lable at ScienceDirect

European Journal of Medicinal Chemistry 116 (2016) 126e135

Contents lists avai

European Journal of Medicinal Chemistry

journal homepage: http: / /www.elsevier .com/locate/ejmech

Research paper

Computer-aided identification of new histone deacetylase 6 selectiveinhibitor with anti-sepsis activity

Jakyung Yoo a, So-Jin Kim a, Dohyun Son a, Heewon Seo a, Seung Yeop Baek a,Cheol-Young Maeng b, Changsik Lee a, In Su Kim a, Young Hoon Jung a, Sun-Mee Lee a,Hyun-Ju Park a, *

a School of Pharmacy, Sungkyunkwan University, Suwon, Gyeonggi-do 16419, Republic of Koreab SK Biopharmaceuticals Co. Ltd., 325 Exporo Yuseong-gu, Daejeon 305-712, Republic of Korea

a r t i c l e i n f o

Article history:Received 11 November 2015Received in revised form16 March 2016Accepted 17 March 2016Available online 19 March 2016

Keywords:HDAC6 selective inhibitorComputer-aided drug designAnti-sepsis

ABBREVIATIONS: HDAC, histone deacetylase; LPShistone deacetylase inhibitors; IL, interleukin; IFNgnecrosis factor-a; ZBD, zinc-binding group.* Corresponding author.

E-mail address: hyunju85@skku.edu (H.-J. Park).

http://dx.doi.org/10.1016/j.ejmech.2016.03.0460223-5234/© 2016 Elsevier Masson SAS. All rights re

a b s t r a c t

Histone deacetylase (HDAC) inhibitors have been recognized as promising approaches to the treatmentof various human diseases including cancer, inflammation, neurodegenerative diseases, and metabolicdisorders. Several pan-HDAC inhibitors are currently approved only as anticancer drugs. Interestingly,SAHA (vorinostat), one of clinically available pan-HDAC inhibitors, shows an anti-inflammatory effect atconcentrations lower than those required for inhibition of tumor cell growth. It was also reported thatHDAC6 selective inhibitor tubastatin A has anti-inflammatory and anti-rheumatic effect. In our efforts todevelop novel HDAC inhibitors, we rationally designed various HDAC inhibitors based on the structuresof two hit compounds identified by virtual screening of chemical database. Among them, 9a ((E)-N-hydroxy-4-(2-styrylthiazol-4-yl)butanamide) was identified as a HDAC6 selective inhibitor (IC50 values of0.199 mM for HDAC6 versus 13.8 mM for HDAC1), and it did not show significant cytotoxicity against HeLacells. In vivo biological evaluation of 9a was conducted on a lipopolysaccharide (LPS)-induced mousemodel of sepsis. The compound 9a significantly improved 40% survival rate (P ¼ 0.0483), and suppressedthe LPS-induced increase of TNF-a and IL-6 mRNA expression in the liver of mice. Our study identifiednovel HDAC6 selective inhibitor 9a, which may serve as a potential lead for the development of anti-inflammatory or anti-sepsis agents.

© 2016 Elsevier Masson SAS. All rights reserved.

1. Introduction

Histone deacetylases (HDACs) are epigenetic enzymes thatregulate several proteins such as transcription factors, chaperonesand signaling molecules as well as histone. [1e3] HDACs aregenerally associated with condensation of chromatin [4] andtranscriptional silencing of genes implicated in the pathogenesis ofmany diseases. [5,6] Therefore, development of HDAC inhibitors(HDACi) is an attractive strategy for the treatment of cancer, [7]inflammation, [8] neurodegenerative diseases, [9] and metabolicdisorders [10], but main effort has been made to develop HDACionly as anticancer therapeutics. To date, synthetic three

, lipopolysaccharide; HDACi,, interferon g; TNF-a, tumor

served.

hydroxamate HDAC inhibitors (SAHA, belinostat, and panobino-stat), [11e13] one benzamide HDAC inhibitor chidamide, [14] andthe natural product cyclic depsipeptide romidepsin, [15] have beenapproved for the treatment of cancer. Some studies show thatHDACi do not simply increase histone acetylation across thegenome thereby generally upregulating gene expression. Manygenes are suppressed by HDACi, because non-histone proteins,especially transcription factors, are also reversely acetylated andtheir functions are noticeably affected. For example, the pan-HDACinhibitor trichostatin A (TSA) suppresses IL (interleukin)-1b/LPS(lipopolysaccharide)/IFNg (interferon g)-induced nitric oxide syn-thase 2 (NOS2) expression in murine macrophage-like cells. [16]Another pan-HDAC inhibitor SAHA also decreased the LPS-induced tumor necrosis factor-a (TNF-a) and IFNg mRNA expres-sion. SAHA is particularly effective for reducing inflammatory cy-tokines at nanomolar concentration, relatively lower dosescompared to the doses required for inhibition of tumors. [17].

Among 4 classes (class I through IV) of classified HDACs, [10]

J. Yoo et al. / European Journal of Medicinal Chemistry 116 (2016) 126e135 127

class II HDACs are divided into 2 groups, i.e., class IIa and IIb. ClassIIb includes 2 isoforms, HDAC6 and HDAC10. [18] Unlike HDACisozymes in other classes, HDAC6 contains 2 homologous catalyticdomains and the ubiquitin binding zinc finger domain at the C-terminal region. [18,19] HDAC6 is primarily localized in the cyto-plasm [20] and affect the function of cytoplasmic nonhistone sub-strates, including tubulin, [21,22] cortactin, [23] and Hsp90. [24]Therefore, HDAC6 selective inhibitors may show limited toxicity byavoiding histone acetylation-induced global gene expressionchange. [25] As a deacetylase or ubiquitinase, HDAC6 causes manydiseases such as neurodegenerative diseases [18,26], cancer [27]and the inflammatory diseases. [28] As shown in Fig. 1, knownHDAC6 inhibitors generally contain a zinc-binding group (ZBG), alinker, and a cap group. Tubacin was first reported as a HDAC6 se-lective inhibitor in 2003 by Haggerty et al. [29] ZBG and linker oftubacin are structurally similar to the pan-HDAC inhibitor SAHA.[30] The bulky cap group is composed of 6 lipophilic rings and thestereochemistry of the dioxane ring is important to adjust the poseof cap group on the protein surface. It enables to affect a-tubulinacetylation and interaction with HDAC6. [31] Tubastatin A wasdeveloped through computational approach using HDAC6 homol-ogy model by Kozikowski and co-workers. [32] It demonstratesabout 1000-fold selectivity for HDAC6 over other HDAC isoforms.[33] In recent studies, tubastatin A showed anti-inflammatory andanti-rheumatic activities in mouse models through inhibiting therelease of inflammatory cytokines like TNF-a, IL-6, and chemokinessuch as NO. [34,35] These results led to an increased interest in thetherapeutic use of HDAC6 selective inhibitors for autoimmunediseases and inflammation.

ACY-1215 (rocilinostat) is the first HDAC6-selective inhibitor,which entered clinical trial, and it is under phase I/II clinical eval-uation in combination with bortezomib or lenalidomide forrelapsed and refractory multiple myeloma. [36] The developmentof selective HDAC6 inhibitors may be useful for better under-standing and their therapeutic applications to target diseases otherthan cancer, with minimizing adverse effects. [37] Hereinwe reportthe development of HDAC6-selective inhibitor compound viacomputational approaches and compound synthesis, and evalua-tion of their disease-modifying activity in mouse sepsis models.

Scheme 1. Flow chart for identifying HDAC6 selective inhibitor 9a.

2. Results and discussion

2.1. Identification of novel HDAC inhibitor by structure-basedvirtual screening and design

The procedure for structure-based virtual screening (VS) in this

HOHN

NHO

O

O OSO

N OH

Tubacin

Fig. 1. Chemical structures of H

study is shown in Scheme 1. Preliminary VS of a commerciallyavailable chemical database including drug-like compounds iden-tified 2 hit compounds (9D and 3C in Scheme 2) with mild HDACinhibitory activities. [38].

The key interactions of TSA with the active site of HDLP servedas the starting point to construct structure-based pharmacophoreconstraints (Supplementary Figure S1). [39] First, UNITY 3D searchusing pharmacophore query reduced initial set (80,600 entries) to2503 entries. In the next step, rigid and flexible docking methodswere applied to detect regions favorable for protein-ligand in-teractions. The 2503 compounds were docked into the bindingpocket using DOCK 4.0 and FlexX. [40] The final binding modes atthe active site of HDLP were ranked for their expected binding af-finity by the scoring function implemented in FlexX. Of the 2503compounds selected in the first step, only 315 entries were selected

HN

OOH

HN

O

N

N

N

HN

OOH

NN

ACY-1215 (rocilinostat)

Tubastatin A

DAC6-selective inhibitors.

Scheme 2. Structure-based design of styrylthiazolylhydroxamate 9a.

J. Yoo et al. / European Journal of Medicinal Chemistry 116 (2016) 126e135128

by visual inspection of the final binding modes together with thescoring values of FlexX. Finally, 164 compounds were selected forbiological assay.

We performed a preliminary screening of the pan-HDACinhibitory activities of the 164 entries obtained from the virtualscreening, using MS-275 as a reference compound. Among the 164candidates, 2 compounds were found to have HDAC inhibitory ac-tivity comparable to MS-275 (Supplementary Figures, S2 and S3,and Table 1). The structures of two hits, referred to as 3C and 9D areshown in Scheme 2. Hit compounds share 3-(styrylthio) prop-anamide group that corresponds to the capping and spacer group ofknown hydroxamte HDAC inhibitors, such as SAHA and TSA. Infollow-up work to confirm the role of this moiety as a capping andspacer group, we synthesized the analogue 9D-HA by introducing ahydroxamate functional group as a Zn-binding group. The com-pound 9D-HA exhibited improved HDAC inhibitory potency withan IC50 value of 3.7 mM (Supplementary Figure S4), in comparisonwith 9D and 3C. To optimize the HDAC inhibitory activity, weneeded a more stable scaffold than thio-linker. Therefore, wereplaced thioether linker, which can be metabolized into sulfoxidein the body, [41] with rigid thiazole moiety as a bioisostere of sul-fide and extended carbon linker unit considering appropriatespacer length as shown in Scheme 2. This hydroxamate analog 9awas designed to examine whether thiazole linker deteriorates theHDAC inhibitory activity of 9D-HA containing hydroxamate group.As expected, the thiazole linker maintained the HDAC inhibitoryactivity, showing IC50 value of 1.48 mM and 0.37 mM in enzymatic(Table 1) and cell-based assay, respectively (Supplementary

Table 1Pan-HDAC inhibition activities of the compounds inScheme 1.

Compound IC50(mM)

MS-275 8.029D 19.183C 29.809D-HA 3.709a 1.48

Figure S5). Our efforts to discover novel HDAC inhibitors, gave anew hydroxamate HDAC inhibitor 9a, and provided a novel scaffoldinvolving styryl linked thiazole moiety as a capping and spacer unitof HDAC inhibitors (Scheme 2).

As summarized in Scheme 3, the synthesis of desired hydrox-amate derivative 9a was initiated from cinnamamide 5. The amidegroup was converted into thioamide 6 using Lawesson's reagent.[42,43] The thioazole derivative 7 was formed by cyclization of 6with bromoketone 4. [44] To prepare bromoketone 4, glutaric an-hydride 1was hydrolyzed with NaOMe, followed by chlorination togive acid chloride 3, which converted into bromokeone 4 viaNierenstein reaction with hydrobromic acid. [45e47] The hydro-lysis of ester 7 with 1NeNaOH gave carboxylic acid 8. Finally, car-boxylic acid was reacted with hydroxyl amine to generatehydroxamate derivative 9a.

We first examined the cytotoxicity of 9a in HeLa cells by MTSassay and the IC50 value was 52 mM, implying that the drug may notbe highly cytotoxic against cancer cells. However, significant anti-inflammatory activity of 9a was observed in LPS-stimulated RAW264.7 cells. Treatment of 9a (0.5e2.5 mM) showed about 50% inhi-bition of LPS-induced increase of TNF-a, IL-6, and NO production,without affecting cell viability. [48] Since severe sepsis is alsorelated with overproduction of TNF-a and NO, we tested the effectof 9a in mice with LPS-induced endotoxemia. As shown in Fig. 2, inthe LPS-treated control group, the survival rate on the first day ofobservation was 70% and reached a stable 20% survival on the fifthday after LPS injection. Log-rank analysis of 10-days survivaldemonstrated that 9a (20 mg/kg i.p. 2 h before and immediatelyafter LPS injection) significantly improved survival rate of sepsis-induced mice, as compared to the control group (P ¼ 0.0483). Thereduction of LPS-induced mortality by 9a may be associated withthe suppression of LPS-induced pro-inflammatory cytokine release.Our result is comparable to the recent study reported by Alam et al.,demonstrating that Tubastatin A improves the survival of cecalligation and puncture (CLP)-induced sepsis mice models and at-tenuates the CLP-induced increase of local and systemic pro-inflammatory cytokine level (TNF-a and IL-6). [49].

Next, we examined whether 9a inhibits the production of TNF-aand IL-6 at the transcription level. Production of TNF-a and IL-6mRNA induced by LPS injection in mouse liver, was measured us-ing real time RT-PCR. Six-hour after LPS injection, mRNA expressionof TNF-a and IL-6 were significantly elevated by 2.3- and 1.8-foldcompared with those of the control group, respectively. Treat-ment of 9a (10 mg/kg) attenuated the LPS-induced over-expressionof TNF-a and IL-6 mRNA (Fig. 3). Taken together, we conclude that9a may inhibit the HDAC6 selectively, repress the LPS-inducedover-expression of pro-inflammatory cytokines, and eventuallyprolong the survival of sepsis-induced mice.

HDAC enzymatic assays and western blot analysis were per-formed to confirm that in vivo anti-sepsis activity of 9a is correlatedwith selective inhibition of HDAC6. HDAC inhibitory activity of 9awas examined with HDAC6 and HDAC1, in comparison withtubastatin A. Compound 9a showed inhibitory potency againstHDAC6 with IC50 values of 199.3 nM and about 70-fold selectivityover HDAC1 (Fig. 4). One of specific substrates for HDAC6 is knownas a-tubulin, whereas HDAC1 is mostly involved in histone deace-tylation. To corroborate selective inhibition of HDAC6 by 9a at acellular level, hyperacetylation of histone H3 and a-tubulin wereexamined by western blot analysis. As shown in Fig. 5, the treat-ment of 2 mM tubastatin A and 10 mM 9a did not lead to hyper-acetylation of histone-H3 significantly, whereas 2 mM TSA, a pan-HDAC inhibitor, produced hyper-acetylated histone H3. TubastatinA and 9a produced dose-dependent increase of hyperacetylatedtubulin. The results supported that 9a selectively inhibits cellularHDAC6 over HDAC1.

Scheme 3. Synthesis of 9a. Reagents and conditions: (a) NaOMe, MeOH, room temperature (rt), 6 h; (b) SOCl2, benzene, reflux, 2 h; (c) i) CH2N2, Et2O, 0 �C, 2 h, ii) HBr, AcOH, rt, 12 h;(d) P2S5, pyridine, 70 �C, 2 h; (e) 4, MeOH, rt, 24 h; (f) 1NeNaOH, THF, MeOH, rt, 2 h; (g) NH2OH$HCl, EDCl, HOBt, Et3N, DMF, rt, 24 h.

Fig. 2. Effects of 9a on LPS-induced lethality.

Fig. 3. Effects of 9a (10 mg/kg) on the LPS-induced mRNA expression of TNF-a and IL-6.

J. Yoo et al. / European Journal of Medicinal Chemistry 116 (2016) 126e135 129

Docking study was performed to examine the binding mode ofHDAC6 selective inhibitor 9a. Homology model of HDAC6 wasestablished using HDAC4 (PDB id: 4CBY) as a template. The activesite of HDAC6 consists of small zinc binding pocket, hydrophobiclinker site (Phe620 and Phe680), [50] and large cap group bindingsite that is able to accommodate structurally diverse moieties. [51]This cap group binding site, which consists of residues such asHis499, His500, and Phe566, is the entrance of HDAC6 with widerrim than HDAC1 (Supplementary Figure S6). [52] Our HDAC6 ho-mology model well defines the binding grooves on the proteinsurface to accommodate hydrophobic and bulky cap groups of se-lective inhibitors. As shown in Fig. 6a, the hydroxamate group of 9aforms hydrogen bonds with His610, His611, and Tyr782 and co-ordinates with catalytic zinc ion in the active site (Zn2þ eO of OH:1.47 Å and Zn2þ eO of carbonyl: 1.96 Å). The thiazole group of

linker is positioned in the tubular access channel and sandwichedbetween Phe620 and Phe680. In particular, the distance betweenthiazole ring and Phe620 is 3.8 Å, which is able to form close vander Waals interaction. The cinnamyl cap group interacts with anopen cavity at the entrance of the binding pocket surrounded byseveral aromatic and hydrophobic residues. The hydroxamategroup of reference compound tubastatin A also forms hydrogenbonds with His611 and Tyr782, and the cap group and phenyl linkeroccupy a region similar to the cinnamyl cap group of 9a (Fig. 6b).Docking results well demonstrates that 9a can bind to the activesite of HDAC6 with intermolecular interactions similar to thoseformed by highly selective HDAC6 inhibitor tubastatin A.

3. Conclusions

In the present study, we successfully demonstrated the use ofcomputational drug design approaches combined with synthesisand in vitro/in vivo assays to identify selective HDAC6 inhibitor 9awith anti-sepsis activity. The structure of 9awas designed based onmild HDAC inhibitor hit compounds identified from virtualscreening of chemical database. A selective HDAC6 inhibitory ac-tivity of 9a was confirmed by enzymatic HDAC assays and westernblot analysis showing dose-dependent increase of tubulin acety-lation without noticeable increase in acetylated histone H3. Inaddition, recombinant human HDAC isoform profiling was carriedout by the Reaction Biology Corp (www.reactionbiology.com), andthe results confirmed the HDAC6-selectivity of 9a (SupplementaryFigure S7). 9a attenuates the expression of LPS-induced pro-in-flammatory cytokines such as TNF-a and IL-6, and thereby im-proves the survival of sepsis mice.

Compound 9a has not only smaller capping group but also moreflexible linker unit than tubastatin A, which may give lowerselectivity of 9a toward HDAC6 compared to tubastatin A. Consid-ering that Wagner et al.'s study suggesting that a bulky cappinggroup is not required for selective inhibition of HDAC6, [55]modification of thiazole-linked alkyl group in 9a may improvethe selectivity. Conclusively, 9a can be used as a lead compound forthe design of selective and potent HDAC6 inhibitor. Further struc-tural optimization of 9a to improve the HDAC6 selectivity andin vivo activity, in parallel with biological mechanistic study, is inprogress to develop antiseptic drug candidates.

4. Materials and methods

4.1. Structure-based virtual screening

The virtual screening strategy was shown in Scheme 1. To

Fig. 4. Selective inhibition of HDAC6 over HDAC1 by 9a.

J. Yoo et al. / European Journal of Medicinal Chemistry 116 (2016) 126e135130

Fig. 5. Western blot analysis of HeLa cell extracts after treated with TSA (Trichostatin A), tubastatin A, and 9a for 24 h. Tubastatin A and 9a selectively increase the acetylated tublin.

J. Yoo et al. / European Journal of Medicinal Chemistry 116 (2016) 126e135 131

conduct the virtual screening, the LeadQuest database (80,600entries) obtained from Tripos, was prepared using SYBYL 8.1. [38]The crystal structure of HDLP bound to TSA was retrieved fromthe Protein Data Bank (PDB entry 1C3R). [39] 3D database screeningusing UNITY module implemented in SYBYL packages performed apre-filtering of database compounds discarding all molecules thatdo not match pharmacophore queries based on X-ray crystalstructure of HDLP. As shown in Supplementary Figure S1, thefollowing queries were set up: (1) OH of Tyr297 as a receptor donorand corresponding ligand acceptor site (2) the phenyl ring of TSA ashydrophobic feature (3) R1, R2, and R3 can be substitute with anyother group or atoms. (4) distance constraints, R2-C1: 2.45 ± 0.10 Å,and hydrophobic feature-R1 and C1: 3.97 ± 0.10 Å and 9.05 ± 0.10 Å,respectively. DOCK 4.0 [53] and FlexX [54] implemented in SYBYL6.81 were used as the docking tool targeting at TSA binding site ofHDLP. The candidate compoundswith best docked poses and scoreswere selected by visual inspection for experimental test.

4.2. Procedures for synthesis of compounds 2, 3, 4, 6, 7, 8 and 9a

Proton and carbon nuclear magnetic resonance (1H and 13CNMR) spectra were recorded with a Varian Unity Inova 300 and500 MHz spectrometer for CDCl3 and DMSO-d6 solutions andchemical shifts (d) are reported as part per million (ppm). Coupling

constant (J) is reported in hertz (Hz). Thin layer chromatography(TLC) was carried out using Kiesegel 60F254 (Merk Co.) silica gelplates. Flash column chromatographywas performedwith E. MerckKiesegel 60 (230e400 mesh ASTM). All reactions were carried outunder nitrogen or argon atmosphere.

4.2.1. Glutarate (2)To a solution of glutaric anhydride (5.0 g, 44 mmol) in methanol

(15 mL), sodium methoxide (50 mg, 1 mmol) was added, and themixture was stirred for 6 h at room temperature. After completeevaporation of the solvent under reduced pressure, the residue wasused in the next step directly without any further purification.

4.2.2. Methyl 5-chloro-5-oxopentanoate (3)To a solution of crudemonomethylglutarate in absolute benzene

(20 mL) dimethylformamide (2 drops) was added and thionylchloride (6.9 mL, 94.3 mmol) was dropwise at room temperaturefor 30 min. The reaction mixture was refluxed for 3 h. Solvent wasremoved in vacuo, and the residue was used in the next stepdirectly without any further purification.

4.2.3. Methyl 6-bromo-5-oxohexanoate (4)Methyl 5-chloro-5-oxopentanoate (4.0 g, 24.3 mmol) was added

to a solution of diazomethane (121.6 mmol) in diethylether

Fig. 6. Docking poses (left) and top views (right) of (A) 9a (carbon atoms in cyan) and (B) tubastatin A (carbon atoms in yellow). The hydrophobic channels for linker unit of 9a andtubastatin A are shown as mesh contour surface. Zinc ion is represented by magenta ball. Hydrogen bonds between the ligand and side chains are shown in dashed yellow lines. (Forinterpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

J. Yoo et al. / European Journal of Medicinal Chemistry 116 (2016) 126e135132

(400 mL) at 0 �C under N2. After 2 h, N2 was bubbled through thesolution to remove excess CH2N2. The residue was treated withglacial acetic acid (10 mL) and hydrobromic acid (33% in acetic acid,5 mL) was dropwise. The mixture was allowed to warm to roomtemperature for 24 h. The reaction mixture was washed withsaturated sodium bicarbonate solution and water. The organic layerwas dried over MgSO4, filtered and evaporated. The residue waspurified by column chromatography (Hexane: EtOAc ¼ 4:1) to givethe 4. (2.4 g, 25% for 4 steps); 1H NMR (300 MHz, CDCl3): d 3.88 (s,2H), 3.68 (s, 3H), 2.75 (t, J ¼ 4.0 Hz, 2H), 2.37 (t, J ¼ 4.0 Hz, 2H), 1.95(q, J ¼ 4.0 Hz, 2H).

4.2.4. (E)-3-Phenylprop-2-enethioamide (6)Phosphorus pentasulfide (1.11 g, 5 mmol) was added portion-

wise to a stirred solution of cinnamamide (1.47 g, 10 mmol) inanhydrous pyridine (4.4 mL). The resulting yellow/orange solutionwas heated at reflux for 2 h, and then allowed to cool to roomtemperature. The mixture was poured into water (10 mL) and thenextracted with diethyl ether (3 � 10 mL). The combined extractswere washed with 1NeHCl, then water, and dried over MgSO4.After filtration, the solvent was removed by evaporation in vacuo togive a brown solid. Crystallisation from benzene gave yellow nee-dles (1.07 g, 66%); 1H NMR (300 MHz, CDCl3): d 7.78 (d, J ¼ 15.0 Hz,1H), 7.58e7.55 (m, 2H), 7.45e7.37 (m, 5H), 6.88 (d, J ¼ 15.0 Hz, 1H).

4.2.5. (E)-Methyl 4-(2-styrylthiazol-4-yl)butanoate (7)The mixture of (E)-3-phenylprop-2-enethioamide (79 mg,

0.48 mmol) and methyl 6-bromo-5-oxohexanoate (72 mg,0.32 mmol) in MeOH (2 mL) was stirred overnight at room tem-perature. The reaction mixture was concentrated by evaporationand the residue was purified by column chromatography (Hexane :EtOAc ¼ 4:1) to give 7 (72 mg, 78%); 1H NMR (300 MHz, CDCl3):d 7.53 (s, 1H), 7.51 (s, 1H), 7.40e7.23 (m, 5H), 6.84 (s, 1H), 3.68 (s,3H), 2.83 (t, J ¼ 7.5 Hz, 2H), 2.40 (t, J ¼ 7.5 Hz, 2H), 2.13e2.03 (m,2H).

4.2.6. (E)-4-(2-Styrylthiazol-4-yl)butanoic acid (8)To a solution of (E)-methyl 4-(2-styrylthiazol-4-yl)butanoate

(1.0 g, 3.48 mmol) in THF (6 mL) and MeOH (6 mL) 1NeNaOH(6 mL) was added. The reaction mixture was stirred at room tem-perature for 2 h, then the solvent was evaporated. The aqueouslayer was acidified with 10% aqueous citric acid solution (pH 3.0)and extracted with ethyl acetate. The organic layer was dried(MgSO4), filtered and solvent was evaporated. The residuewas usedin the next step directly without any further purification.

4.2.7. (E)-N-Hydroxy-4-(2-styrylthiazol-4-yl)butanamide (9a)To a stirred solution of crude (E)-4-(2-styrylthiazol-4-yl)buta-

noic acid in anhydrous DMF (22 mL) 1-hydroxybenzotriazole

J. Yoo et al. / European Journal of Medicinal Chemistry 116 (2016) 126e135 133

hydrate (0.66 g, 4.9 mmol) was added at room temperature fol-lowed by 1-(3-dimethylamino propyl)-3-ethyl-carbodiimide hy-drochloride (EDC, 0.85 g, 5.7 mmol). After stirring for 1 h,hydroxylamine hydrochloride (0.29 g, 4.15 mmol) and Et3N (574 mL,4.15 mmol) were added, and stirring was continued at room tem-perature overnight. The solvent was removed in vacuo, and theresidue was diluted with ethyl acetate and then was washed withsaturated aqueous NaHCO3. The organic layer was dried (MgSO4),filtered and concentrated in vacuo. The residue was purified byflash chromatography (10% methanol in chloroform) to give 9a(0.4 g, 40% for 2 steps). 1H NMR (500 MHz, DMSO-d6): d10.36 (s,1H), 8.67 (s, 1H), 7.69 (s, 1H), 7.67 (s, 1H), 7.41e7.32 (m, 5H), 7.26 (s,1H), 2.70 (t, J¼ 7.5 Hz, 2H), 2.02 (t, J ¼ 7.5 Hz, 2H), 1.89 (t, J¼ 7.5 Hz,2H); 13C NMR (125 MHz, DMSO-d6): d169.57, 166.07, 136.32, 133.92,129.55, 129.50, 127.88, 122.18, 116.54, 114.62, 32.49, 31.08, 25.52;ESI-HRMS: calc. for C15H16N2O2S; [M þ H]þ ¼ m/z 288.0932 ,found: [M þ H]þ ¼ m/z 288.0930.

4.3. HDAC enzymatic assay

Pan-HDAC fluorescent activity was measured in vitro Fluor deLys substrate (Biomol, Plymouth Meeting, PA), which contains anacetylated lysine side chain, according to manufacturer's in-structions and Glomax multi plus (Promega), micro-platespectrofluorometer was used with excitation at 355 nm andemission at 460 nm. The total pan-HDAC assay volume was 25 mland all the assay components were diluted in HDAC assay buffer(50mM Tris/Cl, pH 8.0, 137mMNaCl, 2.7 mMKCl and 1mMMgCl2).The reaction was carried out in half-volume white 96-well plates(Costar 3693). In brief, the pan-HDAC assay mixture containedHDAC substrate (116 mM, 12.5 ml), HeLa nuclear extract (0.5 ml ofextract diluted to 7.5 ml final volume), and drug (diluted to 5 ml finalvolume). Positive controls contained all the above componentsexcept the inhibitor. The negative controls contained neitherenzyme nor inhibitor. In each case these were replaced with anequivalent volume of buffer. The assay components were incubatedat room temperature for 20 min. The reaction was quenched with25 ml HDAC-FDL Developer (KI-105; Biomol) diluted to 20-fold incold assay buffer containing 2 mM TSA. The plates were incubatedfor 20 min at room temperature (22e22 �C) to allow the fluores-cence signal to develop.

The HDAC subtype selectivity was tested to compare theinhibitory effect on the HDAC6 versus HDAC1, by using HDAC6 and1 Fluorimetric Drug Discovery kit (Enzo life science, BML-AK511-0001, BML-AK516-0001). HDAC6 selective inhibitor tubastatin Awas used as a reference. Assays were carried out two steps inaccordance with protocol of the kit. Total HDAC assay volume is50 ml per well. Developer is diluted in HDAC assay buffer (50mMTris/Cl, pH 8.0,137mMNaCl, 2.7mMKCl,1 mMMgCl2). The restof assay components are preparedwith HDAC assay bufferⅡ (50mMTris/Cl, pH8.0, 137 mM NaCl, 2.7 mM KCl, 1 mM MgCl2, 2 mg/mlBSA). All reactions were conducted in half-volume white 96-wellplates (Costar 3693). The first step can be done by reacting HDACsubtype enzyme with HDAC assay mixture. HDAC reaction mixtureincludes substrate solution (1x, 12.5 ml per well) which comprisesan acetylated lysine side chain, diluted HDAC1 or 6 (7.5 ml contains0.3 ug HDAC1 or 6 enzyme perwell) (except for no enzyme control).Compounds were diluted with DMSO (1 ml final volume per well)and delivered to HDAC mixture with incubation of 15 min at roomtemperature. After incubation, in the second step, we treateddeveloper (1x, 25 ml/well) which produces a fluorophore by react-ing with deacetylated substrate and incubated plate at 37 �C for45 min. The fluorescence are determined using Glomax multi plus(Promega) at a wavelength with excitation in the range350e380 nm and emission in the range 440e460 nm. The relative

enzymatic activity (in percent) was shown as the mean value oftriplicate experiments. Dose-response curves and values weregenerated from resulting plots using GraphPad Prism 6 program.

4.4. Western blot analysis

HeLa cells were treated with compound at a dose range of100 nM to 100 mM for 24 h. Sample proteins were processed usingNuclear extract kit (Active motif) and quantified using Bradfordprotein assay (Bio-Rad). Protein samples were electrophoresedon15% SDSepolyacrylamide gels and transferred to a membrane.Membranes were blocked with 8% skim milk in TBSeTween(10 mM TriseHCl (pH 7.5), 150 mMNaCl and 0.1% Tween 20) andprobed with anti-acetylated tubulin (6-11B-1; Sigma) or anti-a-tubulin (B-5-1-2; Sigma) at a dilution of 1:2000 and anti-acetylated histone H3 (06-599; Millipore). Both tubulin andacetyl-tubulin have a molecular mass of about 50 kDa. To re-probethe samemembranewith acetyl-tubulin, membranewas incubatedfor 20 min at room temperature in stripping buffer (ATTO). Resultsof blots were imaged using ChemiDoc (Davinch-chemiTM).

4.5. Animals and experimental models of sepsis

Male ICR mice (27e29 g) were supplied by Daehan-Biolink Co.(Eum-Sung, Korea). The animals were housed in cages located intemperature-controlled rooms with a 12 h lightedark cycle andrecieved water and food ad libitum. All animal procedures wereapproved by the Sungkyunkwan University Animal Care Commit-tee and were performed in accordance with the guidelines of theNational Institutes of Health (NIH publication No. 86-23, revised1985). Endotoxemia was induced by intraperitoneal injection oflipopolysaccharide 10 mg/kg (LPS; Escherichia coli serotypeO111:B4; SigmaeAldrich, St. Louis, MO, USA). The mice intraperi-toneally received vehicle (5% DMSO-contained saline), 9a, 5, 10, or20 mg/kg 2 h before and immediately after LPS injection. The ani-mals were randomly assigned to the following 5 groups: (a)vehicle-treated control (control), (b) vehicle-treated LPS (LPS), (c-e)9a, 5,10, or 20mg/kg-treated LPS (LPSþ 9a, 5, 10, or 20mg/kg). Theanimals were monitored for survival for up to 10 days. In parallelexperiments, mice were euthanized to collect blood samples fromthe abdominal inferior vena cava at 6 h of LPS injection.

4.6. Real-time reverse-transcription polymerase chain reaction (RT-PCR)

Total RNA was extracted from liver tissue using RNAiso (TakaraBio Inc., Shiga, Japan) according to the manufacturer's protocol.Reverse transcription of total RNA was performed for synthesis ofcDNA using EcoDry Synthesis Premix (Takara Bio Inc.). RT-PCR wasperformed using the LightCyclerNano instrument (Roche AppliedScience, Mannheim, Germany). The gene-specific primers used arelisted in Table 2. The PCR amplification cycling conditions were asfollows: holding 94 �C for 300 s; 94 �C for 30 s, 65 �C for 30 s, 72 �Cfor 30 s, total of 28 cycles for TNF-a; 94 �C for 30 s, 54 �C for 30 s,72 �C for 30 s, total of 25 cycles for IL-6 and b-actin.

4.7. Molecular modeling

4.7.1. Homology modeling of HDAC6Human HDAC6 sequence was obtained from UniProt database

(www.uniprot.org). For HDAC6, modeling focused on the catalyticdomain II subunit (Gly481-Gly801), a functional domain of HDAC6.Homologymodels were generated for HDAC6 by Sybyl-X 2.1.1 usingtemplate of HDAC4 (PDB id: 2VQQ, 2VQV, 2VQW, 4CBT, and 4CBY).To arrange zinc at catalytic site, zinc ion and chelating residues

Table 2PCR primers used in this study.

Gene (Accession number) Primer sequences (5' / 30)

TNF-a Sense: GGTGGTGCGAGAAGACAGATG(NM_013693) Antisense: AGGGTCTGGGCCATAGAACTIL-6 Sense: ACTACGTGAACGTCTTTTGT(NM_031168) Antisense: ACCAGAGGAAATTTTCAATAGGCb-actin Sense: GCCAAGGCTACGGGACTCCGAGAA(NM_007393) Antisense: CGTCACACTTCATGATGGAATTGA

J. Yoo et al. / European Journal of Medicinal Chemistry 116 (2016) 126e135134

were extracted from the template HDAC4, and merged into theconstructed models. An energy minimization was performed byfixing the backbone and zinc ion. The homology models werevalidated by examining correlation between biological activity forknown HDAC6 inhibitors and Surflex-dock score. Among them, themodel using 4CBY (sequence identify 49.57%) as a template, pro-vided the most reliable re-docking results, and was used fordocking analysis for 9a.

4.7.2. Docking modelingDocking study were carried out on HDAC6 model by Surflex-

dock in Sybyl-X 2.1.1, operating under Linux OS (CentOS release5.9). The program generated the protomol in the active site ofHDAC6 including zinc ion and key residueswithin a 3 Å radius, suchas His610, His611, Tyr782, Phe620, and Phe680, with a threshold of0.50 and bloat set to 0. Each atom on the protein and ligand islabeled as nonpolar (e.g., the H of a CeH) or polar (e.g., the H of anNeH or the O of a C]O), and generated protomol mimics theintermolecular interactions between drug and HDAC6. The struc-tures of known inhibitors and 9awere energy-minimized using theconjugated gradient method with Gasteiger-Hückel charge until aconvergence value of 0.001 kcal/(Å�mol), using the Tripos forcefield. The main setting was 50 solutions per each compound andother parameters accepted the Surflex-Dock Geom settings. Sur-flex-Dock's scoring function was trained to estimate the dissocia-tion constant (Kd) expressed in elog (Kd) unit. Then, the best posesfrom each run were combined and re-ranked using a consensusscoring (CScore). We selected good binding pose, with Cscore over4 and Surflex-Dock total score higher than 5.0. Docking of 9a andtubastatin A against HDAC1 (PDB id: 4BKX) were performedfollowing the same method described above.

Acknowledgment

This research was supported by Basic Science Research Programthrough the National Research Foundation of Korea (NRF) fundedby the Ministry of Education (NRF-2012R1A5A2A28671860).

Appendix A. Supplementary data

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.ejmech.2016.03.046.

References

[1] H.J. Kim, S.C. Bae, Histone deacetylase inhibitors: molecular mechanisms ofaction and clinical trials as anti-cancer drugs, Am. J. Transl. Res. 3 (2011)166e179.

[2] J.M. Sun, V.A. Spencer, H.Y. Chen, L. Li, J.R. Davie, Measurement of histoneacetyltransferase and histone deacetylase activities and kinetics of histoneacetylation, Methods 31 (2003) 12e23.

[3] I. Rahman, J. Marwick, P. Kirkham, Redox modulation of chromatin remod-eling: impact on histone acetylation and deacetylation, NF-kappaB and pro-inflammatory gene expression, Biochem. Pharmacol. 68 (2004) 1255e1267.

[4] T. Kouzarides, Chromatin modifications and their function, Cell 128 (2007)693e705.

[5] M. Haberland, R.L. Montgomery, E.N. Olson, The many roles of histone

deacetylases in development and physiology: implications for disease andtherapy, Nat. Rev. Genet. 10 (2009) 32e42.

[6] Z. Xu, H. Li, P. Jin, Epigenetics-based therapeutics for neurodegenerative dis-orders, Curr. Transl. Geriatr. Exp. Gerontol. Rep. 1 (2012) 229e236.

[7] N. Ma, Y. Luo, Y. Wang, C. Liao, W.C. Ye, S. Jiang, Selective histone deacetylaseinhibitors with anticancer activity, Curr. Top. Med. Chem. 16 (2016) 415e426and references therein.

[8] M.R. Shakespear, M.A. Halili, K.M. Irvine, D.P. Fairlie, M.J. Sweet, Histonedeacetylases as regulators of inflammation and immunity, Trends Immunol.32 (2011) 335e343.

[9] D.M. Chuang, Y. Leng, Z. Marinova, H.J. Kim, C.T. Chiu, Multiple roles of HDACinhibition in neurodegenerative conditions, Trends Neurosci. 32 (2009)591e601.

[10] S.R. Bhaumik, E. Smith, A. Shilatifard, Covalent modifications of histonesduring development and disease pathogenesis, Nat. Struct. Mol. Biol. 14(2007) 1008e1016.

[11] P.A. Marks, R. Breslow, Dimethyl sulfoxide to vorinostat: development of thishistone deacetylase inhibitor as an anticancer drug, Nat. Biotechnol. 25 (2007)84e90.

[12] R.M. Poole, Belinostat: first global approval, Drugs 74 (2014) 1543e1554.[13] K.P. Garnock-Jones, Panobinostat: first global approval, Drugs 75 (2015)

695e704.[14] K.M. VanderMolen, W. McCulloch, C.J. Pearce, N.H. Oberlies, Romidepsin

(Istodax, NSC 630176, FR901228, FK228, depsipeptide): a natural productrecently approved for cutaneous T-cell lymphoma, J. Antibiot. (Tokyo) 648(2011) 525e531.

[15] M. Dong, Z.Q. Ning, P.Y. Xing, J.L. Xu, H.X. Cao, G.F. Dou, Z.Y. Meng, Y.K. Shi,X.P. Lu, F.Y. Feng, Phase I study of chidamide (CS055/HBI-8000), a new histonedeacetylase inhibitor, in patients with advanced solid tumors and lymphomas,Cancer Chemother. Pharmacol. 69 (2012) 1413e1422.

[16] Z. Yu, W. Zhang, B.C. Kone, Histone deacetylases augment cytokine inductionof the iNOS gene, J. Am. Soc. Nephrol. 13 (2002) 2009e2017.

[17] F. Leoni, A. Zaliani, G. Bertolini, G. Porro, P. Pagani, P. Pozzi, G. Dona, G. Fossati,S. Sozzani, T. Azam, P. Bufler, G. Fantuzzi, I. Goncharov, S.H. Kim,B.J. Pomerantz, L.L. Reznikov, B. Siegmund, C.A. Dinarello, P. Mascagni, Theantitumor histone deacetylase inhibitor suberoylanilide hydroxamic acidexhibits antiinflammatory properties via suppression of cytokines, Proc. Natl.Acad. Sci. U. S. A. 99 (2002) 2995e3000.

[18] M. Dokmanovic, C. Clarke, P.A. Marks, Histone deacetylase inhibitors: over-view and perspectives, Mol. Cancer Res. 5 (2007) 981e989.

[19] Y. Li, D. Shin, S.H. Kwon, Histone deacetylase 6 plays a role as a distinctregulator of diverse cellular processes, Febs J. 280 (2013) 775e793.

[20] Y. Zhang, N. Li, C. Caron, G. Matthias, D. Hess, S. Khochbin, P. Matthias, HDAC-6interacts with and deacetylates tubulin and microtubules in vivo, Embo J. 22(2003) 1168e1179.

[21] C. Hubbert, A. Guardiola, R. Shao, Y. Kawaguchi, A. Ito, A. Nixon, M. Yoshida,X.F. Wang, T.P. Yao, HDAC6 is a microtubule-associated deacetylase, Nature417 (2002) 455e458.

[22] A. Matsuyama, T. Shimazu, Y. Sumida, A. Saito, Y. Yoshimatsu, D. Seigneurin-Berny, H. Osada, Y. Komatsu, N. Nishino, S. Khochbin, S. Horinouchi,M. Yoshida, In vivo destabilization of dynamic microtubules by HDAC6-mediated deacetylation, Embo J. 21 (2002) 6820e6831.

[23] X. Zhang, Z. Yuan, Y. Zhang, S. Yong, A. Salas-Burgos, J. Koomen, N. Olashaw,J.T. Parsons, X.J. Yang, S.R. Dent, T.P. Yao, W.S. Lane, E. Seto, HDAC6 modulatescell motility by altering the acetylation level of cortactin, Mol. Cell 27 (2007)197e213.

[24] J.J. Kovacs, P.J. Murphy, S. Gaillard, X. Zhao, J.T. Wu, C.V. Nicchitta, M. Yoshida,D.O. Toft, W.B. Pratt, T.P. Yao, HDAC6 regulates Hsp90 acetylation andchaperone-dependent activation of glucocorticoid receptor, Mol. Cell 18(2005) 601e607.

[25] B. Barneda-Zahonero, M. Parra, Histone deacetylases and cancer, Mol. Oncol. 6(2012) 579e589.

[26] G. Li, H. Jiang, M. Chang, H. Xie, L. Hu, HDAC6 alpha-tubulin deacetylase: apotential therapeutic target in neurodegenerative diseases, J. Neurol. Sci. 304(2011) 1e8.

[27] G.I. Aldana-Masangkay, K.M. Sakamoto, The role of HDAC6 in cancer,,J. Biomed. Biotechnol. 2011 (2011) 875824. Article ID.

[28] S. Dallavalle, C. Pisano, F. Zunino, Development and therapeutic impact ofHDAC6-selective inhibitors, Biochem. Pharmacol. 84 (2012) 756e765.

[29] S.J. Haggarty, K.M. Koeller, J.C. Wong, C.M. Grozinger, S.L. Schreiber, Domain-selective small-molecule inhibitor of histone deacetylase 6 (HDAC6)-medi-ated tubulin deacetylation, Proc. Natl. Acad. Sci. U. S. A. 100 (2003)4389e4394.

[30] A.V. Bieliauskas, M.K. Pflum, Isoform-selective histone deacetylase inhibitors,Chem. Soc. Rev. 37 (2008) 1402e1413.

[31] N. Khan, M. Jeffers, S. Kumar, C. Hackett, F. Boldog, N. Khramtsov, X.Z. Qian,E. Mills, S.C. Berghs, N. Carey, P.W. Finn, L.S. Collins, A. Tumber, J.W. Ritchie,P.B. Jensen, H.S. Lichenstein, M. Sehested, Determination of the class andisoform selectivity of small-molecule histone deacetylase inhibitors, Biochem.J. 409 (2008) 581e589.

[32] K.V. Butler, J. Kalin, C. Brochier, G. Vistoli, B. Langley, A.P. Kozikowski, Rationaldesign and simple chemistry yield a superior, neuroprotective HDAC6 in-hibitor, tubastatin A, J. Am. Chem. Soc. 132 (2010) 10842e10846.

[33] R. De Vreese, T. Verhaeghe, T. Desmet, M. D'Hooghe, Potent and selectiveHDAC6 inhibitory activity of N-(4-hydroxycarbamoylbenzyl)-1,2,4,9-

J. Yoo et al. / European Journal of Medicinal Chemistry 116 (2016) 126e135 135

tetrahydro-3-thia-9-azafluorenes as novel sulfur analogues of Tubastatin A,Chem. Commun. (Camb) 49 (2013) 3775e3777.

[34] S. Vishwakarma, L.R. Iyer, M. Muley, P.K. Singh, A. Shastry, A. Saxena,J. Kulathingal, G. Vijaykanth, J. Raghul, N. Rajesh, S. Rathinasamy,V. Kachhadia, N. Kilambi, S. Rajgopal, G. Balasubramanian, S. Narayanan,Tubastatin, a selective histone deacetylase 6 inhibitor shows anti-inflammatory and anti-rheumatic effects, Int. Immunopharmacol. 16 (2013)72e78.

[35] S. Ahmed, S. Riegsecker, M. Beamer, A. Rahman, J.V. Bellini, P. Bhansali,L.M. Tillekeratne, Largazole, a class I histone deacetylase inhibitor, enhancesTNF-alpha-induced ICAM-1 and VCAM-1 expression in rheumatoid arthritissynovial fibroblasts, Toxicol. Appl. Pharmacol. 270 (2013) 87e96.

[36] L. Santo, T. Hideshima, A.L. Kung, J.C. Tseng, D. Tamang, M. Yang, M. Jarpe,J.H. van Duzer, R. Mazitschek, W.C. Ogier, D. Cirstea, S. Rodig, H. Eda,T. Scullen, M. Canavese, J. Bradner, K.C. Anderson, S.S. Jones, N. Raje, Pre-clinical activity, pharmacodynamic, and pharmacokinetic properties of a se-lective HDAC6 inhibitor, ACY-1215, in combination with bortezomib inmultiple myeloma, Blood 119 (2012) 2579e2589.

[37] E.F. de Zoeten, L. Wang, K. Butler, U.H. Beier, T. Akimova, H. Sai, J.E. Bradner,R. Mazitschek, A.P. Kozikowski, P. Matthias, W.W. Hancock, Histone deace-tylase 6 and heat shock protein 90 control the functions of Foxp3(þ) T-reg-ulatory cells, Mol. Cell Biol. 31 (2011) 2066e2078.

[38] G. Klebe, Virtual ligand screening: strategies, perspectives and limitations,Drug Discov. Today 11 (2006) 580e594.

[39] M.S. Finnin, J.R. Donigian, A. Cohen, V.M. Richon, R.A. Rifkind, P.A. Marks,R. Breslow, N.P. Pavletich, Structures of a histone deacetylase homologuebound to the TSA and SAHA inhibitors, Nature 401 (1999) 188e193.

[40] H. Claussen, M. Gastreich, V. Apelt, J. Greene, S.A. Hindle, C. Lemmen, TheFlexX database docking environmenterational extraction of receptor basedpharmacophores, Curr. Drug Discov. Technol. 1 (2004) 49e60.

[41] K.A. Usmani, E.D. Karoly, E. Hodgson, R.L. Rose, In vitro sulfoxidation of thi-oether compounds by human cytochrome P450 and flavin-containing mon-ooxygenase isoforms with particular reference to the CYP2C subfamily, DrugMetab. Dispos. 32 (2004) 333e339.

[42] Z. Majer, M. Zewdu, M. Holl�osi, J. Sepr�odi, Z. Vad�asz, I.Tepl�an, Solid phasesynthesis of a GHRP analog containing C-terminal thioamide group, Biochem.Biophys. Res. Commun. 150 (1988) 1017e1020.

[43] K. Nakayama, Y. Ishida, M. Ohtsuka, H. Kawato, K. Yoshida, Y. Yokomizo,S. Hosono, T. Ohta, K. Hoshino, H. Ishida, K. Yoshida, T.E. Renau, R. Leger,J.Z. Zhang, V.J. Lee, W.J. Watkins, MexAB-OprM-specific efflux pump inhibitors

in Pseudomonas aeruginosa. Part 1: discovery and early strategies for leadoptimization, Bioorg Med. Chem. Lett. 13 (2003) 4201e4204.

[44] Y. Dai, Y. Guo, M.L. Curtin, J. Li, L.J. Pease, J. Guo, P.A. Marcotte, K.B. Glaser,S.K. Davidsen, M.R. Michaelides, A novel series of histone deacetylase in-hibitors incorporating hetero aromatic ring systems as connection units,Bioorg Med. Chem. Lett. 13 (2003) 3817e3820.

[45] D.A. Clibbens, M. Nierenstein, CLXV.-The action of diazomethane on somearomatic acyl chlorides, J. Chem. Soc. Trans. 107 (1915) 1491e1494.

[46] P. Brown, D.T. Davies, P.J. O'Hanlon, J.M. Wilson, The chemistry of Pseudo-monic acid. 15. Synthesis and antibacterial activity of a series of 5-alkyl, 5-alkenyl, and 5-heterosubstituted oxazoles,, J. Med. Chem. 39 (1996) 446e457.

[47] J.J. Richards, T.E. Ballard, C. Melander, Inhibition and dispersion of Pseudo-monas aeruginosa biofilms with reverse amide 2-aminoimidazole oroidinanalogues, Org. Biomol. Chem. 6 (2008) 1356e1363.

[48] S.J. Kim, K.S. Baek, H.J. Park, Y.H. Jung, S.M. Lee, Compound 9a, a novel syn-thetic histone deacetylase inhibitor, protects against septic injury in mice bysuppressing MAPK signalling, Br. J. Pharmacol. 173 (2016) 1045e1057.

[49] Y. Li, T. Zhao, B. Liu, I. Halaweish, R. Mazitschek, X. Duan, H.B. Alam, Inhibitionof histone deacetylase 6 improves long-term survival in a lethal septic model,J. Trauma Acute Care Surg. (2015) 378e385.

[50] G. Estiu, E. Greenberg, C.B. Harrison, N.P. Kwiatkowski, R. Mazitschek,J.E. Bradner, O. Wiest, Structural origin of selectivity in class II-selective his-tone deacetylase inhibitors, J. Med. Chem. 51 (2008) 2898e2906.

[51] S. Schafer, L. Saunders, E. Eliseeva, A. Velena, M. Jung, A. Schwienhorst,A. Strasser, A. Dickmanns, R. Ficner, S. Schlimme, W. Sippl, E. Verdin, M. Jung,Phenylalanine-containing hydroxamic acids as selective inhibitors of class IIbhistone deacetylases (HDACs), Bioorg Med. Chem. 16 (2008) 2011e2033.

[52] S. Schafer, L. Saunders, S. Schlimme, V. Valkov, J.M. Wagner, F. Kratz, W. Sippl,E. Verdin, M. Jung, Pyridylalanine-containing hydroxamic acids as selectiveHDAC6 inhibitors, ChemMedChem 4 (2009) 283e290.

[53] T.J.A. Ewing, I.D. Kuntz, Critical evaluation of search algorithms for automatedmolecular docking and database screening, J. Comput. Chem. 18 (1997)1175e1189.

[54] D. Hoffmann, B. Kramer, T. Washio, T. Steinmetzer, M. Rarey, T. Lengauer,Two-stage method for protein-ligand docking, J. Med. Chem. 42 (1999)4422e4433.

[55] F.F. Wagner, D.E. Olson, J.P. Gale, T. Kaya, M. Weïwer, N. Aidoud, M. Thomas,E.L. Davoine, B.C. Lemercier, Y.-L. Zhang, E.B. Holson, Potent and selectiveinhibition of histone deacetylase 6 (HDAC6) does not require a surface-binding motif, J. Med. Chem. 56 (2013) 1772e1776.