Evaluation of LATS1 and LATS2 Promoter …downloads.hindawi.com/journals/joph/2016/5431021.pdfResearch Article Evaluation of LATS1 and LATS2 Promoter Methylation with the Risk of Pterygium

Research ArticleEvaluation of LATS1 and LATS2 Promoter Methylation withthe Risk of Pterygium Formation

Maryam Najafi1 Dor Mohammad Kordi-Tamandani1 and Mohammad Arish2

1Departement of Biology University of Sistan and Baluchestan Zahedan Iran2Department of Ophthalmology Al-Zahra Eye Hospital Zahedan University of Medical Sciences Zahedan 98167-43463 Iran

Correspondence should be addressed to Mohammad Arish arishmohammedgmailcom

Received 16 October 2015 Revised 26 December 2015 Accepted 29 December 2015

Academic Editor Sachin Mulik

Copyright copy 2016 Maryam Najafi et alThis is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Purpose Pterygium is a serious eye problem in countries with high exposure to UV However despite numerous studies themolecular etiology of pterygium is unclear Recent studies have indicated that LATS1 and LATS2 genes are involved in DDRsignaling pathways against continuous UV exposure Our aim was to evaluate the LATS1 and LATS2 promoter methylation withthe risk of pterygium formationMethods We evaluated the promoter methylation status of LATS1 and LATS2 using methylation-specific PCR technique AlsomRNAexpression ofLATS1 andLATS2was assessed in 14 cases of pterygiumand 14 normal specimensby real-time PCR Results Promoter methylation of LATS1 and LATS2 was detected significantly between pterygium tissues andnormal tissues [LATS1 OR = 49 95 CI 154 to 1548 119875 = 0003 LATS2 OR = 71 95 CI 153 to 3319 119875 = 0004] The geneexpression analysis showed a statistically significant difference between pterygium tissues and healthy controls for both LATS1 andLATS2 (119875 lt 005) Conclusions The data of this study is the first report regarding the effect of promoter methylation of the LATS1and LATS2 in the pterygium To confirm these data doing further studies in various genetic populations with large sample sizesusing advanced molecular techniques is proposed

1 Introduction

Pterygium is a common wing-shaped and oriented fibrovas-cular lesion coating the surface of the eye According to thepopulation-based studies its prevalence rate varies from07to 33 [1] This abnormality arises from the conjunctiva andextends into the cornea and can result in remarkable cosmeticproblems visual impairment recurrent inflammation andmild irritation [2] Surgery is needed for cases when lesionexpands to the central part of the cornea [3] (Figure 1)

There are countless theories regarding the causes ofpterygium including UV light exposure viruses oxidativestress DNA methylation apoptotic and oncogenic proteinsloss of heterozygosity microsatellite instability inflammatorymediators extracellular matrix modulators lymphangiogen-esis cell epithelial-mesenchymal transition and alterationsin cholesterol metabolism [4] Most studies have implicatedthat pterygium is a UV light associated disease Thereforewe focused on LATS1 and LATS2 genes which are thecommon tumor suppressor genes in the UV-induced DNA

Damage Response (DDR) signaling pathways Lats (largetumor suppressor) gene a SerThr kinase belongs to theNdrLATS subfamily of AGC (protein kinase APKGPKC)kinases originally isolated from Drosophila melanogasterTwo mammalian homologs of fly lats LATS1 and LATS2 arelocated in 6q251 and 13q1211 chromosomes respectively [5]

One of the DDR signaling pathways which facilitateapoptosis following high levels of UV-induced damage isChk1-Lats2-p21 axis [6] And Chk1-Lats2-(14-3-3) regulatesthe P-body formation as a unique signaling pathway inresponse to UV-induced DNA damage [7] LATS1 and LATS2are also engaged in the regulation of cell cycle through G2-Marrest and G1-S arrest respectively [8 9] After DNA damagethe integrity of genome is warranted through RASSF1A-LATS12-MDM2-P53 signaling pathway [10] In addition alarge amount of literature has reported the function of thesegenes in morphogenesis cell division and apoptosis [11]

Epigenetic modifications such as DNA methylation ofCpG islands in promoter regions are the main cause oftumor suppressor gene silencing and can result in tumor

Hindawi Publishing CorporationJournal of OphthalmologyVolume 2016 Article ID 5431021 5 pageshttpdxdoiorg10115520165431021

2 Journal of Ophthalmology

Table 1 Methylation primer sequences and annealing temperature

Genes Sequences (51015840-31015840) Annealing temperature (∘C) Product size

LATS1M F GGAGTTT CGTTTTGTC 53∘C 138 bpR CGACGTAATAACG AACGCCTA

LATS1 U F TAGGTTGGAGTGTGGTGGT 57∘C 121 bpR CCC AACATAATAACAAACACCT

LATS2M F ATTTCGGTTTATTGTAATTTTC 55∘C 148 bpR AACCAACATAATAAAACCCCG

LATS2 U F TTTGTTTTTTGGGTTTAAGT 55∘C 130 bpR CCAACATAATA AAACCCCA

M methylated U unmethylated

Figure 1 Pterygium

development [12] Some tumors such as breast cancer andastrocytoma have shown downregulation of LATS1 andLATS2 mRNA expression through promoter methylation[13] To our knowledge for the first time this study highlightsthe status of LATS1 and LATS2 promoter methylation andmRNA expression profiles in pterygium

2 Materials and Methods

21 Subject This case-control study was performed from2010 to 2013 consisting of 70 primary pterygium tissues (35males and 35 females with a mean age of 5244 plusmn 20611)and 70 normal conjunctiva tissues of the patients who hadundergone cataract surgery (35 males and 35 females with amean age of 5067 plusmn 23318) The biopsy tissue samples werefrozen in minus80∘C until molecular analysisThese samples werecollected from Al-Zahra Eye Hospital All procedures in thisstudy were approved by the Ethical Board at the ZahedanUniversity of Medical Sciences Informed consent was takenfrom all participants Arish et al 2016 described the clinicalinformation of the patients who have participated in thisstudy [14]

22 DNA Extraction and Modification Genomic DNA wasextracted from frozen tissues by phenol chloroform isoamylalcohol extraction protocol Then 1-2120583g of isolated DNA wasdiluted in 20120583L of water and used for bisulfite treatment byWizardDNAClean-Up System (Promega) kit which converts

unmethylated cytosine to uracil and leaves methylated cyto-sine unaltered According to the manufacturerrsquos instructionsof Promega the treated DNA should be diluted in 20 120583L ofwater and kept at minus20∘C for using in the further experiments

23 Methylation-Specific PCR (MSP) To carry out the MSPanalysis promoters of the genes were recognized throughonline data analysis (httpwwwensemblorg) and then thepreferred sequences were used to design methylated andunmethylated primers by MethPrime online software Ourselection for the site of methylated and unmethylated wasconsistent with the related literature AccuPower HotStartPCR Premix from Bioneer Company (Cat Number K-5050) was used for each PCR reaction Each PCR reactioncontained 1 120583L of modified DNA and 05 120583L of each primerwhich is dissolved in the lyophilized blue pellet of AccuPowerHotStart PCR Premix reached a final volume of 20120583L withwater The MSP amplification was set as follows 95∘C for5min followed by 40 cycles (95∘C for 40 s the annealingtemperature for LATS1 M = 53 U = 57 LATS2 M =555 U = 55 for 40 s and extension at 72∘C for 40 s) Finalincubation was completed at 72∘C for 10min The designedprimers were listed in Table 1 PCR products were detectedby electrophoresis in 2 agarose gel 80ndash100 volts for an houruntil being well separated (Figure 2)

231 RNA Extraction and Modification Total RNA wasextracted from pterygium and control tissues using the RNX-Plus solution (Cat Number MR7713C) A Revert Aid FirstStrand cDNA Synthesis Kit (Fermentas Cat Number K1621)was used to reverse-transcribe 1mg of RNA to cDNA in a finalvolume of 20 120583L

232 mRNA Quantification by Real-Time PCR Real-timePCR was performed using SYBR green in ABI 5700 sequencedetection system (Applied Biosystems) We compared themRNA expression in pterygium tissues related to normaltissues 18S-rRNA was used as an internal standard PCRefficiencies (119864) were calculated for all used primers fromthe given slopes of standard curves generated from serialdilutions of positive controls according to the followingequation 119864 = 2(minusΔΔCT) [15]The designed primers for expres-sion analysis are shown in Table 2

Journal of Ophthalmology 3

150bp100 bp

M U M U M U M U M U M UT1 T2 T3 T4 T5 T6

138bp121 bp

(a) LATS1

150bp100 bp


148bp130bp

(b) LATS2

Figure 2 Representative results of methylation-specific PCR analy-sis of LATS1 (a) and LATS2 (b) in random pterygium tissues (T) Mmethylated U unmethylated Marker 50 bp size marker

24 Statistical Analysis The effect of LATS1 and LATS2genes methylation on the risk of pterygium formation wasdetected by estimating odds ratios (OR) and 95 confidenceintervals (95 CI) using Logistic Regression Avoiding biasin estimating OR we calculated confidence intervals by threemethods including exact Cornfield and Woolf The StataSE (version 131) was employed for statistical analyses TheMann-Whitney test was used to compare expression databetween groups The significance level was set at 119875 le 005

3 Results

The methylation frequency of LATS1 gene was 66 (9428)for cases and 54 (7714) for healthy controls LATS2 geneshowed 9857 (N = 69) methylation in cases and 8286 (N= 58) in the controls group Comparison ofmethylated versusunmethylated indicated significant difference between casesand controls in LAST1 (OR = 49 95CI 154 to 1548 119875 =0003) and LATS2 (OR = 71 95CI 153 to 3319 119875 = 0004)(Table 3)

Decreased expression in case group of both candidategenes (042 plusmn 0030 in case versus 057 plusmn 0068 for controls inLATS1 and 044 plusmn 0028 in cases versus 057 plusmn 0061 controlsin LATS2) was detected Comparison of mean between casesand controls revealed a statistically significant difference inboth genes (119875 lt 005) (Table 4)

4 Discussion

Pterygium is a benign lesion that extends from conjunctivato the cornea where it may interfere with vision Since thecurrent treatment of pterygium is invasive mainly based onsurgery studies for new markers should be conducted Thecurrent knowledge regarding the molecular basis of ptery-gium needs to be widened Presently pterygium is consideredas a UV light exposure-related uncontrolled cell proliferation[16] Environmental factors such as UV radiation play animportant role in tumor promotion through the epigeneticdysregulation of the cell cycle genes [17]

Table 2 Expression primer sequences and annealing temperatures

LATS1 F GTTAAGGGGAGAGCCAGGTCCTT 60∘C 132 bpR TCAAGGAAGTCCCCAGGACTGT

LATS2 F ACTTTTCCTGCCACGACTTATTC 60∘C 77 bpR GATGGCTGTTTTAACCCCTCA

18SRNA F GTAACCCGTTGAACCCCATT 60∘C 112 bpR CCATCCAATCGGTAGTAGCG

LATS1 and LATS2 as a part of DDR signaling pathwaysare putative serinethreonine kinase proteins that localize tothemitotic apparatus and constitute a complex with cell cyclecontrol system [9 18] LATS1 acts as a negative regulatorof CDC2cyclinA which reduces H1 histone kinase activityof CDC2 and results in a G2-Mcell-cycle arrest [19] AlsoLATS1 is activated by RASSF1A (Ras association domainfamily 1 isoform A) that stimulates response to DNA damage[20] The activation of LATS1 promotes genomic stability viastabilizing replication forks by restricting CDK2-mediatedphosphorylation of BRCA2 This modulation not only has afundamental role in error-free DNA repair but alsomaintainsnucleofilament formation at stalled replication forks [21]LATS2 localizes to centrosomes during interphase both earlyand latemetaphase It interacts with the centrosomal proteinsaurora-A and ajuba and also is required for the accumulationof gamma-tubulin and spindle formation at the onset ofmitosis [18] It also interacts with a negative regulator ofp53 and may function in a positive feedback loop withp53 that responds to the cytoskeleton damage The Lats2-Mdm2-p53 axis thus constitutes an innovative checkpointpathway critical for the maintenance of proper chromosomenumber [22] Both LATS1 and LATS2 as tumor suppressorsare part of hippo signaling pathway which has profoundeffects on normal cell fate and tumorigenesis [23] Thereforesilencing of LATS1 and LATS2 putative tumor suppressorgenes through promoter methylation may cause the devel-opment of pterygium The methylation of LATS1LATS2has been demonstrated in Japanese lung cancer patients[24] Decreased expression of LATS1 in colorectal cancerwas in association with the promoter methylation [25] Inaddition promoter hypermethylation mediates decreasedexpression of LATS1 and LATS2 in human astrocytoma [13]Downregulation of LATS1 and LATS2 mRNA expressionby promoter hypermethylation has been reported in breastcancer [5] Consistent with the abovementioned studiesour results confirmed the significant relationship betweenreduced expression of the LATS1 and LATS2 through methy-lation and the risk of pterygium formation Besides our datathe literature reviews showed the aberrant DNA methylationand decreased expression of P16 Ecadherin TGM 2 MMP2and CD24 genes in pterygium [26ndash28] Exploring pterygiummethylation markers and their subsequent effects on mRNAexpression paves the road for better therapy such as discov-ering drugs with the regulation of methylation characteristicFurther studies are required to identify the exact molecularfunction of LATS1LATS2 genes in pterygium in variousand larger genetic populations using advanced moleculartechniques


Table 3 Risk of pterygium formation based on gene promoter methylationa

Gene Methylation statusPterygium tissues119899 = 70

Normal tissues119899 = 70 OR 95 CI 119875

119899 () 119899 ()Exact method

LATS1 U (ref) 4 (571) 16 (2286) 49 144 to 2106 0003M 66 (9428) 54 (7714)

LATS2 U (ref) 2 (285) 12 (1714) 71 147 to 6742 0004M 69 (9857) 58 (8286)

Cornfield method

LATS1 U (ref) 4 (571) 16 (2286) 49 160 to 1476 0003M 66 (9428) 54 (7714)

LATS2 U (ref) 2 (285) 12 (1714) 71 170 to NC 0004M 69 (9857) 58 (8286)

Woolf method

LATS1 U (ref) 4 (571) 16 (2286) 49 154 to 1548 0003M 66 (9428) 54 (7714)

LATS2 U (ref) 2 (285) 12 (1714) 71 153 to 3319 0004M 69 (9857) 58 (8286)

aBinary logistic regression analysisU unmethyl ref reference and M methylOR = odds ratio 95 CI = 95 confidence intervalNC not calculated

Table 4 Comparison of relative gene expression for LATS1 andLATS2 genes between patients with pterygium and healthy controls

Genes Number Mean plusmn SD 119875 valuea

LATS1 Cases 14 042 plusmn 0030lt0001

Controls 14 057 plusmn 0068


Controls 14 057 plusmn 0061aMann-Whitney 119880 test

Ethical Approval

All procedures performed in studies involving human partic-ipants were in accordance with the ethical standards

Consent

Informed consent was obtained from all individual partici-pants included in the study

Conflict of Interests

The authors declare that they have no conflict of interests

Acknowledgments

The authors would like to express their gratitude to theDepartment of Ophthalmology Al-Zahra Eye HospitalZahedanUniversity ofMedical Sciences and theDepartmentof Biology University of Sistan and Baluchestan for support-ing this project financially

References

[1] W Jiao C Zhou T Wang et al ldquoPrevalence and risk factorsfor pterygium in rural older adults in Shandong Province ofChina a cross-sectional studyrdquo BioMed Research Internationalvol 2014 Article ID 658648 8 pages 2014

[2] K Zheng J Cai V Jhanji and H Chen ldquoComparison ofpterygium recurrence rates after limbal conjunctival autografttransplantation and other techniques meta-analysisrdquo Corneavol 31 no 12 pp 1422ndash1427 2012

[3] W Akhter A Tayyab A Kausar and A Masrur ldquoReducingpostoperative pterygium recurrence comparison of free con-junctival auto-graft and conjunctival rotation flap techniquesrdquoJournal of the College of Physicians and Surgeons Pakistan vol24 no 10 pp 740ndash744 2014

[4] E Cardenas-Cantu J Zavala J Valenzuela and J E Valdez-Garcıa ldquoMolecular basis of pterygium developmentrdquo Seminarsin Ophthalmology 2014

[5] Y Takahashi Y Miyoshi C Takahata et al ldquoDown-regulationof LATS1 and LATS2 mRNA expression by promoter hyper-methylation and its association with biologically aggressivephenotype in human breast cancersrdquo Clinical Cancer Researchvol 11 no 4 pp 1380ndash1385 2005

[6] H Suzuki N Yabuta N Okada et al ldquoLats2 phosphorylatesp21CDKN1A after UV irradiation and regulates apoptosisrdquoJournal of Cell Science vol 126 no 19 pp 4358ndash4368 2013

[7] N Okada N Yabuta H Suzuki Y Aylon M Oren andH Nojima ldquoA novel Chk12-Lats2-14-3-3 signaling pathwayregulates P-body formation in response to UV damagerdquo Journalof Cell Science vol 124 part 1 pp 57ndash67 2011

[8] X Yang D-M Li W Chen and T Xu ldquoHuman homologue ofDrosophila lats LATS1 negatively regulate growth by inducingG(2)M arrest or apoptosisrdquoOncogene vol 20 no 45 pp 6516ndash6523 2001


[9] Y Li J Pei H Xia H Ke H Wang and W Tao ldquoLats2 aputative tumor suppressor inhibits G1S transitionrdquo Oncogenevol 22 no 28 pp 4398ndash4405 2003

[10] S F Scrace and E OrsquoNeill ldquoRASSF signalling andDNAdamagemonitoring the integrity of the genomerdquo Molecular BiologyInternational vol 2012 Article ID 141732 11 pages 2012

[11] T Yu J Bachman and Z-C Lai ldquoEvidence for a tumorsuppressor role for the Large tumor suppressor genes LATS1 andLATS2 in human cancerrdquoGenetics vol 195 no 3 pp 1193ndash11962013

[12] M Esteller ldquoCpG island hypermethylation and tumor suppres-sor genes a booming present a brighter futurerdquo Oncogene vol21 no 35 pp 5427ndash5440 2002

[13] Z Jiang X Li J Hu et al ldquoPromoter hypermethylation-mediated down-regulation of LATS1 and LATS2 in humanastrocytomardquoNeuroscience Research vol 56 no 4 pp 450ndash4582006

[14] M Arish D M Kordi-Tamandani M H Sangterash andR Poyandeh ldquoAssessment of promoter hypermethylation andexpression profile of P14ARF andMDM2 genes in patients withpterygiumrdquo Eye amp Contact Lens Science amp Clinical Practice vol42 no 1 pp e4ndashe7 2016

[15] T D Schmittgen and K J Livak ldquoAnalyzing real-time PCR databy the comparative CT methodrdquo Nature Protocols vol 3 no 6pp 1101ndash1108 2008

[16] T M Nolan N DiGirolamo N H Sachdev T Hampart-zoumian M T Coroneo and D Wakefield ldquoThe role ofultraviolet irradiation and heparin-binding epidermal growthfactor-like growth factor in the pathogenesis of pterygiumrdquoTheAmerican Journal of Pathology vol 162 no 2 pp 567ndash574 2003

[17] S K Katiyar T Singh R Prasad Q Sun and M VaidldquoEpigenetic alterations in ultraviolet radiation-induced skincarcinogenesis interaction of bioactive dietary components onepigenetic targetsrdquoPhotochemistry andPhotobiology vol 88 no5 pp 1066ndash1074 2012

[18] N Yabuta S Mukai N Okada Y Aylon and H Nojima ldquoThetumor suppressor Lats2 is pivotal in Aurora A and Aurora Bsignaling during mitosisrdquo Cell Cycle vol 10 no 16 pp 2724ndash2736 2011

[19] H Xia H Qi Y Li et al ldquoLATS1 tumor suppressor regulatesG2M transition and apoptosisrdquo Oncogene vol 21 no 8 pp1233ndash1241 2002

[20] L van der Weyden and D J Adams ldquoThe Ras-associationdomain family (RASSF) members and their role in humantumourigenesisrdquo Biochimica et Biophysica Acta Reviews onCancer vol 1776 no 1 pp 58ndash85 2007

[21] D-E Pefani R Latusek I Pires et al ldquoRASSF1AndashLATS1signalling stabilizes replication forks by restricting CDK2-mediated phosphorylation of BRCA2rdquo Nature Cell Biology vol16 no 10 pp 962ndash971 2014

[22] Y Aylon D Michael A Shmueli N Yabuta H Nojima andM Oren ldquoA positive feedback loop between the p53 andLats2 tumor suppressors prevents tetraploidizationrdquo Genes andDevelopment vol 20 no 19 pp 2687ndash2700 2006

[23] M Gomez V Gomez and A Hergovich ldquoThe Hippo pathwayin disease and therapy cancer and beyondrdquo Clinical andTranslational Medicine vol 3 no 1 article 22 2014

[24] H Sasaki Y Hikosaka O Kawano M Yano and Y FujiildquoHypermethylation of the large tumor suppressor genes inJapanese lung cancerrdquo Oncology Letters vol 1 no 2 pp 303ndash307 2010

[25] P M Wierzbicki K Adrych D Kartanowicz et al ldquoUnderex-pression of LATS1 TSG in colorectal cancer is associated withpromoter hypermethylationrdquo World Journal of Gastroenterol-ogy vol 19 no 27 pp 4363ndash4373 2013

[26] P-L Chen Y-W Cheng C-C Chiang S H Tseng P S Chauand Y-Y Tsai ldquoHypermethylation of the p16 gene promoterin pterygia and its association with the expression of DNAmethyltransferase 3brdquo Molecular Vision vol 12 pp 1411ndash14162006

[27] C-H Young Y-T Chiu T-S Shih et al ldquoE-cadherin promoterhypermethylation may contribute to protein inactivation inpterygiardquoMolecular Vision vol 16 pp 1047ndash1053 2010

[28] A K Riau T T Wong S N Finger et al ldquoAberrant DNAmethylation of matrix remodeling and cell adhesion relatedgenes in pterygiumrdquo PLoS ONE vol 6 no 2 Article ID e146872011

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom


Table 1 Methylation primer sequences and annealing temperature

Genes Sequences (51015840-31015840) Annealing temperature (∘C) Product size

LATS1M F GGAGTTT CGTTTTGTC 53∘C 138 bpR CGACGTAATAACG AACGCCTA

LATS1 U F TAGGTTGGAGTGTGGTGGT 57∘C 121 bpR CCC AACATAATAACAAACACCT

LATS2M F ATTTCGGTTTATTGTAATTTTC 55∘C 148 bpR AACCAACATAATAAAACCCCG

LATS2 U F TTTGTTTTTTGGGTTTAAGT 55∘C 130 bpR CCAACATAATA AAACCCCA

M methylated U unmethylated

Figure 1 Pterygium

development [12] Some tumors such as breast cancer andastrocytoma have shown downregulation of LATS1 andLATS2 mRNA expression through promoter methylation[13] To our knowledge for the first time this study highlightsthe status of LATS1 and LATS2 promoter methylation andmRNA expression profiles in pterygium

2 Materials and Methods

21 Subject This case-control study was performed from2010 to 2013 consisting of 70 primary pterygium tissues (35males and 35 females with a mean age of 5244 plusmn 20611)and 70 normal conjunctiva tissues of the patients who hadundergone cataract surgery (35 males and 35 females with amean age of 5067 plusmn 23318) The biopsy tissue samples werefrozen in minus80∘C until molecular analysisThese samples werecollected from Al-Zahra Eye Hospital All procedures in thisstudy were approved by the Ethical Board at the ZahedanUniversity of Medical Sciences Informed consent was takenfrom all participants Arish et al 2016 described the clinicalinformation of the patients who have participated in thisstudy [14]

22 DNA Extraction and Modification Genomic DNA wasextracted from frozen tissues by phenol chloroform isoamylalcohol extraction protocol Then 1-2120583g of isolated DNA wasdiluted in 20120583L of water and used for bisulfite treatment byWizardDNAClean-Up System (Promega) kit which converts

unmethylated cytosine to uracil and leaves methylated cyto-sine unaltered According to the manufacturerrsquos instructionsof Promega the treated DNA should be diluted in 20 120583L ofwater and kept at minus20∘C for using in the further experiments

23 Methylation-Specific PCR (MSP) To carry out the MSPanalysis promoters of the genes were recognized throughonline data analysis (httpwwwensemblorg) and then thepreferred sequences were used to design methylated andunmethylated primers by MethPrime online software Ourselection for the site of methylated and unmethylated wasconsistent with the related literature AccuPower HotStartPCR Premix from Bioneer Company (Cat Number K-5050) was used for each PCR reaction Each PCR reactioncontained 1 120583L of modified DNA and 05 120583L of each primerwhich is dissolved in the lyophilized blue pellet of AccuPowerHotStart PCR Premix reached a final volume of 20120583L withwater The MSP amplification was set as follows 95∘C for5min followed by 40 cycles (95∘C for 40 s the annealingtemperature for LATS1 M = 53 U = 57 LATS2 M =555 U = 55 for 40 s and extension at 72∘C for 40 s) Finalincubation was completed at 72∘C for 10min The designedprimers were listed in Table 1 PCR products were detectedby electrophoresis in 2 agarose gel 80ndash100 volts for an houruntil being well separated (Figure 2)

231 RNA Extraction and Modification Total RNA wasextracted from pterygium and control tissues using the RNX-Plus solution (Cat Number MR7713C) A Revert Aid FirstStrand cDNA Synthesis Kit (Fermentas Cat Number K1621)was used to reverse-transcribe 1mg of RNA to cDNA in a finalvolume of 20 120583L

232 mRNA Quantification by Real-Time PCR Real-timePCR was performed using SYBR green in ABI 5700 sequencedetection system (Applied Biosystems) We compared themRNA expression in pterygium tissues related to normaltissues 18S-rRNA was used as an internal standard PCRefficiencies (119864) were calculated for all used primers fromthe given slopes of standard curves generated from serialdilutions of positive controls according to the followingequation 119864 = 2(minusΔΔCT) [15]The designed primers for expres-sion analysis are shown in Table 2


150bp100 bp


138bp121 bp

(a) LATS1

150bp100 bp


148bp130bp

(b) LATS2



3 Results



4 Discussion











119899 () 119899 ()Exact method

LATS1 U (ref) 4 (571) 16 (2286) 49 144 to 2106 0003M 66 (9428) 54 (7714)

LATS2 U (ref) 2 (285) 12 (1714) 71 147 to 6742 0004M 69 (9857) 58 (8286)

Cornfield method

LATS1 U (ref) 4 (571) 16 (2286) 49 160 to 1476 0003M 66 (9428) 54 (7714)

LATS2 U (ref) 2 (285) 12 (1714) 71 170 to NC 0004M 69 (9857) 58 (8286)

Woolf method

LATS1 U (ref) 4 (571) 16 (2286) 49 154 to 1548 0003M 66 (9428) 54 (7714)

LATS2 U (ref) 2 (285) 12 (1714) 71 153 to 3319 0004M 69 (9857) 58 (8286)








Ethical Approval


Consent




Acknowledgments


References



































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

















150bp100 bp


138bp121 bp

(a) LATS1

150bp100 bp


148bp130bp

(b) LATS2



3 Results



4 Discussion











119899 () 119899 ()Exact method

LATS1 U (ref) 4 (571) 16 (2286) 49 144 to 2106 0003M 66 (9428) 54 (7714)

LATS2 U (ref) 2 (285) 12 (1714) 71 147 to 6742 0004M 69 (9857) 58 (8286)

Cornfield method

LATS1 U (ref) 4 (571) 16 (2286) 49 160 to 1476 0003M 66 (9428) 54 (7714)

LATS2 U (ref) 2 (285) 12 (1714) 71 170 to NC 0004M 69 (9857) 58 (8286)

Woolf method

LATS1 U (ref) 4 (571) 16 (2286) 49 154 to 1548 0003M 66 (9428) 54 (7714)

LATS2 U (ref) 2 (285) 12 (1714) 71 153 to 3319 0004M 69 (9857) 58 (8286)








Ethical Approval


Consent




Acknowledgments


References



































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of




















119899 () 119899 ()Exact method

LATS1 U (ref) 4 (571) 16 (2286) 49 144 to 2106 0003M 66 (9428) 54 (7714)

LATS2 U (ref) 2 (285) 12 (1714) 71 147 to 6742 0004M 69 (9857) 58 (8286)

Cornfield method

LATS1 U (ref) 4 (571) 16 (2286) 49 160 to 1476 0003M 66 (9428) 54 (7714)

LATS2 U (ref) 2 (285) 12 (1714) 71 170 to NC 0004M 69 (9857) 58 (8286)

Woolf method

LATS1 U (ref) 4 (571) 16 (2286) 49 154 to 1548 0003M 66 (9428) 54 (7714)

LATS2 U (ref) 2 (285) 12 (1714) 71 153 to 3319 0004M 69 (9857) 58 (8286)








Ethical Approval


Consent




Acknowledgments


References



































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of










































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of





















of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















Documents

Evaluation of LATS1 and LATS2 Promoter …downloads.hindawi.com/journals/joph/2016/5431021.pdfResearch Article Evaluation of LATS1 and LATS2 Promoter Methylation with the Risk of Pterygium