A) Kaplan–Meier curve of progression-free survival (PFS) for lymphoma dogs wsignificant difference in PFS was observed between the two groups (P = 0.99). (B) Kaplan–and low (dotted line: n = 22) BCL6 mRNA expression. No significant difference in OS wa

Fig. 3. The percentage of lymphoma cells in lymph node FNA samples. Nosignificant difference was observed between the high (n = 8, median = 90.2) andlow (n = 12, median = 90.9) BCL6 mRNA group.

110 M. Sato et al. / The Veterinary Journal 191 (2012) 108–114

Clinical staging was determined as follows: stage I, involvement limited a singlenode; stage II, involvement of many lymph nodes in a regional area; stage III, gen-eralized lymph node involvement; stage IV, liver and/or spleen involvement (sug-gested by imaging test and/or cytology); stage V, manifestation in the blood and/or bone marrow. Response evaluation criteria for peripheral nodal lymphoma indogs (Vail et al., 2010) were used to evaluate response to therapy.

Real-time PCR measurement of BCL6 mRNA expression in lymphomas

Lymph node FNA samples were collected in RNAlater (Ambion). All FNAs wereconducted thrice from a single lymph node with the largest diameter. Samples werestored at �80 �C. Total RNA was isolated using a commercial available kit (RNAqu-eous, Ambion) and treated with a DNA-free kit (DNase I, Invitrogen). Reverse tran-scription was performed using 500 ng of RNA with a cDNA synthesis kit(PrimeScript RT-PCR Kit, Takara). BCL6 mRNA expression and the expression ofthree endogenous control genes (GAPDH, TBP, and RPL13A) was measured by real-time PCR using TaqMan technology.

Primers and probes for control genes were designed according to a previous re-port (Peters et al., 2007). Primers were designed to hybridize sequences at the junc-tions between two exons to avoid amplification of genomic DNA. For the BCL6 gene,

ith high (solid line, n = 22) and low (dotted line, n = 22) BCL6 mRNA expression. NoMeier curve of overall survival (OS) for lymphoma dogs with high (solid line, n = 22)s observed between the two groups (P = 0.61).

M. Sato et al. / The Veterinary Journal 191 (2012) 108–114 111

TaqMan probes were designed on the basis of the BCL6 cDNA sequence (GenBankaccession number: HM_008708) with Primer Express software program version2.0 (Applied Biosystems). The geNorm software (Vandesompele et al., 2002) wasused to select RPL13A as a reference gene in this study. The primers and probesfor BCL6 and RPL13A are listed in Table 1.

The PCR mixture (25 lL) contained HotStarTaq Master Mix (QIAGEN), 100 nM ofthe probe, 200 nM of forward and reverse primers, and 4 lL cDNA. After HotStarTaqactivation at 95 �C for 10 min, the cDNA samples were subjected to 40 cycles ofdenaturation at 95 �C for 15 s, and annealing/extension at 60 �C for 1 min. In orderto calibrate and generate the standard curve, cDNA derived from a normal caninelymph node was used. Samples were measured in triplicate.

Reproducibility of the quantitation method was examined by comparing resultsobtained from replicate samples during the same reaction run (intra-run variabil-ity) and for different reaction runs (inter-run variability). Intra-run variability anal-ysis was performed on 5-fold dilutions of cDNA obtained from a normal caninelymph node. For this experiment, six replicates for each dilution of cDNA wereamplified. Inter-run variability was assessed using three replicates of cDNA on fourseparate reaction runs. BCL6 mRNA expression in normal canine lymph node cDNAwas also evaluated.

Percentage of tumor cells in lymph node FNA samples determined by real-time PCR

Since lymph node FNA samples were inevitably contaminated with peripheralblood, we evaluated the percentage of tumor cells included in lymph node FNAsamples by real-time PCR with tumor-specific primers and probes according to aprevious report (Yamazaki et al., 2008) in some cases, specific primers and probeswere successfully produced. In short, the sequence of rearranged IgH genes in eachlymphoma case was subjected to a BLAST search in order to obtain the sequence ofthe 30 flanking region of the rearranged IgH J segments. Allele-specific oligonucleo-tides (ASO) complementary to the determining region 3 of the IgH gene of each casewere designed, and tumor cells in lymph node FNA samples were quantified withreal-time PCR. All samples were examined in triplicate.

Immunohistochemical analysis

In cases where owner’s consent was obtained, Tru-cut lymph node biopsieswere conducted. Samples were immediately fixed in 10% neutral buffered formalinfor no longer than 3 days and were subsequently embedded in paraffin. Sections(5 lm thick) were generated and stained with hematoxylin and eosin (HE) to con-firm that biopsies were accurately performed to collect tumor cells.

Fig. 4. Hematoxylin and eosin staining (A) and immunohistochemistry for CD79a (B) andwith diffuse large B-cell lymphoma (DLBCL), high-grade centroblastic type. Immunohistowere negatively stained with BCL6 (D), while lymphocytes in germinal centers of norm

Immunohistochemistry staining for CD79a, CD3 and BCL6 were performedusing primary antibodies (CD79a, clone HM57, Dako; CD3, polyclonal anti-humanCD3, Dako; BCL6, clone EP529Y, Abcam) according to previous reports (Ponceet al., 2010; Sato et al., in press). In brief, heat-induced antigen retrieval was per-formed for 5 min at 121 �C in 1 mM EDTA buffer (pH 8.0) using an autoclave. Endog-enous peroxidase was blocked by 3% hydrogen peroxidase in methanol at roomtemperature for 5 min. Slides were incubated with diluted primary antibodies(CD79a and CD3, 1:100; BCL6, 1:50) for 30 min (CD79a and CD3) and 60 min(BCL6) at room temperature. All reaction products were visualized with 3,30-diam-inobenzidine. Slides of a normal lymph node were used as positive control.

Thirteen archived paraffin-embedded DLBCL samples (diagnosed between 2008and 2009) were evaluated for BCL6 expression. All DLBCL samples were CD79a+ andCD3�. DLBCL according to WHO criteria was determined by an American College ofVeterinary Pathologists board-certified pathologist (Y.K.). Characteristics of the pa-tients with DLBCL are summarized in Table 2.

Statistical analysis

Intra- and inter-run variabilities were assessed by coefficient of variation (CV).Progression-free survival (PFS) was defined as the time from the initiation of treat-ment to the first time that criteria for progressive disease were met, or the time ofdeath from any cause. Dogs were censored in PFS analysis if they were still alive, ifprogressive disease had not occurred before the end of the study, or if they were lostduring follow-up. OS was defined as the time from the first day of chemotherapyuntil death from any cause. Dogs were censored in OS analysis if they were aliveat the end of chemotherapy or were lost during follow-up.

Survival curves were estimated using the Kaplan–Meier product-limit methodand were compared using the log-rank test. Fisher’s exact and Mann–Whitney Utests were used to compare variables between two groups divided by BCL6 mRNAexpression. P < 0.05 (2-sided) was considered significant.

Results

Lymphoma cases

Forty-four dogs newly diagnosed with lymphoma between Au-gust 2007 and May 2010 at the Veterinary Medical Center of theUniversity of Tokyo met the inclusion criteria of this study.

CD3 (C) in lymphoma samples obtained by Tru-cut biopsy. All cases were diagnosedchemistry for BCL6 in DLBCL and normal canine lymph nodes. All lymphoma cases

al lymph nodes were BCL6-positive (E and F).

112 M. Sato et al. / The Veterinary Journal 191 (2012) 108–114

Forty-two of these dogs were classified as having centroblasticlymphoma and two as B-cell immunoblastic lymphoma. The caseswere confirmed cytologically according to the updated Kielclassification.

All dogs were initially treated with a 6-month modified versionof the University of Wisconsin–Madison chemotherapy protocol(UW-25) (Garrett et al., 2002). In cases of progressive disease,L-asparaginase, lomustine, dacarbazine, cytrabine, actinomycin D,and melphalan were used as rescue therapy (Alvarez et al., 2006;Saba et al., 2007; Griessmayr et al., 2009) on the basis of the clini-cian’s decision. The characteristics of dogs enrolled in this studyare summarized in Table 3.

Measurement of BCL6 mRNA expression

The assays were highly reproducible with CV < 0.9 in intra-runvariability and <0.4 in inter-run variability. BCL6 mRNA expressionwas evaluated in 44 dogs with high-grade B-cell lymphoma andtwo normal canine lymph node cDNA samples (Fig. 1). BCL6 mRNAlevels in the two normal canine lymph nodes (31.6 and 21.7) werehigher than those in the lymphoma samples (median: 0.94, range:0.14–8.92). We divided this cohort into two groups by setting acut-off point as the median BCL6 mRNA expression: the high andlow BCL6 mRNA expression groups (>0.94 and <0.94, respectively).No significant differences in the distribution of age, gender, stage V,

Fig. 5. Histopathological and immunohistochemical findings of a canine lymph node salymphoma cells with a large nucleus containing multiple prominent nucleoli. HemImmunolabeling with anti-CD3, hematoxylin counterstain (C). Neoplastic cells were poNeoplastic cells were negative for BCL6. Immunolabeling with anti-BCL6, hematoxylin c

sub-stage b, anemia (PCV < 35%), and complete remission (CR)rates were observed between the two groups (Table 4).

Median follow-up duration from initial diagnosis was 238 days(range: 16–790 days, 95% CI: 212–333 days). The median PFS in thehigh BCL6 mRNA group was 262 days (range: 16–650 days, 95% CI:70–286 days), while the median PFS in the low BCL6 mRNA groupwas 204 days (range: 21–661 days, 95% CI: 95–337 days). Themedian OS was 320 days (range: 35–790 days, 95% CI: 179–470 days) in the high BCL6 mRNA group and 319 days in the lowBCL6 mRNA group (range: 16–642 days, 95% CI: 160–442). No sig-nificant differences in PFS (Fig. 2A) or OS (Fig. 2B) were observedbetween the two groups. Furthermore, no significant differencesin PFS or OS were found using any cut-off points for BCL6 mRNAexpression (data not shown).

Relationship between the percentage of tumor cells in lymph node FNAsamples and BCL6 mRNA expression

Twenty lymph node FNA samples were subjected to real-timePCR using tumor-specific primers and probes to measurelymphoma cells. The median percentage of tumor cells in lymphnode FNA samples was 90.9% (range: 53.7–99.6). There was nosignificant difference in tumor percentages between high (n = 8,median = 90.2) and low BCL6 mRNA expression (n = 12, median =90.9) (Fig. 3).

mple diagnosed with diffuse large B-cell lymphoma (DLBCL). Diffusely proliferatingatoxylin and eosin staining (A and B). Neoplastic cells were negative for CD3.sitive for CD79a. Immunolabeling with anti-CD79a, hematoxylin counterstain (D).ounterstain (E).

M. Sato et al. / The Veterinary Journal 191 (2012) 108–114 113

Immunohistochemical analysis

Tru-cut samples were obtained in 11/44 dogs with newly diag-nosed lymphoma. HE slides showed a uniform proliferation ofimmature lymphoid cells with a large nucleus and narrow cyto-plasm. These cells had multiple nucleoli often located at the nuclearperiphery (Fig. 4A). This morphology corresponded to a centroblas-tic type. Since all samples were CD79a+ and CD3� (Fig. 4B and C),these lymphoma cases were classified as canine high-grade B-celllymphoma, centroblastic type according to the updated Kiel classi-fication and DLBCL according to the WHO classification.

In the newly diagnosed cases analyzed for BCL6 protein expres-sion, four dogs belonged to the high BCL6 mRNA group and sevendogs belonged to the low BCL6 mRNA group. All cases were nega-tively stained with the BCL6 antibody (<1% positive cells) (Fig. 4D),while lymph node germinal centers in normal canine lymph nodeswere BCL6-positive (Fig. 4E and F). In the 13 archived canine DLBCLsamples, immunohistochemical analysis for BCL6 consistently gavenegative results (Fig. 5A–E).

Discussion

We previously reported that canine BCL6 had close homology tohuman BCL6 (96.3%) and that this protein was exclusively ex-pressed in GC in canine lymph nodes, indicating the well conservedfunction of BCL6 between humans and dogs (Sato et al., in press).Hence we hypothesized that BCL6 expression would be a prognos-tic factor in canine high-grade B-cell lymphoma.

However, in contrast to our assumption, the results of this studyrevealed that BCL6 mRNA expression was not correlated with clin-ical outcomes for dogs with high-grade B-cell lymphoma. Whencompared to normal canine lymph nodes, BCL6 expression in lym-phoma samples was much lower. Moreover, BCL6 protein expres-sion was not observed in tumor samples of 11 newly diagnosedand 13 archived DLBCL samples. In humans, more than half of lym-phoma cases (56–80%) are defined as BCL6-positive DLBCL on thebasis of immunohistochemical analysis (Lossos et al., 2001; Hanset al., 2004; Uccella et al., 2008). It is conceivable that GCB-likelymphoma is much less common in dogs and that ABC-like lym-phoma comprises most canine high-grade B-cell lymphomas.

Canine high-grade B-cell lymphoma is a fatal disease with curerates less than 10–20% with CHOP-based chemotherapy. In con-trast, in humans, durable remissions are achieved in 40–50% ofDLBCL patients with CHOP-based chemotherapy (Coiffier, 2001).The lower frequency of GCB-like lymphoma in dogs might contrib-ute to this poorer prognosis compared to humans. Further studiesare needed to determine if canine high-grade B-cell lymphoma hasany similarities to human ABC-like DLBCL. Such studies should uti-lize gene expression profile or immunohistochemical analysisusing several antibodies, such as BCL2 and MUM1, which are rep-resentative markers of ABC-like DLBCL (Hans et al., 2004).

We classified lymphoma cases according to the updated Kielclassification using lymph node FNA samples. Histopathologicalevaluation was not performed in 33/44 newly diagnosed cases,which is a limitation of the present study. Our samples diagnosedwith high-grade B-cell lymphoma might include not only DLBCLbut also late-stage (grade III) follicular lymphomas, which areindistinguishable by cytology, although it has previously been re-ported that follicular lymphoma and other types of B-cell high-grade lymphoma are less common in dogs (Fournel-Fleury et al.,1997; Ponce et al., 2010; Vezzali et al., 2010).

We investigated the percentage of tumor cells in lymph nodeFNA samples by real-time PCR because peripheral blood contami-nation frequently occurs in FNA samples and might affect results.Our results showed that tumor cells were present in approximately

90% of lymph node FNA samples. Therefore, we can exclude thepossibility that contamination of normal cells might have biasedthe results of BCL6 mRNA expression.

Conclusions

BCL6 mRNA expression could not predict the prognosis of ca-nine high-grade B-cell lymphoma. Furthermore, BCL6 proteinwas not expressed in canine DLBCL by immunohistochemistry,which is inconsistent with findings in human DLBCL. Further stud-ies are necessary to elucidate the biological and genetic features ofthis disease.

Conflict of interest statement

None of the authors of this paper has a financial or personalrelationship with other people or organizations that could inappro-priately influence or bias the content of the paper.

References

Alizadeh, A.A., Eisen, M.B., Davis, R.E., Ma, C., Lossos, I.S., Rosenwald, A., Boldrick, J.C.,Sabet, H., Tran, T., Yu, X., Powell, J.I., Yang, L., Marti, G.E., Moore, T., Hudson Jr., J.,Lu, L., Lewis, D.B., Tibshirani, R., Sherlock, G., Chan, W.C., Greiner, T.C.,Weisenburger, D.D., Armitage, J.O., Warnke, R., Levy, R., Wilson, W., Grever,M.R., Byrd, J.C., Botstein, D., Brown, P.O., Staudt, L.M., 2000. Distinct types ofdiffuse large B-cell lymphoma identified by gene expression profiling. Nature403, 503–511.

Alvarez, F.J., Kisseberth, W.C., Gallant, S.L., Couto, C.G., 2006. Dexamethasone,melphalan, actinomycin D, cytosine arabinoside (DMAC) protocol for dogs withrelapsed lymphoma. Journal of Veterinary Internal Medicine 20, 1178–1183.

Burnett, R.C., Vernau, W., Modiano, J.F., Olver, C.S., Moore, P.F., Avery, A.C., 2003.Diagnosis of canine lymphoid neoplasia using clonal rearrangements of antigenreceptor genes. Veterinary Pathology 40, 32–41.

Chang, C.C., Ye, B.H., Chaganti, R.S., Dalla-Favera, R., 1996. BCL-6, a POZ/zinc-fingerprotein, is a sequence-specific transcriptional repressor. Proceedings of theNational Academy of Sciences of the United States of America 93, 6947–6952.

Coiffier, B., 2001. Diffuse large cell lymphoma. Current Opinion in Oncology 13,325–334.

Deweindt, C., Albagli, O., Bernardin, F., Dhordain, P., Quief, S., Lantoine, D., Kerckaert,J.P., Leprince, D., 1995. The LAZ3/BCL6 oncogene encodes a sequence-specifictranscriptional inhibitor: a novel function for the BTB/POZ domain as anautonomous repressing domain. Cell Growth and Differentiation 6, 1495–1503.

Fournel-Fleury, C., Magnol, J.P., Bricaire, P., Marchal, T., Chabanne, L., Delverdier, A.,Bryon, P.A., Felman, P., 1997. Cytohistological and immunological classificationof canine malignant lymphomas: comparison with human non-Hodgkin’slymphomas. Journal of Comparative Pathology 117, 35–59.

Garrett, L.D., Thamm, D.H., Chun, R., Dudley, R., Vail, D.M., 2002. Evaluation of a 6-month chemotherapy protocol with no maintenance therapy for dogs withlymphoma. Journal of Veterinary Internal Medicine 16, 704–709.

Greenlee, P.G., Filippa, D.A., Quimby, F.W., Patnaik, A.K., Calvano, S.E., Matus, R.E.,Kimmel, M., Hurvitz, A.I., Lieberman, P.H., 1990. Lymphomas in dogs. Amorphologic, immunologic, and clinical study. Cancer 66, 480–490.

Griessmayr, P.C., Payne, S.E., Winter, J.E., Barber, L.G., Shofer, F.S., 2009. Dacarbazineas single-agent therapy for relapsed lymphoma in dogs. Journal of VeterinaryInternal Medicine 23, 1227–1231.

Hans, C.P., Weisenburger, D.D., Greiner, T.C., Gascoyne, R.D., Delabie, J., Ott, G.,Muller-Hermelink, H.K., Campo, E., Braziel, R.M., Jaffe, E.S., Pan, Z., Farinha, P.,Smith, L.M., Falini, B., Banham, A.H., Rosenwald, A., Staudt, L.M., Connors, J.M.,Armitage, J.O., Chan, W.C., 2004. Confirmation of the molecular classification ofdiffuse large B-cell lymphoma by immunohistochemistry using a tissuemicroarray. Blood 103, 275–282.

Harris, N.L., Jaffe, E.S., Stein, H., Banks, P.M., Chan, J.K., Cleary, M.L., Delsol, G., DeWolf-Peeters, C., Falini, B., Gatter, K.C., 1994. A revised European–Americanclassification of lymphoid neoplasms: a proposal from the internationallymphoma study group. Blood 84, 1361–1392.

Hosoya, K., Kisseberth, W.C., Lord, L.K., Alvarez, F.J., Lara-Garcia, A., Kosarek, C.E.,London, C.A., Couto, C.G., 2007. Comparison of COAP and UW-19 protocols fordogs with multicentric lymphoma. Journal of Veterinary Internal Medicine 21,1355–1363.

Jacobs, R.M., Messick, J.B., Valli, V.E., 2002. Tumors of the hemolymphatic system.In: Meuten, D.J. (Ed.), Tumors of Domestic Animals, fourth ed. State Press, Iowa,p. 138.

Jaffe, E.S., 1998. Histopathology of the non-Hodgkin’s lymphomas and Hodgkin’sdisease. In: Canellos, G.P., Listrer, T.A., Sklar, J.L. (Eds.), The Lymphomas. WBSaunders, Philadelphia, PA, USA, pp. 77–106.

Jamadar-Shroff, V., Papich, M.G., Suter, S.E., 2009. Soy-derived isoflavones inhibitthe growth of canine lymphoid cell lines. Clinical Cancer Research 15, 1269–1276.

114 M. Sato et al. / The Veterinary Journal 191 (2012) 108–114

Kaiser, H.E., 1981. Animal neoplasms: a systemic review. In: Kaiser, H.E. (Ed.),Neoplasms – Comparative Pathology in Animals, Plants and Man. Williams andWilkins Baltimore, MD, pp. 747–812.

Lossos, I.S., Jones, C.D., Warnke, R., Natkunam, Y., Kaizer, H., Zehnder, J.L.,Tibshirani, R., Levy, R., 2001. Expression of a single gene, BCL-6, stronglypredicts survival in patients with diffuse large B-cell lymphoma. Blood 98,945–951.

MacEwen, E.G., Hayes, A.A., Matus, R.E., Kurzman, I., 1987. Evaluation of someprognostic factors for advanced multicentric lymphosarcoma in the dog: 147cases (1978–1981). Journal of the American Veterinary Medical Association190, 564–568.

Miller, A.G., Morley, P.S., Rao, S., Avery, A.C., Lana, S.E., Olver, C.S., 2009. Anemia isassociated with decreased survival time in dogs with lymphoma. Journal ofVeterinary Internal Medicine 23, 116–122.

Perez-Rosado, A., Artiga, M., Vargiu, P., Sanchez-Aguilera, A., Alvarez-Barrientos, A.,Piris, M., 2008. BCL6 represses NFkappaB activity in diffuse large B-celllymphomas. Journal of Pathology 214, 498–507.

Peters, I.R., Peeters, D., Helps, C.R., Day, M.J., 2007. Development and application ofmultiple internal reference (housekeeper) gene assays for accuratenormalisation of canine gene expression studies. Veterinary Immunology andImmunopathology 117, 55–66.

Ponce, F., Marchal, T., Magnol, J.P., Turinelli, V., Ledieu, D., Bonnefont, C., Pastor, M.,Delignette, M.L., Fournel-Fleury, C., 2010. A morphologic study of 608 cases ofcanine malignant lymphoma in France with a focus on comparative similaritiesbetween canine and human lymphoma morphology. Veterinary Pathology 47,414–433.

Reljic, R., Wagner, S.D., Peakman, L.J., Fearon, D.T., 2000. Suppression of signaltransducer and activator of transcription 3-dependent B lymphocyteterminal differentiation by BCL-6. Journal of Experimental Medicine 192,1841–1848.

Saba, C.F., Thamm, D.H., Vail, D.M., 2007. Combination chemotherapy with L-asparaginase, lomustine, and prednisone for relapsed or refractory caninelymphoma. Journal of Veterinary Internal Medicine 21, 127–132.

Sato, M., Goto-Koshino, Y., Kanemoto, H., Mochizuki, H., Fujino, Y., Ohno, K., Tsujimoto,H., in press. Characterization of canine BCL6 cDNA and detection systems for itsprotein expression. Veterinary Immunology and Immunopathology.

Schebesta, M., Heavey, B., Busslinger, M., 2002. Transcriptional control of B-celldevelopment. Current Opinion in Immunology 14, 216–223.

Seyfert, V.L., Allman, D., He, Y., Staudt, L.M., 1996. Transcriptional repression by theproto-oncogene BCL-6. Oncogene 12, 2331–2342.

Tamura, K., Yagihara, H., Isotani, M., Ono, K., Washizu, T., Bonkobara, M., 2006.Development of the polymerase chain reaction assay based on the caninegenome database for detection of monoclonality in B cell lymphoma. VeterinaryImmunology and Immunopathology 110, 163–167.

Uccella, S., Placidi, C., Marchet, S., Cergnul, M., Proserpio, I., Chini, C., Novario, R.,Pinotti, G., Capella, C., 2008. Bcl-6 protein expression, and not the germinalcentre immunophenotype, predicts favourable prognosis in a series of primarynodal diffuse large B-cell lymphomas: a single centre experience. Leukemia andLymphoma 49, 1321–1328.

Uppenkamp, M., Feller, A.C., 2002. Classification of malignant lymphoma. Onkologie25, 563–570.

Vail, D.M., Thamm, D.H., Reiser, H., Ray, A.S., Wolfgang, G.H., Watkins, W.J., Babusis,D., Henne, I.N., Hawkins, M.J., Kurzman, I.D., Jeraj, R., Vanderhoek, M., Plaza, S.,Anderson, C., Wessel, M.A., Robat, C., Lawrence, J., Tumas, D.B., 2009.Assessment of GS-9219 in a pet dog model of non-Hodgkin’s lymphoma.Clinical Cancer Research 15, 3503–3510.

Vail, D.M., Michels, G.M., Khanna, C., Selting, K.A., London, C.A., 2010. Responseevaluation criteria for peripheral nodal lymphoma in dogs (v1.0) – a veterinarycooperative oncology group (VCOG) consensus document. Veterinary andComparative Oncology 8, 28–37.

Valli, V.E., Jacobs, R.M., Parodi, A.L., Vernau, W., Moore, P.F., 2002. HistologicalClassification of Hematopoietic Tumors of Domestic Animals. World HealthOrganization International Histological Classification of Tumors of DomesticAnimals, Second Series, vol. VIII. Armed Forces Institute of Pathology,Washington, DC, pp. 35–38.

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A.,Speleman, F., 2002. Accurate normalization of realtime quantitative RT-PCRdata by geometric averaging of multiple internal control genes. Genome Biology3 (RESEARCH0034).

Vezzali, E., Parodi, A.L., Marcato, P.S., Bettini, G., 2010. Histopathologic classificationof 171 cases of canine and feline non-Hodgkin lymphoma according to theWHO. Veterinary and Comparative Oncology 8, 38–49.

Yamazaki, J., Baba, K., Goto-Koshino, Y., Setoguchi-Mukai, A., Fujino, Y., Ohno, K.,Tsujimoto, H., 2008. Quantitative assessment of minimal residual disease(MRD) in canine lymphoma by using real-time polymerase chain reaction.Veterinary Immunology and Immunopathology 126, 321–331.