Epigenetic Regulation of V(D)J Recombination in Early B ... · verschlossen werden, wurde zusätzlich zu den mit zugänglichem Chromatin ko- rrelierten Modi kationen die Histon H3

Epigenetic Regulation of V(D)J

Recombination in Early B Cell

Development

Den Naturwissenschaftlichen Fakultäten

der Friedrich-Alexander-Universität Erlangen-Nürnberg

zur

Erlangung des Doktorgrades

vorgelegt von

Stefan Lang

aus Nürnberg

mailto:[email protected]

Als Dissertation genehmigt von den Narurwissen-

schaftlichen Fakultäten der Universität Erlangen-Nürnberg

Tag der Mündlichen Prüfung: 19.02.2008

Vorsitzender

der Promotionskommission: Prof. Dr. Eberhard Bänsch

Erstberichterstatter: Prof. Dr. Thomas Winkler

Zweitberichterstatter: Prof. Dr. Dr. André Gessner

I would like to dedicate this thesis to my wife Geraldine and my two children

Tabea and Tizian, that all three of them tried hardest to accept my ill

moods during the writing process, my parents, that made this work possible

with their babysitting e�ort during my wife's practical year and my

parents-in-law that did as much they could to aid in this babysitting-mission

in the �nal months and whenever things got out of hand.

Zusammenfassung

Die Immunglobulin (Ig) - und T-Zell-Rezeptor (TCR) - Genorte werden nur

im Zuge der B- und T-Zell Entwicklung umgelagert, da nur in diesen Zellen das

notwendige RAG Enzym gebildet wird. Die Ig-Genorte werden nur in B-Zellen

und die TCR-Genorte nur in T Zellen vollständig umgelagert obwohl das RAG-

Enzym in beiden Zelltypen aktiv ist. Daher wurde die Hypothese aufgestellt,

dass die V(D)J Rekombination über die zelltypspezi�sche Zugänglichkeit der

Ig- und TCR-Genorte reguliert wird. Die Zugänglichkeit für den Transkrip-

tionsapparat korreliert mit posttranslationalen Modi�kationen der Histone,

wie der Histon H3 Acetylierung (H3Ac) und der Dimethylierung am Lysin 4

des Histon H3 (H3K4Me2). Da zeitgleich zur V(D)J-Rekombination auch

sterile Transkripte an den Ig und TCR Genorten gefunden werden, wurden in

dieser Arbeit die H3Ac und H3K4Me2 Modi�kationen in hoher Au�ösung an

den Ig- und TCR-Genorten kartiert. Um zu analysieren, ob die Genorte in

rekombinationskompetenten Zellen geö�net, oder in nicht kompetenten Zellen

verschlossen werden, wurde zusätzlich zu den mit zugänglichem Chromatin ko-

rrelierten Modi�kationen die Histon H3 Lysin 9 tri-Methylierung (H3K9Me3)

analysiert, die mit unzugänglichem Chromatin korreliert.

Der erste Rekombinationsschritt in proB Zellen ist die VDJ Rekombination der

schweren Kette (IgH Lokus), wohingegen in proT Zellen der IgH Lokus teil-

weise umgelagert wird (DJ) und die Genorte der β Kette (TCRβ), der δ Kette

(TCRδ) und der γ Kette (TCRγ) vollständig umgelagert werden. In dieser Ar-

beit wird gezeigt, dass in Zellen, die die RAG-Rekombinase nicht exprimieren

können (Rag−/−) alle rekombinationskompetenten J Segmente in ausgedehnten

Chromatin Domänen liegen, die ausgeprägte H3Ac und H3K4Me2 Modi�ka-

tionen zeigen. Nur die JH Segmente zeigen zusätzlich H3K9Me3 Modi�katio-

nen in proB und proT Zellen. Rekombinationskompetente V Segmente zeigen

deutlich weniger H3Ac und H3K4Me2 Modi�kationen, die am IgH Genort

nicht mit der Fequenz korrelieren, in der VH Segmente in VDJH Rekombina-

tionsereignissen gefunden werden. Im Gegensatz zu den VH Segmenten zeigen

drei intergene Regionen in der distalen VH Region (IVARs) starke H3Ac und

H3K4Me2 Modi�kationen. Hier wird gezeigt, dass das am weitesten proxi-

mal gelegene IVAR Element schwache Promoter Aktivität hat und in proB

Zellen an dieser Region in beiden Orientierungen Transkripte starten. Daher

sprechen die Daten in dieser Arbeit weder für eine epigenetisch regulierte Ö�-

nung der V Regionen auf Basis von H3Ac oder H3K4Me2 Modi�kationen an

den V Segmenten, noch für den epigenetischen Ausschluss einzelner Genorte

von der V(D)J Rekombination auf der Basis von H3K9Me3 Modi�kationen an

den V Segmenten.

Es wurde publiziert, dass der IgH Genort zum Zeitpunkt der Rekombination

in Schleifen gelegt wird ('locus contraction') und aktive Transkription vom

komplementären Strang der DH Region und der VH Region statt�ndet. Die

Schleifenbildung und die Transkription könnten funktionell gekoppelt sein,

da Orte aktiver Transkription in vivo zu sogenannten 'transcription factories'

zusammengelegt werden. Da die RNA-Polymerasen in diesen Fabriken fest ve-

rankert sind, würde der Prozess der Transkription die distalen DH Segmente

und die VH Segmente in die Nähe der JH Segmente bringen. In dem hier

aufgestellten Modell werden die IVAR Elemente auf Grund der Transkrip-

tion in die 'transcription factory' eingebunden, in der auch die JH Segmente

eingebunden sind. Die IVAR Elemente wären somit für die Aktivierung der

distalen VH Segmente verantwortlich. Erst aufgrund der Nähe könnten die

distalen VH Segmente an die JH Segmente rekombiniert werden. Dieses Mod-

ell verknüpft die Transkription an der distalen VH Region funktionell mit der

V(D)J Rekombination der in diesen Regionen gelegenen Elemente.

Abstract

The highly variable immunoglobulin (Ig) and T-cell receptor (TCR) genes are

assembled by a somatic recombination process called V(D)J recombination.

V(D)J recombination is restricted to the early stages of B and T cell devel-

opment, as the crucial RAG enzyme is expressed only in these cells. The

recombination process is regulated in a strictly lineage and stage speci�c way.

In the �rst recombination step, proB cells recombine the Ig heavy chain lo-

cus (IgH ), whereas proT cells only partially recombine the IgH locus and

completely recombine the TCRβ, the TCRδ and the TCRγ locus. As the

RAG enzyme is expressed in proB and proT cells, the lineage speci�city of

V(D)J recombination has to be regulated by the di�erential accessibility of

the Ig and TCR loci. The accessibility of promoter elements for the transcrip-

tion machinery correlates with the posttranslational acetylation of histone H3

(H3Ac) and the posttranslational di-methylation of histone H3 at lysine 4

(H3K4Me2). As these modi�cation also correlate with general accessibility,

and furthermore germline transcription at the recombination competent loci

was the �rst hint towards di�erential accessibility, we created a high resolu-

tion map of H3Ac and H3K4Me2 modi�ed chromatin domains across the Ig

and TCR loci. To investigate, whether the loci that are competent for V(D)J

recombination show open chromatin modi�cations, or whether the loci that

are excluded from V(D)J recombination show closed chromatin modi�cations,

the histone H3 lysine 9 tri-methylation (H3K9Me3) that is associated with

heterochromatin formation was also analyzed.

The results of this work demonstrate that the recombination potential of the

Ig and TCR loci correlates with strong H3Ac and H3K4Me2 modi�cations at

the recombination competent J cluster in proB and proT cells from Rag−/−

mice. Only the JH segments show H3K9Me3 marks in addition to the H3Ac

and H3K4Me2 modi�cations in proB and proT cells. At the V segments

comparable levels of histone modi�cations were detected in proB and proT

cells. Functionally, the level of H3Ac and H3K4Me2 modi�cation at the VH

J558 segments does not correlate with the recombination rate of these seg-

ments. Contrary to the VH segments, three chromatin domains at the VH

cluster (IVARs) show the open chromatin marks H3Ac and H3K4Me2 only

in proB cells. In addition to the chromatin con�guration, one IVAR element

shows weak promoter activity in a reporter gene assay using a proB cell-line.

Therefore, neither the idea that complete V clusters or individual V segments

become epigenetically activated for V(D)J recombination by the deposition of

H3Ac or H3K4Me2 marks nor the idea that V clusters or V segments are epige-

netically excluded from V(D)J recombination by the deposition of H3K9Me3

marks are supported by this work.

It has been published that the IgH locus is contracted during V(D)J recom-

bination and this locus contraction is not mediated by the RAG enzyme.

Furthermore, it has been shown that anti-sense transcripts correlate with the

V(D)J recombination at the IgH locus. Both observations are included into a

hypothetical model of V(D)J recombination using the model of transcription

factories. A transcription factory is a chromosomal synapse including several

active promoter elements. The polymerases are located inside these factories

and instead of traveling along the chromatin template upon transcription, the

chromatin is dragged into the factory. In this hypothetical model of V(D)J(H)

recombination presented here, the distal VH segments become activated for

V(D)J recombination, because one of the IVAR promoters associates with the

JH containing transcription factory. The RNA polymerase associated with the

IVAR would drag distal VH segments close to the JH cluster and this proximity

would enable the distal VH segments to participate in V(D)J recombination.

I propose that VH germline transcription is a prerequisite for the activation

of distal VH segments.

Contents

Nomenclature ix

1 Abbrevations 1

2 Introduction 3

2.1 V(D)J Recombination: A Mechanistic Perspective . . . . . . . . . . . . . . 4

2.2 Genomic Distribution of Ig and TCR Variable, Diversity and Joining Seg-

ments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6

2.3 Regulation of V(D)J Recombination During Lymphocyte Development . . 7

2.4 Targeting and Tagging of The Right Locus . . . . . . . . . . . . . . . . . . 10

2.5 Chromatin Structure and Covalent Histone Modi�cations . . . . . . . . . . 11

3 Hypothesis 15

4 Results 17

4.1 Genomic Organization of the BCR and TCR Loci . . . . . . . . . . . . . . 17

4.2 Chromatin Immunoprecipitation . . . . . . . . . . . . . . . . . . . . . . . . 22

4.2.1 Isolation of ProB Cells for the ChIP Experiments . . . . . . . . . . 22

4.2.2 Establishment of Chromatin Immunoprecipitations (ChIP) . . . . . 25

4.2.3 Analysis of the ChIP Precipitate . . . . . . . . . . . . . . . . . . . 25

4.3 Chromatin Modi�cations at the Promoters of Control Genes and the Ig

and TCR Accessibility Control Elements (ACEs) . . . . . . . . . . . . . . 27

4.3.1 Chromatin State of the Control Genes . . . . . . . . . . . . . . . . 28

4.3.2 Chromatin Modi�cations at the IgH Eµ Intron Enhancer Region . . 31

4.3.3 Chromatin Modi�cations at the IgH 3' Enhancer Region . . . . . . 33

4.3.4 Chromatin Modi�cations at the IgH 5' Regulatory Region . . . . . 35

4.3.5 Chromatin Modi�cations at the Igκ Enhancer Regions . . . . . . . 36

4.3.6 Chromatin Modi�cations at the TCRβ Enhancer Region . . . . . . 39

vii

CONTENTS

4.4 High Sensitivity Hidden Markow Model Based Identi�cation of Enriched

Regions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41

4.4.1 Re-Implementation of the TileMap HMM Algorithm . . . . . . . . 41

4.4.2 HMM Aided Analysis of the VH Segments . . . . . . . . . . . . . . 49

4.4.3 Identi�cation of Three Novel Intergenic VH Acetylated Regions

(IVARs) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51

4.4.4 The DH Locus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54

4.4.5 IgL V Segments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54

4.4.6 TCRβ V Segments . . . . . . . . . . . . . . . . . . . . . . . . . . . 57

4.4.7 TCRα/δ Locus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63

4.4.8 TCRγ Locus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66

4.5 VDJ-Recombination Studies . . . . . . . . . . . . . . . . . . . . . . . . . . 68

4.6 Intergenic VH Acetylated Regions (IVARs) . . . . . . . . . . . . . . . . . . 71

4.7 In�uence of IL7 Cultivation on H3 Acetylation at the VH and the Vκ Cluster 73

4.8 In�uence of IL7 Cultivation on H3K4 Di-Methylation at the VH and the

Vκ Cluster . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76

4.9 Changes in the Level of H3K4Me2 Marks at the JH Cluster Upon Expres-

sion of a Functional µHC . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80

5 Discussion 85

5.1 Proposed Model for V(D)J(H) Recombination . . . . . . . . . . . . . . . . 87

5.2 Hypothetical Model for the Establishment and Maintenance Allelic Exclu-

sion at the IgH Locus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90

6 Material 93

6.1 Animals . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93

6.2 Cell lines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93

6.3 Tissue culture media . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93

6.4 Antibodies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93

6.5 Bu�ers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94

6.6 Primer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96

7 Methods 97

7.1 PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97

7.1.1 J558 VDJ Join Ampli�cation . . . . . . . . . . . . . . . . . . . . . 97

7.1.2 Real-Time PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 98

viii

CONTENTS

7.2 Cloning and Sequencing of VJ558DJH Joins . . . . . . . . . . . . . . . . . . 99

7.3 Cell Culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100

7.3.1 Isolation of B Lineage Cells from Mouse Bone Marrow . . . . . . . 100

7.3.2 Isolation of T Lineage Cells from Mouse Thymus . . . . . . . . . . 101

7.4 Cell Culture of Stomal Cells . . . . . . . . . . . . . . . . . . . . . . . . . . 101

7.5 Cell Culture of ProB Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . 101

7.6 Cell Culture of dTG Rag−/− ProB Cells . . . . . . . . . . . . . . . . . . . 102

7.7 Cell Culture of Dendritic Cells . . . . . . . . . . . . . . . . . . . . . . . . . 102

7.8 Surface-Staining of Cells for Flow Cytometric Analysis . . . . . . . . . . . 102

7.9 ChIP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103

7.9.1 Nuclei Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . 103

7.9.2 Chromatin Fragmentation . . . . . . . . . . . . . . . . . . . . . . . 104

7.9.3 Chromatin Precipitation . . . . . . . . . . . . . . . . . . . . . . . . 104

7.9.4 Recoverage of the Precipitated DNA Fraction . . . . . . . . . . . . 105

7.9.5 Random Heptamere Based Whole Genome Ampli�cation . . . . . . 106

7.10 Promotor Studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 107

7.11 Programming E�ort . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 108

7.11.1 Identi�cation of Immunogobuin speci�c Sequences in Genomic DNA

from the RefSeq Database . . . . . . . . . . . . . . . . . . . . . . . 108

7.11.2 Import of the NimbleGene Chip Design . . . . . . . . . . . . . . . . 110

7.11.3 Hidden Markow Model for Statistical Tiling Array Data Evaluation 111

7.11.4 Graphical Report of Mean Enrichment Factor and Statistical Data

Sets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111

7.11.5 Aggregate Plot Over Similar Sequences . . . . . . . . . . . . . . . . 112

References 114

Curriculum Vitae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 135

Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137

A Appdx A 139

A.1 Multiple Alignment of the Three IVAR Elements . . . . . . . . . . . . . . 139

A.2 IMGT Tag to GenBank Conversion . . . . . . . . . . . . . . . . . . . . . . 141

A.3 Mean Enrichment Factor and SEM of All Analyzed Gene Starts . . . . . . 144

A.4 Tabular Region of Interest Format Used for the Graphical Report Program 148

ix

CONTENTS

x

Abbrevations

BCR B cell receptorChIP Chromatin Immuno PrecipitationCLP common lymphoid progenitordTG double transgenicEDTA ethylendiamine-tetraacetateFACS �uorescence activated cell sortingFCS fetal calf serumH3Ac pan histone H3 acetylationH3K4Me2 histone H3 lysin 4 di-methylH3K4Me3 histone H3 lysin 4 tri-methylH3K9Me2 histone H3 lysin 9 di-methylH3K9Me3 histone H3 lysin 9 tri-methylHC heavy chainHMM Hidden Markow ModelHSC hematopoietic stem cellIg immune globulinIMGT the international ImMunoGeneTics information system R©IL interleukinLC light chainµS µHC associated switch regionMACS magnetic activated cell sortingNCBI National Center for Biotechnology InformationORF open reading framePCR polymerase chain reactionRag recombination-activating geneRSS recombination signal sequenceSEM standard error of the meanssDNA single stranded DNATCR T-cell receptortet tetracycline

1

http://imgt.cines.fr/

http://www.ncbi.nlm.nih.gov/

1. ABBREVATIONS

2

Introduction

As mammals, our major defense against a pathogen rich environment is provided by

B and T lymphocytes, which bear clonally distributed antigen receptors. An impressive

diversity in B and T cell receptors (BCR and TCR) is generated during early lymphoid de-

velopment. The large repertoire of lymphocytes, each bearing an unique antigen receptor,

is used to identify and tag pathogens for there elimination by host e�ector functions.

The astonishing number of > 108 possible antigen receptor speci�cities in healthy

individuals encoded by a genome of a size of ∼ 3 ∗ 109 bp, puzzled scientists for decades.

This riddle was solved by Susumo Tonegawa and colleagues, who showed that the genes

coding for the antigen receptors are inherited in a nonfunctional con�guration. The

variable region exons of Ig and TCR genes are split into variable (V), diversity (D) and

joining (J) segments that must be somatically recombined to create a functional coding

exon (Brack et al. (1978); Weigert et al. (1978)). This recombination is restricted to

antigen receptor negative stages of developing lymphocytes and is an integral component

of their developmental program. The assembly of all antigen receptor genes is mediated

by a single recombinase composed of two subunits RAG1 and RAG2, which serves as

the key enzymatic components (Oettinger et al. (1990); Schatz et al. (1989)). The RAG

complex targets conserved recombination signal sequences (RSSs) �anking all Ig and TCR

gene segments (Sakano et al. (1979)).

Although V(D)J recombination gives rise to our main defense line against pathogens,

the process of somatic recombination is also an inherently dangerous process, as defects in

V(D)J recombination can cause severe immunode�ciencies or mislead V(D)J recombina-

tion can cause chromosomal translocations that can lead to lethal malignancies (Bassing

et al. (2002); Kuppers & Dalla-Favera (2001)). Concomitantly V(D)J recombination is

tightly controlled as it is (1) tissue speci�c (e.g., precursor B cells rearrange only Ig,

not TCR loci), (2) locus speci�c (e.g., IgH rearrangement occurs prior to IgL rearrange-

ments), and (3) allelically excluded (only one antigen receptor speci�city is expressed on

a lymphocyte).

Early hints to the molecular mechanisms controlling antigen receptor gene assembly

came from the discovery that non-rearranged, germline gene segments are transcribed

coincident with their recombination (Van Ness et al. (1981); Yancopoulos & Alt (1985)).

This observations led to the hypothesis that V(D)J recombination is regulated by changes

in chromatin structure that permits or denies access of nuclear factors to the Ig and TCR

segments. In non-lymphoid cells, Ig and TCR loci reside in closed chromatin, which is

3

2. INTRODUCTION

inaccessible to the transcription and recombination machinery. Under the in�uence of the

lymphoid developmental program the appropriate Ig or TCR locus is activated, chromatin

at the Ig or TCR segments is converted to an open state and therefore the transcription

machinery can access these segments leading to the germline transcripts and the RAG

enzyme can access the associated RS-sequences and catalyze V(D)J recombination. This

coincidence of germline transcription and recombination suggested that transcriptional

control elements in these loci might also regulate the RAG enzyme (Rag1/2) accessibility

to the nearby gene segments and especially the RSSs. Consistent with this model, targeted

deletion of Ig or TCR speci�c promotors or enhancers severely impairs their recombination

in cis (Afshar et al. (2006); Sleckman et al. (1997); Lauzurica & Krangel (1994); Bouvier

et al. (1996)). Thus, V(D)J recombination is tightly regulated by promotors/enhancers,

which function as accessibility control elements (ACE) to guide antigen receptor gene

assembly and lymphoid development.

2.1 V(D)J Recombination: A Mechanistic Perspective

V(D)J recombination is mediated by RSSs that directly �ank all Ig and TCR gene seg-

ments. Each RSS contains a conserved palindromic heptamer and an AT-rich nonamer,

which are separated by a conserved spacer of 12 or 23 bp in length. Under physiologic con-

ditions, recombination requires two gene segments �anked by a 12- and 23-bp RSS (Sakano

et al. (1979)). Experiments conducted with arti�cial substrates have demonstrated that:

(1) V(D)J recombination is restricted to precursor lymphocytes (Lieber et al. (1987)),

(2) all Ig and TCR genes are assembled by a single recombinase activity (Yancopoulos

et al. (1986)), and (3) the tissue-speci�c components of V(D)J recombinase are encoded

by a pair of linked genes, termed recombination-activating genes 1 and 2 (Rag1 and Rag2 ;

Oettinger et al. (1990)). Early functional experiments with Rag expression vectors showed

that Rag-1/2 is su�cient to confer recombinase activity to any cell type tested (Oettinger

et al. (1990); Oltz et al. (1993)). Accordingly, loss of RAG-function by targeted deletion

in mice or natural mutations in humans produce a severe immunode�cency (SCID) due

to an inabillity to initiate V(D)J recombination (Mombaerts et al. (1992); Schwarz et al.

(1996); Shinkai et al. (1992)).

The advent of in vitro V(D)J recombination systems produced plenty of data that

support the following model for recombination by RAG proteins (Eastman et al. (1996),

McBlane et al. (1995)). First, the RAG1/2 complex binds to an RSS, with initial contact

between RAG1 and the nonamer sequence (Swanson & Desiderio (1998)). Association of

RAG1 with RAG2 enhances contact between recombinase and the heptamer (Swanson &

4

2.1 V(D)J Recombination: A Mechanistic Perspective

Desiderio (1999)). The stoichiometry of active RAG complexes in vivo remains unclear,

however, current evidence suggest that RAG �rst binds to a 12-bp RSS and introduces a

single-strand nick precisely at the heptamer/coding border (Curry et al. (2005); Eastman

et al. (1996); van Gent et al. (1996)). The RAG-nick complex then searches for a 23-bp

RSS, forming a synapse, and introduces a similar nick at the second RSS (Curry et al.

(2005); Jones & Gellert (2002); Mundy et al. (2002)). The liberated hydroxyl groups then

attack the opposing phosphate backbones at each RSS to generate a pair of blunt signal

ends (SE) and sealed hairpins at the coding ends (CE; Roth et al. (1992)). In vitro studies

indicate the existence of a postcleavage complex, which contains the RAG proteins as well

as the CEs and SEs (Agrawal & Schatz (1997); Hiom & Gellert (1998)). This complex is

transient in nature and dissolves rapidly to generate an SE complex (SEC) that retains

bound RAG proteins and CEs as free DNA hairpins.

Formation of the SEC and CEs represents the endpoint of RAG-dependent events in

vitro. Completion of V(D)J recombination requires resolution of DNA ends to rescue the

chromosome and generate coding joins (CJs). Studies of V(D)J recombination in CHO

mutant cells engineered to express RAG proteins revealed an important role for the ubiqui-

tous double-strand break repair machinery in the resolution of both SEs and CEs (Pergola

et al. (1993); Taccioli et al. (1993)). Together with subsequent studies, the following model

has emerged for the resolution of V(D)J breaks by non-homologous end-joining (NHEJ)

repair pathway (Dudley et al. (2005)). Free ends are �rst recognized by a heteromeric

complex of KU proteins, which in turn recruit the catalytic component of DNA-dependent

protein kinase (DNA-PKcs). Activated DNA-PKcs phosphorylates numerous targets that

control cell cycle progression (e.g. P53) and subsequently DNA repair. These include the

Artemis protein and the variant histone H2AX, which is phosphorylated over a broad

region surrounding the break (Chen et al. (2000)). Phosphorylation of Artemis activates

its endonuclease activity, which is critical for opening hairpins at CEs (Ma et al. (2002))

and creating palindromic sequences (P elements) at many V(D)J junctions (Lafaille et al.

(1989)). Moreover, endonuclease activity associated with artemis generates further diver-

sity at CJs via the random deletion of nucleotides from exposed ends (Ma et al. (2002)).

The precursor lymphocyte-speci�c protein, termed terminal deoxynucleotide transferase

(TdT ), enhances junctional diversity through the random addition of nucleotides at CEs

(Komori et al. (1993)).

Final resolution of both CEs ans SEs is achieved following the recruitment of XRCC4,

which binds to and activates DNA ligase IV (Grawunder et al. (1997); Li et al. (1995)).

Studies suggest that an additional repair factor may facilitate V(D)J recombination in

5

2. INTRODUCTION

vivo (Dai et al. (2003)). Notwithstanding, the end result of the process is a highly modi�ed

CJ, which enhances sequence diversity at the CDR3 region of Ig and TCR proteins. The

exposed CJs are resolved rapidly by the NHEJ machinery, whereas SEs are resolved slowly

and the resultant SJs are usally deleted from the genome as episomal circles (Hesslein &

Schatz (2001)).

2.2 Genomic Distribution of Ig and TCR Variable, Diversity and Joining

Segments

The Ig and TCR components of antigen receptors are encoded by seven distinct genomic

loci. The B cell receptor consists of two heavy chains (IgH), each covalently linked to

one light chain (IgL, either Igκ or Igλ). Two classes of T cells exist, which express either

a TCRα/TCRβ or a TCRγ/TCRδ heterodimer. In contrast to the variable region the

constant regions exhibit a normal exon intron structure and are not fused to the variable

region by somatic recombination but by mRNA splicing.

The IgH locus in the mouse spans a region on the telomeric end of chromosome 12 of

∼3 megabases (Mb) (Chevillard et al. (2002)). The constant region coding exons, ordered

Cµ, Cδ, Cγ3, Cγ1, Cγ2b, Cγ2a, Cε and Cα are spread over ∼200 kb at the 3' end of the

locus. Four JH gene segments are positioned in a small cluster 7.5 kb upstream of the

Cµ-coding exons and 13 DH gene segments are located in a linear array further upstream.

Finally, 195 VH gene segments are dispersed over 2.5 Mb region upstream of the D cluster

in C57/BL6 mice (Johnston et al. (2006)). These VH segments are grouped into 15 families

by sequence similarity (all VH segments of one family share at least 80% coding sequence).

The largest family (VHJ558 or V1) consists of 96 family members and is located at the

5' end of the IgH locus. The J558 segments can be grouped into two clusters that display

di�erent gene densities, pseudogene content and families of interspersed VH segments.

The 5' A region occupies 1 Mb and contains 29 J558 segments, 13 J558 pseudogenes, 7

3609 segments and 8 3609 pseudogenes, separated by a large intergeneic distance that

ranges from 7 to 50 kb. The 3' B region occupies 400 kb and contains 19 J558 segments

and 23 pseudogenes (Johnston et al. (2006)). The most D-proximal family 7183 or V5

consists of 21 V segments and is preferentially used in IgH rearrangements in proB cells

(Malynn et al. (1990)), whereas the J558 family dominates the peripheral B cell repertoire

(Chevillard et al. (2002)).

The Igκ locus is described to harbor ∼140 segments and 4 functional J segments,

which are distributed over a 3 Mb region on mouse chromosome 6 (Roschenthaler et al.

(1999),Thiebe et al. (1999)). A single Cκ exon is located 2.5 kb downstream of the Jκ

6

2.3 Regulation of V(D)J Recombination During Lymphocyte Development

cluster. A subset of the Vκ segments are in reverse transcriptional orientation relative to

the Jκ segments and therefore rearrangements utilizing these segments occur via large-

scale inversions between the Vκ RSS and the selected Jκ RSS rather that the usual deletion

mechanism of joining (Gorman & Alt (1998)).

The mouse Igλ locus spans about 200 kb on chromosome 16 and harbors three distinct

cassettes of VλJλ gene segments and Cλ exons (Gorman & Alt (1998)). Only two of the

three Vλ segments (Vλ1 and Vλ2) are used predominantly in developing B cells, if the

Igλ locus is used at all. In normal mice the ratio of expressed Igκ to expressed Igλ is

∼ 10 : 1 (Rolink & Melchers (1996)).

The TCRβ locus spans ∼1 Mb on mouse chromosome 6 (Glusman et al. (2001)). The

5' region of the locus is composed of 35 Vβ segments , 14 of which are nonfunctional

pseudogenes. The 3' region of the locus harbors two Dβ/Jβ clusters, each containing

one Dβ and six functional Jβ segments, followed by one Cβ exon coding for the constant

region. Finally, a single Vβ region, called Vβ14, lies downstream of Cβ2 and rearranges

by an inversional mechanism.

The gene segments encoding mouse TCRα and TCRδ are intermingled in a single locus

spanning 1.5 Mb on chromosome 14 (Bosc & Lefranc (2003), Glusman et al. (2001)). In

total the locus contains over 100 V segments, some of which rearrange only with Jα gene

segments, some only with DδJδ joins, and some contribute to both the TCRα and TCRδ

repertoires (Krangel et al. (2004)). A pair of Dδ and Jδ segments lies between the V

cluster and the Cδ coding region. Further downstream of Cδ lie 60 Jα gene segments

followed by the Cα coding region.

The TCRγ locus is distributed across a short region of DNA (∼200 kb) on mouse chro-mosome 13 (Glusman et al. (2001)). This locus consists of seven Vγ gene segments and one

Vγ pseudogene interspersed among three functional Jγ-Cγ units and one nonfunctional

Jγ-Cγ unit. All of the TCRγ gene segments are positioned in the same transcriptional

orientation.


Both lymphoid lineages derive from pluripotent stem cells (HSC), which di�erentiate

to the common lymphoid progenitor (CLP). The progenitors lack lymphocyte surface

markers, but can di�erentiate into both B and T cells in radiation chimeras. In adult mice

B cell development occurs in the bone marrow, whereas the T cell progenitors migrate

from the bone marrow and complete their development in the thymus. B and T cell

precursors initially lack surface antigen receptors but, on their commitment, they rapidly

7

2. INTRODUCTION

initiate the program of V(D)J recombination at either Ig or TCR loci. This ordered

process is an integral part of the developmental program, with the protein products from

each step guiding the cellular di�erentiation and subsequent steps of gene assembly. The

result of this program is the acquisition of Ig or TCR expression restricted to one antigen

receptor speci�city per cell (allelically excluded expression).

To initiate V(D)J recombination, precursor lymphoids must �rst express the lymphoid

speci�c recombinases - the RAG genes. The RAG-1/2 gene are located ∼15 kb apart on

chromosome 2 in mouse and are under the control of multiple cis-acting elements, that

both repress RAG expression in non-lymphid cells and activate RAG expression in lym-

phoid precursors (Hsu et al. (2003); Yu et al. (1999)). However, neither the ordered

assembly nor the lineage speci�city of the V(D)J recombination is explained by the RAG

expression pattern on its own because both genes are expressed at varying levels through-

out all stages of early lymphoid development.

Upon full commitment to the B cell lineage the CLP progresses to the proB cell

stage gaining surface expression of the B cells lineage markers CD19 and B220 (Co�man

& Weissman (1981); Rolink & Melchers (1996)). These proB cells express the receptor

tyrosin kinase c-kit, FLT3 and B220 on their surface (Ogawa et al. (2000)). They also

express the VpreB and λ5 genes coding for the surrogate light chain (SLC) and the B

cell receptor (BCR) signaling subunits Igα and Igβ. V(D)J recombination �rst creates

DH →JH joints on both alleles and then progresses to VH →DJH assembly. As the

addition and removal of nucleotides during V(D)J recombination is random two of three

of the assembled V regions get recombined out of frame and thus are not capable of coding

for a HC protein. If recombination on the randomly chosen �rst allele is not functional,

the second allele is recombined. If still no HC protein can be translated the cell dies by

apoptosis (Fang et al. (1996)). On the other hand, if a HC protein is translated, it pairs

with the SLC and the signaling molecules Igα and Igβ to form the preB cell receptor

(preBCR, Melchers (1999)).

The entry to the preB cell stage is restricted to preBCR expressing cells, as this re-

ceptor triggers B cell di�erentiation (Rolink et al. (1994)), clonal expansion (Hess et al.

(2001)) and allelic exclusion (Kitamura et al. (1991)). The cells lose c-kit and Rag expres-

sion and gain IL-2Rα-chain (CD25) expression (Rolink et al. (1994, 2000)). After 2 to 5

cell divisions large preB cells di�erentiate into small, resting preB cells. The small preB

cells have lost surrogate light chain expression, re-express the RAG recombinase, show

IgL chain sterile transcripts and actively recombine the IgL cain loci (Rolink & Melchers

(1996)). In fact, the closing of the IgH locus, the re-activation of the RAG recombinase

8


and sequential activation of the IgL loci (�rst κ then λ, Ehlich et al. (1993)) is a pro-

cess that is initiated during the large preB cell stage and is already �nished, when the

stage of small preB cells is reached, because in small preB cells κ and λ light-chain (LC)

loci are already recombined in the characteristic 10:1 ratio (Rolink & Melchers (1996)).

Cells expressing a pairing LC protein traverse into the immature B cell stage. During the

transition of small preB cells to immature B cells the cells are negatively selected against

autoantigen recognition. If the BCR reacts with self-antigen the recombination at the LC

loci continues, leading to secondary recombinations that can delete the autoreactive LC

speci�city and eventually alter the antibody speci�city away from autoreactivity, a process

called receptor editing (Tiegs et al. (1993)). Mice that can only produce a self-reactive

speci�city have an almost absolute block in development at the transition between small

preB cells and immature B cells (Spanopoulou et al. (1994)). The immature B cells that

have �nished Ig gene assembly leave the bone marrow to colonize the secondary lymphoid

organs.

The process of T cell development is analogous with that of B lymphopoiesis in re-

gards to sequential activation of TCR loci for V(D)J recombination, re-activation of RAG

recombinase expression and the dependance on the functionally assembled TCR gene

products. The majority of precursors become α/β rather than γ/δ T cells, and lineage

commitment appears to hinge on which set of genes comes �rst (Robey (2005)). On T lin-

eage commitment, thymocytes lack expression of CD4/CD8 coreceptors and are termed

double-negative (DN) proT cells. The DN population can be further categorized into

the DN1-DN4 subsets based on CD44/CD25 expression (Rothenberg & Taghon (2005)).

The DN2-DN3 subsets �rst target recombinase to DJβ clusters, followed by Vβ →DJβ

rearrangement. Assembly of a functional TCRβ gene leads to expression of a pre-TCR

in DN4 cells, which consists of the TCRβ chain, the pre-T-α chain (pTα) and the CD3

coreceptor complex (von Boehmer (2005)). Expression of the pre-TCR inhibits further

Vβ →DJβ recombination but stimulates several other processes (collectively called β-

selection), including (1) clonal expansion of TCRβ+ proT cells, (2) di�erentiation into

CD4+/CD8+ double positive (DP) preT cells stage, and (3) activation of Vα →Jα re-

combination (Aifantis et al. (1997); Shinkai et al. (1993)). T cell clones that express a

functional TCRα gene undergo positive selection and di�erentiate into CD4 helper or

CD8 cytotoxic T cells. Autoreactive clones are removed from the thymus, by negative

selection. Similar to receptor editing at IgL loci, precursor T cells can undergo multiple

rounds of Vα →Jα recombination until these cells express a TCR that progresses through

9

2. INTRODUCTION

both the positive- and negative-selection checkpoints (Hawwari et al. (2005); Huang et al.

(2005)).

2.4 Targeting and Tagging of The Right Locus

V(D)J recombination is a stepwise, ordered assembly of antigen receptor genes that re-

quires base-pair accurate targeting of the RAG recombinase to the RSS within Ig and

TCR loci during the early stages of lymphocyte development. The numerous levels of

regulation include: (1) lineage speci�city, (2) ordered assembly within each locus (�rst

D→J then V→DJ), (3) stage speci�city (e.g. IgH in proB and IgL in preB cells) and (4)

allelic exclusion. The lineage speci�city is independent of the used RAG recombinase, as

it is vital for V(D)J recombination in both, B and T cells.

The �rst hint to the mechanism of locus targeting was established by the discovery of

'germline transcripts' by the Alt and Perry laboratories. They found a correlation of Ig

and TCR loci 'germline transcription' with their V(D)J recombination potential (Van Ness

et al. (1981); Yancopoulos & Alt (1985)). This correlation lead to the hypothesis that

the steps in V(D)J recombination are regulated by modulations in chromatin accessibility

to the common recombinase complex. It is expected that the RSS sequences of actively

recombining Ig and TCR segments are associated with "open" chromatin that is accessible

for both RAG and the RNA polymerase complex, whereas other RSS sequences would

reside in "closed" chromatin con�guration that inhibits RAG binding. Further support

for the accessibility hypothesis derived from studies showing that �broblasts engineered

to express RAG1/2 could target actively expressed extra-chromosomal substrates (open)

for recombination while endogenous Ig and TCR loci remained both transcriptionally and

recombinationally silent (Schatz et al. (1992)).

Recently, further hints to the regulation of V(D)J recombination come from genetic

analyses of the RAG2 protein. Mouse knockouts and cell culture models show that a

truncated form of RAG2 (lacking its C-terminus) encodes for its "core" enzymatic activity

and can e�ciently perform D→J but not V→DJ recombination (Akamatsu et al. (2003);

Kirch et al. (1998); Liang et al. (2002)). Cortes and colleagues reported that the C-

terminus of RAG-2 directly binds to all four core histones (West et al. (2005)). Speci�c

mutations in the C-terminus that abolish the binding of RAG2 to histones also impair

VH →DJH recombination in proB cell lines. Recently a plant homeodomain was identi�ed

in the C-terminus of RAG2 that directly binds to histone H3 di- or tri-methylated at lysine

4 (Liu et al. (2007)).

10

2.5 Chromatin Structure and Covalent Histone Modi�cations


The DNA of eukaryotic cells is packed into chromatin. The basic building block of chro-

matin is a nucleosome. The nucleosome is composed of 145−147 base-pairs of nucleosomal

DNA wrapped around an octamer of core histones (one tetramer (H3-H4)2 and two dimers

(H2A-H2B)). The nucleosomes are regularly spaced along the DNA with a repeat length of

∼200 bp and form a nucleo�lament that represents the �rst level of chromatin compaction

(van Holde (1988)).

Eukaryotes harbor three general types of chromatin in their nuclei. The most highly

compacted form, constitutive heterochromatin, is stained intensely by DNA-speci�c dyes

and represents the most inaccessible state. Accordingly, very few expressed genes are

found in heterochromatic regions, which include pericentric repeats and the inactive X

chromosome (Fahrner & Baylin (2003)). A second form of chromatin, termed euchro-

matin, is not intensely stained by DNA dyes and represents an open state that contains

most of the cell's expressed genes. Regions of euchromatin are generally more accessable

to nuclear factors and more susceptible to attack by nucleases. A third con�guration of

chromatin, called facultative heterochromatin, is an intermediate form that exhibits many

hallmarks of inactive chromatin but is not constitutively closed. Regions of facultative

heterochromatin contain genetic loci that are silent but can be induced for expression

given the proper cues and chromatin remodeling factors (Fahrner & Baylin (2003)).

The basic problem that compressed "data" is not readable (e.g. compressed computer

�les) also holds true for the tightly packed chromatin, as it prohibits access of most non-

histone proteins to DNA, including transcription factors (TFs) and the basal transcrip-

tion machinery (Geiman & Robertson (2002)). Considering the potentially lethal danger

associated with somatic recombination it is not surprising that even the basal chromoso-

mal building block, the nucleosome, e�ciently suppresses RAG cleavage of RSSs in vitro

(Kwon et al. (1998)). On the other hand, recombinant RAG recombinase cleaves RSSs in

nuclei from primary lymphocytes with the appropriate tissue- stage- and allele-speci�city

(Stanhope-Baker et al. (1996)). Taken together, these studies suggest that most antigen

receptor loci reside in facultative heterochromatin in the common lymphoid progenitor

(CLP) and the respective developmental program leads to the stage speci�c opening of

de�ned chromatin regions that become accessible for both the RAG recombinase and the

transcription machinery.

Genetic elements called locus control regions (LCRs) are meant to be the main regu-

latory element of chromatin structure. These regions confer integration site independent

11

2. INTRODUCTION

and copy number dependent expression of a transgene and were �rst identi�ed in the

human β-globin locus (Ryan et al. (1989)). These LCR elements can overcome local hete-

rochromatin con�guration. Li et al. (2002) describe a model for LCR action that depends

on high a�nity DNA binding TFs, that displace the histones at the LCR sequence and

thus create a 'bridgehead' that serves as binding platform for additional TFs that in term

recruit chromatin remodeling factors that covalently modify either the histone or DNA

components of chromatin (Berger (2002); Li et al. (2002); Richards & Elgin (2002)). A

broad panel of TFs recruit protein complexes that acetylate, methylate, phosphorylate or

ubiquitinilate histones. Subsequently these modi�cations stabilize the binding of other

coactivators including components of the core transcription machinery. Therefore the hi-

stone modi�cations control the transcriptional status of �anking genes ("histone code"

hypothesis, Jenuwein & Allis (2001)).

A well characterized example of the histone code hypothesis is the modi�cation of

lysine-9 on histone 3 (H3K9). This amino acid is targeted by a broad spectrum of histone

acetyltransferases (HATs) and histone deacetylases (HDACs), which do not bind DNA

directly but are recruited by TFs or repressive complexes (Emerson (2002); Nakayama

et al. (2001); Narlikar et al. (2002)). Acetylation of H3K9 leads to high-a�nity interactions

with bromodomains in other HAT or nucleosome-remodeling complexes, which further

augment chromatin accessibility (Peterson & Workman (2000)). In addition, the level

of H3K9 acetylation correlates with the level of transcription at transcription start sites

(Pokholok et al. (2005)). In vitro RAG cleavage studies have extended the in�uence of H3

acetylated histones to the process of V(D)J recombination, as acetylation of nucleosomes

can partially relieve the inhibition of RAG-mediated clevage at RSSs (Kwon et al. (2000)).

In contrast to acetylation, methylation at H3K9 leads to hetereochromatin formation

(Lachner et al. (2001)). Dimethylation at H3K9 is found predominantly at repressed genes

in euchromatin or facultative heterochromatin. This epigenetic mark is deposited by two

histone methyltransferases (HMTs) in mammals, called G9a and GLP (Peters et al. (2001);

Tachibana et al. (2002, 2005)). Trimethylation of H3K9 is observed predominantly at

constitutive or pericentric heterochromatin and is the enzymatic product of two redundant

HMTs called Suv39h1 and Suv39h2 (Peters et al. (2001, 2003)). Consistent with the

histone code hypothesis, methylated H3K9 recruits an entirely di�erent type of remodeling

complexes as compared to acetylated H3K9. This type of complexes is characterized

by the presence of a chromodomain and the property to impair chromatin accessibility

(Bannister et al. (2001); Lachner et al. (2001)). H3K9 methylation marks antigen receptor

gene segments that are recombinationally inert (Johnson et al. (2004); Morshead et al.

12


(2003)) and de-novo H3K9 methylation leads to the loss of germline transcription and

Dβ1Jβ1 recombination at a chimeric chromosomal recombination substrate (Osipovich

et al. (2004)).

One other histone modi�cation shall be introduced, the H3K4 methylation (reviewed

in Ruthenburg et al. (2007)). The H3K4 methylation is intensively studied in yeast,

drosophila and mouse and is linked to transcriptionally active chromatin. High levels of

H3K4 tri-methylation (H3K4Me3) are associated with the 5' region of virtually all active

genes in yeast, drosophila, chicken and mouse, correlating with transcription rates, active

polymerase II occupancy and histone acetylation (Santos-Rosa et al. (2002); Schneider

et al. (2004); Schubeler et al. (2004); Ng et al. (2003); Bernstein et al. (2005); Pokholok

et al. (2005)). Interestingly the H3K4 di-methylation (H3K4Me2) is in yeast spread

throughout the transcribed and the 'poised' (not repressed, but also not expressed) genes

(Santos-Rosa et al. (2002); Ng et al. (2003); Pokholok et al. (2005)), whereas in verte-

brates the H3K4Me2 modi�cation does not mark the poised loci (Schneider et al. (2004);

Bernstein et al. (2005)). In addition to the actively transcribed loci, that in addition to

the H3K4Me2 mark show the H3K3Me3 mark, Bernstein et al. (2005) identi�ed several

H3K4Me2 modi�ed regions that lack the H3K4Me3 mark. These regions are not associ-

ated with active transcription start sites and there modi�cation is highly dependent on

the cell type tested, suggesting that this modi�cation marks lineage speci�c regulatory

elements (Bernstein et al. (2005)).

H3K4 methylation is catalyzed by SET domain proteins of which at least ten are known or

predicted (Ruthenburg et al. (2007)). The largest family of Set proteins is the MLL fam-

ily. In humans it consists of six family members: mixed lineage 1 (MLL1), MLL2, MLL3,

MLL4, SET1A and SET1B, whereas yeast contains only one (Set1). This enhanced vari-

ability likely resembles an enhanced complexity of homeotic gene regulation, as deletion

or truncations of MLL1-3 gene products are not redundant, indicating a special function

for each of these proteins. Several mechanisms for Set protein recruitment are possible:

(1) direct or indirect recruitment by sequence speci�c DNA binding factors (Dou et al.

(2005); Dreijerink et al. (2006); Mo et al. (2006)), (2) direct association with the basal

transcription machinery (Dou et al. (2005); Guenther et al. (2005); Milne et al. (2005)), (3)

association with chromatin through histone modi�cation readers (Wysocka et al. (2003))

or (4) recruitment by RNA (Sanchez-Elsner et al. (2006), review in Ruthenburg et al.

(2007)).

Histone methylation has long been thought to be a stable modi�cation until recently

the histone demethylase LSD1 could be identi�ed (Shi et al. (2004)). This protein is

13

2. INTRODUCTION

able to remove H3K4Me1/2 modi�cations. The CoREST repressive complex enhances

the ability of LSD1 to remove H3K4 methylation, whereas the androgen receptor alters

the speci�city of LSD1 to target H3K9Me1/2 and thereby changes the activity of LSD1

from repressive to activating (Metzger et al. (2005)). The tri-methylated state of H3K4

or H3K9 is removed by a di�erent type of de-methylases, the JmjC domain containing

proteins (histone demethylation reviewed in Tian & Fang (2007)). Over 100 JmjC domain

containing enzymes have been identi�ed (Clissold & Ponting (2001)). These catalytic do-

mains can in principle remove mono-, di- and tri-methylations, but additional (unknown)

mechanisms can further restrict this capability, as the histone demethylase JHDM2A was

found to speci�cally demethylate H3K9(me1/2) (Yamane et al. (2006)). The four mem-

bers of the JMJD2 subfamily (JMJD2A, JMJD2B, JMJD2C, and JMJD2D) are trimethyl

lysine demethylases (Tian & Fang (2007)).

14

Hypothesis

I want to formulate the hypothesis that the V(D)J recombination potential of Ig

and TCR antigen receptor loci correlates with the accessibility of the V gene cluster

that is regulated in a lineage-speci�c way. This accessibility is measurable using the

histone H3 marks pan acetylation (H3Ac) and K4 di-methylation (H3K4Me2). The loci

which are not V(D)J recombination competent are expected to be associated with the

repressive histone H3 lysin 9 tri-methylation (H3K9Me3). Upon progression of the B cell

development from proB cells to preB cells the IgH locus loses and the Igκ locus gains its

recombination potential. This change in the recombination potential should also be visible

in a change of the chromatin accessibility of the respective loci. In detail we expect to

�nd VH segments associated with open chromatin exclusively in proB cells, whereas Vβ,

Vδ and Vγ segments are associated with open chromatin exclusively in proT cells. The

Vκ segments are expected to become associated with open chromatin upon expression of

a signaling competent preBCR.

15

3. HYPOTHESIS

16

Results

4.1 Genomic Organization of the BCR and TCR Loci

A necessary prerequisite for the analysis of the chromatin accessibility in the BCR and

TCR loci was the detailed information about the genomic organization of the respective

loci. Therefore, the chromosomal location and size of the seven antigen receptor loci had

to be extracted from the Mus musculus genome sequence (RefSeq) hosted at the NCBI

(Pruitt et al. (2003)). Furthermore all relevant and known coding and regulatory gene

elements had to be annotated to the extracted sequence contigs.

In a combined way the mouse genome sequence was searched for either locus names

(IgH, IgL, IgK, TCRA, TCRB, TCRG or TCRD) or for sequences that are homologous

to reference V elements. The reference V segments were taken from the IMGT/LIGM

data base (Lefranc et al. (1999)) and the Mus musculus genomic sequence was searched

utilizing the NCBI BLAST algorithm (Altschul et al. (1990)) at the genomic BLAST web

interface. As V segment family-members share a sequence identity of more than 80%,

one BLAST search revealed all V segments of at least one family. Similar searches were

intended to identify the most 5' and 3' V segments of the receptor loci. All sequences

of the seven antigen receptor loci were de�ned, extracted and locally stored. To make

sure all locus speci�c gene segments and possible regulatory regions were included in the

analysis a substantial amount of additional sequence (500 kb) was added at the 5' and 3'

�anks of the Ig or TCR V gene clusters.

In the sequence �les extracted from the RefSeq Mus musculus genome, the V, D, J

and C segments and the regulatory sequences were only very incompletely annotated. To

assign both the correct segment type and the Ig family name to all Ig and TCR segments

within the respective loci the perl script ncbiBLAST_Wrap.pl described in section 7.11.1

was written. The script utilizes a blast formated IMGT/LIGM database, containing the

Ig and TCR feature sequences and the NCBI BLAST algorithm to identify all Ig and TCR

V, D and J segments in the genomic RefSeq sequence. As the BLAST search algorithm

cannot handle feature information, this information was extracted from the IMGT/LIGM

database and stored in a MySQL database. The feature information stored in the database

was compared to the matching regions identi�ed by BLAST. The sequence feature of the

best matching IMGT sequence with regard to the alignment score (E-value in the BLAST

result) was stored.

17

http://www.ncbi.nlm.nih.gov/BLAST/

http://www.ncbi.nlm.nih.gov/BLAST/

4. RESULTS

Table 4.1: Quality control for the identi�cation process at the example of one Cλ segment

and one Jλ segment. The annotations contained in the RefSeq database are shown on the left side, the

newly created annotations are shown on the left side. The feature information is separated into feature

tags, that describe the function of the element and feature information. The feature information shows

additional information for each element.

RefSeq annotations matched IMGT annotations

feature tag feature information feature tag feature information

gene complement(232804..233123) C_region complement(232804..233120)

/db_xref="GeneID:110785" /gene="IGLC1"

/gene="Igl-C1" /translation=""QPKS. . . SLS"

CDS complement(232804..233123) /allele="IGLC1*01"

/db_xref="GeneID:110785" /note="C-REGION"

/gene="Igl-C1"

V_segment complement(232804..233123)

/gene="Igl-C1"

/standard_name="Igl-C1"

gene complement(234277..234314) J_segment complement(234277..234314)

/db_xref="GeneID:404737" /gene="IGLJ1"

/gene="Igl-J1" /translation="WVF. . . TVL"

CDS complement(234277..234314) /allele="IGLJ1*01"

/db_xref="GeneID:404737" /note="J-REGION"

/gene="Igl-J1"

V_segment complement(234277..234314)

/gene="Igl-J1"

/standard_name="Igl-J1"

The RefSeq annotation of the Igλ locus �le almost perfectly matched the Igλ segments

as de�ned in the IMGT/LIGM database. Therefore the Igλ locus could be used to control

the feature identi�cation script. The ncbiBLAST_Wrap.pl script identi�ed all features

already annotated in the Igλ sequence �le, but in addition the correct segment classes

were assigned. As an example, the feature information for one Cλ segment and one Jλsegment contained in the RefSeq sequence is compared to the modi�ed feature information

created by the script (see table 4.1). Whereas the Cλ1 segment and the Jλ1 segment were

both tagged by three di�erent genbank entries ( 'gene', 'mRNA' and 'V_segment') the

18


Table 4.2: Number of identi�ed V, D and J gene segments at the IgH, Igκ, Igλ, TCRα,

TCRβ, TCRα/δ and TCRγ locus. The location and the total number of identi�ed BCR and TCR

segments are shown. The value in brackets represents the expected amount of segments as mentioned

in Cobb et al. (2006) or for the VH segments in Johnston et al. (2006). The TCRα/δ V segments can

recombine either with the Jα segments, with DJδ joints or with both. Therefore all V segments contained

in the TCRα/δ locus are counted to both, the TCRα and the TCRδ locus.

locus chromosomal position V segments D segments J segments

IgH Chr12 108.20-111.80Mb 84 (195) 11 (13) 4 (4)

IgK Chr6 67.80-69.50Mb 106 (∼140) - 5 (5)

IgL Chr16 17.83-18.04Mb 4 (3) - 5 (3)

TCRα Chr14 47.42-48.80Mb 65 (>100) - 41 (60)

TCRβ Chr6 41.03-41.70Mb 23 (35) 2 (2) 14 (12)

TCRα/δ Chr14 48.44-48.68Mb 65 (>100) 2 (2) 2 (2)

TCRγ Chr13 18.65-18.84Mb 5 (8) - 4 (4)

ncbiBLAST_Wrap.pl script tagged the Cλ1 segment as 'C_region' and the Jλ1 segment as

'J_segment'. The location on the genomic DNA was not changed during the identi�cation

process.

The chromosomal location and the number of identi�ed V, D and J segments for

each locus is shown in table 4.2. For most loci less than the published number of V,

D or J segments were found. Most probably, this is due to limitations of the RefSeq

sequence coverage at these repetitive loci rather than to an error in the script, as all V

and J segments were correctly identi�ed at the Igλ locus. The IgH and the Igκ loci were

not yet assembled in the RefSeq version 34.1. Therefore the fragmented loci were merged

into one locally stored sequence �le. A graphical view of the IgH and Igκ locus is shown

in Figure 4.1; the TCRβ and TCRα-δ loci are shown in Figure 4.2. These �gures were

created using the perl script HMM_graphicalReport.pl described in chapter 7.11.4.

19

4. RESULTS

(a) IgH locus

(b) Igκ locus

Figure 4.1: Graphical view of the IgH and Igκ locus in chromosomal orientation. The newly

assigned V segments are marked in red , the D segments in blue and the J segments in green. Regulatory

elements are shown in purple. The gene information line is split into two parts, the upper one displaying

the genes and Ig segments that are expressed in chromosomal orientation, and the lower one shows genes

and Ig segments expressed in reverse orientation. The VH family naming scheme is adopted from IMGT

(Matsuda (1995)) and translates to the naming scheme published in Honjo et al. (2004) as follows: V1

= Vh558; V2 = VhQ52; V3 = Vh36-60; V4 = VhX24; V5 = Vh7183; V6 = Vh606; V7 = VhS107;

V8 =Vh3609P; V9 = VhGAM3-8; V10 = Vh10; V11 = Vh11; V12 = Vh12; V13 = Vh3609N; V14 =

VhSM7; V15 = Vh15.

20


(a) TCRβ locus

(b) TCRα-δ locus

Figure 4.2: Graphical view of the TCRβ and TCRα/δ locus in chromosomal orientation. The

newly assigned V segments are marked in red , the D segments in blue and the J segments in green.

Regulatory elements are shown in purple. The red oval marks the TCRδ D J and C regions. The gene

information line is split into two parts, the upper one displaying the genes and Ig segments that are

expressed in chromosomal orientation, and the lower one shows genes and Ig segments expressed in the

reverse orientation.

21

4. RESULTS

4.2 Chromatin Immunoprecipitation

The aim of this study was to produce a high resolution map of the histone H3 modi�cations

H3Ac, H3K4Me2 and H3K9Me3 at the Ig and TCR loci. We did not want to analyze these

loci in immortalized proB cell lines, which were infected by Abelson virus, because they

contain DJH joints and even unproductive VDJH joints (Eisen et al. (1991)). These DJHor even VDJH joints delete large parts of the locus which are not accessible for evaluation

afterwards. In addition the active Abl kinase in these cells may additionally change the

histone modi�cation pattern. We did not want to use short term IL7 cultivated B cells

either, as IL7 signaling was described to be associated with the gain of H3Ac marks at

the distal VH cluster (Chowdhury & Sen (2001, 2003); Corcoran et al. (1998)). Therefore

we focused on proB and proT cells isolated ex vivo from RAG1−/− mice, that retain the

antigen receptor loci in germline con�guration.

4.2.1 Isolation of ProB Cells for the ChIP Experiments

For the ChIP experiment proB, proT and dendritic cells from RAG−/− mice were used.

CD19+ proB cells were separated from RAG−/− bone marrow (BM) using MACS. The

purity of the CD19+ sorted cells was analyzed in FACS and cell suspensions containing

more that 90% CD19+ cells were used for ChIP. The FACS analysis of one representative

proB cell preparation is shown in Figure 4.3. ProT cells were isolated from RAG−/− thymi

without further puri�cation and DCs were di�erentiated in cultures of primary BM cells

in GM-CSF as published by Lutz et al. (1999). The FACS analysis of a DC culture is

shown in Figure 4.4. In addition we analyzed short term cultures of IL7 cultivated ex vivo

RAG−/− proB cells and proB and preB cells taken from RAG−/− mice transgenic for the

tetracycline (tet) trans-activator and a tet-operon regulated µHC transgene published in

Hess et al. (2001). The proB/preB cell experiments are described in detail in chapter 4.8

and chapter 4.9.

22


Figure 4.3: Isolation of CD19+ proB cells from Rag−/− bone marrow. FACS analysis of a repre-

sentative proB cell preparation (MACS CD19+ sorted Rag−/− proB cells). The initial BM preparation

(top), the �ow-through (middle) and the CD19+ preparations (bottom) were stained for B220 and ana-

lyzed in FACS. The lymphoid population was selected due to size and granularity and was analyzed for

the percentage of B220+ cells.

23

4. RESULTS

Figure 4.4: Generation of dendritic cells (DC) from Rag−/− bone marrow. FACS analysis

of two independent DC preparations, that were cultivated from Rag−/− BM for 8 days in the presence

of GM-CSF. The cells were stained with αCD11c and αCD19 to distinguish between CD11c+ DCs,

CD11c−/CD19− macrophages and CD19+ proB cells.

Figure 4.5: Setup of chromatin fragmentation using ultrasonic pulses. 0 to 8 ultrasonic pulses

(20sec, 0.2 1/sec., 18 % power) were applied to formaldehyde �xed 38.B9 cells. After crosslink reversal

and DNA puri�cation the fragments were separated on an 1.2 % agarose gel (lane 1: 0 pulses, lane 9: 8

pulses).

24


4.2.2 Establishment of Chromatin Immunoprecipitations (ChIP)

We focused on ex vivo proB and proT cells taken from RAG2−/− mice and therefore we

had only a restricted amount of cells available (2-4∗106 cells for one IP).

To prepare the chromatin used for the ChIP, nuclei from formaldehyde �xated cells

were prepared and subsequently the chromatin was fragmented using ultrasonic pulses.

For the adjustment of the fragmentation process 38.B9 cells were �xated and a series of

ultrasonic pulses was applied to the prepared nuclei. The in�uence of multiple pulses on

chromatin fragment length is shown in Figure 4.5. For the subsequent ChIP experiments

six ultrasonic pulses for each preparation were used.

The resulting fragmented chromatin was pre-incubated with protein A agarose to remove

fragments that unspeci�cally bind to protein A agarose. After this pre-clearing step 5 %

of the chromatin solution was removed as INPUT sample and the remaining chromatin

solution was incubated over night with the precipitating antibody at a concentration

recommended by the manufacturer. After the addition of another batch of protein A

agarose, the protein A agarose - antibody - chromatin complex (precipitate) was washed

several times and bound chromatin was eluted. In the eluate the protein-DNA crosslinks

were reverted by heat and the DNA fraction was puri�ed by proteinase K digestion and

phenol/chloroform precipitation.

4.2.3 Analysis of the ChIP Precipitate

On the one hand, the amount of precipitated DNA from 2 to 4∗106 cells is quite restricted

(below photometer sensitivity). On the other hand, we wanted to characterize several large

chromosomal regions with a total size of 8.11 Mb of DNA that is fragmented into more

than 1.6 ∗ 104 di�erent DNA parts in the ChIP precipitate. We additionally needed a

method to resolve a 2 to 4 fold enrichment of a single fragment in the ChIP precipitate

as seen in Chowdhury & Sen (2003). Hence the method to analyze the precipitated DNA

samples had to be (1) sequence speci�c, (2) highly sensitive and (3) able to analyze a

large amount of di�erent chromatin fragments.

To quantify the amount of precipitated DNA, we used comparative hybridization of

�uorescence labeled INPUT and IP fractions to an oligo-nucleotide array. The minimal

amount of DNA needed for array hybridization was 5 µg, but the amount of the ChIP DNA

sample was below the sensitivity of a photometer. Therefore the ChIP precipitate had

to be ampli�ed. For this purpose a random heptamer based whole genome ampli�cation

published by Robyr & Grunstein (2003) was used. This method is based on PCR and

25

4. RESULTS

therefore we had to check whether the ampli�cation was reproducible. To test this, each

ChIP precipitate was ampli�ed twice and the two ampli�cations were used separately

as input for three quantitative PCR reactions. 8 ng of each ChIP ampli�cation was

ampli�ed in replicates. The mean Ct value for each ChIP ampli�cation was calculated

for each PCR. If the quadratic error of the mean Ct value of one PCR between the two

ChIP ampli�cations was higher than one, this actual ChIP experiment was not used for

array hybridization. In addition more than 6 µg of ChIP ampli�cate had to be produced

for array hybridization. Finally the ampli�ed ChIP precipitates were sent to NimbleGene

for array hybridization. In return we received chip hybridization reports consisting of the

chip design information, the �uorescence signals for each oligo and the enrichment factor

for each oligo which is calculated as follows:

enrichment factor = log2fluorescence Signal IP

fluorescence Signal INPUT

To be able to directly compare two di�erent ChIP-on-chip experiments, the enrichment

factors of individual experiments had to be normalized. To normalize, the bi-weighted

mean of all enrichment factors (Mosteller & Tukey (1977)) is subtracted from each en-

richment factor. As a result, the bi-weighted mean of the normalized enrichment factors

becomes zero. This normalization was calculated by the company that performed the

ChIP hybridizations (NimbleGene). In my data sets the bi-weighted mean of all oligo

enrichment factors was comparable with the median across all oligo enrichment factors.

As the NimbleGene o�er included a custom array design, we were able to select the

chromosomal regions for the array design. We not only selected the previously identi�ed

Ig and TCR loci, but in addition selected several chromosomal regions containing genes

with known expression states in proB cells as controls. The loci used as positive controls

(expressed genes) contained the Pax5, Rag1/2, VpreB1, VpreB2 and λ5 genes. The loci

used as negative controls (silent genes) contained the Dentin matrix protein 1 (Dmp1 ),

the Dentin sialophospho protein (Dspp) and the Collagen4α3/4 genes (Col4α3, Col4α4 ).

All chromosomal regions for the array design are shown in table 4.3. The loci are based

on the NCBI RefSeq Mus musculus genome build version 34.1.

The oligos were designed to cover the loci at the highest possible oligo density. Repet-

itive elements were excluded from the oligo design process and therefore a mean overlap

of 36 bp between two successive oligos was achieved.

26

4.3 Chromatin Modi�cations at the Promoters of Control Genes and the Igand TCR Accessibility Control Elements (ACEs)

Table 4.3: Chromosomal regions represented on the oligo nucleotide array. The internal locus

name (gene locus), the corresponding chromosome and the position of the locus on the chromosome are

shown. The position of the loci is based on the NCBI Mus musculus RefSeq database v.34.1

gene locus chromosome position

Collagen4 Chr1 82.5-83.2Mb

Rag1, Rag2 Chr2 101.3-101.45Mb

Pax5 Chr4 44.4-44.9Mb

Dentin Matrix Protein 1 (DMP1) Chr5 103.2-103.3Mb

TCRβ Chr6 40,8-41,8Mb

HoxA1-13 Chr6 52.2-52.4Mb

Igκ Chr6 67.7-71.3Mb

IgH Chr12 108,5-112Mb

TCRγ Chr13 18,5-19Mb

TCRαδ Chr14 47-49Mb

VpreB1, λ5 Chr16 15.6-15.7Mb

VpreB2 Chr16 16.7-16.8Mb

Igλ Chr16 17.6-18.2Mb

4.3 Chromatin Modi�cations at the Promoters of Control Genes and the

Ig and TCR Accessibility Control Elements (ACEs)

In a �rst step, the analysis was focused on the control genes and the well de�ned accessi-

bility control elements (ACEs) of the IgH , Igκ and TCRβ locus. This analysis is based on

the NimbleGene oligo enrichment factors. To show the high density of oligo-nucleotides

and the reproducibility of the oligo enrichment factors, the histone modi�cations for one

control gene (VpreB1 ) are depicted in Figure 4.6. The VpreB1 gene is associated with

H3Ac and H3K4Me2 only in proB cells. No H3K9Me3 modi�cations are visible in proB

and proT cells. The reproducibility of the enrichment factors in independent ChIP ex-

periments is remarkable.

As the software provided by NimbleGene to visualize the ChIP-on-chip data (SignalMap R©)

is spreading the bioinformatic sequence information over several lines, is not showing the

gene identi�ers in the graph and is not able to display the mean enrichment factor of

adjacent oligonucleotides, these features were implemented into the graphical report pro-

gram described in detail in chapter 7.11.4. The graphical report program creates mean

enrichment factor plots. To calculate the mean for these mean enrichment factor plots,

27

4. RESULTS

the oligos were grouped in not overlapping regions (data bins), and the mean and stan-

dard error of the mean (SEM) was calculated over all ChIP replications. Oligos with

an overlap of > 50% with the data bin were counted to this bin. The mean enrichment

factor plots corresponding to the data displayed in Figure 4.6 are shown in Figure 4.7.

Local di�erences of the enrichment factors are preserved in the 50 bp window size data

set, whereas the 500 bp window data set shows the overall tendency more clearly.

4.3.1 Chromatin State of the Control Genes

To test if the transcription start sites of actively transcribed genes are associated with

H3Ac and H3K4Me2 as published by Bernstein et al. (2005) we evaluated the histone

modi�cations at the transcription start sites of the control genes. It is known that the

genes VpreB1, VpreB2 and Pax5 are expressed only in proB cells, the genes RAG-1

and RAG-2 are expressed in proB and proT cells and the genes coding for the Dentin

matrix protein 1 (DMP1 ) , Dentin sialophospho protein (DSPP), Colagen4α3 (Col4a3 )

and Colagen4α4 (Col4a4 ) are not expressed in proB, proT or dendritic cells. To visualize

the enrichment factors at the transcription start sites of the control genes we calculated

the mean enrichment factor of the �rst 500 bp region of each transcript, because this

region showed reproducibly higher levels of H3Ac and H3K4Me2 modi�cations than in the

promoter region in the control genes (for one example see �gures 4.6 and 4.7). The mean

enrichment factors and the SEM for all control genes are shown in Figure 4.8. The histone

modi�cation pattern at the named transcription start sites correlates with the expression

state, as VpreB1, VpreB2 and Pax5 are associated with the open chromatin marks H3Ac

and H3K4Me2 only in proB cells, whereas Rag-1 and Rag-2 show an almost comparable

enrichment for the open chromatin marks in proB and proT cells. Finally the control genes

that are not expressed in proB, proT or dendritic cells show no enrichment for the open

chromatin marks. Surprisingly they also show no enrichment for the heterochromatic

mark H3K9Me3. The level of H3K4Me2 modi�cations seen at the Pax5 transcription

start in DCs is unexpected, as Pax5 is mainly expressed in the B cell lineage and no Pax5

expression could be detected in plasmacytoid DCs (Fuxa & Busslinger (2007)). But in

summary, we could also correlate H3Ac and H3K4Me2 marks with active transcription

start sites.

28


(a) (b)

Figure 4.6: Chromatin state at the VpreB1 gene locus; (a) proB cells and (b) proT cells . In

the top line the chromosomal location of this region is depicted (300 bp between two tics), the second and

third line represent the GenBank feature information 'mRNA' and 'CDS'. The VpreB1 gene is expressed

in reverse orientation. All further lines show the oligo enrichment factors (H3Ac in green; H3K4Me2 in

blue and H3K9Me3 in red). Oligo enrichment data of the same color and cell type represent experimental

replicates. Each oligo is shown as a small horizontal bar representing its location. The position at the y

axis indicates the enrichment factor of the oligo ranging from -1 to +4. The �gure was created using the

SignalMap R© software.

29

4. RESULTS

(a)

(b)

Figure 4.7: Mean enrichment factor plot of ChIP data at the VpreB1 gene locus. Mean

values of independent replicates and mean enrichment factor values from neighboring oligonucleotides are

calculated. For each precipitating antibody, the mean enrichment factors and SEM over (a) 50 bp and (b)

500 bp wide regions are shown. The cell type, number of replications, used chromatin modi�cations and

color code for each displayed ChIP experiment are shown above each subgraph. The data corresponds to

data shown in Figure 4.6.

30


Figure 4.8: Chromatin modi�cations at the transcription start site of the λ5, Pax5, VpreB1,

VpreB2 genes, the Rag1 and Rag2 genes and the Collagen4α3, Collagen4α4, DMP1 and

DSPP genes are shown. Here the mean enrichment factor and the SEM are calculated over all

ChIP replicates and the oligonucleotides binding to a 500 bp region immediately downstream of the

transcription start site. Each ChIP experiment was done replicates except for the H3Ac speci�c ChIP in

proB cells (3x) and the H3K9Me3 speci�c ChIP in proT cells (1x). Upper row: genes expressed only in

proB cell, middle row: genes expressed in proB and proT cells, lower row: genes that are silent in proB,

proT and dendritic cells.

4.3.2 Chromatin Modi�cations at the IgH Eµ Intron Enhancer Region

The IgH intron enhancer Eµ is located ∼1 kb downstream of JH4 between the JH cluster

and the Cµ exons. It has repeatedly been reported to show H3Ac and H3K4Me2 marks

(Morshead et al. (2003); Chowdhury & Sen (2001, 2003)). Therefore we expected to �nd

the Eµ region enriched for H3Ac and H3K4Me2 in proB cells. As even in the T cell lineage

DJH joints can be found (Mizutani et al. (1986)), and as the Eµ intron enhancer is the

key regulatory element that promotes D→JH recombination (Afshar et al. (2006)), it was

expected that the Eµ enhancer is associated with open chromatin also in proT cells.

31

4. RESULTS

Figure 4.9: Mean enrichment factor plot showing two IgM exons, the Eµ enhancer and the

�anking JH cluster in proB, proT and dendritic cells. The locus is displayed from centromer to

telomer, and base positions resemble positions in the regions analyzed. C segments are marked in brown,

J segments in green, DQ52 in blue and the Eµ intron enhancer in purple. The repetitive Sµ switch region

was not included in the tiling array (gap). The number of ChIP replicates used for each cell type is given

above each individual plot. Each data point represents the mean enrichment factor and the SEM of a

500 bp wide region, plotted in the center of the corresponding region.

32


The chromatin modi�cations at the Eµ region are shown in Figure 4.9. The Eµ region

is separated into two chromatin regions that are di�erentially regulated in proB, proT and

dendritic cells. The JH cluster including the DQ52 segment shows H3Ac, H3K4Me2 and

H3K9Me3 marks in proB, proT and dendritic cells, whereas the region �anking the Sµ

switch region shows H3Ac and H3K4Me2 modi�cations only in proB and dendritic cells.

Surprisingly, in proB cells the JH region is not only associated with H3Ac and H3K4Me2

modi�cations, but also with the heterochromatic histone modi�cation H3K9Me3 that is

shown to be incompatible with VDJ recombination (Osipovich et al. (2004)). As the

levels of H3Ac, H3K4Me2 and H3K9Me3 modi�cations are similar in proB and proT

cells, the analyzed histone modi�cations at the Eµ enhancer region can not explain the

lineage speci�city of VDJH recombination, but H3Ac and H3K4Me2 arks at the JH cluster

correlate with the D→JH recombination potential.

4.3.3 Chromatin Modi�cations at the IgH 3' Enhancer Region

The IgH 3' enhancer is characterized by four di�erent DNase1 hypersensitive sites (Pet-

tersson et al. (1990); Dariavach et al. (1991); Mills et al. (1997)). The enhancer directs

transgene expression in B lineage cells (Chauveau et al. (1999)), but its function is best

characterized as a regulator of class switch recombination (Zhang (2003)).

The IgH 3' enhancer elements HS3A, HS3B, HS4 and HS1,2 sequences extracted from

the BAC sequence with the accession number AF450245 were located at the IgH locus

using the BLAST program. The HS4 sequence did not match to the IgH locus based on

the Mus musculus RefSeq genome version 34.1.

The chromatin con�guration at the IgH 3' ACE is shown in Figure 4.10. In proB cells,

the hypersensitive sites show low levels of H3Ac, H3K4Me2 or H3K9Me3 modi�cation,

but several small regions of about 500bp length show high levels of H3Ac modi�cations.

In proT cells these regions also show H3Ac modi�cations although at a reduced level. In

comparison with the chromatin domain at the Eµ enhancer region, both, the length and

the level of the H3Ac modi�ed chromatin domains is reduced. H3K4Me2 and H3K9Me3

modi�cations are hardly visible at the IgH 3' enhancer region.

The H3Ac marks at the IgH 3' enhancer are not lineage speci�c and if compared to the

Eµ enhancer region, the IgH 3' enhancer region is even not enriched for open chromatin.

Therefore, the analyzed chromatin modi�cations at the IgH 3' border can not explain the

lineage speci�city of V(D)J recombination.

33

4. RESULTS

Figure 4.10: Mean enrichment factor plot showing the IgH 3' enhancer region in proB, proT

and dendritic cells. The locus is displayed from centromer to telomer, and base positions resemble

positions in the regions analyzed. The purple bars at the x axis represent the Hs3B, the Hs1/2 and the

Hs3A DNase hypersensitive sites published by Dariavach et al. (1991). The brown bar represents the last

Cα exon. The mean enrichment factor and SEM was calculated over 500 bp wide regions.

34


Figure 4.11: Histone modi�cations at the putative IgH 5' regulatory region described in

Pawlitzky et al. (2006). The locus is displayed from centromer to telomer, and base positions resemble

positions in the regions analyzed. Two genes lie in the displayed region, the zinc �nger protein (Zfp386 )

and the vasoactive intestinal peptide receptor 2 (Vipr2 ). The published DNase1 hypersensitive sites,

located at the 5' end of the Zfp386 gene are displayed as purple bars. The mean enrichment factor and

SEM was calculated over 500 bp wide regions.

4.3.4 Chromatin Modi�cations at the IgH 5' Regulatory Region

Lately a potential 5' regulatory region was published by Pawlitzky et al. (2006). This

region is located at the telomeric end of the IgH locus and consists of three di�erent

DNase 1 hypersensitive sites (HS1, HS2 and HS3a/b). These sites elicit transciptional

repression in transient transfection assays if the HS1 site or all HS sites are inserted

upstream of a V promoter driving luciferase gene expression (Pawlitzky et al. (2006)). As

35

4. RESULTS

these Dnase 1 hypersensitive sites were not annotated in the RefSeq database, they were

mapped to the IgH locus using the HS sequence information contained in the sequence

�le AY196298 published by Pawlitzky et al. (2006).

The chromatin con�guration at the 5' regulatory region is shown in Figure 4.11. The

promoter elements of the two genes (Zfp386 and Vipr2 ) show H3Ac and H3K4Me2 marks

in all three cell types, whereas only in proB cells the DNase 1 hypersensitive site 1 (HS1)

is associated with H3K9Me3. As H3K9Me3 modi�cations are correlated with heterochro-

matin formation and gene silencing (Hwang et al. (2001); Nielsen et al. (2001); Osipovich

et al. (2004) review in Grewal & Jia (2007)), the proB cell speci�c occurrence of the HS1

and the repressive e�ect of the HS1 fragment in transient transfection assays published by

Pawlitzky et al. (2006) point in the same direction as the H3K9Me3 modi�cations found

in this analysis. As only the H3K9Me3 modi�cations are lineage speci�c, this region is

hardly responsible for lineage speci�c activation of V(D)JH recombination.

4.3.5 Chromatin Modi�cations at the Igκ Enhancer Regions

The Igκ locus is genetically controlled by a set of di�erent cis-acting elements: one in the

Jκ/Cκ intron (iEκ), one 9 Kb downstream of Cκ (3'Eκ) and a recently de�ned element

called Ed, positioned downstream of 3'Eκ (Gorman & Alt (1998); Liu et al. (2002)). Single

deletion of either the iEκ or the 3'Eκ enhancer signi�cantly impairs Vκ →Jκ rearrangement

(5-10x each), while a dual iEκ/3'Eκ deletion completely cripples Jκ transcription and

recombination in cis (Gorman et al. (1996); Inlay et al. (2004); Takeda et al. (1993); Xu

et al. (1996)).

The iEκ sequence was found in the IMGT database and was therefore identi�ed during

the initial annotation process. The 3'Eκ and Ed elements were added to the genomic Igκ

sequence using the location information published by Liu et al. (2002). Regulatory regions

that could not be assigned using sequence information are marked as approximate (apr.)

in the �gures.

The chromatin con�guration at the iEκ region is shown in Figure 4.12. Interestingly,

the iEκ cluster lies in a chromatin domain that shows weak H3Ac marks in proB cells,

weak H3Ac and H3K4Me2 marks but strong H3K9Me3 marks in proT cells and a high

level of H3K4Me2 modi�cations in dendritic cells, whereas the Jκ cluster shows no H3Ac,

H3K4Me2 or H3K9Me3 modi�cations in the analyzed cells. The chromatin con�guration

at the 3'Eκ enhancer and the Ed enhancer is shown in Figure 4.13. For these ACEs, no

36


Figure 4.12: Mean enrichment factor plot showing the the Jκ cluster, Eκ enhancer and the

Cκ segment. The locus is displayed from centromer to telomer, and base positions resemble positions

in the regions analyzed. The Jκ segments 1 to 5 are depicted as green bars, the iEκ enhancer is depicted

in purple and the Cκ segment is shown in brown. The mean enrichment factor and SEM over 500 bp

windows is depicted.

37

4. RESULTS

Figure 4.13: Mean enrichment factor plot showing the 3'Eκ and the Ed elements 5' of the

iEκ enhancer in proB, proT and dendritic cells. The locus is displayed from centromer to telomer,

and base positions resemble positions in the regions analyzed. Both enhancer elements were annotated

using the published distances from the Cκ segment (Liu et al. (2002)). The mean enrichment factor and

the SEM are calculated over 500 bp windows.

38


clear enrichment for any chromatin modi�cation can be detected in the analyzed cells. In

summary, the iEκ enhancer may already be active in proB cells, but the element could

also reside in poised chromatin as the H3K4Me2 modi�cation is completely missing in

proB cells. In proT cells the histone con�guration may indicate an active repression of

the Igκ locus, because of the high level of H3K9Me3 modi�cations present at the iEκ

region in proT cells.

4.3.6 Chromatin Modi�cations at the TCRβ Enhancer Region

TCRβ regulation is mainly provided by the Eβ enhancer and one promoter upstream of

each DJβ cluster (Cobb et al. (2006)). Eβ function is T-lineage speci�c and is activated

in the earliest stage of thymocyte development. In addition DJβ recombination is T cell

speci�c (McDougall et al. (1988), Corcoran et al. (2003)). Accordingly, open chromatin

modi�cations were expected only in proT cells.

The location of the enhancer was not marked in the RefSeq database and therefore we

extracted the enhancer sequence from the IMGT/LIGM database and matched it to the

TCRβ locus using the BLAST algorithm. The enhancer fragment is located between the

second C region and the anti-sense oriented most 5' V segment (V31 in IMGT notion or

Vβ14 in Cobb et al. (2006)).

The chromatin state at the TCRβ D, J and C regions containing the enhancer is shown

in Figure 4.14. Both Jβ regions are associated with H3Ac and H3K4Me2 modi�cations

exclusively in proT cells. The H3Ac chromatin marks are particularly strong at both Jβ

regions. The TCRβ enhancer is associated with H3K4Me2 in proB, proT and dendritic

cells. Therefore, the lineage speci�c D→Jβ recombination of TCRβ transgenes described

by Capone et al. (1993) and the T cell speci�city of TCRβ recombination correlates with

the lineage speci�c H3Ac and H3K4Me2 marks at the DJβ clusters.

39

4. RESULTS

Figure 4.14: Lineage speci�c H3Ac and H3K4Me2 modi�cations at both DJCβ clusters in

proT cells. Histone modi�cations at the TCRβ DJ region ranging from the D1 segment to the V segment

nr. 31 (or Vβ14) at the 5' end of the TCRβ locus are shown. The locus is displayed from centromer to

telomer, and base positions resemble positions in the regions analyzed. The two DJβ clusters (D in blue

and J in green) are separated by the Cβ1 segment (brown). The Cβ segments were not clearly annotated

during the annotation process and therefore are split into several elements. The Cβ2 segment is located

between the DJβ2 cluster and the Eβ enhancer (purple). The mean enrichment factor and SEM were

calculated over 500 bp sized windows.

40

4.4 High Sensitivity Hidden Markow Model Based Identi�cation of EnrichedRegions

4.4 High Sensitivity Hidden Markow Model Based Identi�cation of En-

riched Regions

The VH segments were not as clearly associated with any of the analyzed histone modi�ca-

tions as seen for the regulatory regions or the control genes, but small di�erences between

proB and proT cells were suggested by the evaluation of the mean enrichment factor over

the VH coding sequences shown in Figure 4.15. To identify signi�cant di�erences in the

overall level of histone modi�cation at the VH coding sequences of proB and proT cells,

we used a Wilcoxon matched pair test. Both, the level of H3K4Me2 modi�cations over all

VH segments and the level of H3K9Me3 modi�cations over all VH segments was signi�-

cantly di�erent between proB and proT cell ChIP experiments (p < 10−4). In addition

to this global analysis, we wanted to identify chromosomal regions, that are signi�cantly

enriched relative to other regions in the same ChIP experiment. We wanted to know if

the weak H3Ac and H3K4Me2 modi�cations at the distal VH segments were signi�cant.

We did not want to use a standard statistical test like the Wilcoxon matched pair test

to perform this task, as the ∼ 3.6 ∗ 105 oligos on one array would result in ∼ 3.6 ∗ 105

statistical tests and lead to a massive problem of multiple testings. To avoid this problem,

we did not use a sliding window approach as published by Bernstein et al. (2005), but

instead used a hidden markov based method for 'ChIP-on-chip' or tiling array evaluation

named TileMap that was published by Ji & Wong (2005).

TileMap has been developed for ChIP-on-chip (or tiling array) experiments with a limited

amount of reproductions (n = 2 to 3) and has the advantage that no estimation about

the length of a enriched region has to be made. To completely understand the method

and to have full access to the algorithm I re-implemented the HMM parts of the TileMap

program using the Perl programming language version 5.8.8.

4.4.1 Re-Implementation of the TileMap HMM Algorithm

The TileMap array statistics program utilizes a three step approach to evaluate the array

data. First the oligo hybridization signals from di�erent ChIP experiments have to be

normalized, second a 'statistically forti�ed' enrichment factor is calculated including all

ChIP replicates (probe level test statistics) and last a hidden Markov model (HMM) is

calculated to assign each oligo a probability to be part of an enriched region (Penriched).

41

4. RESULTS

(a)

(b)

(c)

Figure 4.15: Mean enrichment factor at the coding sequence of all VH segments ordered

in IgH transcription orientation. Each data point was calculated using the mean oligo enrichment

factors of oligos binding to a 500 bp window starting at the second VH exon (green square - proB cells,

blue triangle proT cells). (a): H3Ac speci�c ChIP experiments; proB n= 3; proT n = 2. (b): H3K4Me2

speci�c ChIP experiments; proB n = 2; proT n= 2. (c) H3K9Me3 speci�c ChIP experiments, proB n = 2;

proT n = 1. The regression line is calculated using the Lowess algorithm implemented in the R package

(Cleveland & Develin (1998); R Development Core Team (2006)). The level of enrichment over all VH

segments di�ers signi�cantly between proB and proT cells for the H3K4Me2 and H3K9Me3 modi�cations,

but not for the H3Ac modi�cation using a Wilcoxon matched pair test.

42


(a)

(b)

Figure 4.16: Quantil normalization of three di�erent INPUT hybridizations. Depicted are M

versus A plots of (a) raw data and (b) quantil-normalized data of 3 pairwise compared experiments. M:

ratio of �uorescence signals; A: mean �uorescence signal. The hybridization signals were log2 transformed.

Quantil Normalization

Normalization based on the original hybridization signals is a prerequisite for TileMap cal-

culation. As no normalization based on hybridization values is performed by NimbleGene,

the hybridization signals �rst had to be normalized. I used the quantil normalization (Bol-

stad et al. (2003)) that was also used for the original TileMap calculation (Ji & Wong

(2005)). Quantil normalization basically removes experimental variations as e. g. di�erent

photo-multiplier settings or di�erent DNA �uorescence dye labeling e�ciencies using a

rank based calculation.

The calculation is based on the idea, that although the �uorescence signals of single oligos

may di�er in there absolute value, the overall distribution of �uorescence signals should

be reproducible between concomitant hybridizations (replicates). Therefore a change in

the overall distribution of �uorescence signals should be due to experimental variations.

To get rid of these variations the oligos of di�erent ChIP replicates are sorted according

43

4. RESULTS

to their �uorescence signals. After this sort, the normalization step assigns each oligo

the mean �uorescence value of all oligos with the same rank. The 'rank' of an oligo is

the position of the oligo in the list of all oligos ordered by the �uorescence signal. After

the normalization, the oligos are brought back to their original order. The e�ect of the

quantile normalization on the distribution of oligo �uorescence signals is exempli�ed in

Figure 4.16.

Probe Level Test Statistics

The probe level test statistic basically represents an inverse mean oligo enrichment factor

(log( INPUT / IP )) rescaled to the reproducibility of the INPUT and IP �uorescence

signals. The probe level test statistics (t(i), oligo i|i ∈ N; with i = the position of an oligo

in a line of oligos ordered by there chromosomal location) were calculated as described

in Ji & Wong (2005). Because t(i) is calculated inversely to the NimbleGene calculated

enrichment factor, the oligos that are enriched by the ChIP precipitation (IP > INPUT )

show negative probe level test statistic values. The mean oligo �uorescence signals are

calculated over all �uorescence signal values of one oligo that were obtained during the

hybridization with a replicate DNA preparation. To exclude oligos with multiple full

length binding sites in the analyzed sequences, we determined the number of full length

binding sites using the BLAST program. For the statistical evaluation only oligos with a

single full length binding site were used.

Statistical Evaluation of the Probe Level Test Statistics to Identify Enriched Chromatin

Domains

Now the �uorescence values were normalized and these normalized �uorescence values

were combined to create an inverse enrichment factor. But still the signi�cantly enriched

oligos had to be identi�ed. To assign the probability to be part of an enriched region

(Penriched) to each oligo, a hidden Markov model (HMM) is used. HMM is a statistical

model in which the system being modeled (the oligos ordered by chromosomal location i)

is assumed to be a Markov process with unknown parameters. An important feature of

a Markov process is the fact that the observable parameters (here: the probe level test

statistics) are logically connected to the hidden parameters (here: the enrichment state,

Hütt Mark-Thorsten (2006)). How vague this logical connection can be is illustrated

by one example: In an interactive spreadsheet designed to teach the forward backward

algorithm that is used to calculate the �nal HMM probabilities, the logical connection

44


between the weather temperature and the amount of ice cones eaten by a random person

is used to explain a markov line (Eisner (2002)). The connection between the temperature

and the ice cones eaten is not absolute, but rather in�uenced by other circumstances, and

therefore an initial estimation of the correlation between the temperature and the ice

cones eaten has to be created. I want to stress the fact, that the initial hidden markov

model is an estimation.

For our problem the hidden parameter (H) has two states: either the oligo is part

of an enriched region (H+) or the oligo is not part of an enriched region (H−). The

state of the hidden parameter is logically connected with the probe level test statistic

values, as one oligo shows a low probe level test statistic value, because the complemen-

tary sequence was enriched during the ChIP experiment. Therefore each probe level test

statistics value has a probability to be measured because the internal state was 'enriched'

(f1(Ti) = p(H+)) and one possibility to be measured becuase the internal state was 'not

enriched' (f0(Ti) = p(H−)).

Ji & Wong (2005) describes two di�erent methods to determine the internal state speci�c

probability functions. The �rst one is based on biological knowledge about which chro-

mosomal regions should be enriched in the ChIP experiment. The second one is based

on the fact that enriched oligos tend to cluster in regions and therefore the oligos next to

the most enriched ones should also re�ect the H+ internal state, whereas the oligos next

to oligos showing little to no enrichment should also re�ect the H− internal state. We

�nally did use the second method, because we had no hypothesis about enriched regions

in dendritic cells or in the H3K9Me3 speci�c ChIP experiments.

To de�ne oligos that are most probably binding to enriched regions, TileMap uses the

(simple) hypothesis, that the oligos that show the smallest probe level test statistics val-

ues also correlate best with the internal state H+. Five percent of all oligos that show

the smallest probe level test statistics value are used to create the probability function

f(1) (enriched). The probability function f(0) (not enriched) is crated using 95 % of the

oligos showing the highest probe level test statistics values. The probability functions

used for the statistical evaluation of H3Ac proB cell speci�c ChIP results are shown in

Figure 4.16(a). All other values required to de�ne a HMM were calculated as described

by Ji & Wong (2005).

45

4. RESULTS

(a)

(b)

Figure 4.17: Changes in the probability functions and the probability values of all oligonu-

cleotides with the iteration of the HMM. (a): changes in the probability functions of the structure

T (i) → P (H+|H−) with ongoing iterations (internal state enriched (f(1), H+) in green, not enriched

(f(0),H−) in red). Shown are the probability functions for the HMM initial estimation (iteration 0),

iteration 1,2 7,8 and 9. The change in the probability functions is most prominent in the �rst iteration

(initial estimate to �rst re-iteration). (b): histogram of the probability to be part of a enriched region

(P (H+)) of all oligonucleotides on the array. The initial estimate (red) and the ninth iteration (black)

are shown. Note the small amount of oligos with unclear internal state ( 0.01 < P (H+) < 0.99) thatremains almost unchanged during the HMM iterations although the amount of oligos that were found to

be enriched increases almost three fold.

46


The algorithm to calculate P(H+) is termed 'standard forward backward algorithm'

and is quite complex (described in Eisner (2002) and in Hütt Mark-Thorsten (2006)).

I implemented the algorithm in Perl and calculated the ice cone example from Eisner

(2002); the results were identical (data not shown).

To reduce the in�uence of untrusted enriched regions smaller than 500 bp during the data

based learning the algorithm is capable of, I did not use each oligo probability value, but

the median probability over a 500 bp region around the actual oligo to recalculate the

probability functions f0 and f1.

As the calculation of probe level test statistics absolutely depends on replicate �uorescence

values, only ChIP experiments with two or more replicates were statistically evaluated.

During the nine re-iterations of the probability functions, the sensitivity increases with

a potential loss of speci�city. In Figure 4.17 the performance of the HMM algorithm

and the in�uence of re-iteration on the distibution of enriched oligos (P(H+) ≥ 0.99)

is depicted. Although the probability functions are not very di�erent (Figure 4.16(a))

almost all oligos were identi�ed to have been either enriched (p(H+) > 0.99) or not

enriched (p(H+) < 0.01) during the ChIP experiment (see Figure 4.16(b)).

Although the forward backward algorithm takes into account the enrichment factors

of the whole Markow chain to assign the P (H+) probabilities to the oligos, I still doubt

that regions smaller that 500 bp can be enriched by a ChIP experiment with initially

precipitated ∼500 bp long DNA fragments. Therefore I only accepted enriched regions

larger than 500 bp and each oligo in these regions had to be enriched with P (H+) ≥ 0.99.

A visual control of the mean enrichment factors at the statistically enriched regions

has been proposed by the micro-array devision of RZPD, the german re-distributor of

the NimbleGene 'ChIP-on-chip' service (Dr. K. Juerchott, personal communication). To

show the sensitivity and speci�city of the statistical test, the transcription start sites of

the Rag1 gene, the Pax5 gene, the VpreB1 gene, the λ5 gene and the Collagen4α3/4

genes are displayed in Figure 4.18.

The Rag1 transcription start site shows both H3Ac and H3K4Me2 modi�cations, but

clearly no H3K9Me3 modi�cations. The two 'open' modi�cations are already in the �rst

round of HMM evaluation marked as signi�cantly enriched in both proB and proT cells.

The H3K4Me2 modi�cations are slowly declining from the Rag1 transcription start to

the 3' end of the gene. Although the level of H3Ac and H3K4Me2 modi�cations is much

lower at the downstream sequences, the reiteration process of the statistical evaluation

leads to a signi�cant enrichment of these sequences.

47

4. RESULTS

(a)

(b)

(c)(d)

Figure

4.18:Dire

ctcompariso

nofthemeanenrich

mentfactordata

andtheHMM

results.

Thegenomic

regionscontainingthe

transcrip

tionsta

rtof(a)theRag1gene,

(b)theVpreB1geneandtheλ5gene,

(c)thePax5geneand(d)theColla

gen4α3geneandthe

Colla

gen4α4geneare

depicted

.Foreach

region,themeanenrich

mentisshow

ntogeth

erwith

theresu

ltsofthe�rst

HMM

analysis

(#0)andthe

ninth

iteratio

n(#

9).

Thesig

ni�cantly

enrich

edchromatin

domainsare

depicted

ascolored

bars,

where

thecolorindica

testheanalyzed

histo

ne

modi�catio

n.

48


The H3K9Me3 modi�cation at the Rag1 coding sequence is very weak, but nevertheless

signi�cant in proB cells. In proT cells this modi�cation can not be statistically evaluated

due to the missing replicate. H3K9Me3 marks at the coding sequence are also seen at the

λ5 gene. The occurrence of the heterochromatin mark H3K9Me3 at actively transcribed

genes is surprising, but Vakoc et al. (2005) has published similar results. The λ5 gene

shows like the VpreB1 gene and the Pax5 gene H3Ac and H3K4Me2 marks only in proB

cells. The signi�cantly enriched regions in the λ5 gene in proT cells can be ignored, as

the H3Ac and H3K4Me2 modi�cations do not overlap and the level of enrichment is not

comparable to the enrichment at the Rag1 transcription start in proT cells.

At the Pax5 gene the independence of the forward-backward algorithm from a de�ned

window size becomes clear: Although the Pax5 transcription start site and one region

in the Pax5 promoter show stronger H3K9Me3 modi�cations than at the Rag1 coding

sequence, these regions are not signi�cantly enriched during the HMM evaluation. In

summary, the results of the statistical evaluation can be related to the mean enrichment

factor values, but the biological relevance of the statistical results always have to be

critically revisited.

4.4.2 HMM Aided Analysis of the VH Segments

For the evaluation of the VH region, we used the sequence of the C57/BL6 VH cluster pub-

lished in Johnston et al. (2006). After the HMM calculation, regions larger than 500 bp

were marked enriched if each oligo binding to that region showed a higher probability than

99% to be part of an enriched region (P (H+) > 0.99). A V segment is identi�ed as signif-

icantly enriched if the coding sequence overlaps with an enriched region. No VH segment

shows signi�cant H3Ac and H3K9Me3 marks in proB cells. In proT cells no VH segment

shows a signi�cant level of H3Ac modi�cations (the statistical evaluation of H3K9Me3 en-

richment in proT cells could not be calculated). The enrichment state for the H3K4Me2

modi�cation of each VH segment is shown in Figure 4.19. Preferentially the distal VH

segments were signi�cantly enrichment for H3K4Me2 in proB, proT and dendritic cell.

Interestingly, the enriched VH segments are mostly located in the distal A cluster of the

VH region, that shows also di�erences in the gene density, the percentage of J558 pseudo

genes and the family type of the interspersed V segments when compared to the proximal

B cluster (Johnston et al. (2006)). As the preference for the distal VH segment was seen

in proB, proT and dendritic cells, the occurrence of the H3K4Me2 modi�cation at the

49

4. RESULTS

Figure 4.19: H3K4Me2 enrichment state of each VH segment published in Johnston et al.

(2006). The whole VH cluster is shown from 5' to 3' and the base pairs resemble position in the published

sequence �le with the accession number BN00872. Each VH segment is depicted as a colored bar and

the color indicates the family of the VH segment. The distal J558 A cluster is highlighted in blue. The

location of the V segments is plotted against the enrichment state after the ninth HMM iteration.

VH segment is not lineage speci�c and does not correlate with the published preferential

usage of proximal VH gene families in V→DJH recombination (Malynn et al. (1990)).

The distribution of chromatin modi�cations at the VH segments was never measured

as detailed as possible with this analysis. To investigate this distribution and to control

the statistical evaluation, an aggregate of all VH segments that were found enriched in

the statistical analysis of the H3K4Me2 speci�c ChIP experiments is created. To generate

these plots the enrichment factors were grouped into data bins that were located on each

VH segment in relation to the start of the second VH exon1.

1The second V exon was used because not only functional VH segments were found to be enriched,

50


The aggregate plot in Figure 4.20 shows, that the VH segments are located in a chromatin

domain of about 2 kb size, that shows H3K4Me2 marks in proB, proT and dendritic cells.

ProT cells show a clearly reduced level of H3K4Me2 modi�cations at the VH segments

compared to proB or dendritic cells. H3Ac and H3K9Me3 modi�cations were only ana-

lyzed in proB and proT cells and both modi�cations are not enrichment at the selected

VH segments. The distribution of H3K4Me2 speci�c marks at the VH segments is slightly

di�erent in the proB, proT and dendritic cells. Notably, the H3K4Me2 modi�cations

appear less strong at the RSS sequences of the VH genes in proB cells as compared to

proT and dendritic cells (4.19, red arrows). As for these plots up to 2.400 oligos were

included in one data point (up to 77 VH segments, ∼32 oligos / 500 bp) the reduced levelof H3K4Me2 modi�cation at the VH RSS elements in proB cells is highly signi�cant.

The reduced level of H3K4Me2 modi�cations at the VH segments in proB cells, could

be due to nucleosomal remodeling that clears speci�cally the RSS elements of recom-

bination competent V segments from nucleosomes, as the association of RSS elements

with nucleosomes forms a potent barrier for RAG-mediated cleavage of in vitro substrates

(Kwon et al. (1998)) and nucleosome remodeling is able to promote RAG mediated cleav-

age to levels seen at naked RSS templates (Kwon et al. (2000)).

In summary the VH segments are neither lineage speci�cally enriched for open chro-

matin marks nor are the enriched VH segment evenly spaced across the VH cluster. The

only clear di�erence between proB and proT cells lies in the level of H3K4Me2 modi�-

cations at the VH segments and the reduced level of H3K4Me2 modi�cation at the RSS

element in proB cells. Therefore, neither H3Ac nor H3K4Me2 modi�cations correlate with

the lineage speci�c V(D)JH recombination potential.

4.4.3 Identi�cation of Three Novel Intergenic VH Acetylated Regions (IVARs)

We identi�ed three novel intergenic regions at the distal VH cluster. The histone con�gu-

ration at these elements is shown in Figure 4.21. All three elements show signi�cant H3Ac

and H3K4Me2 modi�cation only in proB cells. The most proximal IVAR#3 element also

shows signi�cant H3K9Me3 modi�cations. Interestingly, the V8 segment downstream of

the IVAR#2 element is signi�cantly associated with H3K4Me2 in proB, proT and den-

dritic cells, whereas the IVAR#2 itself shows H3K4Me2 and H3Ac modi�cations only in

but also pseudogenes that did not contain a functional �rst exon.

51

4. RESULTS

(a)

(b)

(c)

Figure

4.20:Aggregate

meanenrich

mentfactors

ofVHgenesin

proB(a),proT(b)anddendritic

cells

(c).

AllVHgenes

thatwere

enrich

edin

theH3K4Me2

ChIPsacco

rdingto

theHMM

analysis

(77VHgenes

inproB,34VHgenes

inproTand45VHgenes

indendritic

cells)

are

centered

atthesta

rtof

theseco

ndVHexon.Themeanenrich

mentfacto

r(+

/-SEM)of500bpreg

ionsofallenrich

edVseg

mentisshow

n

(H3Acin

green

,H3K4Me2

inblueandH3K9Me3

inred

).Thedata

pointcontainingtheRSSelem

entsismarked

byred

arrows.

52


(a) (b)

(c)

Figure 4.21: Histone modi�cations at three, yet undescribed intergenic VH acetylated regions

(IVARs, purple). The HMM results from the ninth iteration is shown beneath each graph. ((a), (b),

(c)): IVAR#1, IVAR#2 and IVAR#3. The IVAR regions are located in the distal VH cluster. The loci

are displayed in IgH transcriptional orientation, and base positions resemble positions in the BN000872

sequence �le. IVAR#2 lies about 4 kb upstream of a VH gene of the V8 family (displayed as red box)

and about 4 kb downstream of a VH gene of the V1 family (displayed as blue box).

53

4. RESULTS

proB cells. Therefore the IVAR elements show a clearer lineage speci�c histone modi�-

cation pater than the VH segments. All three elements are almost sequence identical as

shown by a multiple alignment of the sequences in the appendix A.1.

As the IVAR elements are the only lineage speci�cally chromatin modi�ed regions

in the VH cluster, these elements could be required for the regulation of lineage spe-

ci�c V(D)JH recombination. The most proximal IVAR#3 element is further analyzed in

chapter 4.6.

4.4.4 The DH Locus

The DH locus has been reported to be associated with H3K4Me2 at the centromeric

(DQ52) and telomeric (DFL16.1) end in Rag−/− proB cells (Sen & Oltz (2006)). In

Abelson murine leucemia virus transformed cell lines this modi�cation pattern was shown

by Morshead et al. (2003), but here especially the DFL16.1 element was enriched for

H3K4Me2. In a proT cell line this DH segment was not associated with H3K4Me2 marks.

In this analysis, the DQ52 segment shows H3Ac, H3K4Me2 and H3K9Me3 modi�ca-

tions in proB and proT cells as already seen in Figure 4.9. The level of histone modi�ca-

tions at the other DH elements is drastically reduced, although the DH element directly

upstream of DQ52 and the most distal DFL16.1 segment are signi�cantly enriched for

H3K4Me2 marks in proB cells as shown in Figure 4.22. In proT cells parts of the in-

tergenic DH sequences show H3Ac marks, but here the level of H3Ac modi�cations is

very low. In proT and dendritic cells the DH element directly upstream of the DQ52 is

associated with H3K4Me2 marks. In summary for the IgH locus, only the IVAR elements

are clearly and lineage speci�cally associated with open chromatin.

4.4.5 IgL V Segments

The Igκ locus is meant to become V(D)J recombined in small, resting preB cells and

not in the here analyzed proB cells. Therefor we did not expect it to be associated with

open chromatin in this analysis. As expected, none of the Vκ segments was signi�cantly

enriched for H3Ac, H3K4Me2 of H3K9Me3 modi�cations in proB, proT or dendritic cells

(see Figure 4.23). As some intergenic Vκ sequences show H3K9Me3 marks in proB cells,

but H3K4Me2 marks in proT cells, the Igκ V region seems to be in a more accessible

con�guration in proT cells that in proB cells.

54


Figure 4.22: Histone modi�cations at the DH cluster in proB, proT and dendritic cells. The

locus is displayed in chromosomal orientation, starting at the most proximal DQ52 segment and ending at

the most distal DFL16.1 segment. The mean enrichment factor and SEM of 500 bp regions was calculated

and is displayed for each cell type above the statistical results from the ninth HMM iteration (#9).

55

4. RESULTS

Figure 4.23: Statistical evaluation of chromatin modi�cations at the Igκ lous. The enriched

regions found in HMM iteration 9 are shown. The base positions resemble positions in the regions

analyzed. The location of the Ig segments is shown in blue on the bottom for each line. The enriched

regions are marked as colored bars above the Ig information and the label for each information line shows

the precipitating antibody and the used cell type. The color code for the data lines is as follows: H3Ac

= green, H3K4Me2 = blue, H3K9Me3 = red. The enhancer region is situated at the 3' end of the locus

in the lower right corner.

56


The signi�cant enrichment for H3K9Me3 at several regions in the Vκ cluster could

be related to the mean enrichment factors using serial mean enrichment plots across the

whole locus, but the levels of H3K9Me3 modi�cations never reache levels seen at the Eµ

region or the iEκ enhancer (data not shown). Only one chromatin domain, the promoter

of an anti-sense orientated Vκ segment at the proximal end of the Vκ cluster, shows

weak H3Ac and H3K9Me3 marks in proB cells, weak H3Ac and H3K4Me2 marks but

strong H3K9Me3 marks in proT cells and strong H3K4Me2 marks in DCs (see Figure

4.24). Hence the chromatin con�guration at this domain closely resembles the chromatin

con�guration at the iEκ enhancer region. As the domain is located at the promoter region

of an anti-sense orientated Vκ segment, the chromatin domain may regulate the expression

of an anti-sense Vκ transcript. The Igλ locus shows no signi�cant histone modi�cations

in the analyzed cells.

In summary, both IgL loci seem to reside in a poised state in proB cells, whereas in

proT cells V(D)J recombination at the Igκ locus seems to be actively suppressed, as the

iEκ enhancer region and the new putative VH regulative element both show high levels

of H3K9Me3 modi�cations.

4.4.6 TCRβ V Segments

The major di�erence in histone modi�cation at the TCRβ locus between proB and proT

cells lies in the accessibility change at the Jβ clusters (Figure 4.14). This di�erence is

con�rmed during the statistical analysis, as no enrichment for H3Ac or H3K4Me mod-

i�cations was detected at the DJβ clusters in proB or dendritic cells, whereas the open

character of the Jβ clusters in proT cells was con�rmed (Figure 4.25(d)).

The statistical analysis of the Vβ cluster depicted in Figure 4.25 shows that Vβ seg-

ments were found to be enriched for H3K4Me2 modi�cations preferentially in proT cells.

In addition, ∼71% of the Vβ segments show a signi�cant enrichment for H3K4Me2 marks

in proT cells, whereas in proB cells only ∼33% and in dendritic cells only ∼13% of the Vβ

segments were signi�cantly associated with H3K4Me2. However, this drastic di�erence

in the number of enriched segments had no obvious in�uence on the mean H3K4Me2

enrichment over all Vβ segments that were signi�cantly enriched for H3K4Me2 shown in

Figure 4.25(b),(c).

The VH RSS elements show a clearly reduced level of H3K4Me2 modi�cation in proB

cells when compared to the VH coding sequence. In proT and dendritic cells this reduction

57

4. RESULTS

Figure 4.24: Histone modi�cations at a potential regulatory element in the Vκ-cluster. The

displayed V segment is the third last Vκ segment at the proximal end of the Vκ cluster. It is separated

by ∼0.5 Mb from the iEκ region. The locus is displayed from centromer to telomer, and base positions

resemble positions in the regions analyzed. The statistical results from the ninth HMM iteration are

shown beneath the mean enrichment data.

58


(a)

(b) (c)

(d)

Figure 4.25: Histone modi�cations of the TCRβ locus in proB, proT and dendritic cells. (a):

The enrichment state of the Vβ segments for H3K4Me2 modi�cations after the statistical evaluation. The

enrichment state of the Vβ segments is plotted against the location of the V segments in the Vβ cluster.

((b), (c)): Aggregate mean enrichment factors of Vβ genes in proB (b) and proT cells (c). All Vβ genes

that were statistically enriched in the H3K4Me2 ChIPs (9 Vβ genes in proB and 16 Vβ genes in proT

cells) are centered at the start of the second Vβ exon.The mean enrichment factor (+/- SEM) of 500 bp

regions of all enriched V segment is shown (H3Ac in green, H3K4Me2 in blue and H3K9Me3 in red).(d):

Distribution of statistically enriched chromatin domains accross the TCRβ locus. The Vβ cluster and

the DJCβ clusters are displayed.

59

4. RESULTS

in the level of H3K4Me2 modi�cations was not visible. The Vβ RSS element do not show

this e�ect in proT cells.

At the IgH locus the only clearly lineage speci�cally enriched chromatin domains lie

in the intergenic regions of the VH cluster. Therefore, we searched the TCRβ cluster

for similar elements in respect to the chromatin con�guration. We could not identify a

intergenic Vβ acetylated region during a detailed analysis of the mean enrichment factors

over the whole TCRβ locus (data not shown). Nevertheless the detailed analysis revealed

a large H3Ac modi�ed chromatin domain at the center of the Vβ cluster. But contrary

to the IVAR elements, that chromatin domain spans over two Vβ segments (see Figure

4.26). The level of H3Ac enrichment seen at this region is comparable to the level of H3Ac

enrichment seen at the Dβ1 segment. As this region is the only clearly H3Ac enriched

region in the Vβ cluster and it also shows H3K4Me2 modi�cations, this region may have

a yet unknown function in V(D)Jβ recombination.

One part of the Vβ cluster was already analyzed for H3Ac enrichment by Tripathi et al.

(2002). The region analyzed could be identi�ed using the primer sequences mentioned

in the paper and is displayed in Figure 4.27. All Vβ segments in the analyzed region

show less H3Ac modi�cations than the chromatin domain at the center of the Vβ cluster

shown in Figure 4.26. Nevertheless, we could reproduce the relative di�erences in the

level of H3Ac enrichment published by Tripathi et al. (2002) between the V16, Vb13,

V9 and V12 segments. But in proB cells these Vβ segments show similar levels of H3Ac

modi�cations. Therefore, only the central chromatin domain shows clear and lineage

speci�c H3Ac modi�cations at the Vβ cluster. Together with the lineage speci�c H3Ac

and H3K4Me2 marks at the DJCβ clusters, this newly identi�ed chromatin domain could

be responsible for the activation of Vβ segments for T cell speci�c V(D)J recombination.

60


Figure 4.26: Histone modi�cations at the chromatin domain in the TCRβ locus that shows

the highest proT cell speci�c H3Ac modi�cations. The locus is displayed from centromer to

telomer, and base positions resemble positions in the regions analyzed. The Vβ segments are named

according to the IMGT naming scheme except for the Vβ segment named Va, where the IMGT name

was not recovered during the locus annotation process and the Vβ segment named Vb13.2, that was

annotated according to Tripathi et al. (2002). The displayed mean enrichment factor and SEM values

were calculated over 500 bp wide regions and the statistical results from the ninth iteration are displayed.

61

4. RESULTS

Figure 4.27: Detailed evaluation of the Vβ region published by Tripathi et al. (2002). The locus

is displayed in chromosomal orientation and base positions resemble positions in the regions analyzed.

Potential Vβ segments without annotation in the IMGT database are named Va, Vb and Vc. All other

Vβ segments are annotated according to the IMGT nomenclature with the following correspondence

to Tripathi et al. (2002): V16=Vβ11; Vb=Vβ12 Vc=Vβ9. The Vβ13 gene in Tripathi et al. (2002) is

displayed as Vb13.2 in the �gure. Mean enrichment factor and SEM of 500 bp regions and the statistical

results from the ninth iteration are displayed.

62


4.4.7 TCRα/δ Locus

The TCRα locus and the TCRδ locus are located in the same genomic region. The

Vδ segments are intermingled between the Vα segments and some V segments can even

be used in α/β and γ/δ T cell receptors (Krangel et al. (2004)). The DJCδ cluster is

surrounded by the JCα cluster and the Vα/δ cluster. The TCRα locus is assembled in

DP preT cells, whereas the TCRδ locus becomes assembled in DN proT cells (Cobb et al.

(2006)). Therefore we expect that the TCRα locus, or at least the Jα cluster, resides in

an inactive chromatin environment in Rag−/− proT cells, whereas the DJδ cluster resides

in an open chromatin environment.

During the statistical evaluation shown in Figure 4.27(a), 25% of the Vα/δ segments

show a signi�cant enrichment for H3Ac in proT cells, whereas only 8% show a signif-

icant enrichment for H3Ac in proB cells. Therefore clearly more Vα/δ segments show

H3Ac modi�cationsa in proT cells than in proB cells. This tendency can not be seen

for the H3K4Me2 modi�cation, as in proT cells 23% of all Vα/δ segments are enriched

for H3K4Me2 whereas in proB cells 25% and in dendritic cells only 6% are enriched for

H3K4Me2. Therefore, we conclude, that the Vα/δ segments are not lineage speci�cally

enriched for the open chromatin marks H3Ac and H3K4Me2. Even a detailed visualiza-

tion of the chromatin modi�cations using serial mean enrichment factor plots across the

whole Vα/δ locus did not reveal a clearly proT cell speci�cally enriched region (data not

shown).

At the IgH locus the RSS elements show a signi�cantly reduced enrichment for H3K4Me2

in the recombination competent cells, but at the TCRα/δ locus the RSS elements were

comparably enriched for H3K4Me2 in proT cells and in proB cells (see �gure 4.28(b),(c)).

The Jα cluster is not associated with open chromatin in proT, proB and dendritic

cells even so the TCRα enhancer region is associated with H3K4Me2 in proT, proB and

dendritc cells. On the other hand the DJδ cluster shown in Figure 4.29 is clearly enriched

for H3Ac and H3K4Me2 only in proT cells.

D→J recombination at the IgH locus always precedes V→DJ recombination. Re-

combination at the TCRδ locus does not follow this strict segment type speci�c order

of V(D)J recombination (Chien et al. (1987)). Therefore, it is interesting, if the level of

H3Ac or H3K4Me2 modi�cations is clearly di�erent between the 'distal' D segments of

these two loci. When we compare the chromatin modi�cations at the Dδ2 segment with

the chromatin modi�cations at the DH cluster proximal of DQ52, the Dδ2 shows a much

63

4. RESULTS

(a)

(b) (c)

Figure 4.28: Histone modi�cations at the TCRα/δ locus in proB, proT and dendritic cells.

(a): The enriched regions found during the ninth HMM iteration are shown. The TCRα/δ locus is spread

over �ve lines. The �rst four lines show the Vα/δ cluster and the �fth line depicts the (D)JC clusters

of both TCR chains. V and D segments are depicted as blue bars, J segments are shown in green, C

segments in brown and regulatory elements in purple. The DJCδ cluster is marked by a red circle. ((b),

(c)): Aggregate mean enrichment factors of all Vα/δ genes in proB (b) and proT cells (c). The Vα/δ genes

are centered at the start of the second V exon.The mean enrichment factor and SEM was calculated over

500 bp regions of all enriched V segment (H3Ac in green, H3K4Me2 in blue and H3K9Me3 in red).

64


Figure 4.29: Detailed evaluation of the chromatin modi�cations at the D, J and C segments

of the TCRδ chain. Shown are the Dδ1 and Dδ2 segments, the Jδ1 and Jδ2 segments, the Cδ cluster,

the TCRδ enhancer Eδ and the anti-sense orientated Vδ5 segment. This region is marked by a red circle

in �gure 4.28. The mean enrichment factor and SEM are calculated over 500bp regions.

65

4. RESULTS

stronger level of H3Ac and H3K4Me2 marks. Therefore, the level of H3Ac and H3K4Me2

modi�cations at the distal D segments correlates with the strict segment type speci�c

order of V(D)J recombination.

In summary both, the Jα and the Vα/δ cluster are not clearly associated with open

chromatin, whereas the DJδ cluster is proT cell speci�cally associated with open chro-

matin. These �ndings correlate with the V(D)J recombination potential of the TCRα/δ

locus in DN proT cells.

4.4.8 TCRγ Locus

The TCRγ locus is separated into several sub-loci each consisting of a set of V, J and

C segments (Baker et al. (1998)). The sub-locus upstream of the Cγ1 is best analyzed and

therefore only this part was evaluated here. The TCRγ locus is V(D)J recombined in DN

proT cells (Cobb et al. (2006)). Therefor the TCRγ locus is expected to be associated

with the open chromatin marks H3Ac and H3K4Me2 in proT cells.

The TCRγ locus shows H3Ac and H3K4Me2 marks at the J cluster only in proT cell,

wheras the Eγ enhancer shows H3K4Me2 marks also in proB cells (see Figure 4.30). The

Vγ segments show an association with H3Ac and H3K4Me2 in proT cells. Whereas H3Ac

modi�cations are proT cell speci�c, H3K4Me2 modi�cations at the Vγ segments are in

part reproducible in proB and dendritic cells.

In the mean enrichment factor plot in Figure 4.30 the regions signi�cantly enriched for

H3Ac and H3K4Me2 marks also show high levels of H3Ac and H3K4Me2 modi�cations.

In proT cells both the Jγ and the Vγ cluster are visibly associated with open chromatin.

Unlike all other Ig or TCR loci the Vγ cluster is clearly associated with open chromatin,

but again this association is not strictly T cell speci�c, as the level of H3K4Me2 enrichment

seen at the Vγ cluster is also visible in proB and dendritic cells.

In summary, the recombination competent TCR V segments show a lineage speci�c

association with H3Ac and H3K4Me2 marks, whereas the (D)J clusters are clearly lineage

speci�cally associated with open chromatin marks only in proT cells.

66


Figure 4.30: Histone modi�cations at the TCRγ locus upstream of the Cγ1 segment shown

in brow. The locus is displayed from centromer to telomer, and base positions resemble positions in the

regions analyzed. Both, the mean enrichment factor / SEM over 500 bp wide regions and the statistical

results from the ninth iteration are shown.

67

4. RESULTS

4.5 VDJ-Recombination Studies

In this analysis, preferentially the distal VH segments show H3K4Me2 modi�cations. To

investigate, whether this chromatin modi�cation has an in�uence on V→DJH recombina-

tion, we wanted to analyze the frequency of distal versus proximal VH segments in VDJH

joint creation.

The VHJ558 gene family in the C57/BL6 mouse genome consist of 84 family members

and spans a 1 Mb genomic region at the 5' end of the IgH locus (Johnston et al. (2006)).

The family is separated into two genomic regions, that di�er in the gene density, the

percentage of J558 pseudo genes and the family type of the interspersed V segments. The

42 J558 segments in the distal 1 Mb A cluster are intermingled with 15 3609 V segments,

whereas V segments of this family are completely missing in the 400 kb large B cluster

(Johnston et al. (2006)).

In this analysis, signi�cantly more of the 42 J558 genes in the A cluster show a signi�cant

level of H3K4Me2 modi�cations than of the 42 J558 segments in the B cluster (35 vs.

15; χ2 p = 9.009−9). If this modi�cation is bene�cial for VDJH recombination, we would

expect, that the enriched V segments are more often found in VDJH joints than the not

enriched V segments. Therefore the A cluster J558 segments should be found in V(D)J

recombination events more frequently than those of the B cluster.

To access primary V(D)J recombination events we made use of a RFLP in the murine

IgH locus that distinguishes between the IgHa and the IgHb allotypes. The polymorphism

de�ning the restriction enzyme recognition sequence is located at the IgHa J region down-

stream of the JH3 segment (Figure 4.31). Using this RLFP we were able to selectively

clone and sequence IgMb VDJ recombination events from IgMa expressing splenic B cells

of two IgHa/b heterozygous mice.

Figure 4.31: Location of the IgHa speci�c A�II site and the VDJ PCR-primers (germline

con�guration).

68

4.5 VDJ-Recombination Studies

(a) A cluster

(b) B cluster

Figure 4.32: Usage of individual VJ558 gene segments of the distal A cluster and the proximal

B cluster in non-functional VDJ recombinations of splenic B cells. The results for both mice

are shown separately. Statistically overrepresented VH genes are marked by **.

IgMa expressing splenic B cells from two DBAxC57/BL6 mice were separately sorted,

and 93 V(D)J recombination events of the IgHb allele were analyzed (72 respectively 22

sequenced VDJH joints). For all but two VDJH joints we could exclude that the assembled

gene is able to create a functional µHC protein, as all VDJH joints were either recombined

out of frame, contained a stop codon or were marked as pseudo genes in the published IgH

VH cluster (Johnston et al. (2006)). The distribution of the sequenced VH J558 segments

over the VH cluster is shown in Figure 4.32.

In summary 44 J558 segments of the A cluster and 49 of the B cluster were sequenced.

With the hypothesis, that each J558 segment in the IgH locus can be ampli�ed, the

A cluster J558 segments are recombined as frequently as the J558 V segments of the

69

4. RESULTS

Figure 4.33: DH segment usage in non-functional VDJ recombinations from splenic B cells.

DJH2 and DJH3 recombinations events are analysed separately. Statistically overrepresented DH seg-

ments are marked by **.

B cluster (χ2 p = 0.18). Therefore we have to reject the initial hypothesis, that the

H3K4Me2 modi�cation is correlated with the V(D)J recombination potential of the J558

VH segments.

To additionally check if any of the V segments was sequenced more often than ex-

pected by chance we applied poisson statistics corrected for multiple testing. Only for the

J558.26.116 V segment a higher probability to be sequenced could be proven in both mice

(Figure 4.32). The V segment was also overrepresented in two other V(D)J joint analyses

(Gu et al. (1991); Schwers (1995)). As this VH segment did not show H3Ac or H3K4Me2

modi�cations in proB cells, H3K4Me2 marks are not correlated with the recombination

potential of single VJ558 segments.

In this thesis the most proximal and the most distal DH segment showed H3K4Me2

marks in proB cells. Therefore we wanted to analyze, if the DH recombination potential

is correlated with the H3K4Me2 modi�cations at the DH cluster. We checked whether

the proximal or distal DH segments are used more frequently in V(D)J recombination

than expected by chance. Using the poisson statistics we found a signi�cantly higher

usage of the distal DH segment DFL16.1 in both mice (IMGT notation, Figure 4.33). But

this e�ect is restricted to the JH3 containing V(D)J recombination events. As D→JHrecombination normally does not lead to allelic exclusion visible in splenic B cells (Ehlich

et al. (1994)), successive D→JH recombination events are possible. In a �nal result

of successive D→JH recombination events at the DJH cluster, preferentially the distal

DH segments are possible recombination partners for the JH3 element, leading to an

70

4.6 Intergenic VH Acetylated Regions (IVARs)

overrepresentation of the most distal DFL16.1 segment in VDJH3 recombination events.

Therefore, H3K4Me2 modi�cations at either VH or DH segments does not correlate with

the VDJH recombination potential of these segments.

4.6 Intergenic VH Acetylated Regions (IVARs)

Analysis of the IgH V cluster chromatin con�guration revealed three regions that show

H3Ac and H3K4Me2 modi�cations only in proB cells (IntergenicVH Acetylated Regions,

IVARs). These three elements are almost sequence identical showing a sequence similarity

of at least 95% (multiple sequence alignment in A.1). The IVARs are associated with open

chromatin exclusively in B cells (Figure 4.21 and Figure 4.33(a)). A cross species BLAST

search revealed more than 10 over 600 bp long matches to the rat IgH locus at the

telomeric tail of chromosome 6 (data not shown). As H3Ac modi�cations are associated

with transcription start sites (Bernstein et al. (2005)), we checked whether the IVARs are

transcriptional enhancers or promoters. For this analysis we concentrated on IVAR#3.

The IVAR#3 region was tested in a reporter gene assay during a diploma work (Stein

(2006)). In summary the IVAR#3 element showed no enhancer activity, but in connection

with the Eµ enhancer it was able to signi�cantly promote luciferase expression. The Eµ

dependent promoter in the analyzed IVAR#3 element drives a transcript that is oriented

in anti-sense to the IgH transcriptional orientation (Stein (2006)). This �nal result of the

diploma work was reproduced once and the result is shown in Figure 4.34 together with

the chromatin con�guration at the IVAR#3 element in proB and proT cells.

71

4. RESULTS

(a) proB (b) proT

(c) luciferase expression (d) Positive control

vector (e) Sense orientation

(f) Anti-sense orienta-

tion

(g) Negative control

vector

Figure 4.34: Analysis of the transcriptional activity of the IVAR#3 element. (a),(b): Mean

enrichment factor plot showing the chromatin con�guration at the IVAR#3 element in proB and proT

cells. The mean enrichment and SEM over 500 bp regions is shown. (c): Reporter assays testing the

IVAR#3 element in both orientations relative to Cµ in combination with the Eµ enhancer element.

Assays were performed in triplicates, values are set in relation to the negative control experiment using

the reporter vector without promoter element and error bars denote the standard deviations. (d), (e), (f)

and (g): Schematic view of the used reporter gene constructs. For detailed information about the vectors

see Stein (2006) and chapter 7.10.

72

4.7 In�uence of IL7 Cultivation on H3 Acetylation at the VH and the Vκ

Cluster


Cluster

The distal VH segments, namely the J558 or V1 family members have been reported to

be H3 acetylated upon IL7 signaling (Chowdhury & Sen (2001, 2003); Corcoran et al.

(1998)). The reported association of VH segments with H3Ac comparable to the Eµ

intron enhancer could not be reproduced in ex vivo proB cells, and therefor one ChIP

experiment using IL7 cultivated CD19+ proB cells from Rag−/− mice was performed.

No statistical evaluation was possible for the IL7 cultivated H3Ac precipitation, as this

ChIP experiment was done only once. The level of H3Ac modi�cations at the VH coding

sequence and the aggregate plot over all VH segments of ex vivo and IL7 cultivated proB

cells is shown in Figure 4.35. Indeed, a weak gain of H3Ac modi�cations can be seen at the

VH segment coding sequence, and interestingly this weak gain is most prominent at the

distal VH segments. But in the aggregate plot, the gain of H3Ac modi�cation at the VH

segment is not restricted to the coding sequence. Instead, the gain of H3Ac modi�cations

is visible over a range of at least 10 kb around the VH elements. As again mainly the

distal VH segments were additionally H3Ac modi�ed, this gain of H3Ac modi�cations does

not correlate with the V→DJH recombination frequency of the distal VJ558 segments.

Furthermore the level of H3Ac modi�cations at the J558.26.116 V segment that was

previously identi�ed to participate in V(D)J recombination more frequently than the

other J558 V segments was not signi�cantly enhanced.

IL7 cultivation of Rag1−/− proB cells leads to a gain of H3Ac modi�cations at the distal

VH cluster, but does not correlate with the V(D)J recombination potential of VH J558

segments. Hence, the additional deposition of H3Ac modi�cations could be a experimental

artifact. Therefore, the change in the level of H3Ac modi�cations at the Igκ V cluster

was also analyzed.

The level of H3Ac modi�cations at the Vκ coding sequence and the aggregate plot over all

Vκ segments of ex vivo and IL7 cultivated proB cells is shown in Figure 4.36. Interestingly

the change in the level of H3Ac modi�cations at the Vκ segments is comparable to the

gain of H3Ac modi�cations at the VH segments, as at least a 10 kb wide area around the

Vκ segments is a�ected by this change in H3Ac modi�cations. Furthermore the change

in the level of H3Ac modi�cations at the Vκ locus is almost equal to the change seen at

the VH segments. Therefore, the change in H3Ac modi�cations at the IgH locus upon

IL7 cultivation may be an experimental artifact.

73

4. RESULTS

(a)

(b)

Figure 4.35: In�uence of IL7 cultivation on VH segment H3 acetylation. (a): mean enrichment

factors over 500 bp regions covering the VH segments for ex vivo proB cells (green) and IL7 cultivated

proB cells (red). The colored line represents a local regression for each cell type that is calculated using

the R package Lowess function. (b): Aggregate mean enrichment factors of all 195 VH genes in ex vivo

(green) and IL7 cultivated proB cells (red). The VH segments are centered at the start of the second V

exon.The mean enrichment factor and SEM of 500 bp regions of all V segments is shown.

74


Cluster

(a)

(b)

Figure 4.36: In�uence of IL7 cultivation on Vκ segment H3 acetylation. (a): mean enrichment

factors over 500 bp regions covering the Vκ segments for ex vivo proB cells (green) and IL7 cultivated

proB cells (red). The colored line represents a local regression for each cell type that is calculated using

the R package Lowess function. (b): Aggregate mean enrichment factors of all 106 Vκ genes in ex vivo

(green) and IL7 cultivated proB cells (red). The Vκ segments are centered at the start of the second V

exon.The mean enrichment factor (+/- SEM) of 500 bp regions of all V segments is shown.

75

4. RESULTS

4.8 In�uence of IL7 Cultivation on H3K4 Di-Methylation at the VH and

the Vκ Cluster

Although IL7 culture had no clear in�uence on H3Ac marks at the VH segments, we

additionally analyzed the in�uence of IL7 cultivation on H3K4Me2 modi�cations. For

this analysis we cultivated Rag−/− proB cells that were transgenic for a tetracycline (tet)

regulated functional µ heavy chain protein (µHC, Hess et al. (2001)). The mice harbor a

tetracycline (tet) regulated transcription factor (tet o� system) under control of the Eµ

enhancer and an IgH V exon together with the Cµ constant regions under the control of

a tet operon. The tet regulator is activating transcription of the µHC transgene in the

absence of tetracycline. Addition of tet into the cell culture medium shuts down µHC

expression. As the only di�erence between proB and preB cells is the expression of a

functional µHC, we can change the phenotype of Rag−/− dTG derived, cultivated CD19+

B cells from proB to preB stage by removing tet from the cell culture medium.

The ChIP IP fraction of proB cells that were cultivated under repressive conditions

(+tet) was hybridized together with the ChIP IP fraction of induced proB cells (−tet) onto

a NimbleGene chip and therefore no enrichment factor in respect to the �uorescence value

of genomic DNA (INPUT) was calculated. This ChIP-on-chip experiment was mainly used

for the comparison between proB and preB cells in chapter 4.9, but in addition we were

able to investigate the in�uence of IL7 cultivation on the H3K4Me2 modi�cations.

To compare the H3K4Me2 data between ex vivo and IL7 cultivated proB cells, the +tet

IP �uorescence values were compared with the IL7 cultivated proB cell INPUT data set

to calculate the oligo enrichment factors. This INPUT data set was already used to

calculate the H3Ac enrichment factors from IL7 cultivated proB cells. From each of the

newly calculate H3K4Me2 speci�c enrichment factors the median of all newly calculated

enrichment factors was subtracted to re-center the median enrichment factor to zero. This

normalization step is comparable to the normalization calculated by NimbleGene.

The level of H3K4Me2 modi�cations at the VH and the Vκ coding sequence in proB

and preB cells is shown in Figure 4.37. Upon IL7 cultivation of proB cells the H3K4Me2

modi�cations at the distal VH segments are lost, whereas the Vκ segment associated

H3K4Me2 modi�cations stay almost unchanged. As this e�ect could be due to a dif-

ference in the INPUT oligo hybridization signals, we additionally calculated the oligo

enrichment factors using an INPUT data set from Rag−/− proB cells hybridized together

with a H3K4Me2 precipitate. With this data set the e�ects seen in Figure 4.37 could be

reproduced.

76

4.8 In�uence of IL7 Cultivation on H3K4 Di-Methylation at the VH and theVκ Cluster

(a)

(b)

Figure 4.37: In�uence of IL7 cultivation on VH and Vκ segment H3K4Me2 enrichment.

Depicted are the mean enrichment factors of 500 bp regions starting at the coding sequence of the

V segments of ex vivo (blue rectangle, n = 2) and IL/ cultivated proB cells (red circles, n = 1). The

regression line is calculated using the R statistical package Lowess function. (a): The VH segments

as published in Johnston et al. (2006). (b): Vκ segments; base pairs resemble positions in the regions

analyzed.

It is possible, that the sensitivity to detect H3K4Me2 modi�cations is lower in the

ChIP experiment using the IL7 cultivated dTG proB cells. Therefore we compared the

level of H3K4Me2 marks at the Eµ enhancer region, the iEκ region and the anti-sense Vκ

promoter element between ex vivo proB cells and IL7 cultivated dTG cells (Figure 4.38).

IL7 cultivation leads to an impressive gain of H3K4Me2 modi�cations at the Eµ enhancer

region and the iEκ region. Hence, the sensitivity to detect H3K4Me2 modi�cations was

not reduced in the IL7 ChIP experiment. In contrast to the H3K4Me2 modi�cations at the

77

4. RESULTS

(a)

(b)

(c)

Figure4.38:In�uenceofIL7cultiv

atio

nonthechromatin

modi�catio

nsattheEµregion(a),theiEκregion(b)andthepromoter

regionofthe�rst

anti-se

nse

orie

ntatedVκsegment(c).

Themeanenrich

mentfacto

randSEM

over500bpwidereg

ionsare

show

n.

78

4.8 In�uence of IL7 Cultivation on H3K4 Di-Methylation at the VH and theVκ Cluster

Figure 4.39: Chromatin modi�cations at the transcription start sites of genes expressed in

proB cells either isolated ex vivo or cultivated in IL7. The mean enrichment factor and the SEM

are calculated over all ChIP replicates and the oligonucleotides binding to a 500 bp region immediately

downstream of the transcription start site. The ex vivo proB cell speci�c ChIP experiment were done

at least in replicates. whereas the ChIP experiments using the IL7 cultivated proB cells were performed

only once.

Eµ enhancer region, the level of H3Ac modi�cations is not changed during IL7 cultivation,

whereas at the iEκ region the level of H3Ac marks also rises. Interestingly the level of

H3K4Me2 and H3Ac modi�cations at the recombination incompetent Jκ cluster is not

changed during IL7 cultivation of proB cells. The promoter region of the �rst anti-sense

orientated Vκ segment shows chromatin modi�cation patterns comparable to the iEκ

region and therefore it is not surprising, that the histone modi�cations at the promor

region are changed in parallel to the iEκ region upon IL7 cultivation.

It is surprising, that on the one hand the H3K4Me2 modi�cations at the VH segments

are lost and on the other hand the Eµ region, the iEκ region and the proximal Vκ promoter

massively gain H3K4Me2 modi�cations. To test whether the signal to noise ratio was

changed and therefore all regions clearly associated with H3K4Me2 in ex vivo proB cells

79

4. RESULTS

show a higher enrichment for H3K4Me2 in IL7 cultivated cells, the transcription start sites

of the positive control genes are once again analyzed in Figure 4.39. Instead of a gain of

H3K4Me2 modi�cations at the positive control genes all transcription start sites analyzed

show a clear reduction of H3K4Me2 marks upon IL7 cultivation. This reduction is seen

most clearly at the Rag1/2 genes where H3K4Me2 modi�cations are almost completely

lost. Therefore IL7 cultivation most probably induces a qualitative change in the genomic

H3K4Me2 modi�cation pattern.

4.9 Changes in the Level of H3K4Me2 Marks at the JH Cluster Upon

Expression of a Functional µHC

The chromatin state associated with the establishment of allelic exclusion has been in-

vestigated using proB and proT cell speci�c ChIP experiments. We found preferentially

at the recombination competent D and J clusters, but also at the distal VH cluster a

signi�cant association with H3K4Me2 modi�cations. To test, if these modi�cations are

speci�cally lost upon µHC protein expression and the concomitant progression from the

proB to the preB cells stage, we performed one ChIP experiment using proB cells express-

ing a transgenic µHC protein.

PreB cells were generated using Rag−/− dTG mice described by Hess et al. (2001).

µHC expression upon removal of tet is activated only in about 13to 1

2of the cultivated dTG

proB cells, as published by Hess et al. (2001) and visible in Figure 4.40. To investigate the

in�uence of µHC expression on the level of H3K4Me2 modi�cations, IP fractions of proB

cells (+tet) were hybridized together with the IP fraction of preB cells (−tet) onto one

NimbleGene Chip. The oligo enrichment factors were calculated as previously described

(see page 76).

The di�erence in H3K4Me2 modi�cations at the Eµ enhancer region and the iEκ re-

gion is shown in Figure 4.41. Very surprisingly, the Eµ/JH region looses the H3K4Me2

chromatin marks, that were acquired upon culture of µHC negative dTG proB cells with

IL7 upon µHC expression. In contrast to the loss of H3K4Me2 modi�cations at the EµJHregion, the iEκ/Cκ region gains additional H3K4Me2 modi�cations compared to the culti-

vated dTG proB cells. In addition to the gain of H3K4Me2 modi�cations at the enhancer

region, the Jκ cluster becomes associated with H3K4Me2 modi�cations upon µHC ex-

pression. At the proximal Vκ promoter region, a similar gain of H3K4Me2 modi�cations

compared to the iEκ region is seen.

80

4.9 Changes in the Level of H3K4Me2 Marks at the JH Cluster UponExpression of a Functional µHC

Figure 4.40: Induction of the µHC expression by tetracycline. FACS analysis of intracellular

αµHC stained, IL7 cultivated Rag−/− dTG CD19+ B cells. The viable cell population was selected due

to size and granularity and analyzed for the percentage of µHC expressing cells. Shown is a histogram

of induced (−tet) and not not induced (+tet) cell cultivated samples that were used for the proB/preB

speci�c ChIP experiment. The ChIP experiments were done using cells from both preparations.

The Vκ segments additionally gain H3K4Me2 modi�cations upon expression of a func-

tional µHC in proB cells. The level of H3K4Me2 modi�cations at the Vκ segments is

comparable to the level at the VH segments, as again the gain is focused at the distal Vκ

segments and in addition the gain is restricted to the coding sequence of the Vκ segments.

At the Igλ locus no clear changes during the proB to preB di�erentiation are visible.

In summary, the level of H3K4Me2 marks at the JH cluster and the Jκ cluster correlates

with the V(D)J recombination potential of the IgH and Igκ locus in preB cells, whereas

the H3K4Me2 marks at the VH segments are not reduced between ex vivo proB cells and

IL7 cultivated dTG preB cells. The gain of H3K4Me2 modi�cations at the Vκ segments

correlates with the gain of V(D)J recombination potential. But H3K4Me2 modi�cation at

the VH segments do not correlate with the recombination potential of single VH segments.

81

4. RESULTS

(a)

(b)

(c)

Figure4.41:IL7andµHCsig

nalin

gdependentdi�erencesin

thelevelofH3K4Me2modi�catio

ns(a)attheEµregion,(b)atthe

iEκregionand(c)attheputativ

eVκregulatory

element.

Themeanenrich

mentfacto

randSEM

over500bpreg

ionsforexvivoproB

cells(blue,n=2),IL7cultiva

teddTGproBcells

(black,n=1)andIL7cultivated

dTGproBcells

expressin

gaµHCprotein

(purple,

n=1)are

show

n.

82

4.9 Changes in the Level of H3K4Me2 Marks at the JH Cluster UponExpression of a Functional µHC

(a)

(b)

(c) (d)

Figure 4.42: Change in the level of H3K4Me2 modi�cation at the VH segments and the Vκ

segments upon µHC expression in IL7 cultivated dTG cells. (a), (b): mean enrichment factor

over a 500 bp wide region at beginning of the coding sequence of each V segment at (a) the IgH locus

and (b) the Igκ locus. The base positions resemble position in the published VH cluster or the Igκ locus

analyzed in this thesis. The connected line represents a regression line claculated by the Lowess function

of the R package. (c), (d): Aggregate mean enrichment factor (c) over all VH segments or (d) over all Vκ

segments showing the local di�erences in H3K4Me2 enrichment. The mean enrichment factor and SEM

is calculated over 500 bp regions.

83

4. RESULTS

84

Discussion

General accessibility for the transcription machinery correlates with histone H3 acety-

lation (H3Ac) and histone H3 lysine 4 di-methylation (H3K4Me2; Santos-Rosa et al.

(2002); Schneider et al. (2004); Schubeler et al. (2004); Ng et al. (2003); Bernstein et al.

(2005); Pokholok et al. (2005)). We could con�rm this correlation during the analysis of

the histone modi�cation in the promoter regions of the control genes Rag1/2, VpreB1/2,

λ5 and Pax5.

The only enzyme needed to initiate V(D)J recombination is the RAG1/2 enzyme

complex, as Rag1/2 expression is su�cient to confer recombinase activity to any cell type

tested (Oettinger et al. (1990); Oltz et al. (1993)). At the endogenous Ig and TCR loci

V(D)J recombination is not only dependent on Rag1/2 expression, but also on the cell

type and the developmental state of the B and T cells (Stanhope-Baker et al. (1996)).

The �rst hints to the mechanism of cell type speci�c V(D)J recombination were Ig and

TCR germline transcription that correlate with the V(D)J recombination potential (Yan-

copoulos & Alt (1985)). Hence, the accessibility of the RSSs for the RAG enzyme is most

likely the limiting factor that mediates the tissue, stage and locus speci�city of the V(D)J

recombination process.

Accessibility for the RAG enzyme is meant to be correlated with the same chromatin

modi�cations that are correlated with active transcription (H3Ac and H3K4Me2/3). In

this work, the JH cluster in proB and proT cells, the Jκ cluster in preB cells and the

Jβ, the Jδ and the Jγ clusters in proT cells show both, H3Ac and H3K4Me2 marks.

These �ndings con�rm the results published by Chowdhury & Sen (2001, 2003); Huang

et al. (2001); Maes et al. (2006); Morshead et al. (2003); Oestreich et al. (2006) and Ye

et al. (2001). Therefore, the chromatin con�guration at the J clusters correlates with the

V(D)J recombination potential of the locus. But why should the histone modi�cations

at the J clusters be a readout for V(D)J recombination potential? First, we and Maes

et al. (2006) showed, that the chromatin domain at the J clusters of V(D)J recombination

competent loci are broader than the chromatin domains at the transcription start sites of

control genes. Second, loss of germline transcription and H3K4Me2 marks is correlated

with the loss of Jα recombination potential at the TCRα locus (Abarrategui & Krangel

(2006)). And last, Liu et al. (2007) showed that a PHD �nger domain in the RAG2

C-terminus is directly binding to H3K4Me2/3 containing chromatin. Hence, at least the

H3K4Me2/3 modi�cation at the 5' RSS element seems to be a prerequisite for e�cient

V(D)J recombination.

85

5. DISCUSSION

As B cell development in Rag2−/− proB cells can be complemented by transgenic

Rag2 expression (Shinkai et al. (1992)), the developmental program, that creates open

chromatin at the IgH locus in proB cells and at the TCRβ, the TCRδ and the TCRγ loci in

proT cells should be fully functional. Therefore, the next step for V(D)J recombination

at the IgH, the TCRβ and the TCRδ loci in Rag−/− proB and proT cells is the D→J

recombination. In this analysis, the majority of 3' RSS elements in the DH cluster shows

no or only very weak H3Ac or H3K4Me2 modi�cations. And even the Dβ and Dδ segments

show clearly reduced levels of H3Ac and H3K4Me2 modi�cation compared to the Jβ or

Jδ segments. This clear reduction in the level of H3Ac and H3K4Me2 marks at the D

segments has been reported only for the DH cluster (Sen & Oltz (2006)). Hence, the

3' RSS elements at the DH segments do not need to show H3Ac or H3K4Me2 marks to

become e�ciently V(D)J recombined.

Recombination competent J segments show H3Ac and H3K4Me2 marks, whereas re-

combination competent D segments show reduced levels of H3K4Me2 modi�cations and

almost no H3Ac marks. In this analysis, V segments of all recombination competent loci

show less H3Ac and H3K4Me2 modi�cations than the corresponding J cluster. Further-

more, the histone modi�cations at the V segments that were found were found in both,

recombination competent and recombination incompetent cells. Even the preferential as-

sociation of distal VH segments with H3K4Me2 marks could be reproduced in proT and

dendritic cells. Therefore, a lineage speci�c activation of the V segments does not corre-

late with the level of H3Ac or H3K4Me2 modi�cations. In addition, the recombination

frequency of distal J558 VH segments that preferentially show H3K4Me2 modi�cations is

equal to the proximal J558 VH segments, which do not show H3K4Me2 marks. Hence, the

V segments show only weak or no active histone modi�cations comparable to the distal

DH segments.

The association of RSS elements with nucleosomes forms a potent barrier for RAG-

mediated cleavage of in vitro substrates (Kwon et al. (1998)) and nucleosome remodeling

is able to promote RAG mediated cleavage to levels seen at naked RSS templates (Kwon

et al. (2000)). In addition many RSS element show an intrinsic nucleosome positioning

function, which may provide an inherent protection from inappropriate recombination un-

til the associated nucleosome is remodeled (Baumann et al. (2003)). The in vivo removal

of nucleosomes from the RSS elements would result in a reduced density of H3K4Me2

at this elements. As we did not directly measure the distribution of nucleosomes at the

VH RSS elements, we interpret the reduced H3K4M2 modi�cations at the VH RSS ele-

ments in concert with the published �ndings as a hint towards B cell speci�c nucleosomal

86

5.1 Proposed Model for V(D)J(H) Recombination

remodeling at and around the VH RSS elements.

At the VH , the Vκ and the Vβ clusters only the IVAR elements, the central region in

the Vβ cluster and the proximal Vκ promoter show H3Ac and H3K4Me2 modi�cations at

a comparable level to the J clusters. None of these regions were previously described.

Further analysis of the IVAR#3 element showed, that the IVAR#3 element has weak

promoter activity in anti-sense to the IgH expression. Recent data from our group show

that sense and anti-sense transcripts start at the IVAR#3 element only in Rag−/− proB

and not in Rag−/− proT cells (A. Giniewski and S. Lang, unpublished).

Anti-sense transcription at both, the DH and the VH cluster correlates with VDJH recom-

bination in proB cells (Bolland et al. (2004, 2007)). Therefore, both clusters are actively

transcribed, but show neither H3Ac nor H3K4Me2 modi�cations at the Ig segments.

Together with the �nding that ongoing transcription tends to cluster in transcription fac-

tories containing app. 2 to 8 actively transcribed genes (reviewed in Faro-Trindade &

Cook (2006)), these data implie a novel view of V(D)J recombination.


At the IgH locus transcription at the Eµ enhancer region is initiated as early as the

comman lymphoid progenitor (CLP, Forsberg et al. (2005)). I propose, that this process of

transcription initiates a transcription factory, including at least the µ0 (sense) transcript,

the Iµ (sense) transcript and the DH anti-sense transcript (Bolland et al. (2007); Nelson

et al. (1983)). The JH cluster is expected to be located inside the transcription factory,

as the active chromatin marks H3Ac and H3K4Me2 completely cover the whole Eµ region

including both, the µ0 and the Iµ transcription start. The RNA pol II complexes are

stably included in the transcription factories and therefore the transcription complexes

do not slide along the template DNA but draw the template into the transcription factory

(Faro-Trindade & Cook (2006)).

During DH anti-sense transcription, large parts of the DH cluster are drawn into the

Eµ associated transcription factory. Active anti-sense transcription therefore signi�cantly

reduces the distance between the DH segments and the JH cluster. Now the Rag enzyme

is able to catalyze D→JH recombination of the distal DH segments. After DJH joint

creation and deletion of large parts of the DH cluster, the DH anti-sense transcript may

be extended into the proximal VH cluster, looping in the proximal VH segments (see �gure

5.1).

In WT mice ∼ 30 - 50% of peripheral T lymphocytes contain DJH joints, and interestingly

the most proximal DH segment (DQ52) is used in an unexpectedly high frequency (Born

87

5. DISCUSSION

et al. (1988); Mizutani et al. (1986); Suzuki et al. (1989)). Only upon forced expression

of Pax5 in the T cell lineage VDJH joints are reported in T cells. Therefore I expect, that

forced expression of Pax5 in T cells leads to the initiation of the DH anti-sense transcript.

Hence the whole DH cluster is activated for V(D)J recombination and even the proximal

VH segments can participate in V→DJH recombinations in T cells.

The DH anti-sense transcript most probably does not extend into the distal VH cluster,

but in this region the IVAR promotors are active in proB cells and initiate anti-sense

transcription. Therefore we postulate, that the IVAR promotors are included into the Eµ

associated transcription factory and start to drag distal VH segments into close contact

with the DJH RSS element (see �gure 5.1).

But how is the accessibility of the RSS elements at the DH or VH segments (distal

RSS elements) regulated? We did not �nd lineage speci�c H3K4 methylation at these el-

ements, and as preferentally the distal VH segments show H3K4Me2 marks, the identi�ed

level of H3K4Me2 modi�cations does not correlated with the published higher frequency

of proximal VH segments in VDJH joints (Malynn et al. (1990)). As the RAG2 protein

was shown to preferentially bind to H3K4Me3 (Liu et al. (2007)), it may be possible,

that the recombination potential of DH and VH segments does correlate with the level of

H3K4Me3 marks at the RSS elements. We did not analyze this modi�cation, but as the

J clusters of all recombination competent Ig and TCR loci show clear H3K4Me3 modi�-

cations, and Abarrategui & Krangel (2006) showed that the level of both, H3K4Me2 and

H3K4Me3 marks was clearly reduced at the recombination incompetent Jα segments, we

would expect that both, H3K4Me2 and H3K4Me3 modi�cations are associated with the

V(D)J recombination potential. For the VH segments we can not exclude that after DJHrecombination the level of H3K4 methylation at the RSS elements is increased. But as

the DH segments could take part in V(D)J recombination if the RAG enzyme would be

expressed, the absence of H3K4Me2 modi�cations at the DH cluster of Rag−/− proB cells

argues against the need of H3K4 methylation marks at the distal RSS elements.

Instead of a histone modi�cation that stabilizes RAG binding and thereby increases acces-

sibility for the RAG enzyme, the signal sequence itself represses accessibility by causing

nucleosome positioning over the RSS (Baumann et al. (2003)). As nucleosomal RSS

substrates inhibit RAG enzyme activity (Kwon et al. (1998)) and the nucleosomal posi-

tioning is at least in part a random thermodynamical process (Baumann et al. (2003)),

the RAG binding to RSS elements may be regulated by the random occurrence of distal

RSS elements that are not bound to a nucleosome.

88


Figure 5.1: Model for the activation of V→DJH recombination at the proximal and distal

VH cluster modi�ed from Chakalova et al. (2005). Only the transcription of the DH anti-sense

transcript and one IVAR anti-sense transcript is depicted. The Eµ associated transcription factory is

depicted as blue cycle including the JH cluster, one IVAR element and the associated transcription

complexes. The pol II complex transcribing the DH anti-sense transcript (upper part of the factory) is

immobilized at the factory and therefore drags the template DNA sequence into the factory instead of

moving along the DNA sequence. After DJ joint creation the DH anti-sense transcript is expected to

reach into the proximal VH cluster. In the process of transcription, proximal VH segments are relocated

into close proximity of the DJ joint, enabling V→DJH recombination (depicted as bi-headed arrow), but

the DH anti-sense transcript does not reach the distal VH cluster. To also activate distal VH segments

the IVAR elements might be stably connected to the Eµ associated transcription factory. The IVAR

associated pol II complex might be used to relocate distal VH segments into the transcription factory,

drastically reducing the distance between the distal VH RSS element and the DJ joint associated RSS

thereby increasing the probability for these VH segments to take part in VDJH joint creation.

89

5. DISCUSSION

To elucidate the in�uence of (anti-sense) transcription at both, the proximal JH cluster

and the distal VH cluster, I propose a targeted deletion of the identi�ed promoter elements.

To clarify the in�uence of H3K4 methylation on the recombination potential of distal

RSS elements, I propose a targeted recruitment of a SET domain protein that is able to

methylate H3K4 to both, DH and VH RSS elements.

5.2 Hypothetical Model for the Establishment and Maintenance Allelic

Exclusion at the IgH Locus

The hypothetical model for the establishment of allelic exclusion is based on the �nding

that not only the 'open chromatin' marks H3Ac and H3K4Me2 were detected at the

JH cluster, but also the H3K9Me3 modi�cation that is associated with heterochromatin

formation (Strahl & Allis (2000); Melcher et al. (2000); Rea et al. (2000)).

In this work, H3K9Me3 modi�cations were detected at the JH cluster in proB and

proT cells, at the iEκ enhancer region and the proximal Vκ promoter preferentially in

proT cells and the IgH 5' DNase hypersensitive site in proB cells. Osipovich et al. (2004)

showed that recruitment of an H3-K9 methyltransferase (G9a) overrides ACE function

and inhibits V(D)J recombination on chromosomal gene segments using a chimeric re-

combination substrate.

The in vivo occurrence of H3K9Me3 modi�cations at the iEκ enhancer and the proximal

Vκ promoter in proT cells could be explained by the stable exclusion of the Igκ locus

from V(D)J recombination in T cells. At the IgH 5' DNase hypersensitive site the in

vivo H3K9Me3 modi�cations are correlated with the transcriptionally inactive state of

the Zfp386 gene in proB cells (Pawlitzky et al. (2006)) although the promoter regions

of the Zfp386 gene show H3Ac and H3K4Me2 modi�cations, as dominant negative e�ect

of H3K9 methylation on transcription has also been shown by Osipovich et al. (2004).

Therefore, we propose, that the clearly visible H3K9Me3 modi�cations in our ChIP ex-

periments are functionally relevant. H3K9Me3 modi�cations at the IgH locus have not

been published yet.

Chromosomal regions showing a concomitant occurrence of the 'open chromatin' mark

H3K4Me3 and the 'closed chromatin' mark H3K27Me3 were lately named 'bivalent do-

mains' (Bernstein et al. (2006)). The proposed function of these 'bivalent domains' is

to keep developmentally regulated genes in a silent, 'poised' state in embryonic stem

cells. As Rag−/− proB cells are at a developmental step close to the hematopoietic stem

cells, the occurrence of 'open chromatin' mark H3K4Me2 and the 'closed chromatin' mark

90

5.2 Hypothetical Model for the Establishment and Maintenance AllelicExclusion at the IgH Locus

H3K9Me3 at the JH cluster in our data could indicate a 'bivalent domain' at the devel-

opmentally regulated IgH locus. But the Eµ enhancer is not in a silent, 'poised' state

in proB cells and in addition, H3K4 methylation is reported to be mutually exclusive to

H3K9 methylation (Noma & Grewal (2001); Wang et al. (2001)). Therefore, we would

dismiss the model of a 'bivalent state' at the JH cluster and propose a model where both

modi�cations are associated with di�erent JH alleles.

The H3K4Me2 marks and H3K9Me3 marks could be located on both alleles in one cell

or either modi�cation could be associated with both JH alleles in on cell resulting in an

inhomogenous cell population. We can not di�erentiate between both possibilities, but

allelic di�erences between the two alleles in one cell can also be seen in the asynchronous

replication of the two IgH alleles (Mostoslavsky et al. (2001)). The H3K9Me3 modi�cation

is expected to lead to stable heterochromatin formation (Hwang et al. (2001); Nielsen et al.

(2001), reviewed in Grewal & Jia (2007)). In addition, Osipovich et al. (2004) showed that

targeting H3K9Me2/3 modi�cations at a chimeric recombinations substrate shuts down

transcription at this locus. With the hypothesis, that D→JH recombination of distal DH

segments is dependent on the anti-sense Dµ transcript that is initiated between the Eµ

enhancer at the JH cluster (Bolland et al. (2007)), the H3K9Me3 modi�cations at the

Eµ/JH region could correlate with a allele speci�c opening of the JH cluster for V(D)J

recombination.

V→DJ recombination requires the H3K4Me2 binding Phd �nger of the RAG2 protein

(West et al. (2005); Liu et al. (2007)) whereas H3K9Me3 modi�cations at the RSS elements

of a chromosomal recombination substrate inhibits V(D)J recombination and germline

transcription of this substrate(Osipovich et al. (2004)). As both IgH alleles of one cell

can undergo V(D)J recombination, there is most probably a mechanism, that is able to

remove the H3K9Me3 marks from the JH cluster and activate V(D)J recombination at

the previously suppressed allele.

A hint towards the regulatory element, that mediated the transcriptional repression

is given by the tet regulated µHC expression system published by Hess et al. (2001). In

this system, the expression of the transgenic µHC that contains the parts of the Eµ/JHregion upstream of the Eµ enhancer and downstream of the JH3 segment is regulated by

a tet operon. The tet transactivator is able to bind to this tet operon if no tet is present

in the cell culture medium. Therefore, all cells should express the µHC protein upon tet

removal from the cell culture medium. But only 13to 1

2of all cells express the HC protein

(Hess et al. (2001), this thesis). Therefore, either the tet transactivator is not expressed

in all cells or the transactivator can not bind to all µHC transgenes. Galler (2004) could

91

5. DISCUSSION

show that the transactivator is indeed expressed in cells that do not express the µHC

protein. Therefore, the low percentage of µHC expressing cells is at least in part due to

inaccessibility of the tet operon for the tet trans-activator.

The µHC transgene contains the transcription start site of the anti-sense Dµ transcript

that is located between the Eµ enhancer and the JH4 segment (Hess et al. (2001); Bolland

et al. (2007)). Therefore, it is possible that this region contains the binding sites of a H3K9

methyl transferease, that is able to establish a H3K9Me3 modi�ed chromatin domain,

leading to the suppression of µHC expression in a subset of cells.

With the hypothesis, that D→JH recombination of distal DH segments is dependent

on the anti-sense Dµ transcript, a stable reporter construct under the control of the

Eµ/JH cluster (the Dµ promoter, Bolland et al. (2007)) could be a reporter of D→JHrecombination potential. It would be of interest, if this transcript is made in all transgenic

cells and if cells, that do not express the reporter show H3K9Me3 marks at the reporter

gene. The most interesting question would be, if cells, that in the beginning do not express

the reporter gene and contain H3K9Me3 marks at this gene afterwards come to express

the reporter.

The maintenance of allelic exclusion correlates with the loss of H3K4Me2 modi�cations

at the JH cluster upon expression of a µHC and di�erentiation into preB cells, as described

here for the �rst time. Hypothetically, allelic exclusion is established by the monoallelic

expression of the Dµ transcript and therefore the recombination process is also restricted

to one allele. As the transcription in this model is correlated with the chromatin state

(H3K4Me2 vs. H3K9Me3), the maintenance of allelic exclusion in preB cells could be

explained by the �xation of the heteochromatin state at the JH allele showing H3K9Me3

marks upon the expression of a signaling competent µHC protein. The actively (anti-

sense) transcribed, recombination competent allele would be kept in the active chromatin

con�guration.

92

Material

6.1 Animals

genotype referenceDBA2 Charles River WIGA GmbH (Sulzfeld, D)C57Bl/6 Charles River WIGA GmbH (Sulzfeld, D)Rag-1−/− Mombaerts et al. (1992)

Ig-tTA / tet-µHC / Rag−/− Hess et al. (2001)

6.2 Cell lines

name origin organ comment referenceST-2 BC8 BM stromal cells Ogawa et al. (1988)38.B9 mouse lymphoma Abelson-transformed Alt et al. (1984)

J558/IL-7 mouse myeloma IL-7 producer Winkler et al. (1995)

6.3 Tissue culture media

Unless stated otherwise, tissue culture media and additives were purchased from PAN-

Biotech (Aidenbach, D) or GIBCOTMInvitrogen (Karlsruhe, D).

RPMI-based medium (10% FCS)

500 ml RPMI-1640without L-Glutaminewith 2.0 g/l HaHCO3

50 ml fetal bovine serum5 ml 100mM L-Glutamine5 ml 10,000 U/ml Penicillin, 10 mg/ml Streptomycin

500 µl 50 mM β-mercaptoethanoloptional:

5 ml IL-7 supernatant ( J558/IL-7; approx. 200 µg/ml )

6.4 Antibodies

Speci�city Usage Company Order IDpan αH3Ac ChIP Upstate 06-599αH3K4Me2 ChIP Upstate 07-030αH3K9Me3 ChIP Upstate 07-442αB220-APC FACS BioScience 17-0452-82αB220-FITC FACS Becton Dickenson 553088

93

6. MATERIAL

Speci�city Usage Company Order IDαIgMa-FITZ FACS Becton Dickenson 05094DαIgMb-Bio FACS Becton Dickenson 05102DαIgM-Bio FACS Becton Dickenson 02082D

αmouseCD19 Microbeads MACS B cell selection Miltenibiotech 130-049-301

6.5 Bu�ers

Water derived from an ultra-pure water puri�cation system (PURELAB Plus UV; ELGA

labwater, Siershahn, D) was used for the production of all solutions, bu�ers and dillutions.

Standard Bu�ers

TE 10mM Tris/HCl,pH 7.41mM EDTA

TAE 40 mM Tris acetate, pH 8.01 mM EDTA

PBS 137 mM NaCl2.7 mM KCl8mM Na2HPO4

1.5 mM KH2PO4

Erythrozyte-lysis-bu�er 0.01 mM NH3Cl0.02 mM HEPES0.01 mM EDTA

FACS-bu�er 2 % FCSin PBS

MACS-bu�er 2% FCS2 mM EDTA

in PBSBioTerm 10x PCR bu�er 670 mM Tris-HCL pH 8.8

160 mM (NH4)2SO4

15 mM MgCl20.1% Tween 20

5x TM bu�er 400 mM Tris-HCl pH 9.010 mM MgCl2

luziferin solution pH 7.8 20 mM Tricine1.07 mM (MgCO3)4Mg(OH)2 x 5H2O2.67 mM MgSO4

0.1 mM EDTA33.3 mM DDT270 µM coenzyme A470 µM D-luziferin530 µM ATP

94

6.5 Bu�ers

ChIP Bu�ers

wash bu�er I 10 mM Tris acetate pH 8.00.25% Triton X1001 mM EDTA

0.5 mM EGTAwash bu�er II 10 mM Tris acetate pH 8.0

1 mM EDTA0.5 mM EGTA200 mM NaCl

chip bu�er 20 mM Tris acetate pH 8.00.2% SDS0.1% Triton X100

0.2 mM EDTA150 mM NaCl

low-salt bu�er 20 mM Tris acetate pH 8.00.1% SDS1% Triton X100

150 mM NaClhigh-salt bu�er 20 mM Tris acetate pH 8.0

0.1% SDS1% Triton X100

2 mM EDTA500 mM NaCl

LiCl bu�er 10 mM Tris acetate pH 8.01% NP401% deoxycholat

1 mM EDTA0.25 M LiCl

proteinA agarose 0.02 M NaH2PO4

swelling bu�er 0.15 M NaCl

Proteinase Inhibitor Stocks

inhibitor concentration solvent used dillutionPMSF 10mg/ml methanol 1:1000

PepstatinA 1mg/ml H2O 1:1000

95

6. MATERIAL

6.6 Primer

primer lab code 3'-5' sequencedg_ChIP_PCR_Amp TW528 gtt tcc cag tca cga tcn nnn nnn nnChIP_PCR_Amp TW529 gtt tcc cag tca cga tcJh3_4_REV TW857 ttt tcc tct gta ccc gac aaa aacIgH_J3_seq TW858 ccc aga ccc atg tct caa ctIgH_J2_seq TW859 ttc tga ctc cca agg tgt cc13170 TW860 gcg aag ctt gRg cct ggg Rct tca gtg aagVAR34_5' TW504 cct ggg atg tca ctg ata tac act ctgVAR34_3' TW505 gta gta gcc agt aaa tga gta acc aga agc1S10*01_prom_rev TW530 cag cag tat gct cag gtc ca1S10*01_prom_for TW531 gca aca gac tca ggt caa aca tJh_5' TW341 gct gat gca gac aga cat cct cag ctc cJh_3' TW342 ggg ctc cag gat tat ctc aga tgg agg ccV_H_enh_for TW658 aaa tcg atg ctg ata agc acc agc aaa aV_H_enh_rev TW659 aaa tcg atc tgt ttc tct ctt agt gaa agt tga a

96

Methods

7.1 PCR

All PCRs were performed in either a GeneAmp PCR System 9700 thermocycler (PE Bio

Systems) or in a primus 96 thermocycler (PEQLAB).

7.1.1 J558 VDJ Join Ampli�cation

To eliminate the IgMa allele derived template we performed an A�II digestion of the bulk

template DNA:

Reaction Mix10 µg genomic DNA30 µl NEB2 bu�er3 µl NEB 100x BSA

3 µl (60u) NEB A�II enzyme∑300 µl H2O

The reaction was incubated at 37◦C over night. Subsequently the reaction was pre-

cipitated with one volume of isopropanol and washed once with one volume of 0% EtOH.

The precipitate was resuspended in TE to a �nal concentration of 500 ng/µl genomic

DNA. To amplify as many VJ558 containing VDJ joints we used the J558 speci�c primer

published in Ehlich et al. (1994).

PCR contents67 mM Tris-HCL pH 8.816 mM (NH4)2SO4

1.5 mM MgCl20.01 % Tween 201 nmol primer TW 860250 pmol primer TW 8570.1 u Qiagen HotStar Taq polymerase100 ng A�II digested template

97

7. METHODS

PCR programinitial denaturation 95 ◦C 15 min.37 cycle ampli�cation 95 ◦C 15 sec.

61.7 ◦C 1 min.72 ◦C 2 min.

�nal extension 72 ◦C 10 min.store 4 ◦C ∞

The PCR product size varied in respect to the used JH segment:

used J segment fragment lengthJH1 1.6 kbJH2 1.18 kbJH3 0.8 kb

7.1.2 Real-Time PCR

Real time PCR was used to control the ChIP ampli�cation step. Each PCR reaction

was done in duplicates to enhance the reliability of the results and estimate the mistake

introduced during the pipetting procedure.

Real-Time PCR reaction mix5 µl Quiagen QPCR 2x MM1 µl 20 mmol primer solution4 µl DNA template

For each data generating Real-Time PCR reaction 8 ng DNA were used. For the

standard a series of twofold dilutions of an equimolar combination of at least two INPUT

ampli�cations ranging from 32 to 4 ng was used. The three PCR setups di�er only in the

used annealing temperature.

standard Real-Time PCR programinitial denaturation 95◦C 15 min.40 cycle ampli�cation 95◦C 15 sec.

x ◦C 20 sec.72 ◦C 20 sec.

store 4 ◦C ∞DNA concentration measurement was performed after every elongation period.

98

7.2 Cloning and Sequencing of VJ558DJH Joins

PCR primers and annealing temperaturesIdenti�er 3' primer 5' primer annealing temperature [◦C]VAR34 TW 504 TW505 56.0

V1S10 promotor TW 530 TW 531 56.0JH TW 341 TW 342 62.0

7.2 Cloning and Sequencing of VJ558DJH Joins

JH558 speci�c V(D)J PCR was performed as mentioned in chapter 7.1.1 and the resulting

product was directly cloned into the pCR2.1-TOPO cloning vector following the manu-

factures protocol. Chemically competent TopF10' bacteria were transformed with 2 µl

TOPO reaction. After 10 min. incubation on ice the bacteria were heat shocked for 30

sec. on 42◦C and once again placed on ice. After addition of 200 µl LB media, expression

of the antibiotic resistance was induced for 30 min. at 37◦C with shaking. The bacteria

were plated on a LB-agar plate supplemented with 50 µg ampicillin, IPTG and xGal. The

plates were incubated on 37◦C over night and the next day all white colonies were picked

into 2 ml LB amp media containing 50 µg ampicillin and grown at 37◦C in a rotator for

another 16 hours. Plasimds were prepared using the Qiagen QIAprep Spin Miniprep Kit

following the companies protocol. Finally the vector was eluted with 50 µl EF (Qiagen)

bu�er.

The plasmids were digested using EcoRI (NEB) and A�II (NEB) to identify the length

of the inserted fragment and the IgMa derived recombinations following the manufactures

protocol. The JH speci�c primer is located between the JH3 and the JH4 segment and

therefore three di�erent ampli�cation length are expected: JH1 recombinations 1.5 kb,

JH2 recombinations 1.18 kb and �nally JH3 recombinations with 0.8 kb. IgMa derived

products are 300 bp shorter due to the A�II RFLP.

Plasmids containing a VDJH2 or VDJH3 fragment derived from an IgHb allele were

sequenced using the JH3 (TW858) and JH2 (TW859) speci�c sequencing primers that are

located ∼100 bp downstream of the respective JH segment.Standard sequencing reaction

1 µl plasmid preparation in TE ( ∼300 ng)1 µl BigDye v.33 µl primer (2 mM)

3.5 µl 5x TM bu�er∑20 µl H2O

99

7. METHODS

Sequenceing programinitial denaturation 95 ◦C 5 min.40 cycle ampli�cation 95 ◦C 15 sec.

48 ◦C 15 sec.72 ◦C 4 min.

store 4 ◦C ∞These reactions were transferred without further puri�cation into the Virology department

for sequencing.

The sequence data was processed using the Staden package programs Pregap4 and

Gap4 to clip sequencing vector parts and unreadable parts from the sequences and create

a fasta formated database excluding sequence identical V(D)J joints. This database was

directly used as input for the NCBI Ig BLAST. Search parameters were changed to search

for mouse Ig segments (not Ig germline V genes). For an in detail junction analysis the

IMGT/JunctionAnalysis was used. Both results were processed and evaluated using the

OpenO�ce v2.0 'Calc' spreadsheet application. Poisson statistics were calculated using

the OpenO�ce POISSON function. The statistics were corrected for multiple testing

by division of the statistical signi�cance threshold (0.01 ** or 0.05 *) by the number of

di�erent V or D segments identi�ed.

7.3 Cell Culture

7.3.1 Isolation of B Lineage Cells from Mouse Bone Marrow

To obtain mouse B lineage cells from the bone marrow (BM), mice were killed by CO2 in an

airtight chamber. Preparations were carried out with ice-cold bu�ers (except erythrocyte

lysis), and cell suspension were kept on ice. BM was �ushed out of femurs using MACS

bu�er and a 23B needle. The cells were spun down (1400 rpm, 8 min., 4◦C) and the

supernatant was removed. To disrupt the erythrocytes the cells were resuspended in 5 ml

erythrocyte lysis bu�er and kept on RT for exactly 5 min. Lysis reaction was stopped

by addition of 10 ml MACS bu�er. Large tissue parts were dissociated by pipetting,

remaining tissue parts and bone splinters were removed by �ltration though a cell strainer

(Bectom Dickinson Labware) and the resulting cell number was counted. Cells were

pelleted and resuspended in 90 µl MACS bu�er per 107 cells. After addition of 10 µl

αmouseCD19 microbeads per 107 cells the cells were incubated at 4◦C for 15-30 min. The

labeling of the cells was stopped by addition of at least 10 ml MACS bu�er and subsequent

centrifugation. Finally the cells were resuspended in 2-4 ml MACS bu�er and �ltert

through a pre-seperation �lter (Miltenyi Biotech). Microbead labeled CD19+ B cells were

100

7.4 Cell Culture of Stomal Cells

sorted using either MS separation columns or the autoMACS sorting machine (program:

possel) following the instruction of the manufacturer. The �ow through and the positive-

fraction were routinely analyzed using αB220 surface staining and �ow cytometry. If the

cells were prepared for culture or the autoMACS machine was used, the BM extraction

from the femur and all subsequent steps were performed under sterile conditions.

7.3.2 Isolation of T Lineage Cells from Mouse Thymus

To obtain mouse T lineage cells from the thymus, mice were killed by CO2 in an air-

tight chamber, the thymus was extracted and squashed through a PBS �ooded 200 µm

mesh steel grid into a petri dish �lled with ice cold PBS using the plunger of a plastic

syringe. Large tissue parts were dissociated by pipetting and remaining tissue parts and

were removed by �ltration through a cells strainer (Bectom Dickinson Labware). After

erythrocyte lysis as described previously the resulting cell number was counted. Cells

were pelleted by centrifugation (1400 rpm, 8 min., 4◦C) and the cells were directly used

for ChIP.

7.4 Cell Culture of Stomal Cells

ST-2 cells were cultivated in RPMI medium supplemented with 10 % FCS in a humidi�ed

incubator at 37◦C, 5 % CO2. The cells were grown in 175 cm2 tissue-culture �asks and

passaged every three days with 10 ml trypsin/EDTA (PAN Biotech) per �ask to detach

the cells from the plastic (5-10 min. incubation at 37◦C). Stromal cells were replated at

6 ∗ 105 cells/�ask in 30 ml medium. ST-2 cells, which were used as feeder cells for dTG

Rag−/− proB cell culture were γ-iradiated with 30 gy, which prevents further cell division,

and seeded at 1 ∗ 106 cells per 25 cm2 �ask in 5 ml medium.

7.5 Cell Culture of ProB Cells

ProB cells were isolated from Rag−/− BM as described and seeded on stromal cell coated

25 cm2 �asks in a concentration of 3 ∗ 105 cells/�ask. Cells were cultured with 10 ml

RPMI + 1% IL7 media for 5 days. As almost half of the proB cells grow beneath the

stromal cell layer, not only the supernatant was collected, but also the stromal cell layer.

To separate the stromal cells from the B cells these preparation was not performed using

Trypsin/EDTA, but a sterile cell scraper. The cells were collected in MACS bu�er supple-

mented with 20 mM EDTA to disrupt the Ca2+ dependent cell-cell contacts between the

101

7. METHODS

B cells and the stromal cells. This treatment does not disrupt the inter-stromal cell-cell

contacts and therefore we could separate stromal cell clusters from B cells using a cells

strainer (Bectom Dickinson Labware). This treatment increased the collected amount of

B cells by almost 50 %. The cultured cells were directly used for ChIP.

7.6 Cell Culture of dTG Rag−/− ProB Cells

ProB cells were isolated from dTG Rag−/− BM as described and seeded on stromal cell

coated 25 cm2 �asks in a concentration of 3∗105 cells/�ask. Cells were cultured with 10 ml

RPMI + 1% IL7 + 200 ng/ml tet media for 5 days. The cells were harvested as described

and cells from one �ask were re-seeded on two �asks coated with irradiated stromal cells,

one containing tet supplemented media and on without tet. The tet supplemented media

suppressed µHC expression, whereas in the −tet con�guration the µHC can be expressed.

After two days of culture the cells were once again harvested and directly used for ChIP.

7.7 Cell Culture of Dendritic Cells

Dendritic cells were cultured as described in Lutz et al. (1999). The standard RPMI

10% FCS Medium was supplemented with 0.5% GMCSF cell culture supernatant created

in the Lutz laboratories. After cultivation for 8 days, the cells were harvested by vigorous

pipetting and used directly for ChIP.

7.8 Surface-Staining of Cells for Flow Cytometric Analysis

Surface staining of cells in suspension was carried out in micronic polypropylen tubes

(1 ml) using multi-stack racks (Micronics B.V.), Eppendorf 1.5 ml cups or 15 ml falcons,

depending on the total volume. All incubations were performed on ice using ice-cooled

antibody dilutions and MACS bu�er. Monoclonal or polyclonal antibodies were used

either directly �urochrome-labeled or as biotinylated antibodies, which were �uorescence

tagged using streptavidin-�urochrome conjugates.

• cells were resuspended in MACS bu�er (approx. 1 ∗ 106 cells/ml) and transfered

into the appropriate tube

• centrifugation at 1400 rpm for 5 min., ◦C

• supernatant was removed

• cell pellets were resuspended in 0.1-1 ml of the antibody solution

102

7.9 ChIP

• incubate for 30 min. on ice

• cells were washed once with MACS bu�er

• centrifugation, removal of the supernatant (if no biotin labeled antibody was used:

resuspension in 1 ml MACS bu�er for FACS analysis or resuspension to a concen-

tration of 30 ∗ 106/ml for cell sort at the MoFlow)

• cell pellets were resuspended in 1 ml Strep PE-Cy5.5 conjugate in MACS bu�er

• incubation for 20 min. on ice

• cells were washed once with MACS bu�er

• centrifugation, removal of supernatant, resuspension as mentioned earlier

The cells were either analyzed on a four-color FACSCaliburTM

instrument (BD Bioscience,

San Jose, CA, USA) or sorted with a three-laser/six-color MoFloTM

high-speed cell sorter

(Dako, CA USA). Data �les were analyzed using FlowJoTM

software (Tree Star, Ashland,

Or, USA).

7.9 ChIP

The Chromatin immuno precipitation is a mixture of protocols, adopted from Orlando

et al. (1997) and the Upstate 'Chromatin Immunoprecipitation (ChIP) Assay' protocol.

Unless stated otherwise, all incubations were performed at 4◦C on a rotating wheel.

7.9.1 Nuclei Preparation

Nuclei were prepared to reduce ChIP backgroud levels.

• cells were resuspended in 1ml PBS and transfered to Eppendorf cups

• centrifugation at 6000 rpm for 5 min, 4◦C

• supernatant was removed

• cell pellets were resuspended in 0.97ml PBS + 27µl 37% formaldehyde

• incubation for 8 min

• addition of ∼ 10 mg solid glycine, centrifugation at 6000 rpm for 5 min

103

7. METHODS

• cell were washed 1ml PBS + 1 0/00 PMSF stock solution and centrifuged at 6000

rpm for 5 min

• cell pellets were resuspended in 0.5ml of wash bu�er 1 + 1 0/00 PMSF


• centrifugation at 10.000 rpm for 10 min

• cell pellets were resuspended in 0.5ml of wash bu�er 2 + 1 0/00 PMSF


• centrifugation at 10.000 rpm for 10 min

7.9.2 Chromatin Fragmentation

Ultrasonic DNA fragmentation was performed using a Bandelin Sonopuls HD 2200 ultra-

sonic homogenizer connected to the MS72 probe extension.

• the pelleted nuclei were resuspended in 1ml of ChIP bu�er and transfered to 1.5ml

Eppendorf cups

• soni�cate at 18% power for 20 sec. with a pulse duration of 0.2 seconds

• place the sample on ice for 1 min.

• return to the soni�cation step and process each sample 6 times

7.9.3 Chromatin Precipitation

The fragmented nuclei suspension is precleared using 20 µl proteinA agarose suspen-

sion that was created from lyophilized proteinA-agarose (Sigma Aldrich). The proteinA

agarose suspension was prepared following the companies protocol with 20 % EtOH as

preservative and was washed two times with 500 µl ChIP bu�er before use. Unless stated

otherwise, centrifugation of proteinA agarose suspensions was always performed at 2.000

rpm for 30-60 sec. in an Eppendorf centrifuge.

• add a 20 µl equivalent of washed proeinA agarose beads

• incubate for 1 hour at 4◦C

104

7.9 ChIP

• centrifuge at maximum speed for 5 min. (keep the supernatant!)

• transfer the supernatant to a fresh eppendorf cup

• remove 20 µl precleared chromatin solution as INPUT fraction

• add the appropriate amount of precipitating antibody

� 2.5 µg αH3Ac

� 2.5 µg αH3K4Me2

� 1 µg αH3K9Me3

• incubate over night at 4◦C

• add 20 µl equivalent of washed proeinA agarose beads

• incubate for 1 hour at 4◦C

• precipitate the proteinA agarose chromatin complexes

• wash the precipitate each time for 5 min. with 1 mlof the following solutions

1. 1x low-salt bu�er

2. 1x high-salt bu�er

3. 1x LiCl bu�er

4. 2x TE

7.9.4 Recoverage of the Precipitated DNA Fraction

Unless stated otherwise, incubations were from now on performed on RT in a rotating

wheel. The elution bu�er was always freshly prepared.

• resuspend the precipitate in 250 µl elution bu�er and incubate for 15 min.

• precipitate the proteinA agarose and transfer the supernatant to a fresh eppendorf

cup (IP sample)

• repeat the elution step once

• add 480 µl elution bu�er to the INPUT sample

105

7. METHODS

• add 20 µl 5M NaCl to IP and INPUT samples

• incubate on 65◦C for 4 to 16 hours

• add 10 µl 0.5M EDTA, 20 µl TrisHCL pH 6.5 and 20 µg proteinaseK

• incubate at 45◦C for 1 hour

• perform Phenol/Chloroform, Isoprop and 70% EtOH precipitation

• resuspend the DNA pellet in 16 µl TE (this TE must not contain traces of DNA)

7.9.5 Random Heptamere Based Whole Genome Ampli�cation

The amount of DNA recovered after ChIP precipitation was not su�cient for labeling and

hybridisation with a DNA oligonucleotide array. Thus a DNA whole genome ampli�cation

method was required. The method was adapted from Robyr & Grunstein (2003) and uses

the random integration of a partially degenerated primer whose constant part is used for

PCR ampli�cation.

Random primer integration is achieved in two cycles of denaturation, hybridisation and

elongation mediated by the NEB klenow-exo− fragment. The reactions were carried out

in PCR tubes incubated in a PCR machine. The samples containing 7µl of precipitated

or input DNA, 1.5µl of NEB2 10x restriction enzyme bu�er, 2.5µl of 0.2 mM dNTP mix

and 2µl of 20pMol primer TW528 where denatured by 94◦C for 2 minutes prior to an

incubation for 2 minutes at 8◦C. The reaction was then paused at 8◦C for addition of

1µl of klenow-exo− fragment (5u) followed by a slow temperature gradient rising over 72

cycles from 8◦C to 37◦C in 6 minutes. Elongation was carried out for 1 hour at 37◦C and

the whole process of denaturation, adding of enzyme, annealing and elongation was once

repeated. Reaction was stopped by addition of 20µl of TE bu�er and stored at -20◦C if

not used directly in the second step PCR ampli�cation.

The second step of the ampli�cation is a conventional PCR ampli�cation using primer

TW529. 15µl Template DNA from step 1 were ampli�ed in a 100µl PCR (67 mM Tris-HCL

(pH 8.8), 16 mM (NH4)2SO4, 1.5 mM MgCl2, 0.01% Tween 20, 1.25 nmol oligonucleotide,

0.25mM dNTPs, and 5U recombinant Taq polymerase (BioTherm)). Initial denatura-

tion at 92◦Cfor 30 seconds was followed by two successive 30 second annealing steps at

�rst 40◦C and second 50◦C and elongation at 72◦C for 90 seconds. After 24 identical

cycles, elongation was allowed to proceed for another 10 minutes at 72◦C. PCRs were

subsequently puri�ed through columns (QIAquick PCR Puri�cation Kit, Qiagen Inc.)

106

7.10 Promotor Studies

following the manufactures protocol and eluted in 50µl H2O. The DNA concentration was

measured in a photometer (1:24 dilution; 50 µl).

7.10 Promotor Studies

For a detailed protocol of the promotor studies please refer to Stein (2006). In short, the

primers TW 658 and TW 659 were used to amplify the IVAR#3 fragment from C57/BL6

liver DNA using the standard BioTherm taq polymerase.

PCR programinitial denaturation 95◦C 5 min.35 cycle ampli�cation 95◦C 15 sec.

55◦C 15 sec.72◦C 2 min.

�nal extension 72◦C 10 min.store 4◦C ∞

The PCR product was cloned into the pCR2.1-TOPO cloning vector (InvitrogenTM,

germany) and the orientation of the insert was identi�ed. The Eµ enhancer was cloned

into the pGL3-promotor vector 5' of the luciferase ORF and the SV40 promotor initially

driving luciferase expression in the pGL3-promotor vector was replaced by the IVAR frag-

ment one time in IgH sense orientation, one time in anti-sense orientation using restriction

nuclease sites in the MCS of the cloning vector. After cloning and ampli�cation of these

vectors they were used to transfect 38.B9 cells.

38.B9 proB cells were electroporated with the reporter plasmids. DEAE-Dextran was

used to enhance transfection rates. The electroporation was performed in 4 mm cuvettes

using a total of 8∗106 cells in RPMI-only with 2.5 ng plasmid DNA and 125 µg/ml DEAE-

Dextran. The cells were electroporated with 260 V and 60 µF and after incubation on RT

for 10 min. the cells were transferred to 6 well plates and supplemented with 4 ml RPMI

10 % FCS. After 24 hours cultivation the cells were collected and lysed with 100 µl Glo

Lysis bu�er (Promega, USA).

The protein concentration of each lysate was measured in BCA assay. 25 µl of a 1:10

dilution of the lysate in PBS (∑100 µl) was mixed with 200 µl BCA working solution

(50:1 reagent A to reagent B, Pierce, USA) in a 96 well �at bottom plate and these wells

were compared to a BSA standard ranging from 2 mg/ml to 0.97 µg/ml. Each protein

lysate was analyzed in replicates. The absorption at 562 nm was measured in an elisa

reader.

107

7. METHODS

For the luciferase measurement a constant amount of protein in the lysate was used

and the volume of the protein solution was adjusted to 30µl using PBS. The relative

light units were measured in a luminometer that directly added 50 µl of luziferin solution

2 second before the 15 seconds data acquiring interval. These RLU values were acquired

three times per lysate. For the data representation the mean RLU value for each vector

was set into relation to the mean RLU value of the pGL3-basic+Eµ vector that had no

promotor inserted upstream of the luciferase ORF.

7.11 Programming E�ort

The libraries and scripts were written in perl version 5.8.8. The project is object oriented

and relies on several other programs. It is necessary to have a working MySQL server and

the NCBI toolkit installed as well as the perl packages DBI, Date::Simple and the GD

library interface. Additionally the ImageMagick library and the EMBOSS sequence ma-

nipulation package were used, but these programs are not needed for the proper function

of the following.

7.11.1 Identi�cation of Immunogobuin speci�c Sequences in Genomic DNA from the

RefSeq Database

The aim was to identify all Ig and TCR segments in the IgH, the Igκ, the Igλ, the TCRβ,

the TCRα/δ and TCRγ loci. To accomplish this task I needed (1) the location of the

Ig and TCR loci in the Mus muculus genomic sequence, (2) the sequence information of

as may Ig and TCR segments as possible and (3) a method to combine both databases.

The identi�cation of the location of the loci was already described in chapter 4.1. The Ig

and TCR segment sequence information was extracted from the IMGT/LIGM database,

using all Mus muculus speci�c sequences entries. These sequences were extracted by a

simple perl script unsing a regular expression search for the string ' Mus muculus ' in all

IMGT/LIGM database entries. The matching entries were written into a new �le.

The identi�cation of the TCR and BCR segments in the genomic DNA was divided

into three steps. First the loci were locally stored as genbank formated sequence �les,

second the Mus muculus speci�c IMGT sequences were compared with (matched against)

these locally stored sequences and third the new, 'enhanced' loci (with the Ig or TCR

segments assigned) were created using the most promising IMGT matches.

To create a local copy of the Ig or TCR loci the identi�ed chromosomal region had

to be extracted from the RefSeq database. As not all of the Ig and TCR loci were com-

108


pletely assembled in the RefSeq database version 34.1, I had to combine di�erent genbank

formated sequence parts to one locally stored locus. To create these partial loci �rst the

sequence �les were extracted from the RefSeq database and �anking sequences not part

of the respective locus were removed. The resulting sequence �les were merged inserting

the amount of unknown sequence (N nucleotides) mentioned in the NCBI chromosomal

map �le. The location of the sequence features were adjusted to the new locus, rede�ning

the start and end positions for each genbank formated feature.

This whole process is implemented in the perl script ChromosomalRegions2SeqFiles.pl

and the two library �les seq_contig.pm and gbFileMerger.pm. As the further ChIP eval-

uation relies on locally stored genbank formated sequences, this script was also used to

create genbank formated �les for all other loci represented on the NimbleGene chip. In-

formation about the command line parameters to start the whole process can be viewed

using the '-help' option upon invocation of the script.

To identify the Ig and TCR segments I �rst had to search for the Mus muculus part

of the IMGT/LIGM database in the newly created genbank formated Ig and TCR loci.

The comparison between one sequence and a database of sequences is best performed by

the NCBI BLAST algorithm, that is free of charge and can be obtained at the NCBI

web page (FTP). As this program was used, but it is only able to use fasta formated

sequences, that lack all feature information. Therefore, the feature information of theMus

muculus IMGT/LIGM database entries was extracted and stored in a primitive MySQL

database searchable for the IMGT accession numbers. The sequence information was

extracted and stored in a fasta formated database using once again the IMGT accession

numbers for sequence identi�cation. The fasta formated IMGT database was transformed

into a BLAST formated database following the instructions shipped with the BLAST

executables. In the end, the blast formated database and the feature database were both

ordered by the same accession tags and therefor the IMGT feature information could be

correlated to the sequence match.

The actual sequence match was performed against the locally stored fasta formated RefSeq

Mus muculus genome loci using the megablast algorithm with an initial wordmatch of

40 bp (-W 40), the tabular output options (-m 8 -D 3), the fasta formated genome sequence

(-i <input.fasta>) and the blast formated IMGT database fragment (-d <IMGT.fasta>).

The output was directly written to a temporary �le (-o <blast.tabel>).

The BLAST program produces a confusing amount of matching regions and therefor

I had to implement a script that (1) is able to identify the most promising BLAST match

in the results and (2) can handle the IMGT feature information stored in the MySQL

109

7. METHODS

database. This confusing amount of BLAST hits was reduced by three di�erent selection

criteria: First all hits showing less than 90% sequence identity were removed. Second,

all hits that did not contain a full length IMGT feature were removed. To test for a full

length IMGT feature, the start and end positions of the IMGT feature information stored

in the MySQL database were compared to the start and end positions of the matching

sequence as reported in the BLAST tabular output. Third, only the best BLAST hit in

regards to the BLAST 'E-value' was used, if several BLAST hits overlapped at the same

genomic position. Now the surviving BLAST hits contained the best matching IMGT

features found in the IMGT/LIGM database and �nally the initial BLAST hit and the

IMGT features were converted to genbank entries. For the IMGT features, the feature

tag and all feature entry identi�ers had to be changed from IMGT style to genbank style.

The self-made conversion table is shown in the appendix A.2. All newly created genbank

features were added to the original genbank formated and locally stored Ig or TCR locus.

This whole process is implemented in the script ncbiBLAST_Wrap.pl. Help about the

command line parameters of this script can be obtained by starting the script without

any parameter.

7.11.2 Import of the NimbleGene Chip Design

The NimbleGene chip design is reported in two di�erent �les. One �le describes for each

oligo the physical location on the chip, the oligo class (EXPERIMENTAL, CONTROL,

. . . ), the oligo ID and most importantly the oligo sequence. The other �le contains the

oligo ID and the location on the Mus muculus RefSeq genome. As this analysis was based

on the modi�ed RefSeq sequences and the published VH cluster (Johnston et al. (2006))

the oligo location on the chromosome was useless. Instead of the chromosomal location I

needed the location on the locally stored genbank sequences. Therefore the NimbleGene

provided oligo sequences were extracted from the �rst �le (*.ndf) using the ndfFile.pm

library function WriteAsFastaDB. The resulting fasta formated database was reformated

to be used with the BLAST algorithm, using the NCBI toolkit. The location of the oligos

on the locally stored loci was identi�ed using the ncbiBLAST_Wrap.pl script described

previously. The selection criteria for the BLAST hits were 100 % sequence identity over

the full length of the oligo.

For each oligo the oligo location information was stored in a MySQL database for later

on usage. In addition to the location, for each oligo the number of full length binding

sites in the analyzed sequences was stored. This number was used later on to exclude

110


oligos that were representing highly repetitive sequences (more that 5 binding sites in the

analyzed sequences).

7.11.3 Hidden Markow Model for Statistical Tiling Array Data Evaluation

The Hidden Markow Model (HMM) based statistical evaluation of tiling array data is

published in Ji & Wong (2005). The calculation of this statistical model was already

described in (4.4.1 starting on page 41). The resulting probabilities to be part of an

enriched region for each oligo were stored in �les of the same structure as the NimbleGene

mean enrichment factor data. In contrast to the NimbleGene provided �les, the HMM

data �les containe only the (unique) oligo ID and the probability value.

The whole process is implemented into the T-Tester.pl script, that has to be adapted

for each experimental setup. Help about this script is written directly in the script.

7.11.4 Graphical Report of Mean Enrichment Factor and Statistical Data Sets

The aim of the graphical report programming e�ort was to generate a report utility

that is able to create graphics that show either only the mean enrichment factor data,

only the signi�cantly enriched regions or both data sets at once in a comprehendible

format. Therefore, the ChIP experiments have to be plotted in separate subgraphs for

each analyzed cell type. The analyzed chromatin modi�cations have to be represented

by di�erent colors and the label for every subgraph has to be automatically created. To

allow a convenient report mechanism of multiple genomic regions, these regions have to

be de�ned in a tabular order. This tabular order also allows the unattended generation

of multiple �gures in a row (batch processing mode).

The displayed genomic regions or regions of interest (ROI) are de�ned in a colon sepa-

rated text �le (*.csv) that is editable in a standard editor like the unix 'vi' or the windows

'notepad' program. A sample �le is shown in the appendix A.4. The tabular information

is used to identify the genbank sequence �le, that contains the feature informations, that

are displayed in the �gure and collect the IDs of the oligos that represent this genomic

region on the array. After the collection of this information, the data to be displayed is

collected.

If NimbleGene formated oligo enrichment factor data sets are provided, data bins are

de�ned starting at the �rst base pair of the ROI and using either the standard window

size of 500 bp or the window size mentioned in the table. The oligo IDs are grouped in

these data bins according to there location. The provided NimbleGene formated oligo

111

7. METHODS

enrichment factor data sets are grouped according to the analyzed cell type and the

analyzed chromatin modi�cation. The mean enrichment factor and standard error of the

mean (SEM) of all oligos that are grouped in one oligo bin is calculated.

If NimbleGene formated statistical data is provided, the oligos are ordered by chro-

mosomal location and enriched regions are de�ned. If all oligos in a at least 500 bp long

region show a probability to be part of an enriched region that is higher than 99%, this

region is marked as enriched. The enriched regions are plotted as colored bars below the

corresponding mean enrichment factor plots.

The �gure is separated into as many sub�gures as cell types are displayed. In one

sub�gure only one cell type is shown. For this cell type, each chromatin modi�cation is

represented in a di�erent color (green→ H3Ac, blue→ H3K4Me2 and red→ H3K9Me3).

This color code applies to mean enrichment factors and signi�cantly enriched regions alike.

The feature information for each ROI is displayed only once at the bottom of the �gure.

Only view genbank feature types are displayed in this graphical view. The displayed ones

are shown in Figure 7.1.

The whole process is implemented in the scripts regionXY_plot.pl, HMM_graphicalReport.pl

and regionXY_plot_with_HMM.pl. Help to the command line parameters of all three

scripts can be obtained upon invocation of the scripts without parameter.

7.11.5 Aggregate Plot Over Similar Sequences

The aim of the aggregate plot is to display the mean enrichment factor of multiple, similar

chromosomal elements as transcription start sites or V segments. To create this type of

report graph, a list of strings is needed. The �rst base pair of each genbank feature, that

contains one string of this list is recorded. A user de�ned amount of genomic sequence is

added at the 5' and the 3' side of this feature start point and data bins are create relative

to the feature start point. Therefore, all oligos are sorted into these bins according to

three relative distance to the feature start site. Hence, the mean enrichment factor is

calculated over all these similar sequence features. For this type of plot, only NimbleGene

formate mean enrichment data �les can be used.

The whole process is implemented in the script V_SegmentBlot.pl. Help to the com-

mand line parameters of all three scripts can be obtained upon invocation of the scripts

without parameter.

112


(a) D segment

(b) V segment (c) J segment (d) Enhancer

(e) Gene

Figure 7.1: Visualization of the genbank feature entries for the graphical report scripts.

'Sense' orientated features (left to right) are shown in the upper line ((b)), 'anti-sense' orientated ones

(right to left) are shown in the lower line ((a),(c),(d) and (e)). (a): The DH cluster; D segments are

represented by a blue bars; only the name of the �rst and last DH segment is shown. The names are

centered above the D segments. (b): V segments are depicted as blue bars. The V family name in IMGT

notion is depicted centered at the start of the V segment. If the V segment consists of two exons the

exon/intron structure is shown and the orientation of the segment is indicated by blue arrow heads in

the intron region. (c): J segments are depicted as green bars and unlike the D segments each J segments

name is shown centered above the segment. (d): Enhancer elements are shown by purple bars. Not every

enhancer name is displayed, but if it is displayed, the name is centered at the 'start' of the enhancer

as indicated by the orientation in the sequence �le. (e): Genes are depicted in black containing the

exon/intron structure and the coding sequence. The not coding mRNA sequence is depicted as small bar

whereas the coding sequence is shown as large bar. Comparable to the V segments the orientation of the

genes is indicated by black arrow heads in the intron regions.

113

7. METHODS

114

References

The page numbers behind the references lead back to the citation in the text.

Abarrategui, I. & Krangel, M.S. (2006). Regulation of T cell receptor-alpha gene

recombination by transcription. Nat Immunol , 7, 1109�1115. 85, 88

Afshar, R., Pierce, S., Bolland, D.J., Corcoran, A. & Oltz, E.M. (2006).

Regulation of IgH gene assembly: role of the intronic enhancer and 5'DQ52 region in

targeting DHJH recombination. J Immunol , 176, 2439�2447. 4, 31

Agrawal, A. & Schatz, D.G. (1997). RAG1 and RAG2 form a stable postcleavage

synaptic complex with DNA containing signal ends in V(D)J recombination. Cell , 89,

43�53. 5

Aifantis, I., Buer, J., von Boehmer, H. & Azogui, O. (1997). Essential role of the

pre-T cell receptor in allelic exclusion of the T cell receptor beta locus. Immunity , 7,

601�607. 9

Akamatsu, Y., Monroe, R., Dudley, D.D., Elkin, S.K., Gartner, F.,

Talukder, S.R., Takahama, Y., Alt, F.W., Bassing, C.H. & Oettinger,

M.A. (2003). Deletion of the RAG2 C terminus leads to impaired lymphoid develop-

ment in mice. Proc Natl Acad Sci U S A, 100, 1209�1214. 10

Alt, F.W., Yancopoulos, G.D., Blackwell, T.K., Wood, C., Thomas, E.,

Boss, M., Coffman, R., Rosenberg, N., Tonegawa, S. & Baltimore, D.

(1984). Ordered rearrangement of immunoglobulin heavy chain variable region seg-

ments. EMBO J , 3, 1209�1219. 93

Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J. (1990).

Basic local alignment search tool. J Mol Biol , 215, 403�410. 17

115

REFERENCES

Baker, J.E., Cado, D. & Raulet, D.H. (1998). Developmentally programmed re-

arrangement of T cell receptor Vgamma genes is controlled by sequences immediately

upstream of the Vgamma genes. Immunity , 9, 159�168. 66

Bannister, A.J., Zegerman, P., Partridge, J.F., Miska, E.A., Thomas, J.O.,

Allshire, R.C. & Kouzarides, T. (2001). Selective recognition of methylated lysine

9 on histone H3 by the HP1 chromo domain. Nature, 410, 120�124. 12

Bassing, C.H., Swat, W. & Alt, F.W. (2002). The mechanism and regulation of

chromosomal V(D)J recombination. Cell , 109 Suppl, S45�55. 3

Baumann, M., Mamais, A., McBlane, F., Xiao, H. & Boyes, J. (2003). Regulation

of V(D)J recombination by nucleosome positioning at recombination signal sequences.

EMBO J , 22, 5197�5207. 86, 88

Berger, S.L. (2002). Histone modi�cations in transcriptional regulation. Curr Opin

Genet Dev , 12, 142�148. 12

Bernstein, B.E., Kamal, M., Lindblad-Toh, K., Bekiranov, S., Bailey, D.K.,

Huebert, D.J., McMahon, S., Karlsson, E.K., Kulbokas, E.J.r., Gingeras,

T.R., Schreiber, S.L. & Lander, E.S. (2005). Genomic maps and comparative

analysis of histone modi�cations in human and mouse. Cell , 120, 169�181. 13, 28, 41,

71, 85

Bernstein, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff,

J., Fry, B., Meissner, A., Wernig, M., Plath, K., Jaenisch, R., Wagschal,

A., Feil, R., Schreiber, S.L. & Lander, E.S. (2006). A bivalent chromatin struc-

ture marks key developmental genes in embryonic stem cells. Cell , 125, 315�326. 90

Bolland, D., Wood, A., Afshar, R., Featherstone, K., Oltz, E. & Corcoran,

A. (2007). Antisense intergenic transcription precedes Igh D-to-J recombination and is

controlled by the intronic enhancer, Emicro. Mol Cell Biol . 87, 91, 92

Bolland, D.J., Wood, A.L., Johnston, C.M., Bunting, S.F., Morgan, G.,

Chakalova, L., Fraser, P.J. & Corcoran, A.E. (2004). Antisense intergenic

transcription in V(D)J recombination. Nat Immunol , 5, 630�637. 87

Bolstad, B.M., Irizarry, R.A., Astrand, M. & Speed, T.P. (2003). A comparison

of normalization methods for high density oligonucleotide array data based on variance

and bias. Bioinformatics , 19, 185�193. 43

116

REFERENCES

Born, W., White, J., Kappler, J. & Marrack, P. (1988). Rearrangement of IgH

genes in normal thymocyte development. J Immunol , 140, 3228�3232. 87

Bosc, N. & Lefranc, M.P. (2003). The mouse (Mus musculus) T cell receptor alpha

(TRA) and delta (TRD) variable genes. Dev Comp Immunol , 27, 465�497. 7

Bouvier, G., Watrin, F., Naspetti, M., Verthuy, C., Naquet, P. & Ferrier,

P. (1996). Deletion of the mouse T-cell receptor beta gene enhancer blocks alphabeta

T-cell development. Proc Natl Acad Sci U S A, 93, 7877�7881. 4

Brack, C., Hirama, M., Lenhard-Schuller, R. & Tonegawa, S. (1978). A com-

plete immunoglobulin gene is created by somatic recombination. Cell , 15, 1�14. 3

Capone, M., Watrin, F., Fernex, C., Horvat, B., Krippl, B., Wu, L., Scollay,

R. & Ferrier, P. (1993). TCR beta and TCR alpha gene enhancers confer tissue-

and stage-speci�city on V(D)J recombination events. EMBO J , 12, 4335�4346. 39

Chakalova, L., Debrand, E., Mitchell, J.A., Osborne, C.S. & Fraser, P.

(2005). Replication and transcription: shaping the landscape of the genome. Nat Rev

Genet , 6, 669�677. 89

Chauveau, C., Jansson, E.A., Muller, S., Cogne, M. & Pettersson, S. (1999).

Cutting edge: Ig heavy chain 3' HS1-4 directs correct spatial position-independent

expression of a linked transgene to B lineage cells. J Immunol , 163, 4637�4641. 33

Chen, H.T., Bhandoola, A., Difilippantonio, M.J., Zhu, J., Brown, M.J., Tai,

X., Rogakou, E.P., Brotz, T.M., Bonner, W.M., Ried, T. & Nussenzweig,

A. (2000). Response to RAG-mediated VDJ cleavage by NBS1 and gamma-H2AX.

Science, 290, 1962�1965. 5

Chevillard, C., Ozaki, J., Herring, C.D. & Riblet, R. (2002). A three-megabase

yeast arti�cial chromosome contig spanning the C57BL mouse Igh locus. J Immunol ,

168, 5659�5666. 6

Chien, Y.H., Iwashima, M., Wettstein, D.A., Kaplan, K.B., Elliott, J.F.,

Born, W. & Davis, M.M. (1987). T-cell receptor delta gene rearrangements in early

thymocytes. Nature, 330, 722�727. 63

Chowdhury, D. & Sen, R. (2001). Stepwise activation of the immunoglobulin mu heavy

chain gene locus. EMBO J , 20, 6394�6403. 22, 31, 73, 85

117

REFERENCES

Chowdhury, D. & Sen, R. (2003). Transient IL-7/IL-7R signaling provides a mech-

anism for feedback inhibition of immunoglobulin heavy chain gene rearrangements.

Immunity , 18, 229�241. 22, 25, 31, 73, 85

Cleveland, W. & Develin, S. (1998). Locally-weighted regression: an approach to

regression analysis by local �tting. J. Am. Stst. Assoc., 83, 596�610. 42

Clissold, P.M. & Ponting, C.P. (2001). JmjC: cupin metalloenzyme-like domains in

jumonji, hairless and phospholipase A2beta. Trends Biochem Sci , 26, 7�9. 14

Cobb, R.M., Oestreich, K.J., Osipovich, O.A. & Oltz, E.M. (2006). Accessibility

control of V(D)J recombination. Adv Immunol , 91, 45�109. 19, 39, 63, 66

Coffman, R.L. & Weissman, I.L. (1981). B220: a B cell-speci�c member of th T200

glycoprotein family. Nature, 289, 681�683. 8

Corcoran, A.E., Riddell, A., Krooshoop, D. & Venkitaraman, A.R. (1998).

Impaired immunoglobulin gene rearrangement in mice lacking the IL-7 receptor. Nature,

391, 904�907. 22, 73

Corcoran, L., Ferrero, I., Vremec, D., Lucas, K., Waithman, J., O'Keeffe,

M., Wu, L., Wilson, A. & Shortman, K. (2003). The lymphoid past of mouse

plasmacytoid cells and thymic dendritic cells. J Immunol , 170, 4926�4932. 39

Curry, J.D., Geier, J.K. & Schlissel, M.S. (2005). Single-strand recombination

signal sequence nicks in vivo: evidence for a capture model of synapsis. Nat Immunol ,

6, 1272�1279. 5

Dai, Y., Kysela, B., Hanakahi, L.A., Manolis, K., Riballo, E., Stumm, M.,

Harville, T.O., West, S.C., Oettinger, M.A. & Jeggo, P.A. (2003). Nonho-

mologous end joining and V(D)J recombination require an additional factor. Proc Natl

Acad Sci U S A, 100, 2462�2467. 6

Dariavach, P., Williams, G.T., Campbell, K., Pettersson, S. & Neuberger,

M.S. (1991). The mouse IgH 3'-enhancer. Eur J Immunol , 21, 1499�1504. 33, 34

Dou, Y., Milne, T.A., Tackett, A.J., Smith, E.R., Fukuda, A., Wysocka, J.,

Allis, C.D., Chait, B.T., Hess, J.L. & Roeder, R.G. (2005). Physical associa-

tion and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16

acetyltransferase MOF. Cell , 121, 873�885. 13

118

REFERENCES

Dreijerink, K.M.A., Mulder, K.W., Winkler, G.S., Hoppener, J.W.M., Lips,

C.J.M. & Timmers, H.T.M. (2006). Menin links estrogen receptor activation to his-

tone H3K4 trimethylation. Cancer Res , 66, 4929�4935. 13

Dudley, D.D., Chaudhuri, J., Bassing, C.H. & Alt, F.W. (2005). Mechanism

and control of V(D)J recombination versus class switch recombination: similarities and

di�erences. Adv Immunol , 86, 43�112. 5

Eastman, Q.M., Leu, T.M. & Schatz, D.G. (1996). Initiation of V(D)J recombina-

tion in vitro obeying the 12/23 rule. Nature, 380, 85�88. 4, 5

Ehlich, A., Schaal, S., Gu, H., Kitamura, D., Muller, W. & Rajewsky, K.

(1993). Immunoglobulin heavy and light chain genes rearrange independently at early

stages of B cell development. Cell , 72, 695�704. 9

Ehlich, A., Martin, V., Muller, W. & Rajewsky, K. (1994). Analysis of the B-cell

progenitor compartment at the level of single cells. Curr Biol , 4, 573�583. 70, 97

Eisen, A.F., Atkinson, M.J., Celler, J.W., Paige, C.J. & Wu, G.E. (1991).

Measurement of recombinase activity in a set of related Abelson murine leukemic virus

pre-B cell lines: DJ/DJ lines have more recombinase activity than do VDJ/VDJ lines.

Int Immunol , 3, 477�484. 22

Eisner, J. (2002). An Interactive Spreadsheet for Teaching the Forward-Backward Al-

gorithm. In D. Radev & C. Brew, eds., Proceedings of the ACL Workshop on E�ective

Tools and Methodologies for Teaching NLP and CL. 45, 47

Emerson, B.M. (2002). Speci�city of gene regulation. Cell , 109, 267�270. 12

Fahrner, J.A. & Baylin, S.B. (2003). Heterochromatin: stable and unstable invasions

at home and abroad. Genes Dev , 17, 1805�1812. 11

Fang, W., Mueller, D.L., Pennell, C.A., Rivard, J.J., Li, Y.S., Hardy, R.R.,

Schlissel, M.S. & Behrens, T.W. (1996). Frequent aberrant immunoglobulin gene

rearrangements in pro-B cells revealed by a bcl-xL transgene. Immunity , 4, 291�299. 8

Faro-Trindade, I. & Cook, P.R. (2006). Transcription factories: structures conserved

during di�erentiation and evolution. Biochem Soc Trans , 34, 1133�1137. 87

119

REFERENCES

Forsberg, E.C., Prohaska, S.S., Katzman, S., Heffner, G.C., Stuart, J.M.

& Weissman, I.L. (2005). Di�erential expression of novel potential regulators in

hematopoietic stem cells. PLoS Genet , 1, e28. 87

Fuxa, M. & Busslinger, M. (2007). Reporter gene insertions reveal a strictly B

lymphoid-speci�c expression pattern of Pax5 in support of its B cell identity function.

J Immunol , 178, 3031�3037. 28

Galler, G.R. (2004). Pre-B cell receptor-mediated Regulation of the V(D)J-

recombaintion machenery in murine B lymphopoiesis . Ph.D. thesis, Friedrich-Alexander

university Erlangen-Nuernberg. 91

Geiman, T.M. & Robertson, K.D. (2002). Chromatin remodeling, histone modi�ca-

tions, and DNA methylation-how does it all �t together? J Cell Biochem, 87, 117�125.

11

Glusman, G., Rowen, L., Lee, I., Boysen, C., Roach, J.C., Smit, A.F., Wang,

K., Koop, B.F. & Hood, L. (2001). Comparative genomics of the human and mouse

T cell receptor loci. Immunity , 15, 337�349. 7

Gorman, J.R. & Alt, F.W. (1998). Regulation of immunoglobulin light chain isotype

expression. Adv Immunol , 69, 113�181. 7, 36

Gorman, J.R., van der Stoep, N., Monroe, R., Cogne, M., Davidson, L. &

Alt, F.W. (1996). The Ig(kappa) enhancer in�uences the ratio of Ig(kappa) versus

Ig(lambda) B lymphocytes. Immunity , 5, 241�252. 36

Grawunder, U., Wilm, M., Wu, X., Kulesza, P., Wilson, T.E., Mann, M. &

Lieber, M.R. (1997). Activity of DNA ligase IV stimulated by complex formation with

XRCC4 protein in mammalian cells. Nature, 388, 492�495. 5

Grewal, S.I.S. & Jia, S. (2007). Heterochromatin revisited. Nat Rev Genet , 8, 35�46.

36, 91

Gu, H., Tarlinton, D., Muller, W., Rajewsky, K. & Forster, I. (1991). Most

peripheral B cells in mice are ligand selected. J Exp Med , 173, 1357�1371. 70

Guenther, M.G., Jenner, R.G., Chevalier, B., Nakamura, T., Croce, C.M.,

Canaani, E. & Young, R.A. (2005). Global and Hox-speci�c roles for the MLL1

methyltransferase. Proc Natl Acad Sci U S A, 102, 8603�8608. 13

120

REFERENCES

Hawwari, A., Bock, C. & Krangel, M.S. (2005). Regulation of T cell receptor alpha

gene assembly by a complex hierarchy of germline Jalpha promoters. Nat Immunol , 6,

481�489. 10

Hess, J., Werner, A., Wirth, T., Melchers, F., Jack, H.M. & Winkler, T.H.

(2001). Induction of pre-B cell proliferation after de novo synthesis of the pre-B cell

receptor. Proc Natl Acad Sci U S A, 98, 1745�1750. 8, 22, 76, 80, 91, 92, 93

Hesslein, D.G. & Schatz, D.G. (2001). Factors and forces controlling V(D)J recom-

bination. Adv Immunol , 78, 169�232. 6

Hiom, K. & Gellert, M. (1998). Assembly of a 12/23 paired signal complex: a critical

control point in V(D)J recombination. Mol Cell , 1, 1011�1019. 5

Honjo, T., Alt, F.W. & Neuberger, M.S. (2004). Molecular biology of B cells .

Elsevier, Amsterdam. 20

Hsu, L.Y., Lauring, J., Liang, H.E., Greenbaum, S., Cado, D., Zhuang, Y.

& Schlissel, M.S. (2003). A conserved transcriptional enhancer regulates RAG gene

expression in developing B cells. Immunity , 19, 105�117. 8

Huang, C.Y., Sleckman, B.P. & Kanagawa, O. (2005). Revision of T cell receptor

{alpha} chain genes is required for normal T lymphocyte development. Proc Natl Acad

Sci U S A, 102, 14356�14361. 10

Huang, J., Durum, S.K. & Muegge, K. (2001). Cutting edge: histone acetylation

and recombination at the TCR gamma locus follows IL-7 induction. J Immunol , 167,

6073�6077. 85

Hütt Mark-Thorsten, D.M. (2006). Methoden der Bioinformatik eine Einführung .

Springer, Berlin Heidelberg. 44, 47

Hwang, K.K., Eissenberg, J.C. & Worman, H.J. (2001). Transcriptional repression

of euchromatic genes by Drosophila heterochromatin protein 1 and histone modi�ers.

Proc Natl Acad Sci U S A, 98, 11423�11427. 36, 91

Inlay, M.A., Tian, H., Lin, T. & Xu, Y. (2004). Important roles for E protein binding

sites within the immunoglobulin kappa chain intronic enhancer in activating Vkappa

Jkappa rearrangement. J Exp Med , 200, 1205�1211. 36

121

REFERENCES

Jenuwein, T. & Allis, C.D. (2001). Translating the histone code. Science, 293, 1074�

1080. 12

Ji, H. & Wong, W.H. (2005). TileMap: create chromosomal map of tiling array hy-

bridizations. Bioinformatics , 21, 3629�3636. 41, 43, 44, 45, 111

Johnson, K., Pflugh, D.L., Yu, D., Hesslein, D.G.T., Lin, K.I., Bothwell,

A.L.M., Thomas-Tikhonenko, A., Schatz, D.G. & Calame, K. (2004). B cell-

speci�c loss of histone 3 lysine 9 methylation in the V(H) locus depends on Pax5. Nat

Immunol , 5, 853�861. 12

Johnston, C.M., Wood, A.L., Bolland, D.J. & Corcoran, A.E. (2006). Complete

sequence assembly and characterization of the C57BL/6 mouse Ig heavy chain V region.

J Immunol , 176, 4221�4234. 6, 19, 49, 50, 68, 69, 77, 110

Jones, J.M. & Gellert, M. (2002). Ordered assembly of the V(D)J synaptic complex

ensures accurate recombination. EMBO J , 21, 4162�4171. 5

Kirch, S.A., Rathbun, G.A. & Oettinger, M.A. (1998). Dual role of RAG2 in

V(D)J recombination: catalysis and regulation of ordered Ig gene assembly. EMBO J ,

17, 4881�4886. 10

Kitamura, D., Roes, J., Kuhn, R. & Rajewsky, K. (1991). A B cell-de�cient mouse

by targeted disruption of the membrane exon of the immunoglobulin mu chain gene.

Nature, 350, 423�426. 8

Komori, T., Okada, A., Stewart, V. & Alt, F.W. (1993). Lack of N regions in anti-

gen receptor variable region genes of TdT-de�cient lymphocytes. Science, 261, 1171�

1175. 5

Krangel, M.S., Carabana, J., Abbarategui, I., Schlimgen, R. & Hawwari, A.

(2004). Enforcing order within a complex locus: current perspectives on the control of

V(D)J recombination at the murine T-cell receptor alpha/delta locus. Immunol Rev ,

200, 224�232. 7, 63

Kuppers, R. & Dalla-Favera, R. (2001). Mechanisms of chromosomal translocations

in B cell lymphomas. Oncogene, 20, 5580�5594. 3

122

REFERENCES

Kwon, J., Imbalzano, A.N., Matthews, A. & Oettinger, M.A. (1998). Acces-

sibility of nucleosomal DNA to V(D)J cleavage is modulated by RSS positioning and

HMG1. Mol Cell , 2, 829�839. 11, 51, 86, 88

Kwon, J., Morshead, K.B., Guyon, J.R., Kingston, R.E. & Oettinger, M.A.

(2000). Histone acetylation and hSWI/SNF remodeling act in concert to stimulate

V(D)J cleavage of nucleosomal DNA. Mol Cell , 6, 1037�1048. 12, 51, 86

Lachner, M., O'Carroll, D., Rea, S., Mechtler, K. & Jenuwein, T. (2001).

Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature, 410,

116�120. 12

Lafaille, J.J., DeCloux, A., Bonneville, M., Takagaki, Y. & Tonegawa, S.

(1989). Junctional sequences of T cell receptor gamma delta genes: implications for

gamma delta T cell lineages and for a novel intermediate of V-(D)-J joining. Cell , 59,

859�870. 5

Lauzurica, P. & Krangel, M.S. (1994). Temporal and lineage-speci�c control of T cell

receptor alpha/delta gene rearrangement by T cell receptor alpha and delta enhancers.

J Exp Med , 179, 1913�1921. 4

Lefranc, M.P., Giudicelli, V., Ginestoux, C., Bodmer, J., Muller, W., Bon-

trop, R., Lemaitre, M., Malik, A., Barbie, V. & Chaume, D. (1999). IMGT,

the international ImMunoGeneTics database. Nucleic Acids Res , 27, 209�212. 17

Li, Q., Peterson, K.R., Fang, X. & Stamatoyannopoulos, G. (2002). Locus

control regions. Blood , 100, 3077�3086. 12

Li, Z., Otevrel, T., Gao, Y., Cheng, H.L., Seed, B., Stamato, T.D., Taccioli,

G.E. & Alt, F.W. (1995). The XRCC4 gene encodes a novel protein involved in DNA

double-strand break repair and V(D)J recombination. Cell , 83, 1079�1089. 5

Liang, H.E., Hsu, L.Y., Cado, D., Cowell, L.G., Kelsoe, G. & Schlissel,

M.S. (2002). The "dispensable" portion of RAG2 is necessary for e�cient V-to-DJ

rearrangement during B and T cell development. Immunity , 17, 639�651. 10

Lieber, M.R., Hesse, J.E., Mizuuchi, K. & Gellert, M. (1987). Developmental

stage speci�city of the lymphoid V(D)J recombination activity. Genes Dev , 1, 751�

761. 4

123

REFERENCES

Liu, Y., Subrahmanyam, R., Chakraborty, T., Sen, R. & Desiderio, S. (2007).

A Plant Homeodomain in Rag-2 that Binds Hypermethylated Lysine 4 of Histone H3

Is Necessary for E�cient Antigen-Receptor-Gene Rearrangement. Immunity . 10, 85,

88, 91

Liu, Z.M., George-Raizen, J.B., Li, S., Meyers, K.C., Chang, M.Y. & Gar-

rard, W.T. (2002). Chromatin structural analyses of the mouse Igkappa gene locus

reveal new hypersensitive sites specifying a transcriptional silencer and enhancer. J Biol

Chem, 277, 32640�32649. 36, 38

Lutz, M.B., Kukutsch, N., Ogilvie, A.L., Rossner, S., Koch, F., Romani, N.

& Schuler, G. (1999). An advanced culture method for generating large quantities of

highly pure dendritic cells from mouse bone marrow. J Immunol Methods , 223, 77�92.

22, 102

Ma, Y., Pannicke, U., Schwarz, K. & Lieber, M.R. (2002). Hairpin opening and

overhang processing by an Artemis/DNA-dependent protein kinase complex in nonho-

mologous end joining and V(D)J recombination. Cell , 108, 781�794. 5

Maes, J., Chappaz, S., Cavelier, P., O'Neill, L., Turner, B., Rougeon, F.

& Goodhardt, M. (2006). Activation of V(D)J recombination at the IgH chain JH

locus occurs within a 6-kilobase chromatin domain and is associated with nucleosomal

remodeling. J Immunol , 176, 5409�5417. 85

Malynn, B.A., Yancopoulos, G.D., Barth, J.E., Bona, C.A. & Alt, F.W.

(1990). Biased expression of JH-proximal VH genes occurs in the newly generated reper-

toire of neonatal and adult mice. J Exp Med , 171, 843�859. 6, 50, 88

Matsuda, H. (1995). Immunoglobulin genes . Academic Press. 20

McBlane, J.F., van Gent, D.C., Ramsden, D.A., Romeo, C., Cuomo, C.A.,

Gellert, M. & Oettinger, M.A. (1995). Cleavage at a V(D)J recombination signal

requires only RAG1 and RAG2 proteins and occurs in two steps. Cell , 83, 387�395. 4

McDougall, S., Peterson, C.L. & Calame, K. (1988). A transcriptional enhancer

3' of C beta 2 in the T cell receptor beta locus. Science, 241, 205�208. 39

124

REFERENCES

Melcher, M., Schmid, M., Aagaard, L., Selenko, P., Laible, G. & Jenuwein,

T. (2000). Structure-function analysis of SUV39H1 reveals a dominant role in hete-

rochromatin organization, chromosome segregation, and mitotic progression. Mol Cell

Biol , 20, 3728�3741. 90

Melchers, F. (1999). Fit for life in the immune system? Surrogate L chain tests H

chains that test L chains. Proc Natl Acad Sci U S A, 96, 2571�2573. 8

Metzger, E., Wissmann, M., Yin, N., Muller, J.M., Schneider, R., Peters,

A.H.F.M., Gunther, T., Buettner, R. & Schule, R. (2005). LSD1 demethy-

lates repressive histone marks to promote androgen-receptor-dependent transcription.

Nature, 437, 436�439. 14

Mills, F.C., Harindranath, N., Mitchell, M. & Max, E.E. (1997). Enhancer

complexes located downstream of both human immunoglobulin Calpha genes. J Exp

Med , 186, 845�858. 33

Milne, T.A., Dou, Y., Martin, M.E., Brock, H.W., Roeder, R.G. & Hess,

J.L. (2005). MLL associates speci�cally with a subset of transcriptionally active target

genes. Proc Natl Acad Sci U S A, 102, 14765�14770. 13

Mizutani, S., Ford, A.M., Wiedemann, L.M., Chan, L.C., Furley, A.J.,

Greaves, M.F. & Molgaard, H.V. (1986). Rearrangement of immunoglobulin

heavy chain genes in human T leukaemic cells shows preferential utilization of the

D segment (DQ52) nearest to the J region. EMBO J , 5, 3467�3473. 31, 88

Mo, R., Rao, S.M. & Zhu, Y.J. (2006). Identi�cation of the MLL2 complex as a

coactivator for estrogen receptor alpha. J Biol Chem, 281, 15714�15720. 13

Mombaerts, P., Iacomini, J., Johnson, R.S., Herrup, K., Tonegawa, S. & Pa-

paioannou, V.E. (1992). RAG-1-de�cient mice have no mature B and T lymphocytes.

Cell , 68, 869�877. 4, 93

Morshead, K.B., Ciccone, D.N., Taverna, S.D., Allis, C.D. & Oettinger,

M.A. (2003). Antigen receptor loci poised for V(D)J rearrangement are broadly asso-

ciated with BRG1 and �anked by peaks of histone H3 dimethylated at lysine 4. Proc

Natl Acad Sci U S A, 100, 11577�11582. 12, 31, 54, 85

Mosteller & Tukey (1977). Data Analysis and Regression: A Second Course in Statis-

tics , vol. pp. 203-209. Addison-Wesley. 26

125

REFERENCES

Mostoslavsky, R., Singh, N., Tenzen, T., Goldmit, M., Gabay, C., Elizur,

S., Qi, P., Reubinoff, B.E., Chess, A., Cedar, H. & Bergman, Y. (2001).

Asynchronous replication and allelic exclusion in the immune system. Nature, 414,

221�225. 91

Mundy, C.L., Patenge, N., Matthews, A.G.W. & Oettinger, M.A. (2002). As-

sembly of the RAG1/RAG2 synaptic complex. Mol Cell Biol , 22, 69�77. 5

Nakayama, J., Rice, J.C., Strahl, B.D., Allis, C.D. & Grewal, S.I. (2001). Role

of histone H3 lysine 9 methylation in epigenetic control of heterochromatin assembly.

Science, 292, 110�113. 12

Narlikar, G.J., Fan, H.Y. & Kingston, R.E. (2002). Cooperation between com-

plexes that regulate chromatin structure and transcription. Cell , 108, 475�487. 12

Nelson, K.J., Haimovich, J. & Perry, R.P. (1983). Characterization of productive

and sterile transcripts from the immunoglobulin heavy-chain locus: processing of micron

and muS mRNA. Mol Cell Biol , 3, 1317�1332. 87

Ng, H.H., Robert, F., Young, R.A. & Struhl, K. (2003). Targeted recruitment of

Set1 histone methylase by elongating Pol II provides a localized mark and memory of

recent transcriptional activity. Mol Cell , 11, 709�719. 13, 85

Nielsen, S.J., Schneider, R., Bauer, U.M., Bannister, A.J., Morrison, A.,

O'Carroll, D., Firestein, R., Cleary, M., Jenuwein, T., Herrera, R.E. &

Kouzarides, T. (2001). Rb targets histone H3 methylation and HP1 to promoters.

Nature, 412, 561�565. 36, 91

Noma, C.D., K Allis & Grewal, S.I. (2001). Transitions in distinct histone H3 methy-

lation patterns at the heterochromatin domain boundaries. Science, 293, 1150�1155.

91

Oestreich, K.J., Cobb, R.M., Pierce, S., Chen, J., Ferrier, P. & Oltz, E.M.

(2006). Regulation of TCRbeta gene assembly by a promoter/enhancer holocomplex.

Immunity , 24, 381�391. 85

Oettinger, M.A., Schatz, D.G., Gorka, C. & Baltimore, D. (1990). RAG-1 and

RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science, 248,

1517�1523. 3, 4, 85

126

REFERENCES

Ogawa, M., Nishikawa, S., Ikuta, K., Yamamura, F., Naito, M., Takahashi,

K. & Nishikawa, S. (1988). B cell ontogeny in murine embryo studied by a culture

system with the monolayer of a stromal cell clone, ST2: B cell progenitor develops �rst

in the embryonal body rather than in the yolk sac. EMBO J , 7, 1337�1343. 93

Ogawa, M., ten Boekel, E. & Melchers, F. (2000). Identi�cation of CD19(-

)B220(+)c-Kit(+)Flt3/Flk-2(+)cells as early B lymphoid precursors before pre-B-I cells

in juvenile mouse bone marrow. Int Immunol , 12, 313�324. 8

Oltz, E.M., Alt, F.W., Lin, W.C., Chen, J., Taccioli, G., Desiderio, S. &

Rathbun, G. (1993). A V(D)J recombinase-inducible B-cell line: role of transcriptional

enhancer elements in directing V(D)J recombination. Mol Cell Biol , 13, 6223�6230. 4,

85

Orlando, V., Strutt, H. & Paro, R. (1997). Analysis of chromatin structure by in

vivo formaldehyde cross-linking. Methods , 11, 205�214. 103

Osipovich, O., Milley, R., Meade, A., Tachibana, M., Shinkai, Y., Krangel,

M.S. & Oltz, E.M. (2004). Targeted inhibition of V(D)J recombination by a histone

methyltransferase. Nat Immunol , 5, 309�316. 13, 33, 36, 90, 91

Pawlitzky, I., Angeles, C.V., Siegel, A.M., Stanton, M.L., Riblet, R. &

Brodeur, P.H. (2006). Identi�cation of a candidate regulatory element within the

5' �anking region of the mouse Igh locus de�ned by pro-B cell-speci�c hypersensitivity

associated with binding of PU.1, Pax5, and E2A. J Immunol , 176, 6839�6851. 35, 36,

90

Pergola, F., Zdzienicka, M.Z. & Lieber, M.R. (1993). V(D)J recombination in

mammalian cell mutants defective in DNA double-strand break repair. Mol Cell Biol ,

13, 3464�3471. 5

Peters, A.H., O'Carroll, D., Scherthan, H., Mechtler, K., Sauer, S.,

Schofer, C., Weipoltshammer, K., Pagani, M., Lachner, M., Kohlmaier,

A., Opravil, S., Doyle, M., Sibilia, M. & Jenuwein, T. (2001). Loss of the

Suv39h histone methyltransferases impairs mammalian heterochromatin and genome

stability. Cell , 107, 323�337. 12

127

REFERENCES

Peters, A.H.F.M., Kubicek, S., Mechtler, K., O'Sullivan, R.J., Derijck,

A.A.H.A., Perez-Burgos, L., Kohlmaier, A., Opravil, S., Tachibana, M.,

Shinkai, Y., Martens, J.H.A. & Jenuwein, T. (2003). Partitioning and plastic-

ity of repressive histone methylation states in mammalian chromatin. Mol Cell , 12,

1577�1589. 12

Peterson, C.L. & Workman, J.L. (2000). Promoter targeting and chromatin remod-

eling by the SWI/SNF complex. Curr Opin Genet Dev , 10, 187�192. 12

Pettersson, S., Cook, G.P., Bruggemann, M., Williams, G.T. & Neuberger,

M.S. (1990). A second B cell-speci�c enhancer 3' of the immunoglobulin heavy-chain

locus. Nature, 344, 165�168. 33

Pokholok, D.K., Harbison, C.T., Levine, S., Cole, M., Hannett, N.M., Lee,

T.I., Bell, G.W., Walker, K., Rolfe, P.A., Herbolsheimer, E., Zeitlinger,

J., Lewitter, F., Gifford, D.K. & Young, R.A. (2005). Genome-wide map of

nucleosome acetylation and methylation in yeast. Cell , 122, 517�527. 12, 13, 85

Pruitt, K.D., Tatusova, T. & Maglott, D.R. (2003). NCBI Reference Sequence

project: update and current status. Nucleic Acids Res , 31, 34�37. 17

R Development Core Team (2006). R: A Language and Environment for Statistical

Computing . R Foundation for Statistical Computing, Vienna, Austria, ISBN 3-900051-

07-0. 42

Rea, S., Eisenhaber, F., O'Carroll, D., Strahl, B.D., Sun, Z.W., Schmid,

M., Opravil, S., Mechtler, K., Ponting, C.P., Allis, C.D. & Jenuwein, T.

(2000). Regulation of chromatin structure by site-speci�c histone H3 methyltransferases.

Nature, 406, 593�599. 90

Richards, E.J. & Elgin, S.C.R. (2002). Epigenetic codes for heterochromatin forma-

tion and silencing: rounding up the usual suspects. Cell , 108, 489�500. 12

Robey, E. (2005). The alphabeta versus gammadelta T cell fate decision: when less is

more. Immunity , 22, 533�534. 9

Robyr, D. & Grunstein, M. (2003). Genomewide histone acetylation microarrays.

Methods , 31, 83�89. 25, 106

128

REFERENCES

Rolink, A. & Melchers, F. (1996). B-cell development in the mouse. Immunol Lett ,

54, 157�161. 7, 8, 9

Rolink, A., Grawunder, U., Winkler, T.H., Karasuyama, H. & Melchers, F.

(1994). IL-2 receptor alpha chain (CD25, TAC) expression de�nes a crucial stage in

pre-B cell development. Int Immunol , 6, 1257�1264. 8

Rolink, A.G., Winkler, T., Melchers, F. & Andersson, J. (2000). Precursor B

cell receptor-dependent B cell proliferation and di�erentiation does not require the bone

marrow or fetal liver environment. J Exp Med , 191, 23�32. 8

Roschenthaler, F., Kirschbaum, T., Heim, V., Kirschbaum, V., Schable,

K.F., Schwendinger, J., Zocher, I. & Zachau, H.G. (1999). The 5' part of

the mouse immunoglobulin kappa locus. Eur J Immunol , 29, 2065�2071. 6

Roth, D.B., Menetski, J.P., Nakajima, P.B., Bosma, M.J. & Gellert, M.

(1992). V(D)J recombination: broken DNA molecules with covalently sealed (hairpin)

coding ends in scid mouse thymocytes. Cell , 70, 983�991. 5

Rothenberg, E.V. & Taghon, T. (2005). Molecular genetics of T cell development.

Annu Rev Immunol , 23, 601�649. 9

Ruthenburg, A.J., Allis, C.D. & Wysocka, J. (2007). Methylation of lysine 4 on

histone H3: intricacy of writing and reading a single epigenetic mark. Mol Cell , 25,

15�30. 13

Ryan, T.M., Behringer, R.R., Martin, N.C., Townes, T.M., Palmiter, R.D. &

Brinster, R.L. (1989). A single erythroid-speci�c DNase I super-hypersensitive site

activates high levels of human beta-globin gene expression in transgenic mice. Genes

Dev , 3, 314�323. 12

Sakano, H., Huppi, K., Heinrich, G. & Tonegawa, S. (1979). Sequences at the

somatic recombination sites of immunoglobulin light-chain genes. Nature, 280, 288�

294. 3, 4

Sanchez-Elsner, T., Gou, D., Kremmer, E. & Sauer, F. (2006). Noncoding RNAs

of trithorax response elements recruit Drosophila Ash1 to Ultrabithorax. Science, 311,

1118�1123. 13

129

REFERENCES

Santos-Rosa, H., Schneider, R., Bannister, A.J., Sherriff, J., Bernstein,

B.E., Emre, N.C.T., Schreiber, S.L., Mellor, J. & Kouzarides, T. (2002).

Active genes are tri-methylated at K4 of histone H3. Nature, 419, 407�411. 13, 85

Schatz, D.G., Oettinger, M.A. & Baltimore, D. (1989). The V(D)J recombination

activating gene, RAG-1. Cell , 59, 1035�1048. 3

Schatz, D.G., Oettinger, M.A. & Schlissel, M.S. (1992). V(D)J recombination:

molecular biology and regulation. Annu Rev Immunol , 10, 359�383. 10

Schneider, R., Bannister, A.J., Myers, F.A., Thorne, A.W., Crane-

Robinson, C. & Kouzarides, T. (2004). Histone H3 lysine 4 methylation patterns

in higher eukaryotic genes. Nat Cell Biol , 6, 73�77. 13, 85

Schubeler, D., MacAlpine, D.M., Scalzo, D., Wirbelauer, C., Kooperberg,

C., van Leeuwen, F., Gottschling, D.E., O'Neill, L.P., Turner, B.M., Del-

row, J., Bell, S.P. & Groudine, M. (2004). The histone modi�cation pattern of

active genes revealed through genome-wide chromatin analysis of a higher eukaryote.

Genes Dev , 18, 1263�1271. 13, 85

Schwarz, K., Gauss, G.H., Ludwig, L., Pannicke, U., Li, Z., Lindner, D.,

Friedrich, W., Seger, R.A., Hansen-Hagge, T.E., Desiderio, S., Lieber,

M.R. & Bartram, C.R. (1996). RAG mutations in human B cell-negative SCID.

Science, 274, 97�99. 4

Schwers, S. (1995). Analyse des Immunglobulin-Repertoires muriner B-Lymphozyten

auf der Ebene von Zellpopulationen und Einzelzellen. Master's thesis, Univerity Koeln.

70

Sen, R. & Oltz, E. (2006). Genetic and epigenetic regulation of IgH gene assembly.

Curr Opin Immunol , 18, 237�242. 54, 86

Shi, Y., Lan, F., Matson, C., Mulligan, P., Whetstine, J.R., Cole, P.A.,

Casero, R.A. & Shi, Y. (2004). Histone demethylation mediated by the nuclear

amine oxidase homolog LSD1. Cell , 119, 941�953. 13

Shinkai, Y., Rathbun, G., Lam, K.P., Oltz, E.M., Stewart, V., Mendelsohn,

M., Charron, J., Datta, M., Young, F. & Stall, A.M. (1992). RAG-2-de�cient

mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell ,

68, 855�867. 4, 86

130

REFERENCES

Shinkai, Y., Koyasu, S., Nakayama, K., Murphy, K.M., Loh, D.Y., Reinherz,

E.L. & Alt, F.W. (1993). Restoration of T cell development in RAG-2-de�cient mice

by functional TCR transgenes. Science, 259, 822�825. 9

Sleckman, B.P., Bardon, C.G., Ferrini, R., Davidson, L. & Alt, F.W. (1997).

Function of the TCR alpha enhancer in alphabeta and gammadelta T cells. Immunity ,

7, 505�515. 4

Spanopoulou, E., Roman, C.A., Corcoran, L.M., Schlissel, M.S., Silver,

D.P., Nemazee, D., Nussenzweig, M.C., Shinton, S.A., Hardy, R.R. & Bal-

timore, D. (1994). Functional immunoglobulin transgenes guide ordered B-cell di�er-

entiation in Rag-1-de�cient mice. Genes Dev , 8, 1030�1042. 9

Stanhope-Baker, P., Hudson, K.M., Shaffer, A.L., Constantinescu, A. &

Schlissel, M.S. (1996). Cell type-speci�c chromatin structure determines the target-

ing of V(D)J recombinase activity in vitro. Cell , 85, 887�897. 11, 85

Stein, M.F. (2006). Charakterisierung eines putativen Enhancers im IgH-lokus . Master's

thesis, Friedrich-Alexander university Erlangen-Nuernberg. 71, 72, 107

Strahl, B.D. & Allis, C.D. (2000). The language of covalent histone modi�cations.

Nature, 403, 41�45. 90

Suzuki, H., Abe, M., Nishikawa, S., Nakayama, E. & Shiku, H. (1989). Preferential

usage of JH2 in D-J joinings with DQ52 in murine lymphocytes. Int Immunol , 1, 643�

646. 88

Swanson, P.C. & Desiderio, S. (1998). V(D)J recombination signal recognition: dis-

tinct, overlapping DNA-protein contacts in complexes containing RAG1 with and with-

out RAG2. Immunity , 9, 115�125. 4

Swanson, P.C. & Desiderio, S. (1999). RAG-2 promotes heptamer occupancy by

RAG-1 in the assembly of a V(D)J initiation complex. Mol Cell Biol , 19, 3674�3683. 4

Taccioli, G.E., Rathbun, G., Oltz, E., Stamato, T., Jeggo, P.A. & Alt, F.W.

(1993). Impairment of V(D)J recombination in double-strand break repair mutants.

Science, 260, 207�210. 5

131

REFERENCES

Tachibana, M., Sugimoto, K., Nozaki, M., Ueda, J., Ohta, T., Ohki, M.,

Fukuda, M., Takeda, N., Niida, H., Kato, H. & Shinkai, Y. (2002). G9a histone

methyltransferase plays a dominant role in euchromatic histone H3 lysine 9 methylation

and is essential for early embryogenesis. Genes Dev , 16, 1779�1791. 12

Tachibana, M., Ueda, J., Fukuda, M., Takeda, N., Ohta, T., Iwanari, H., Sak-

ihama, T., Kodama, T., Hamakubo, T. & Shinkai, Y. (2005). Histone methyl-

transferases G9a and GLP form heteromeric complexes and are both crucial for methy-

lation of euchromatin at H3-K9. Genes Dev , 19, 815�826. 12

Takeda, S., Zou, Y.R., Bluethmann, H., Kitamura, D., Muller, U. & Rajew-

sky, K. (1993). Deletion of the immunoglobulin kappa chain intron enhancer abolishes

kappa chain gene rearrangement in cis but not lambda chain gene rearrangement in

trans. EMBO J , 12, 2329�2336. 36

Thiebe, R., Schable, K.F., Bensch, A., Brensing-Kuppers, J., Heim, V.,

Kirschbaum, T., Mitlohner, H., Ohnrich, M., Pourrajabi, S., Roschen-

thaler, F., Schwendinger, J., Wichelhaus, D., Zocher, I. & Zachau, H.G.

(1999). The variable genes and gene families of the mouse immunoglobulin kappa locus.

Eur J Immunol , 29, 2072�2081. 6

Tian, X. & Fang, J. (2007). Current perspectives on histone demethylases. Acta Biochim

Biophys Sin (Shanghai), 39, 81�88. 14

Tiegs, S.L., Russell, D.M. & Nemazee, D. (1993). Receptor editing in self-reactive

bone marrow B cells. J Exp Med , 177, 1009�1020. 9

Tripathi, R., Jackson, A. & Krangel, M.S. (2002). A change in the structure of

Vbeta chromatin associated with TCR beta allelic exclusion. J Immunol , 168, 2316�

2324. 60, 61, 62

Vakoc, C.R., Mandat, S.A., Olenchock, B.A. & Blobel, G.A. (2005). Histone

H3 lysine 9 methylation and HP1gamma are associated with transcription elongation

through mammalian chromatin. Mol Cell , 19, 381�391. 49

van Gent, D.C., Ramsden, D.A. & Gellert, M. (1996). The RAG1 and RAG2

proteins establish the 12/23 rule in V(D)J recombination. Cell , 85, 107�113. 5

van Holde, K. (1988). in Chromatin, 111�148. Springer, New York. 11

132

REFERENCES

Van Ness, B.G., Weigert, M., Coleclough, C., Mather, E.L., Kelley, D.E. &

Perry, R.P. (1981). Transcription of the unrearranged mouse C kappa locus: sequence

of the initiation region and comparison of activity with a rearranged V kappa-C kappa

gene. Cell , 27, 593�602. 3, 10

von Boehmer, H. (2005). Unique features of the pre-T-cell receptor alpha-chain: not

just a surrogate. Nat Rev Immunol , 5, 571�577. 9

Wang, H., Cao, R., Xia, L., Erdjument-Bromage, H., Borchers, C., Tempst,

P. & Zhang, Y. (2001). Puri�cation and functional characterization of a histone H3-

lysine 4-speci�c methyltransferase. Mol Cell , 8, 1207�1217. 91

Weigert, M., Gatmaitan, L., Loh, E., Schilling, J. & Hood, L. (1978). Rear-

rangement of genetic information may produce immunoglobulin diversity. Nature, 276,

785�790. 3

West, K.L., Singha, N.C., De Ioannes, P., Lacomis, L., Erdjument-Bromage,

H., Tempst, P. & Cortes, P. (2005). A direct interaction between the RAG2 C

terminus and the core histones is required for e�cient V(D)J recombination. Immunity ,

23, 203�212. 10, 91

Winkler, T.H., Melchers, F. & Rolink, A.G. (1995). Interleukin-3 and interleukin-

7 are alternative growth factors for the same B-cell precursors in the mouse. Blood , 85,

2045�2051. 93

Wysocka, J., Myers, M.P., Laherty, C.D., Eisenman, R.N. & Herr, W. (2003).

Human Sin3 deacetylase and trithorax-related Set1/Ash2 histone H3-K4 methyltrans-

ferase are tethered together selectively by the cell-proliferation factor HCF-1. Genes

Dev , 17, 896�911. 13

Xu, Y., Davidson, L., Alt, F.W. & Baltimore, D. (1996). Deletion of the Ig kappa

light chain intronic enhancer/matrix attachment region impairs but does not abolish V

kappa J kappa rearrangement. Immunity , 4, 377�385. 36

Yamane, K., Toumazou, C., Tsukada, Y.i., Erdjument-Bromage, H., Tempst,

P., Wong, J. & Zhang, Y. (2006). JHDM2A, a JmjC-containing H3K9 demethylase,

facilitates transcription activation by androgen receptor. Cell , 125, 483�495. 14

Yancopoulos, G.D. & Alt, F.W. (1985). Developmentally controlled and tissue-

speci�c expression of unrearranged VH gene segments. Cell , 40, 271�281. 3, 10, 85

133

REFERENCES

Yancopoulos, G.D., Blackwell, T.K., Suh, H., Hood, L. & Alt, F.W. (1986).

Introduced T cell receptor variable region gene segments recombine in pre-B cells: evi-

dence that B and T cells use a common recombinase. Cell , 44, 251�259. 4

Ye, S.K., Agata, Y., Lee, H.C., Kurooka, H., Kitamura, T., Shimizu, A.,

Honjo, T. & Ikuta, K. (2001). The IL-7 receptor controls the accessibility of the

TCRgamma locus by Stat5 and histone acetylation. Immunity , 15, 813�823. 85

Yu, W., Misulovin, Z., Suh, H., Hardy, R.R., Jankovic, M., Yannoutsos, N.

& Nussenzweig, M.C. (1999). Coordinate regulation of RAG1 and RAG2 by cell

type-speci�c DNA elements 5' of RAG2. Science, 285, 1080�1084. 8

Zhang, K. (2003). Accessibility control and machinery of immunoglobulin class switch

recombination. J Leukoc Biol , 73, 323�332. 33

134

Curriculum Vitae

Stefan Thomas Lang

Address

Marsweg 6590763 FurthDeutschlandPhone: +49-911-7874665Email: [email protected]

Personal Details

Gender: MaleDate of birth: 25th of February, 1977Place of birth: Nurnberg, GermanyPresent Citizenship: GermanMartial status: married

University Education

11/1997–09/1999 Prediploma studies of biology(University Erlangen Nurnberg)

11/1999 Prediploma oral exams

11/1999–09/2001 Diploma studies of biology(University Erlangen/Nurnberg)

04/2002 Diploma oral exams

04/2002–01/2003 Diploma thesis in the laboratory of Prof. Dr. T. Winkler(University Erlangen/Nurnberg): ”Untersuchung von entwick-lungsspezifischen Enhancern in der B-Lymphozyten Entwick-lung”

03/2003–08/2007 PhD thesis in the laboratory of Prof. Dr. T. Wnkler: ”Epi-genetic Regulation of V(D)J Recombination in Early B CellDevelopment”

03/2003–03/2006 Fellowship holder of DFG GK592: ”Lymphozyten: Differen-zierung, Aktivierung & Deviation”

School Education

09/1983–07/1987 Primary school Nurnberg/Reichelsdorf

09/1987–07/1996 Gymnasium Nurnberg/Eibach(Abitur: Juni 28, 1996)

Civil Service

10/1996–10/1997 Home for the elderly, Nurnberg/Reichelsdorf(AWR Altenwohn- und Pflegeheim)

Publications

-None-

Acknowledgements

First of all I want to thank Prof. Dr. Thomas Winkler for giving me the

opportunity to work in his lab and the patience to accept my programing

e�ort that sometimes may have looked like a big waste of time, but in the end

proved to be necessary work. He always kept the overview and directed my

e�orts towards the laboratory work. Great respect for his acceptance of my

familiar duties that mostly kept me from evening lectures. Thanks to trust

my capabilities for these four years.

In addition I want to thank for all the additional chances to develop my till

then rather rudimentary soft-skills. My thanks for this very time intensive

work goes to Prof. Dr. Thomas Winkler, Prof. Dr. Georg Fey and the

Graduate College. Especially Thomas had a lot of support and help about

the changes that have to take place to render my talks understandable.

Furthermore, I like to thank the supervisor of the Graduate College Prof. Dr.

Hans-Martin Jäck for his great e�ort to create a community feeling between

the members of the College establishing retreats and workshops. Additional

thanks to my PhD advisory committee Prof. Dr. Dr. André Gessner and PD.

Dr. Reinhard Voll that had much interest and support for my work.

Thanks goes to all (former) members of the Winkler lab, as there were Dr. Ute

Wellmann, Florian Weisel, Sven Wach, Sven Brenner, Sonja Misch, Marcello

Stein, Kristin Kruse, Bastian Hammer, Florian Sprater, Heike Welsel, Andrea

Schneider and Sabine Manz. All these people most of the time had an open

ear if things got depressing or I just had to tell the (PhD) stories to come

to new aspects. Special thanks to Bastian Hammer, Marcello Stein, Florian

Sprater and Kristin Kruse, who helped in this work. An additional thank goes

to Bastian Hammer, who made it clear, that Real-Time PCR is no option to

evaluate the ChIP precipitates and Florian Weisel, who had no problems to

share his cultured cells with me.

At last I want to thank the open source community for creating such wonder-

ful programs and programming languages, as I mainly relied on open source

software. I used the Perl programing language, the Emboss sequence manip-

ulation package and several other programs to evaluate my results and �nally

also on the LATEX document markup language to write this thesis.

Appdx A

A.1 Multiple Alignment of the Three IVAR Elements

The sequences of al three IVAR elements are aligned using the clustalw program.

139

10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|Consensus TACGTTGATGGATTTCTGTATATTAAACCATCCCTGCATCCCTTGAATGAAACCTGCTTTCTGACCTTTGTGAGCAGAAATTTAACAAGCATCATCTAATCTTAAAACGCCTGTAGTTCAGCTATGTTGATTCACATTAGGAGATAAATGACGCTTTGGCATGGCTGTGGAAGGGGAATTTTGACACAGTIVAR#1 ...................................A.....................................A................................................................C............T......................................IVAR#2 .............................................................................T.............................G......G.G.........................................................................IVAR#3 ..............................................T...............................................................................................................................................Consensus TACGTTGATGGATTTCTGTATATTAAACCATCCCTGCATCCCTTGAATGAAACCTGCTTTCTGACCTTTGTGAGCAGAAATTTAACAAGCATCATCTAATCTTAAAACGCCTGTAGTTCAGCTATGTTGATTCACATTAGGAGATAAATGACGCTTTGGCATGGCTGTGGAAGGGGAATTTTGACACAGT

200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|Consensus TCCTGGCACTGGAGCATTGTTTCCCATTGATCCCCATATTCCCCATGTGTGCTGATGACTGCTCTTGGCTTGAAATTGATCTACTCTTGGCTACTTTACTGTCAATCTCTCTTTCTGGGGAATACACTTCTCTTCATTACTCAGAGCAAATCACTCCATAATAAATGAAACACATGTGCTTCTCACGAATIVAR#1 ...............................................................................................................C..............................................................................IVAR#2 .........................................................................................A.............................T...................A..................................................IVAR#3 ......................................C....TT..........................A.....A..............................................................................................................G.Consensus TCCTGGCACTGGAGCATTGTTTCCCATTGATCCCCATATTCCCCATGTGTGCTGATGACTGCTCTTGGCTTGAAATTGATCTACTCTTGGCTACTTTACTGTCAATCTCTCTTTCTGGGGAATACACTTCTCTTCATTACTCAGAGCAAATCACTCCATAATAAATGAAACACATGTGCTTCTCACGAAT

390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|Consensus GAGGAATGGAGTTGGCCnTGAGGCTGTAGAGGATAAGGACAAGGATTTCTTCTTGGCATTTATGGCCATGAGAACAGATCTAGACAACATAATCACAAAGGACATAAAAGCCAACATGCTCCTTTGTAGAAATAGTTCATTGACTTGAAATTGGAAACATAAGGAGATACATGTACCCTCCCGTACAATGIVAR#1 .....G...........A.........C.G.................................A......................................................................T.......................................................IVAR#2 .................C.....................A..........................................A.............................................................................................AT............IVAR#3 .................G.............................................................................................A..................................A...........................................Consensus GAGGAATGGAGTTGGCCnTGAGGCTGTAGAGGATAAGGACAAGGATTTCTTCTTGGCATTTATGGCCATGAGAACAGATCTAGACAACATAATCACAAAGGACATAAAAGCCAACATGCTCCTTTGTAGAAATAGTTCATTGACTTGAAATTGGAAACATAAGGAGATACATGTACCCTCCCGTACAATG

580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|Consensus ACTGCTGTATTAATTTGCCAGGATTAACTTGGGGATATCAAGGATAGAGAGTGAAAGTGGTCTCAAGATTAAAAGGCATGAATAGAAAAAAAAAAGGAATTTATAAAATACAAGCAAATGACAGATTCATTTCATAGGAGAAATATATATATAnAnACAnnnnnnCAAATAATATTTGAAGGAGATTAGAIVAR#1 ...............................................................................A............---..........................................................------------.........................IVAR#2 ...................................................G..........................................................................................G..........T.T...------.....G...................IVAR#3 ....................T...G........................................G..............................A..........................................T.T.C.C.C.C.C.C.C...CACACA................C........Consensus ACTGCTGTATTAATTTGCCAGGATTAACTTGGGGATATCAAGGATAGAGAGTGAAAGTGGTCTCAAGATTAAAAGGCATGAATAGAAAAAAAAAAGGAATTTATAAAATACAAGCAAATGACAGATTCATTTCATAGGAGAAATATATATATAnAnACAnnnnnnCAAATAATATTTGAAGGAGATTAGA

770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|Consensus CTAGGTTATGGAATCTTTAGGATGAGGAAATAAAGATTAGAGAACTTTAAAGACGAGGAACAAGCATGCAAACAGTTAGTAGTTTGTTCTCCTAGTTACTTGTAGGATTTGCGATGACAATGCTTAnAGAGATATTAGCAATAGCTGGCTGGCCTTACATGCGTAAAATTAAAAACTTGGTAAAAATTCAIVAR#1 .....................................................T........................................................................A...............................................................IVAR#2 .........................................................A....................C.G.............................................G...............................................................IVAR#3 .........A........................................................................---------------------------------------------..........................T..................C.......-G........Consensus CTAGGTTATGGAATCTTTAGGATGAGGAAATAAAGATTAGAGAACTTTAAAGACGAGGAACAAGCATGCAAACAGTTAGTAGTTTGTTCTCCTAGTTACTTGTAGGATTTGCGATGACAATGCTTAnAGAGATATTAGCAATAGCTGGCTGGCCTTACATGCGTAAAATTAAAAACTTGGTAAAAATTCA

960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|Consensus TTTCTGTTCTTACATGAAAATAGTTACTAAGGTCTGTGnTCTGCTATACCACTAAATCACAAGAGCATAnAAAAGTAGTTTGTTCTCCTAGTTACTTGTAGGATTCAGGATGATAATGCTTAGAGAGATATTAAAGAGAGCTGGCTTGCTTTACCTGnATAAAnTTAAAATCTTnGTAnAAAATCATTTCIVAR#1 ...............................A......--------------------------------------------------------------------------------------------------------------------------------------------------------IVAR#2 ......................................A..............................C.......................................................................................A.....A..........A...C...........IVAR#3 ......................................T..............................A.......................................................................................C.....T..........G...A...........Consensus TTTCTGTTCTTACATGAAAATAGTTACTAAGGTCTGTGnTCTGCTATACCACTAAATCACAAGAGCATAnAAAAGTAGTTTGTTCTCCTAGTTACTTGTAGGATTCAGGATGATAATGCTTAGAGAGATATTAAAGAGAGCTGGCTTGCTTTACCTGnATAAAnTTAAAATCTTnGTAnAAAATCATTTC

1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|Consensus TGTTCTTACATnAAAACAGTTACTAAGGTCTGTGGTCTACTGTACCACAAAGTCACAAGAGCTGTGCCCAGCTATCAGTGAAGAATAGGCTGTGTAACTCCTATAAGGAAATGTTATTTTGCTTTGTTTTTAGTTTTTTTTTTTnTTTTAAGGAAGCAGGGGTTGGAGCTTCGATCATAGATTTTATGTAIVAR#1 ----------------------------------.....................................G........................................................................C................T..........A.................IVAR#2 ...........T...................................................................................................................G................-.............T...............................IVAR#3 ...........G..................................................................................................................................C.--............................................Consensus TGTTCTTACATnAAAACAGTTACTAAGGTCTGTGGTCTACTGTACCACAAAGTCACAAGAGCTGTGCCCAGCTATCAGTGAAGAATAGGCTGTGTAACTCCTATAAGGAAATGTTATTTTGCTTTGTTTTTAGTTTTTTTTTTTnTTTTAAGGAAGCAGGGGTTGGAGCTTCGATCATAGATTTTATGTA

1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|Consensus AATTTAAGGATTTTTAAAATAACTATTAATAATGATCAAAGTCTTATGATTAGCTTTAGTAGATAAAAGACTTGCTTCAGGCTCTTTGGATGGGAGAAAGAATGAAAAGACAGAAGGCAAAAGAATGGGAGAAAGCAGGAAGGCAAAGGCATGAGAAGAGAACATGGAAGAATGATAAGAATCCTTGGATIVAR#1 ....................T.....................--....................................T...A..........T..............................................................................................IVAR#2 ........................................A.....................................................................................................................................................IVAR#3 ..........................................................................................C...................................................................................................Consensus AATTTAAGGATTTTTAAAATAACTATTAATAATGATCAAAGTCTTATGATTAGCTTTAGTAGATAAAAGACTTGCTTCAGGCTCTTTGGATGGGAGAAAGAATGAAAAGACAGAAGGCAAAAGAATGGGAGAAAGCAGGAAGGCAAAGGCATGAGAAGAGAACATGGAAGAATGATAAGAATCCTTGGAT

1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|Consensus AAAGAGAGAGCACTTGAACACACCCCTTGCATCCACTACTGTGACCCAGAGTAATTATAGAGTTAGnnnnAGCCACTCTCATTTCCACCTTGCTTCAAGACCTACCTCACACTCATGTGGACCTCTGCACTGTGTGACGIVAR#1 ......................G.............................C.............TTAG..A..................................................................IVAR#2 ............................A.....................................----...........................................................G.........IVAR#3 ..................................................................----.....G...............................................................Consensus AAAGAGAGAGCACTTGAACACACCCCTTGCATCCACTACTGTGACCCAGAGTAATTATAGAGTTAGnnnnAGCCACTCTCATTTCCACCTTGCTTCAAGACCTACCTCACACTCATGTGGACCTCTGCACTGTGTGACG

A.2 IMGT Tag to GenBank Conversion


The Conversion Table used.

IMGT feature tag GenBank feature tag

(DJ)-C-CLUSTER misc_sequence

(DJ)-J-C-CLUSTER misc_sequence

(DJ)-J-CLUSTER misc_sequence

(VDJ)-C-CLUSTER misc_sequence

(VDJ)-J-C-CLUSTER misc_sequence

(VDJ)-J-CLUSTER misc_sequence

(VJ)-C-CLUSTER misc_sequence

(VJ)-J-C-CLUSTER misc_sequence

(VJ)-J-CLUSTER misc_sequence

1st-CYS misc_sequence

2nd-CYS misc_sequence

3'D-SPACER misc_sequence

C-LIKE-DOMAIN gene

C-REGION C_region

C-SEQUENCE C_region

CAAT_SIGNAL CAAT_signal

CAP_SITE misc_sequence

CDR1 misc_sequence

CDR1-IMGT misc_sequence

CDR2 misc_sequence


CDR3 misc_sequence


CH-S C_region

CH-SD misc_sequence

CH-T misc_sequence

CH-X misc_sequence

CH1 C_region

CH1D exon

CH2 C_region

CH2D exon

CH3 C_region

CH3D exon

CH4 C_region

CH4D exon

CH5 C_region

CH6 C_region

CH7 C_region

CL exon

141

A. APPDX A


CONSERVED-TRP misc_sequence

CYTOPLASMIC-REGION misc_sequence

D-(DJ)-C-CLUSTER misc_sequence

D-(DJ)-CLUSTER misc_sequence

D-(DJ)-J-C-CLUSTER misc_sequence

D-(DJ)-J-CLUSTER misc_sequence

D-CLUSTER misc_sequence

D-J-C-CLUSTER misc_sequence

D-J-C-SEQUENCE misc_sequence

D-J-CLUSTER misc_sequence

D-J-GENE misc_sequence

D-J-REGION misc_sequence

D-J-SEQUENCE misc_sequence

D-REGION D_segment

D-SEQUENCE D_segment

ENHANCER enhancer

EX1 exon

EX2 exon

EX2A exon

EX2B exon

EX2C exon

EX2R exon

EX2T exon

EX3 exon

EX4 exon

EXON exon

FR1 misc_sequence

FR1-IMGT misc_sequence

FR2 misc_sequence


FR3 misc_sequence



GENE gene

INIT-CODON misc_sequence

INIT-CONS misc_sequence

INSERTION misc_recomb

INT-DONOR-SPLICE misc_signal

INTERNAL-HEPTAMER misc_signal

J-C-CLUSTER misc_sequence

J-C-INTRON misc_sequence

J-C-REGION misc_sequence

142



J-C-SEQUENCE misc_sequence

J-CLUSTER misc_sequence

J-PHE misc_sequence

J-REGION J_segment

J-TRP misc_sequence

JUNCTION misc_sequence

L-INTRON-L misc_sequence

L-PART1 V_segment

L-REGION misc_sequence

L-V-D-J-C-REGION misc_sequence

L-V-D-J-C-SEQUENCE misc_sequence

L-V-D-J-REGION misc_sequence

L-V-D-REGION misc_sequence

L-V-D-SEQUENCE misc_sequence

L-V-J-C-REGION misc_sequence

L-V-J-C-SEQUENCE misc_sequence

L-V-J-REGION misc_sequence

L-V-REGION misc_sequence

L-V-SEQUENCE misc_sequence

LINKER misc_sequence

MISC_FEATURE misc_sequence

N-AND-D-J-REGION misc_sequence

N-AND-D-REGION misc_sequence

N-GLYCOSYLATION-SITE misc_sequence

N-REGION misc_sequence

N1-REGION misc_sequence




OCTAMER enhancer

P-REGION misc_sequence

PENTADECAMER misc_sequence

POLYA_SIGNAL polyA_signal

PYR-RICH misc_sequence

SILENCER terminator

STERILE-TRANSCRIPT misc_sequence

STOP-CODON misc_sequence

TATA_BOX TATA_signal

TRANSMEMBRANE-REGION misc_sequence

UNSURE unsure

V-(DJ)-C-CLUSTER misc_sequence

V-(DJ)-CLUSTER misc_sequence

143

A. APPDX A


V-(DJ)-J-C-CLUSTER misc_sequence

V-(DJ)-J-CLUSTER misc_sequence

V-(VDJ)-C-CLUSTER misc_sequence

V-(VDJ)-CLUSTER misc_sequence

V-(VDJ)-J-C-CLUSTER misc_sequence

V-(VDJ)-J-CLUSTER misc_sequence

V-(VJ)-C-CLUSTER misc_sequence

V-(VJ)-CLUSTER misc_sequence

V-(VJ)-J-C-CLUSTER misc_sequence

V-(VJ)-J-CLUSTER misc_sequence

V-CLUSTER misc_sequence

V-D-(DJ)-C-CLUSTER misc_sequence

V-D-(DJ)-CLUSTER misc_sequence

V-D-(DJ)-J-C-CLUSTER misc_sequence

V-D-(DJ)-J-CLUSTER misc_sequence

V-D-EXON misc_sequence

V-D-GENE misc_sequence

V-D-J-C-CLUSTER misc_sequence

V-D-J-C-REGION misc_sequence

V-D-J-CLUSTER misc_sequence

V-D-J-EXON misc_sequence

V-D-J-GENE misc_sequence

V-D-J-REGION misc_sequence

V-D-REGION misc_sequence

V-J-C-CLUSTER misc_sequence

V-J-C-REGION misc_sequence

V-J-CLUSTER misc_sequence

V-J-EXON misc_sequence

V-J-GENE misc_sequence

V-J-REGION misc_sequence

V-LIKE-DOMAIN misc_sequence

V-REGION V_segment

scFv misc_sequence

A.3 Mean Enrichment Factor and SEM of All Analyzed Gene Starts

In the table the feature name, the start and end positions of the analyzed regions are men-

tioned. The positions resemble positions in the regions analyzed. The table is sorted by

the mean enrichment factor in the H3Ac precipitated, proB cell speci�c ChIP experiments.

144

DC H3K4Me2 preB IL7 H3K4Me2 proB H3Ac proB H3K4Me2 proB H3K9Me3 proB IL7 H3Ac proB IL7 H3K4Me2 proT H3Ac proT H3K4Me2 proT H3K9Me3feature name start [bp] end [bp] mean SEM mean SEM mean SEM mean SEM mean SEM mean SEM mean SEM mean SEM mean SEM mean SEM

Pax5 225864 226364 0.91 0.08 2.11 0.15 2.76 0.07 1.8 0.06 0.81 0.05 3.37 0.1 0.93 0.13 0.32 0.05 0.03 0.03 0.07 0.04Lambda5 34350 34850 0.2 0.05 0.72 0.19 2.04 0.09 1 0.05 0.21 0.06 2.19 0.17 0.81 0.14 0.19 0.04 0.06 0.03 0.08 0.05

Rag1 53686 54186 0.4 0.06 1.15 0.12 1.79 0.08 1.36 0.06 -0.35 0.04 1.83 0.14 -0.13 0.08 1 0.13 0.84 0.09 -0.01 0.07Vpreb2 51524 52024 -0.02 0.04 1.07 0.1 1.73 0.07 1.1 0.04 0.28 0.04 2.19 0.1 0.54 0.09 0.1 0.03 0.04 0.02 -0.18 0.03Vpreb1 39593 40093 -0.1 0.03 0.98 0.12 1.72 0.06 1.02 0.05 0.26 0.04 2.02 0.11 0.6 0.09 0.05 0.03 0 0.03 -0.21 0.03Dad1 1773302 1773802 1.73 0.07 1.47 0.15 1.68 0.07 1.69 0.07 -0.5 0.06 1.97 0.11 0.53 0.1 1 0.14 0.64 0.08 -0.2 0.07Hnrpc 203812 204312 1.14 0.14 0.88 0.26 1.66 0.11 0.95 0.09 -0.11 0.06 1.41 0.2 0.57 0.14 0.79 0.13 0.46 0.08 -0.11 0.05Rag2 29433 29933 0.35 0.03 1.8 0.14 1.43 0.04 1.39 0.05 -0.41 0.04 1.96 0.07 0.37 0.07 1.03 0.11 0.63 0.07 -0.1 0.05

5730589K01Rik 379751 380251 0.62 0.1 0.68 0.19 1.41 0.1 0.93 0.09 0.2 0.06 1.04 0.15 0.79 0.09 0.29 0.09 0.21 0.05 -0.1 0.074930427A07Rik 132567 133067 1.29 0.14 1.1 0.26 1.32 0.1 1.5 0.11 -0.07 0.07 1.14 0.16 0.53 0.12 0.4 0.1 0.57 0.09 -0.17 0.05

Zfp219 120351 120851 1.26 0.08 1.48 0.18 1.32 0.08 1.34 0.08 -0.23 0.05 1.13 0.12 0.6 0.09 0.62 0.09 0.56 0.07 -0.05 0.05Abhd4 1779227 1779727 1.81 0.05 1.53 0.16 1.26 0.04 1.89 0.06 -0.93 0.07 0.68 0.06 0.17 0.11 0.74 0.1 0.74 0.08 -0.13 0.05Crip1 128199 128699 1.02 0.09 1.52 0.19 1.13 0.08 1.39 0.1 -0.22 0.06 1.26 0.14 0.53 0.09 0.59 0.11 0.5 0.06 -0.12 0.05Hoxa3 156179 156679 1.43 0.06 2.33 0.15 1.12 0.06 1.63 0.06 -0.21 0.07 0.77 0.05 0.58 0.11 0.2 0.07 0.44 0.05 -0.21 0.05Mettl3 404690 405190 0.72 0.07 0.23 0.2 1.12 0.06 0.96 0.06 0.13 0.06 0.92 0.09 0.16 0.13 0.36 0.07 0.36 0.06 -0.1 0.09Rab2b 378936 379436 1.04 0.08 1.08 0.16 1.11 0.09 1.09 0.06 -0.27 0.05 0.69 0.13 0.51 0.09 0.49 0.1 0.38 0.06 -0.15 0.08

E130112L23Rik 85680 86180 1.62 0.13 1.45 0.28 1.06 0.08 1.16 0.09 0.35 0.05 0.72 0.11 0.35 0.12 0.4 0.08 0.68 0.09 -0.02 0.055230400G24Rik 554026 554526 0.75 0.09 0.48 0.18 0.96 0.1 0.87 0.08 0.25 0.03 0.94 0.16 0.22 0.06 0.37 0.09 0.39 0.05 -0.02 0.05

Top3b 41734 42234 0.76 0.08 0.34 0.13 0.93 0.07 0.9 0.07 -0.03 0.04 1.01 0.14 0.44 0.07 0.46 0.09 0.38 0.06 -0.22 0.07Slc7a7 1934010 1934510 0.49 0.07 0.93 0.19 0.92 0.06 0.83 0.05 0.05 0.05 0.37 0.11 0.02 0.11 0.04 0.04 -0.01 0.03 -0.11 0.06Zfp386 24022 24522 0.78 0.11 0.64 0.17 0.89 0.08 0.88 0.07 -0.07 0.06 0.8 0.15 0.57 0.07 0.46 0.1 0.36 0.07 -0.14 0.05Ephb6 937670 938170 0.54 0.07 1.03 0.27 0.88 0.09 0.98 0.09 0.06 0.05 0.76 0.14 0.74 0.14 0.38 0.11 0.57 0.09 -0.25 0.04Ndrg2 7276 7776 0.98 0.07 0.18 0.17 0.86 0.04 0.98 0.07 0.04 0.04 0.26 0.06 -0.36 0.12 0.23 0.07 0.4 0.06 -0.21 0.06Rem2 1993513 1994013 0.79 0.06 0.49 0.1 0.86 0.05 1.03 0.07 0.02 0.05 0.41 0.05 0.18 0.12 0.08 0.04 0.07 0.03 -0.34 0.04Zfp386 3316580 3317080 0.73 0.11 0.59 0.17 0.85 0.08 0.84 0.07 -0.05 0.06 0.75 0.14 0.57 0.07 0.44 0.1 0.35 0.07 -0.13 0.05

2510002D24Rik 7633 8133 0.61 0.09 0.29 0.19 0.8 0.08 0.73 0.08 0.3 0.06 0.62 0.11 0.52 0.16 0.26 0.08 0.24 0.06 -0.13 0.044930572I07Rik 272571 273071 0.44 0.07 0.09 0.14 0.7 0.06 0.6 0.06 0.18 0.06 0.63 0.09 0.31 0.06 0.09 0.06 0.21 0.05 -0.22 0.04

Mmp14 1948547 1949047 0.61 0.07 0.04 0.19 0.69 0.07 0.58 0.07 0.31 0.04 0.56 0.09 0.04 0.11 0.08 0.05 0.2 0.04 -0.15 0.06Hira 47802 48302 0.53 0.07 0.23 0.14 0.65 0.06 0.58 0.05 0.27 0.05 0.49 0.1 0.38 0.1 0.18 0.04 0.28 0.05 -0.13 0.04Hira 47802 48302 0.53 0.07 0.23 0.14 0.65 0.06 0.58 0.05 0.27 0.05 0.49 0.1 0.38 0.1 0.18 0.04 0.28 0.05 -0.13 0.04

1700028O09Rik 50685 51185 0.83 0.07 0.48 0.14 0.61 0.05 0.94 0.07 0.2 0.05 0.51 0.07 0.07 0.08 0.27 0.05 0.36 0.06 -0.12 0.05Vipr2 3340933 3341433 0.42 0.06 -0.04 0.13 0.57 0.05 0.54 0.03 0.28 0.05 0.49 0.06 0.66 0.18 0.11 0.04 0.25 0.04 -0.14 0.05Oxa1l 1877818 1878318 0.22 0.04 0.08 0.08 0.51 0.06 0.45 0.03 0.22 0.04 0.21 0.07 0.35 0.09 0.08 0.04 0.18 0.04 -0.06 0.07Hoxa10 178501 179001 0.23 0.05 -0.63 0.14 0.44 0.06 0.39 0.03 0.35 0.05 0.33 0.12 0.1 0.11 0.05 0.03 0.17 0.04 -0.25 0.05Mta1 74502 75002 0.18 0.15 -0.3 0.1 0.44 0.06 0.44 0.08 0.2 0.12 0.49 0.13 0.52 0.25 0.18 0.12 0.17 0.04 -0.16 0.13

Stard3nl 376616 377116 0.43 0.07 0.27 0.19 0.44 0.05 0.48 0.04 0.33 0.04 0.4 0.09 0.44 0.17 0.13 0.06 0.26 0.04 -0.09 0.04Irs1 126032 126532 0.15 0.04 -0.3 0.24 0.43 0.06 0.5 0.03 0.14 0.03 0.5 0.1 0.25 0.24 0.03 0.04 0.19 0.05 -0.29 0.06

LOC545840 101883 102383 0.12 0.04 -0.36 0.11 0.43 0.05 0.39 0.03 0.24 0.04 0.32 0.09 0.2 0.13 0 0.03 0.18 0.03 -0.26 0.06Olfr49 1801968 1802468 -0.03 0.04 -0.32 0.11 0.4 0.03 -0.32 0.03 -0.23 0.04 0.07 0.05 -0.97 0.08 0.09 0.04 -0.19 0.03 -0.49 0.08

LOC432852 357434 357934 0.34 0.06 -0.13 0.12 0.39 0.05 0.4 0.05 0.3 0.06 0.38 0.08 0.04 0.08 0.08 0.05 0.23 0.05 -0.18 0.04Gm77 12850 13350 -0.11 0.05 -0.48 0.17 0.39 0.05 -0.24 0.05 -0.28 0.05 -0.09 0.08 -0.71 0.12 0.09 0.06 -0.05 0.04 -0.12 0.05Hoxa1 101284 101784 0.84 0.08 0.93 0.17 0.39 0.06 0.78 0.04 -0.04 0.07 -0.02 0.11 0.52 0.14 0.05 0.05 0.23 0.04 -0.08 0.06Traf6 83125 83625 0.25 0.05 -0.46 0.09 0.38 0.05 0.3 0.03 0.37 0.06 0.22 0.09 0.06 0.12 0.08 0.03 0.18 0.03 -0.13 0.08Hoxa7 161685 162185 0.18 0.04 0.38 0.09 0.38 0.03 0.91 0.03 -0.29 0.04 0.01 0.05 -0.17 0.06 0.06 0.04 0.19 0.04 -0.06 0.07

2600010E01Rik 145563 146063 0.12 0.04 -0.34 0.13 0.37 0.04 -0.06 0.04 0.09 0.05 0.23 0.07 0.08 0.16 0.04 0.03 -0.04 0.03 -0.15 0.05LOC544675 337179 337679 0.32 0.05 -0.1 0.12 0.37 0.06 0.14 0.03 0.45 0.06 0.29 0.08 0.66 0.14 0.13 0.04 0.09 0.03 -0.12 0.05

Grhpr 497335 497835 0.41 0.05 0.07 0.13 0.37 0.05 0.52 0.04 0.25 0.04 0.33 0.08 0.37 0.09 0.06 0.04 0.23 0.04 -0.14 0.04Mrpl40 47189 47689 0.38 0.08 -0.01 0.19 0.35 0.07 0.43 0.04 0.35 0.08 0.35 0.1 0.31 0.15 0.06 0.05 0.2 0.05 -0.13 0.04Hoxa9 170932 171432 -0.1 0.05 0.24 0.08 0.35 0.04 0.79 0.04 -0.05 0.04 -0.09 0.06 -0.25 0.09 -0.18 0.04 -0.15 0.05 -0.22 0.06

LOC545051 1699945 1700445 0.12 0.05 0.26 0.13 0.33 0.05 0.13 0.03 0.02 0.06 0.17 0.06 0.35 0.11 0.04 0.03 -0.01 0.03 -0.1 0.05Supt16h 296808 297308 0.18 0.03 -0.21 0.06 0.33 0.04 0.49 0.03 0.1 0.03 0.33 0.06 0.49 0.08 0.01 0.04 0.19 0.04 -0.15 0.05Mrpl52 1943740 1944240 0.23 0.05 -0.23 0.1 0.33 0.05 0.45 0.04 0.24 0.04 0.22 0.09 0.34 0.13 0.03 0.03 0.22 0.04 -0.15 0.06Hoxa4 134616 135116 0.21 0.05 -0.03 0.12 0.31 0.05 0.48 0.04 0.08 0.04 0.3 0.08 0.49 0.11 0.1 0.04 0.17 0.04 -0.17 0.05Hoxa11 189281 189781 0.18 0.04 0.09 0.14 0.3 0.05 0.54 0.04 0.1 0.04 0.37 0.08 0.63 0.12 -0.06 0.04 0.2 0.03 -0.24 0.05

Hrb 668591 669091 0.25 0.05 -0.2 0.11 0.3 0.05 0.4 0.03 0.28 0.05 0.24 0.06 0.44 0.12 0.04 0.03 0.15 0.03 -0.16 0.05Crip2 116719 117219 0.16 0.05 -0.26 0.07 0.28 0.04 0.47 0.03 0.13 0.03 0.16 0.07 0.11 0.08 -0.06 0.02 0.14 0.03 -0.16 0.04Sall2 428277 428777 0.55 0.04 -0.06 0.07 0.27 0.04 0.33 0.03 -0.3 0.04 0.12 0.04 -0.14 0.08 0.12 0.05 0.14 0.03 -0.08 0.05

I


Col4a3 416084 416584 0.21 0.05 -0.15 0.14 0.27 0.04 0.26 0.03 0.16 0.04 0.06 0.07 0.28 0.13 0.06 0.03 0.14 0.03 -0.1 0.04Lrp10 1981558 1982058 0.12 0.03 -0.33 0.1 0.26 0.04 0.44 0.03 0.16 0.03 0.24 0.06 0.21 0.1 -0.01 0.03 0.22 0.03 -0.2 0.05Hoxa6 151736 152236 0.07 0.04 -0.15 0.07 0.23 0.03 0.53 0.03 0.17 0.04 0.04 0.06 0.17 0.06 -0.1 0.03 0.14 0.03 -0.06 0.05Nrbf2 659496 659996 -0.15 0.05 -0.6 0.09 0.23 0.04 0.21 0.03 0.05 0.04 0.1 0.07 -0.11 0.07 0.03 0.04 0.08 0.03 -0.22 0.05Chd8 322228 322728 -0.17 0.04 -0.55 0.09 0.22 0.04 -0.3 0.03 0.71 0.04 0 0.05 -0.43 0.1 0.03 0.04 -0.15 0.04 0.02 0.05Trpv6 967937 968437 0.17 0.03 -0.2 0.1 0.22 0.04 0.22 0.03 0.12 0.05 0.11 0.07 0.21 0.09 0.02 0.03 0.1 0.03 -0.05 0.05

MGC60843 3259476 3259976 0.22 0.07 0.26 0.28 0.21 0.07 0.08 0.07 -0.1 0.04 -0.09 0.08 -0.38 0.23 -0.06 0.04 -0.07 0.04 -0.09 0.06Olfr1511 490378 490878 0.78 0.03 0.67 0.11 0.2 0.03 0.88 0.03 -0.67 0.04 0.12 0.05 -0.3 0.11 0.05 0.04 0.16 0.02 -0.38 0.04Ppm1f 74121 74621 0.19 0.03 -0.35 0.07 0.18 0.03 0.26 0.03 0.11 0.04 -0.09 0.05 0.07 0.08 0 0.03 0.05 0.04 -0.16 0.04

LOC213480 1238575 1239075 -0.28 0.05 0.29 0.1 0.17 0.03 -0.05 0.03 -0.3 0.05 0.26 0.07 -0.34 0.09 0.17 0.03 -0.03 0.03 -0.21 0.05LOC436474 1249417 1249917 -0.11 0.03 -0.21 0.06 0.16 0.02 0.05 0.02 -0.27 0.03 0.19 0.04 -0.11 0.08 0 0.03 -0.17 0.03 -0.09 0.03

Col4a4 415400 415900 0.08 0.05 -0.21 0.07 0.16 0.05 0.15 0.03 0.16 0.05 0.02 0.08 0.27 0.07 -0.01 0.03 0.11 0.02 -0.04 0.06Hoxa2 107829 108329 0.44 0.05 -0.05 0.09 0.15 0.04 0.41 0.03 0.03 0.04 0.06 0.07 0.66 0.12 -0.03 0.04 0.15 0.04 -0.11 0.06

Olfr1510 510477 510977 0.65 0.03 0.68 0.09 0.15 0.04 0.78 0.03 -0.67 0.04 0.09 0.05 -0.22 0.09 0.04 0.03 0.14 0.02 -0.33 0.04LOC232077 3587563 3588063 0.05 0.03 -0.4 0.06 0.14 0.03 0.32 0.03 0.16 0.03 0.12 0.06 0.07 0.08 -0.04 0.03 0.21 0.04 -0.13 0.05LOC545048 170159 170659 0.02 0.07 0.91 0.17 0.13 0.05 -0.2 0.05 -0.42 0.03 0.14 0.1 -0.03 0.19 0.09 0.04 -0.17 0.04 -0.41 0.06

Olfr165 580021 580521 -0.11 0.05 -0.08 0.09 0.12 0.05 -0.38 0.03 -0.05 0.04 0.25 0.06 -0.53 0.09 -0.17 0.05 -0.1 0.03 -0.21 0.055730596B20Rik 120996 121496 -0.12 0.03 -0.16 0.09 0.11 0.04 0.12 0.03 -0.07 0.05 0.05 0.08 -0.13 0.09 0.02 0.04 0.1 0.03 -0.14 0.052210010C04Rik 377918 378418 0.05 0.07 -0.31 0.44 0.09 0.09 -0.17 0.12 0.19 0.08 -0.07 0.12 -0.5 0.4 0.01 0.07 0.06 0.05 0.06 0.09

Trpv5 992146 992646 -0.01 0.05 -0.44 0.16 0.09 0.05 -0.34 0.04 -0.31 0.07 -0.13 0.07 -0.75 0.1 -0.05 0.03 -0.17 0.04 -0.29 0.07LOC435887 129185 129685 0.13 0.06 -0.14 0.1 0.08 0.06 -0.19 0.05 0 0.07 0.17 0.08 0.03 0.12 0.04 0.04 -0.02 0.03 0.11 0.05

Hoxa5 147648 148148 0.2 0.06 0.04 0.11 0.08 0.05 0.37 0.03 0.25 0.05 -0.48 0.11 0.48 0.1 -0.03 0.03 0.08 0.04 0.01 0.05Rpgrip1 211023 211523 -0.12 0.07 -0.44 0.16 0.08 0.08 -0.1 0.04 0.06 0.09 -0.02 0.12 -0.26 0.15 0.04 0.04 -0.06 0.04 0.09 0.08

A730076H11Rik 1292122 1292622 0.16 0.03 -0.09 0.07 0.07 0.03 0.09 0.02 -0.31 0.03 0.33 0.05 -0.16 0.06 0.12 0.03 -0.03 0.02 0.01 0.05Olfr221 135821 136321 -0.13 0.04 -1.27 0.1 0.06 0.03 -0.36 0.05 -0.58 0.06 -0.33 0.07 -0.77 0.11 0.07 0.03 -0.15 0.03 -0.32 0.07Ufd1l 5288 5788 -0.04 0.03 -0.01 0.08 0.05 0.04 -0.02 0.04 0.09 0.04 -0.14 0.12 0.17 0.08 0.09 0.03 -0.03 0.03 0.02 0.04

LOC382645 373910 374410 0 0.05 -0.1 0.09 0.04 0.05 0.02 0.03 0.01 0.05 -0.04 0.08 0.05 0.09 -0.07 0.03 0.07 0.04 -0.06 0.05Igh 1702694 1703194 -0.08 0.04 0.43 0.11 0.01 0.03 0.4 0.04 -0.42 0.04 0.16 0.05 -0.06 0.1 -0.06 0.03 -0.05 0.03 0.1 0.06

Adam6 520612 521112 -0.23 0.03 -0.24 0.09 0 0.02 0.24 0.03 -0.52 0.03 0.06 0.03 -0.34 0.08 0.16 0.03 -0.16 0.03 -0.2 0.075330426L24Rik 1868004 1868504 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Try10l 713680 714180 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 01700020H15 242323 242823 0.02 0.05 -0.11 0.06 0 0.04 0 0.04 -0.11 0.04 0.02 0.06 -0.05 0.06 0.04 0.03 0.06 0.03 0.02 0.04

5730446D14Rik 110130 110630 -0.1 0.03 -0.12 0.07 0 0.05 -0.02 0.04 -0.25 0.04 0 0.05 0.11 0.08 0.09 0.03 -0.05 0.03 -0.01 0.06Rnase13 16605 17105 -0.09 0.07 -0.17 0.1 -0.01 0.06 -0.04 0.04 -0.6 0.08 -0.32 0.1 0.05 0.09 0.14 0.05 0.01 0.03 -0.16 0.06

LOC195281 913725 914225 -0.1 0.05 -0.37 0.08 -0.02 0.04 -0.03 0.04 -0.23 0.04 -0.01 0.05 0 0.09 0.01 0.03 -0.15 0.03 -0.11 0.04Olfr164 457293 457793 -0.12 0.03 -0.45 0.09 -0.02 0.04 -0.38 0.04 -0.22 0.03 -0.03 0.06 -0.53 0.09 -0.07 0.04 -0.22 0.03 -0.04 0.05Dmp1 38501 39001 -0.03 0.04 -0.27 0.06 -0.03 0.05 -0.03 0.03 -0.06 0.05 -0.17 0.06 0.07 0.11 -0.06 0.03 0.01 0.03 0.05 0.06

Trygn16 791192 791692 -0.12 0.04 0.03 0.08 -0.03 0.03 -0.18 0.03 -0.26 0.04 -0.21 0.07 0.01 0.07 -0.19 0.03 -0.14 0.05 -0.06 0.081700074P13Rik 282466 282966 0.15 0.04 -0.4 0.05 -0.04 0.05 -0.13 0.03 0.06 0.05 -0.1 0.07 -0.21 0.08 -0.04 0.03 0 0.02 -0.02 0.04

Prss2 853890 854390 0.25 0.04 -0.22 0.09 -0.05 0.03 -0.05 0.03 -0.23 0.05 -0.18 0.05 -0.22 0.11 -0.06 0.03 -0.09 0.03 0.03 0.05Zcchc7 440077 440577 0.01 0.04 0.01 0.08 -0.05 0.04 0.03 0.04 0.16 0.04 -0.03 0.05 0.15 0.09 -0.03 0.04 0 0.04 0.23 0.08

Ankrd12 607276 607776 0.01 0.04 0.1 0.09 -0.07 0.04 -0.32 0.06 -0.02 0.04 -0.29 0.07 -0.22 0.15 0.01 0.05 -0.13 0.05 0.09 0.05Olfr1512 472658 473158 -0.14 0.03 -0.16 0.08 -0.08 0.03 -0.19 0.04 -0.87 0.04 -0.55 0.06 -0.25 0.1 0.06 0.02 -0.14 0.03 -0.3 0.05

LOC434039 2373402 2373902 0.01 0.04 0.11 0.08 -0.09 0.06 0 0.03 0.32 0.05 -0.06 0.08 0.18 0.09 -0.01 0.03 0.08 0.03 0.19 0.05LOC545335 651719 652219 -0.15 0.03 -0.6 0.1 -0.09 0.05 -0.41 0.06 -0.37 0.04 -0.19 0.06 -0.86 0.15 -0.01 0.04 -0.07 0.03 -0.21 0.08

Moxd2 229430 229930 -0.2 0.04 -0.13 0.11 -0.09 0.03 -0.11 0.03 -0.41 0.04 -0.28 0.04 -0.45 0.09 0.04 0.03 0.08 0.03 -0.06 0.05Olfr1513 449651 450151 -0.25 0.03 -0.26 0.08 -0.1 0.04 -0.26 0.04 -0.97 0.05 -0.54 0.07 -0.3 0.1 0.04 0.03 -0.21 0.03 -0.31 0.05

LOC436569 812370 812870 -0.23 0.04 -0.21 0.07 -0.11 0.03 -0.12 0.03 -0.31 0.04 -0.12 0.04 -0.15 0.11 0.01 0.02 -0.02 0.03 -0.09 0.061810009J06Rik 307251 307751 0.03 0.05 -0.02 0.05 -0.12 0.05 -0.03 0.03 0.1 0.04 -0.07 0.07 0.1 0.05 -0.06 0.04 0.13 0.03 0.07 0.05

LOC194360 303662 304162 -0.25 0.04 0.25 0.1 -0.13 0.04 -0.22 0.03 -0.27 0.05 0.14 0.05 -0.02 0.11 -0.06 0.03 -0.09 0.03 0.17 0.054930418P06Rik 175435 175935 -0.04 0.06 -0.3 0.12 -0.14 0.05 -0.34 0.05 -0.69 0.06 -0.34 0.08 -0.45 0.16 0.1 0.03 -0.06 0.04 -0.21 0.04

LOC545834 144 644 -0.05 0.05 -0.32 0.12 -0.15 0.04 -0.12 0.03 -0.33 0.06 -0.08 0.05 -0.31 0.09 -0.15 0.03 -0.06 0.03 0.02 0.07Olfr1508 563614 564114 -0.21 0.04 -0.05 0.08 -0.17 0.04 -0.17 0.04 -0.57 0.04 -0.24 0.04 -0.19 0.16 -0.08 0.03 -0.13 0.03 -0.12 0.05

E130010M05Rik 281243 281743 -0.05 0.04 -0.09 0.04 -0.18 0.05 0.15 0.04 0.1 0.03 -0.2 0.06 0.27 0.06 -0.07 0.04 0.13 0.04 -0.03 0.05LOC545618 268564 269064 -0.15 0.08 -0.17 0.09 -0.18 0.07 -0.21 0.05 -0.05 0.07 -0.33 0.1 -0.43 0.09 0.03 0.04 -0.11 0.05 -0.13 0.06LOC384419 2417174 2417674 -0.1 0.04 0.34 0.12 -0.19 0.04 -0.15 0.03 -0.14 0.06 0.07 0.05 0.17 0.13 -0.07 0.04 0 0.04 0.09 0.05

Dspp 5489 5989 0.05 0.05 -0.12 0.05 -0.19 0.05 0.12 0.04 0.1 0.05 -0.19 0.05 0.38 0.1 -0.03 0.03 0.12 0.04 0.07 0.07

II


1810049H19Rik 657659 658159 -0.14 0.04 -0.34 0.1 -0.2 0.04 -0.06 0.04 -0.4 0.07 -0.21 0.06 -0.1 0.1 -0.02 0.03 0.05 0.03 -0.1 0.05Mgam 71189 71689 -0.14 0.04 -0.15 0.06 -0.21 0.04 -0.03 0.03 -0.39 0.06 -0.45 0.06 0.28 0.09 -0.01 0.03 -0.11 0.03 -0.11 0.05Amph 22374 22874 -0.08 0.03 -0.05 0.06 -0.23 0.04 0.03 0.03 -0.05 0.03 -0.24 0.05 0.1 0.06 -0.08 0.03 -0.03 0.03 -0.07 0.09

LOC545852 2420740 2421240 -0.16 0.05 -0.58 0.11 -0.25 0.05 -0.37 0.03 -0.29 0.05 -0.13 0.06 -0.85 0.13 -0.22 0.07 -0.15 0.03 -0.36 0.06LOC434166 2218032 2218532 -0.23 0.06 0.41 0.1 -0.26 0.09 -0.72 0.06 0.15 0.06 -0.05 0.09 -1.77 0.1 -0.12 0.11 -0.18 0.08 -1.02 0.09

Try4 645720 646220 -0.11 0.03 -0.39 0.1 -0.29 0.04 -0.13 0.03 -0.46 0.05 -0.24 0.05 -0.25 0.09 -0.1 0.03 -0.1 0.03 -0.03 0.051810018L02Rik 597064 597564 -0.08 0.03 -0.2 0.12 -0.31 0.04 -0.14 0.03 -0.51 0.05 -0.17 0.06 -0.16 0.16 -0.07 0.03 -0.13 0.03 -0.1 0.06

LOC381784 2512781 2513281 -0.16 0.04 0.21 0.09 -0.39 0.05 -0.25 0.04 -0.27 0.05 -0.34 0.06 0.12 0.14 -0.1 0.04 -0.09 0.03 -0.04 0.04Gm1077 1893769 1894269 -0.11 0.03 0.34 0.1 -0.44 0.05 -0.22 0.05 -0.32 0.06 -0.22 0.06 -0.05 0.11 -0.07 0.04 -0.04 0.04 -0.16 0.06Olfr1509 550522 551022 0.33 0.06 1.2 0.11 -0.46 0.04 0.5 0.04 -1.05 0.05 -0.29 0.05 -0.3 0.1 -0.07 0.05 0.11 0.04 -0.16 0.05

LOC545849 1607596 1608096 -0.32 0.03 0.47 0.09 -0.52 0.04 -0.37 0.04 -0.5 0.03 -0.25 0.05 -0.21 0.15 -0.12 0.05 -0.2 0.03 -0.13 0.06

III

A. APPDX A

A.4 Tabular Region of Interest Format Used for the Graphical Report

Program

#gbFilename,start,end,x axis title,picture title,picture filename,window size

Collagen,380000,450000,chromosomal orientation,collagen4_250,collagen4_250,250

Collagen,380000,450000,chromosomal orientation,collagen4_250,collagen4_500,500

DMP,0,60000,chromosomal orientation,dmp_250,dmp_250,250

DMP,0,60000,chromosomal orientation,dmp_250,dmp_500,500

pax5,180000,240000,chromosomal orientation,pax5_250,pax5_250,250

Rag,0,100000,chromosomal orientation,Rag_250,Rag_250,250

VpreB1,26000,70000,chromosomal orientation,VpreB1_250,VpreB1_250,250

VpreB2,40000,60000,chromosomal orientation,VpreB2_250,VpreB2_250,250

148

Documents

Epigenetic Regulation of V(D)J Recombination in Early B ... · verschlossen werden, wurde zusätzlich zu den mit zugänglichem Chromatin ko- rrelierten Modi kationen die Histon H3