Enhancer Activity of Upstream Hypersensitive Site 2 of the Chicken

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 269, No. 51, Issue of December 23, pp. 3256532571, 1994 Printed in U.S.A.

Enhancer Activity of Upstream Hypersensitive Site 2 of the Chicken P-Globin Cluster Is Mediated by GATA Sites*

(Received for publication, September 7, 1994)

Lynne V. AbruzzoS and Marc Reitman§ From the Diabetes Branch, NIDDK, National Institutes of Health, Bethesda, Maryland 20892-1770

Upstream of the chicken P-globin gene cluster are four DNase I-hypersensitive sites (HS1-t). Hypersensitive sites located upstream of the mammalian P-globin clusters have enhancer activity and mediate position-independent gene expression. In contrast, a region inside the chicken cluster has enhancer activity and mediates position-independent expression. Here we investigate the function of the chicken upstream sites, which are different from the mammalian ones in sequence, number, and distance from the genes. Each was tested for its effect on reporter gene expression in transfected primary erythroid cells. HS2 and HS3 (4.4 and 6.4 kilobases upstream of pglobin) showed significant enhancer activity while HS1 and HS4 (1.6 and 11 kilobases upstream of pglobin) did not. A 237-base pair region of HS2 contained the sequences necessary for enhancer activity. Proteins from erythroid extracts bound HS2 in seven different regions; six of these sites were characterized. GATA-1 bound to four of the sites. Each site contributed to the enhancer activity of HS2. Two other sequences bound proteins that may be related to Spl and erythroid kriippel-like factor. Surprisingly, mutations in these elements, which disrupted protein binding, did not affect enhancer activity. Thus, the observed enhancer activity of HS2 is due to the four GATA sites. The existence of multiple GATA sites in both chicken HS2 and the mammalian upstream sites may be due to evolution from a common element with preservation of only very short sequences or to convergent evolution. These observations highlight the crucial role for GATA proteins in globin regulation.

The expression of globin genes is believed to be regulated at two levels. First, the whole globin cluster (genes and flanking regions) is converted into an open chromatin configuration. This step is tissue specific but not developmental stage-specific. Next, individual globin genes are selected for transcription in a developmental stage-specific manner. This two-step process for gene activation is likely to apply to all genes but is amenable to study in gene clusters where cluster-specific and gene-specific events can be distinguished.

Comparing the regulation of the chicken and mammalian P-globin clusters is instructive since these clusters evolved in- dependently by gene duplications from a single ancestral P-glo-

Markey Charitable Trust. The costs of publication of this article were * This work was supported in part by Grant 93-9 from the Lucille P.

defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ Present address: University of Maryland Medical System, Dept. of Pathology, Baltimore, MD 21201.

dressed: National Institutes of Health, Diabetes Branch, Bldg. 10, Rm. 8 Lucille P. Markey Scholar. To whom correspondence should be ad-

85-239, Bethesda, MD 20892-1770. Tel.: 301-496-6090; Fax: 301-402- 0573; E-mail: [email protected].

bin (1). In the human cluster (5’-~-~y-*y-6+-3’), the five genes are arranged in order of developmental expression (2). In the chicken cluster (5‘-p-pH-pA+3’) the early embryonic genes flank the genes that are expressed later in development. Primi- tive lineage erythroid cells are produced from day 2 to 5 of embryogenesis and express the p and E genes. The definitive cells are produced from embryonic day 6 through adulthood and express the pH (until hatching) and PA genes (3).

Important regulatory functions reside in five DNase I-hypersensitive sites found 6-25 kilobases upstream of the human P-globin genes (4-6). These sites are required for high level and copy number-dependent, position-independent globin gene expression in transgenic mice. Elements that confer copy number dependence/position independence are said to possess locus control region activity. Locus control regions are believed to act by establishing an open, decondensed chromatin conformation that allows transcription. The upstream hypersensitive sites also are postulated to interact with the individual globin promoters in a competitive manner, resulting in developmental stage-specific expression (reviewed in Refs. 7-12).

DNase I-hypersensitive sites within and upstream of the chicken P-globin gene cluster also have been mapped (13, 14). One pan-erythroid site colocalized with a strong transcriptional enhancer found between the PA and E genes (15, 16). Choi and Engel have proposed that stage-specific globin expression is achieved by competition between the PA and E gene promoters for interaction with this enhancer (17, 18). This enhancer also confers position-independent expression (191, a property not found within the E to P region of the human cluster. The PA/. enhancer by itself is insufficient to open chromatin; it must interact with other elements (20).

The functions of the four upstream hypersensitive sites (HS ‘1-4) located approximately 1.6, 4.4, 6.4, and 11 kilobases 5‘ of the p gene have not been studied. Three of the sites (HS1-3) exhibit erythroid-specific hypersensitivity a t all stages of development and thus are expected to be important in cluster regulation. The sequences of these sites are not demonstrably similar to each other or to the sites upstream of the mammalian clusters (21). The 5’-most site, HS4, is hypersensitive in both erythroid and nonerythroid tissues. This site recently has been shown to function as an insulator or boundary element (22).

In this paper, we examine the contribution of the upstream hypersensitive sites to chicken P-globin gene transcription. When assayed for enhancer activity by transient expression, HS2 and HS3 showed significant enhancer activity while HS1 and HS4 did not. We focused our subsequent studies on HS2. A 237-bp region contained four GATA-1-binding sites that contributed to the enhancer activity, and two sites with putative Spl-like and EKLF (erythroid Kriippel-like factor)/CACD-like binding activities that did not contribute to enhancer activity.

The abbreviations used are: HS, DNase I hypersensitive site; EKLF,

bp, base pairb). erythroid kriippel-like factor; CAT, chloramphenicol acetyltransferase;

32565

32566 GATA Sites Mediate Enhancer Activity of Chicken HS2

EXPERIMENTAL PROCEDURES pPWAT (formerly pAcat (15)) is the expression vector into which all

deletion mutant and clustered point mutant constructs were inserted. pPACAT contains the chicken PA-globin gene promoter driving the chloramphenicol acetyltransferase (CAT) gene. In all the constructs described below, the test inserts were placed in theXbaI site 3' of the CAT gene. All mutated and polymerase chain reaction-generated regions were sequenced. Where not otherwise referenced, routine procedures were followed (23). Numbers refer to bases in GenBank locus CHKH- BBRE (accession no. L17432).

Construction of the Upstream Hypersensitive Site Plasmids-The sites were obtained as fragments with blunt ends as follows: HS1, HindIII-StuI (5719-7407), blunted with Klenow; HS2, EcoRI (3007- 45591, blunted with Klenow; HS3, BamHI-EcoRI (895-2388), blunted with Klenow; HS4, SacI-SspI(-1300 bp), blunted with T4 DNApolym- erase. XbaI linkers (CTCTAGAG) were added, the fragments were cloned into pBluescriptIISK- (Stratagene), and excised withXbaI. Next the XbaI cassettes were inserted into the XbaI site of pPACAT. In the "A" orientation the "coding" strand of the hypersensitive site is the coding strand of the reporter. Our laboratory designations for the plasmids with the A orientation are: HSl, p610; HS2, p594; HS3, p592; and HS4, p588.

Construction ofHS2 Deletions and Point Mutants-Plasmids HS2A1, HS2A3, and HS2A5 were constructed as described above for HS1-4 using: HS2A1, NcoI (3631-4060), blunted with Klenow; HS2A3, PstI (377941691, blunted with T4 DNA polymerase; and HS2A5, PvuII (3669-3876). Plasmids HS2A2 (3447-3885) and HS2A4 (3671-3907) were constructed by polymerase chain reaction, with XbaI sites added at the 5' ends of the primers. The restriction enzyme- and polymerase chain reaction-generated fragments were cloned into pBluescriptIISK-, and transferred into pPWAT. Our laboratory designations for the plasmids with the A orientation are: HS2A1, p701; HS2A2, pLA32; HS2A3, pLA18; HS2A4, pLA26; and HS2A5, pLA39.

The clustered point mutant constructs were made by oligonucleotide mutagenesis (Doubletake, Stratagene), starting from construct HS2A1. Generally, mutations were four opposite-base transversions. However for FP2, the four opposite-base transversions created a GATA-1 site, as determined by electrophoretic mobility shift assays. Thus, in oligonucleotide M2 the indicated five mutations were made. The oligonucleotides used to generate the mutations (uppercase letters) were: M1, gctgcccggacccccTAAAcactcctgctaaccc; M2, aggggaaaaagcagCTACTggt- gcggtgggcgca; M3a, gcctggcgctgcattGCGAtcgggctgcagagag; M3b, att- tatctcgggctgACTCgagggtggtgaggaa; M4, agggtggtgaggaacGCGAtggtgt- ggggctggc; M6, ggctgccggggggcgCGCTgagggcagagggcag; and M7, ggctcggcggcagctTCGCgggggtgttgtgctg. Each mutated XbaI fragment was subcloned into the XbaI site of pPACAT. Our laboratory designations for the plasmids with the A orientation are: pM1, pLA53; pM2, pLA92; pM3a, pLA43; pM3b, pLA60; pM4, pLA46; pM6, pLA70; and pM7, pLA50.

Dansient Expression-Transient expression of erythroid cells was performed essentially as described previously (15, 24). Circulating erythroid cells isolated from 10-day chicken embryos were subjected to osmotic shock in 250 mM NH,C1 a t 25 "C for 36 min. The cells (20-25 A412 unitskulture) were transfected with 1.8 pg of CsCl gradient-purified CAT plasmid and 0.2 pg of Rous sarcoma virus-luciferase (25) control plasmid in a volume of 0.5 ml. After 4 0 4 8 h of incubation a t 37 "C, each culture was assayed for CAT activity with quantitation on a Molecular Dynamics PhosphorImager and for luciferase activity (Luciferase Assay System, Promega).

Each sample's CAT activity was normalized to its luciferase activity and expressed as a percent of the positive control, pPACAT-EP (formerly pAcat-EP) assayed in parallel. ppACAT-EP contains the strong enhancer from between the PA- and €-globin genes (26). The assay back- ground was determined from transfections with pBluescriptIISK-. Plas- mids were assayed in duplicate in at least two (usually three to six) independent assays. Results are expressed as the mean 2 standard deviation.

Preparation of Protein Extracts-Nuclear extracts were prepared from 5-, lo-, and 17-day embryonic chicken erythroid cells as described previously (271, with the inclusion of fresh leupeptin (0.5 pg/ml), pep- statin A (0.7 pg/ml), aprotinin (0.5 pg/ml), chymostatin (0.7 pg/ml), and phenylmethylsulfonyl fluoride (0.5 mM). Whole cell extracts from Sf9 cells infected with baculovirus expressing chicken GATA-1 (M. Pickaart and G. Felsenfeld) or from cells infected with a control baculovirus were provided by M. Pickaart.

DNase Z Footprinting-DNase I footprinting of the coding strand was performed on a 400-bp BamHIIBgZI fragment from pLA40 (the "B"

Construct: Relative CAT activity:

PP~CAT 1.8 f1.1

PP~CAT-EP loo f19 HS4 3.8 f1.9 HS3 15.7 f i . 9

I HS2 16.3 f7.4 I HS1 3.1 f1.4

P B" PA E

3 E u

5 kb

PACAT plasmids containing individual upstream hypersensitive sites FIG. 1. Enhancer activity of the upstream hypersensitive sites.

(HSI4) or control DNA (pP"CAT and pp"CATEP) were transfected into 10-day embryonic chicken erythroid cells. pPACAT contains no in- sert, and pP%AT-EP contains the enhancer found between the PA and E genes. The CAT activity, normalized to luciferase and pPqAT-EP, is presented as the mean 2 standard deviation. See "Experimental Proce- dures'' for details. The map at the bottom shows the upstream hypersensitive sites ( I 4 ) , the four P-like globins, and the PA/e enhancer (E). The bars depict the regions included in constructs H S 1 4 .

orientation of pLA39, see above) labeled using T4 polynucleotide kinase at the BamHI site. Footprinting of the noncoding strand used the 472-bp BamHIIHindIII fragment from p704 (the "B" orientation of p701, see above) labeled at the Hind111 site. The reactions were done as described (28), with the following modifications. Binding reactions (10 mM NaHEPES, 60 mM KCI, 10% glycerol, 1 m~ MgCl,) were incubated at 37 "C for 20 min. Incubation with DNase I was at 4 "C for 2 min.

Electrophoretic Mobility Shift Assays-Oligonucleotides were synthesized on an Applied Biosystems 394 DNA/RNA Synthesizer. The locations of the oligonucleotide probes derived from the wild-type HS2 sequence are (Fig. 3B): A, 3686-3715; B, 3723-3752; C, 3762-3791; D, 3788-3817; E, 3812-3861; F, 38373866; and G, 3861-3910. The oligonucleotides used to introduce the point mutations (above) also were used as probes and as competitors in electrophoretic mobility shiR assays. The authentic factor binding sites are: Spl, GAATCCTAACT- GGGCGGAGTTATGCTGGTG (29); GATA, AGCTTCGGTTGCAGATA- AACATTGAA'M'CA (27); NF-E4, TGCCCGGGGAAGAGGAGGGGC- CCGGCGGAG (chick PA-globin promoter -64 to -35, Ref. 30); USF, ATAGGTGTAGGCCACGTGACCGGGTGTTCC (adenovirus major late promoter -72 to -43, Ref. 31); and CACCC, CGACGTAGAGCCACAC- CCTGGTAAGGGTCG (mouse P"*-globin promoter -104 to -75, which binds EKLF (32) and CACD (33)).

Gel-purified oligonucleotides were labeled with T4 polynucleotide kinase. Nuclear extracts were mixed with 10-20 fmol of probe in 100 mM KCl, 50 mM NaHEPES, 5 m~ MgCl,, 1 m~ dithiothreitol, 0.01% (w/v) Nonidet P-40, 20 pg/pl bovine serum albumin, and 0.05 pg/pl poly(d1-dC) in a volume of 20 pl. Rabbit antiserum (no. 9799) specific for chicken GATA-1 was provided by T. Evans. Antiserum (0.1 pU20 of final reaction volume) was preincubated with extract (60 min, 4 "C) before the binding reaction. Competitor oligonucleotides were mixed with probe before addition of the nuclear extract. Binding reactions were incubated at 25 or 37 "C for 10 min. Electrophoresis was performed in 8% polyacrylamide gels in 10 mM TRIS base, 10 mM HEPES, and 1 mM EDTA, pH 8.0.

RESULTS

Enhancer Activity of the Upstream Hypersensitive Sites-To begin our examination of the upstream hypersensitive sites, we assayed each for enhancer activity in a transient expression assay. The sites (as fragments of -1300 to 1689 bp) were tested for their ability to increase expression of the PACAT reporter in 10-day erythroid cells (Fig. 1). HS2 and HS3 each showed enhancer activity (8.8- and 8.5-fold relative to pp"CAT, respectively) while HS1 and HS4 did not significantly stimulate expression (1.7- and 2.0-fold relative to ppACAT, respectively). The enhancer activity of both HS2 and HS3 was independent of each site's orientation in the plasmid (data not shown).

To define more precisely the region responsible for the en-

GATA Sites Mediate Enhancer Activity of Chicken HS2 32567

Construct: Relative

CAT activity:

p ~ A ~ ~ ~ 1.0 f2.4 p p A ~ ~ ~ ~ ~ io0 k15

4 HSZ 16.3 k7.4 - HSZA1 12.1 f2.0 - HSZA2 3.8 B.9 - HSZA4 13.1 B.1

H HSZA5 5.1 k3.0

1-1 HSZA3 3.4 52.8

I I I 3400 3500 3600 3700 3800 3900 4000 4100 4200

FIG. 2. CAT activity of the deletion mutants of HS2. PWAT plasmids containing fragments of HS2 were transfected into 10-day embryonic chicken erythroid cells. The CAT activity, normalized to luciferase and ppWAT-EP, is presented as the mean ? standard deviation. See “Experimental Procedures” for details. The burs depict the included regions. The scale is in base pairs and is numbered as in GenBank locus CHKHBBRE.

hancer activity of HS2, we constructed a series of deletion mutants. These plasmids were expressed transiently in 10-day erythroid cells (Fig. 2). The smallest fragment that retained maximal enhancer activity (HS2A4) was 237 bp, from 3671 to 3907. Constructs HS2A2, HS2A3, and HS2A5 showed much less enhancer activity, suggesting that these deletions removed positive-acting DNA elements between 3671-3778 and 3886 3907.

Factor Binding to HS2-To identify the protein-binding sites within HS2, we undertook in vitro DNase I footprinting. Nu- clear extracts from primitive (5 day) or definitive (10 and 17 day) embryonic erythroid cells were used as a source of factors. The data for the 5- and 17-day extracts are presented in Fig. 3. Seven footprinted regions were detected in HS2. Most of the differences between the primitive and definitive extracts were in footprint intensity, not location. In general, stronger footprints were obtained with nuclear extracts from 5-day cells than from 10- or 17-day cells.

Electrophoretic mobility shift assays were performed to identify the protein factors that produced the footprints. Oligonu- cleotide probes A-G corresponding to footprints FP1-7 were synthesized (see “Experimental Procedures” and Fig. 3B).

Probe A spans the FP1 region and includes overlapping consensus S p l (3697-3704) and EKLF/CACD sequences (3696- 3704 (32-33)). This probe formed two major complexes with nuclear extracts from 17-day erythroid cells (Fig. 4 A , bands a and b) . A similar pattern of complexes was observed with nuclear extracts from 5- and 10-day erythroid cells (data not shown). Band a was competed for by oligonucleotides containing Spl-, NF-E4-, or CACCC-binding sites, but not by oligonucleotides containing GATA or USF sites. Some of band a may be due to S p l since it has the mobility expected for Spl and an anti-Spl antibody supershifted some of this band (data not shown).

Complex b has the same mobility as the major band observed with the CACCC probe and was competed by the CACCC oligonucleotide more efficiently than the Spl and NF-E4 oligonucleotides. GATA and USF oligonucleotides failed to compete for this band. These findings suggest that complex b is not due to a degradation product of Spl and may be due to binding by the chicken homolog of ELKF. Confirmation requires characteriza- tion of the EKLF protein in chicken and further definition of the EKLF consensus binding site.

The M1 oligonucleotide, containing point mutations in the Spl/EKLF/CACD motif of FP1, did not compete for factor bind-

ing to unmutated probe A. When the M1 oligonucleotide was used as a labeled probe, no complexes were observed. Thus, the M1 mutation abolishes the DNA-protein interactions mediated by this region of HS2.

Probe B spans FP2, which does not include a known consensus motif. Using 17-day extracts, several specific complexes were observed on prolonged exposures (Fig. 4B). A similar pattern was observed using 5- and 10-day extracts (data not shown). Band a was competed efficiently by the Spl oligonucleotide, but not by GATA or M2 oligonucleotides, the latter containing a mutated FP2 site. Band b was competed by CACCC and NF-E4 oligonucleotides, less efficiently by Spl and M2 oligonucleotides, and not by a GATA oligonucleotide (Fig. 4B and data not shown).

Probes C (FP3) and D (FP4) both contain canonical GATA-1 consensus motifs (WGATAR). A single specific complex was observed with each probe using 17-day extract (Fig. 4C). This complex had the mobility of an authentic GATA-1.DNA complex and was competed for by a GATA, but not by a Sp l oligonucleotide. Similar results were obtained with 5- and 10-day extracts (data not shown). A weaker GATA band was seen with probe D than probe C. When the GATA site in probe C was mutated, the resulting oligonucleotide (M3a) neither competed for GATA-1 binding, nor bound GATA-1. A probe extending 10 bp farther 3‘ than probe C (3762-3801) detected the GATA-1 complex already observed, but did not show any other shifted bands (data not shown). These data suggest that FP3 and FP4 result from GATA-1 binding and that the FP3 site binds with a higher apparent affinity than the FP4 site.

Probe E is a 50-mer that spans FP5 and FP6. A band with the mobility of GATA-1 and three complexes ( a , c, and d ) of slower mobility were observed with this probe (Fig. 40). Similar pat- terns were obtained with 5- and 10-day extracts (data not shown). An authentic GATA site competed only the fastest band, and review of the FP6 sequence revealed a noncanonical GATA site at 3843-3848 (CGATAG, Refs. 34-35). Oligonucleo- tide F is a 30-mer that contains FP6 (and DNA farther down- stream than probe E) but deletes FP5 and upstream DNA. Oligonucleotide F competed bands a and d, and to a lesser extent, band c and the putative GATA-1 complex. When used as a probe, F also yielded a GATA-1 complex on long exposures (data not shown). It is likely that F binds GATA-1 weakly due to the proximity of the site to the end of the probe. The mutated FP6 oligonucleotide, M6, failed to compete for the putative GATA band, but did compete band a (Fig. 40). These data suggest that E binds GATA (as well as other unidentified proteins) and that M6 disrupts the GATA binding.

Probe G (FP7) contains a GATA motif. A prominent complex with the mobility expected for a GATA-1 complex was seen with 5- (Fig. a), lo-, and 17-day extracts (data not shown). This complex was specifically competed by a GATA oligonucleotide, but not by S p l or mutated FP7 (M7) oligonucleotides. Several weak complexes of slower mobility were observed on long exposures, particularly with primitive cell extracts (data not shown); the identities of the factors binding to these sites are unknown.

The sites in FP3, FP4, FP6, and FP7 are postulated to bind GATA-1 based on the footprinted sequences, and the sizes of the complexes (GATA-2 and GATA-3 would give slower complexes (36)). Two assays were used to confirm that these sites bind GATA-1. Electrophoretic mobility shift experiments using an extract containing recombinant chicken GATA-1 demonstrated that each of the four sites bound GATA-1 (Fig. 5). Control Sf9 extract did not bind to these sequences. An authentic GATA probe bound the recombinant protein, but an Sp l probe did not. Antiserum specific for chicken GATA-1 inhibited complex for-


I

I FPZ

L! +

FP.7

FP-I I ! W

FPS I

FPh I

B

17 day: 5 day:

37211

I a7911

3KW

FP 1

Extract - 5d 17d - -PM

17d

B I I

- 3770

- 3719

- 3695 - -- "- a " - 8 " - 12 13 14 15 16 17 18 19 20 21

"

FP2 FP3 """"""" " $ 4 """"""""- """"""""- =="""""" """ """

3671 GCTGCTGGGTGGAGGCTGCCCGGACCCCCGCCCCACTCCTGCT~CCCCGAGGGGA~GCAGGCGGCGGTGCGGTGGGCGCAGCCTGGCGCTGCA~AT~CGGGCTGCAGAGAGGG CGACGACCCACCTCCGACGGGCCTGGGGGCGGGGTGAGGACGATTGGGG~CCCC~TTTTCGTCCGCCGCCACGCCACCCGCGTCGGACCGCGACGT~TAGAGCCCGACGTCTCTCCC

17 day: 5 day:

t =============== t "-t t "" "" " " ""

"""""""""""- """"""""" """""""""

""""""""==__""" t====== t

A B C

FP6 """ """

FP7

3791 TGGTGAGGAACTATCTGGTGTGGGGCTGGCAGGGCGTGGGGCTGCCGGGGGGCGATAGGAGGGCAGAGGGCAGCGGGCTCGGCGGCAGCTGATAGGGGGTGTTGTGCTGTGGGGTTGCTC ACCACTCCTTGATAGACCACACCCCGACCGTCCCGCACCCCGACGGCCCCCCG~~TCCTCCCGTCTCCCGTCGCCCGAGCCGCCGTCGACTATCCCCCAC~CACGACACCCCAACGAG

17 day: 5 day:- """""_ """""_ "

" ===t t . . . . . . . . ""_ "_" -

E D G

F FIG. 3. DNase I footprinting of HS2 of the chicken P-globin cluster.A, The "coding" strand is shown in lunes 1-11 and the non-coding strand

in lanes 12-21. Footprints (FPI-7) are indicated by filled or open rectangles (indicating strong or weak protection) and hypersensitive sites by arrows. DNA was incubated with nuclear extract from primitive cells (5d, 313 pg of protein, lunes 3-.5,14 and 15), definitive cells (17d, 820 pg of protein, lunes 6-8, 16, and 171, or without extract (lunes 1, 2,9, 10,12, 13, 18, 19). The protein.DNA complexes were treated with DNase I (0.01 units, lunes 2,10,13; 0.03 units, lunes 1,5,9,12,17, and 19; 0.1 unit, lunes 4,8,15, 16, and 18; 0.3 unit, lunes 3,7,14, or 1 unit, lune 6) as described under "Experimental Procedures." Lanes 11 and 21 are A+G sequencing ladders. Base numbering as in CHKHBBRE is indicated at the righi. Undigested non-coding strand probe is shown in lune 20. The non-coding strand 17-day samples cannot be interpreted above 3776 (indicated by *) due to undenatured probe. B, sequence of HS2. Footprinting regions are labeled FPl-7. Strong and weak footprints are indicated by = and -, respectively. Data for the coding strand are shown above the sequence and below for the non-coding strand. Results using 5- and 17-day extracts are so labeled, and hypersensitive sites are marked by arrows. The 3860-3890 region was footprinted only on the non-coding strand. The approximate region of FP7 is shown by dots since it was mapped a t a resolution of -3 bp. The burs (A-G) represent the oligonucleotide probes used in the electrophoretic mobility shift studies. The 5' end of probe D extends to 3788. Bases that were mutated to disrupt footprints are shaded (see "Experimental Procedures"). Sequence numbering is that of Genbank locus CHKHBBRE.

mation on each of the four oligonucleotides; preimmune serum In summary, we identified seven protein-binding sites by did not inhibit complex formation (Fig. 5). An authentic GATA footprinting and mobility shift assays. Six sites were charac- probe served as a positive control. terized in detail, four of which (FP3, FP4, FP6, and FP7) are


A B c' .r

,,Y probe: @ C $ $ probe: B

""

b -

C probe: C

D E D C M3a Drobe: E probc: G

GATA-1- 4 \

l 2 < . 4 <

FIG. 4. Electrophoretic mobility shift studies of HS2. Oligonucleotide probes and competitors were double-stranded 30- or 50-mers (see "Experimental Procedures" and Fig. 3R for sequences). Probes are indicated at the top of each panel. Nuclear extracts were from 17-day (panels A -D) , or 5-day (panel E) embryonic chicken erythroid cells. Competitor oligonucleotides were added in a 10- or 100-fold molar excess as indicated. The position of an authentic GATA-1 shift is shown in some panels. Bands discussed in the text are labeled at the Leo; the designated letters apply only to the single panel in which they are shown. PanelsA and C contain two independent experiments. The exposure time forpanel B was -8-fold longer than panel A ; probes A and B were of similar specific activity.

GATA-1 sites. Two footprinting regions (FP1 and FP2) appear to bind both Spl- and EKLF/CACD-like factors. Nucleotide substitutions that prevent the binding of these factors were identified.

Enhancer Activity of Point Mutants within HS2-We next studied constructs containing mutated protein-binding regions of HS2 to assess their contribution to the region's enhancer activity. The clustered point mutations that disrupt protein binding were introduced into HS2Al and enhancer activity was assayed by transient expression (Fig. 6). Mutating FP1 (pM1) increased enhancer activity by 40%. Thus, the loss of the protein binding to this putative Spl/EKLF/CACD-like site did not impair enhancer activity. Mutating FP2 (pM2) had no effect on enhancer activity. Mutant pM3b disrupted the 3' end of FP3, which contained a footprint in primitive cell extracts. This mutation slightly decreased enhancer activity in definitive cells.

Mutants pM3a, pM4, pM6, and pM7 disrupted the GATA sites in FP3, FP4, FP6, and FP7, respectively. In each of these plasmids, enhancer activity was significantly reduced. Thus, each of the four GATA sites contributes to the enhancer activity of HS2. The enhancing effect attributed to 3671-3778 in the deletion mutant experiments (compare HS2A3 with HS2A4) is explained by the GATA site in FP3 (3769-3774). The positive effect of 3886-3907 is more difficult to explain (compare HS2A2 with HS2A4). Possible explanations are that the deletion of 3886-3907 affected GATA-1 binding to the motif in FP7 a t 3880-3885, or that there is a positive element in 3885-3907 that we did not detect by the protein binding experiments.

DISCUSSION

HS2 and HS3 Contain Enhancer Activit-y-We and others have found DNase I-hypersensitive sites upstream of the


probe: C I) G g a C D C E _"" ""

CXtraCt: C + C + C + C + C + R R R R R R R R R R R R R R R C + antiserum: - I P - I P - I P - I P - I P

- 4

-x-

- GAT(\- 1

--x

23 24 25 26 27

FIG. 5. Electrophoretic mobility shifts using recombinant chicken GATA-1 or antiserum to chicken GATA-1. Oligonucleotide probes were double-stranded 30- or 50-mers (see Fig. 3 R ) and are identified at the top of each panel. The position of authentic GATA-1 complex is shown at the left, and the mobility of degraded cGATA-1 bound to probe is indicated by *. In lanes 1-10,26, and 27, equal amounts of extract were used from Sf9 cells expressing a cGATA-1 baculovirus contruct (+) or control infected cells ( C ) . In lanes 11-25, nuclear extracts from 10-day embryonic chicken erythroid cells ( R ) were incubated with buffer (-), cGATA-1-specific antiserum ( I ) , or preimmune serum (P) before addition of probe. With probe E (lanes 23-27), prolonged gel runs were used to increase the resolution of the GATA-1 complex from a slower complex. The exposure times for probe D (lanes 3 . 4 , and 14-16) were 4-fold longer than for the other probes; all of the probes were of similar specific activity.

Kelativc Construct: CAT activity:

PRO CAT 1.0 f2.4

" HS261 12.1 B.0 " pM1 16.8 M . 4

" pY2 12.7 f2.8 " pM3a 3.1 k1.2

" pY3b 7.3 S . 1

" pM4 2.8 S . 5

- pM6 1.2 B.8

- ,, QM7 1.8 s . 9

"

"

"

"

"

"

\ I

S700 SR00 3900 4000

FIG. 6. CAT activity of clustered point mutations in HS2. Open rectangles represent putative Spl/CACCC-binding sites. Closed circles represent GATA-binding sites. An unidentified factork) is indicated by the open circle. Mutated elements in each construct are indicated by a x. The CAT activity, normalized to luciferase and pp"CAT-EP, is presented as the mean 2 standard deviation. See "Experimental Proce- dures" for experimental details. The data are from a minimum of six determinations per construct.

chicken p-globin cluster (13, 14). We now show that HS2 and HS3 function as enhancers in transient expression assays, while HS1 and HS4 do not. These upstream enhancers are the second and third enhancers to be defined in the chicken p-globin cluster. The first is the intergenic enhancer found between the PA and E genes (15, 16). The distribution of enhancer activity in the chicken complex differs from that of the human cluster, which has a strong upstream enhancer (hHS2; 37,381 and moderate enhancers within the cluster, 3' of the A y and p-globin genes (39-41).

Factor Binding to HS2"Our data demonstrate that HS2 contains four GATA motifs that can bind GATA-1 and that each of the four sites contributes to the observed enhancer activity. GATA-1 is a zinc-finger transcription factor that is essential for erythroid development and influences the expression of every erythroid gene studied (27, 42-44). GATA sites have also been shown to mediate promoter-enhancer interaction (45, 46). The data suggest that GATA-1 acts a t these sites, but we cannot exclude a role for GATA-2 or other GATA family factors (42).

I t is more difficult to identify the proteins that bind to the FP1 and FP2 regions of HS2. Antibody supershift experiments

suggested that Spl (or antigenically related proteins) accounts for some of the binding a t FP1. It is unclear which proteins beside Spl account for the observed slowest-migrating band; other protein.DNA complexes (such as NF-E4; 30) may have this mobility. The observed faster-migrating complex (b) comi- grates with proteins that bind to the CACCC site from the mouse p"*-globin promoter. This sequence binds EKLF, an erythroid-specific transcriptional activator (32), which may be the same as CACD (33). To date, this factor has not been characterized in chickens. Due to the large number of factors that can bind to GC-rich Spl- and EKLF-like motifs, it is difficult to know if these proteins and/or others (e.g. TEF-1(47), A€'-3 (48), and SSP (49)) occupy these sites in vivo. Mutations in FP1 and FP2 that abolish in vitro factor binding failed to diminish transcription in the transient expression assay. Possible explanations for these observations are 1) the sites alter chromatin structure and their effect is not detectable by transient expression assays, 2) the sites influence globin gene expression only in primitive cells, or 3) the sites interact with regulatory elements not in the test constructs.

Chicken HS3 contains a number of sites that are likely to mediate its enhancer activity, including canonical GATA and NF-E2 motifs and a CACCC sequence. Clearly, a functional analysis is required to determine the actual contribution of each of these sites. In contrast to HS3, HS1 contains two canonical GATA motifs but fails to stimulate transcription in our transient expression assay. Thus, the simple presence of GATA motifs is not sufficient to ensure enhancer activity.

Hypersensitive Site Evolution-Examination of the upstream hypersensitive sites from four mammalian species (humans, goats, mice, and rabbits) demonstrated evolutionary conserva- tion of the sites' location and sequence (50 and references therein). In contrast, the chicken and mammalian 5' sites do not show sequence similarity (21). If the sites have a common ancestor, the lack of detectable similarity could be explained by the small size of the functional motifs (6-10 bp), the length of time since the last common ancestor (-310 million years), and tolerance for variation in site spacing. By comparing the factor- binding profiles, rather than the sequences, older relationships might be revealed. While mammalian HS2, HS3, and HS4 contain sites that bind GATA-1 and/or Spl/EKLF, chicken HS2 is most similar to mammalian HS3, which has many GATA and CACC motifs and one AF"l/NF-E2 site (51-53). However, the order of the motifs in chicken HS2 and mammalian HS3 does


not appear related, and mammalian HS3 has weak (50) or no (51, 54) enhancer activity in transient expression assays. Taken together, these observations neither support nor refute the hypothesis that the avian- and mammalian-hypersensitive sites have a common ancestor. Thus, the multiple GATA sites in both chicken HS2 and some of the mammalian upstream sites may have evolved from a common ancestor with preservation of only very short sequences. Alternatively, they may represent convergent evolution.

Functions of the Upstream Hypersensitive Sites-Each of the four erythroid-specific upstream hypersensitive sites of the human P-globin cluster has been shown individually to mediate position-independent gene expression, although the level of expression varied depending on the particular site and developmental stage examined (55). In the chicken cluster, the PA gene and its 3' enhancer sufficed to direct position-independent expression (19,20). In recent experiments we have expressed the whole chicken P-globin cluster in mice. While the upstream sites did not substitute for the PA/€ enhancer in producing copy number-dependent expression of PA-globin, they significantly increased globin expression.' These results suggest that the upstream sites interact with gene-proximal elements.

The four functional GATA-1 sites are obvious candidates for mediating the interaction between the upstream hypersensitive sites and the globin genes. Further experiments will be needed to examine the contribution of these sites to position- independent gene expression. It will also be important to identify the target sites for HS2 interaction with the genes and the other proteins that mediate the interactions. Thus, our identi- fication of HS2 and HS3 as enhancers and our detailed char- acterization of HS2 are significant steps toward the goal of understanding globin gene expression.

Acknowledgments-We thank Drs. T. Evans for antiserum and M. Pickaart for recombinant extracts, J. Grasso, C. Trainor, and E. Bresnick for advice and comments, and M. Mason, A. Dean, and A. Ginsberg for reviewing the manuscript.

REFERENCES 1. Czelusinak, J., Goodman, M., Hewett-Emmett, D., Weiss, M. L., Venta, P. J.,

2. Stamatoyannopoulos, G., and Nienhuis, A. W. (1994) in The Molecular Basis of and Tashian, R. E. (1982) Nature 298,297-300

Blood Diseases (Stamatoyannopoulos, G., Nienhuis, A. W., Majerus, P. W., and Varmus, H., eds) pp. 107-155, Saunders, Philadelphia

3. Bruns, G. A. P., and Ingram, V. M. (1973) Philos. %ns. R. SOC. Lond. Ser B. Biol. SOC. 266, 225-305

4. Tuan, D., Solomon, W., Li, Q., and London, I. M. (1985) Proc. Natl. Acad. Sei. U. S. A. 82, 6384-6388

5. Forrester, W. C., Takegawa, S., Papayannopoulou, T., Stamatoyannopoulos, G.,

6. Grosveld, F., Blom van Assendelft, G., Greaves, D., and Kollias, G. (1987) Cell and Groudine, M. (1987) Nucleic Acids Res. 16, 10159-10177

7. Tomes, T. M., and Behringer, R. R. (1990) Dends Genet. 6, 219-223 61,975-985

8. Evans, T., Felsenfeld, G., and Reitman, M. (1990) Annu. Reu. Cell Biol. 6, 95-124

Mason, M., Lee, E., Westphal, H., and Reitman, M. (1994) Mol. Cell. Biol., in press.

10. Crossley, M., and Orkin, S. H. (1993) Curr Biol. 3,232-237 11. Dillon, N., and Grosveld, F. (1993) Dends Genet. 9, 134-137

13. Stalder, J., Larsen, A,, Engel, J. D., Dolan, M., Groudine, M., and Weintraub, 12. Engel, J. D. (1993) Thxds Genet. 9,304-309

14. Reitman, M., and Felsenfeld, G. (1990) Mol. Cell. Biol. 10, 2774-2786 15. Hesse, J. E., Nickol, J. M., Lieber, M. R., and Felsenfeld, G. (1986) Proc. Natl.

16. Choi, 0.-R., and Engel, J. D. (1986) Nature 323,731-734 17. Choi, 0.-R., and Engel, J. D. (1988) Cell 66, 17-26 18. Foley, K. P., and Engel, J. D. (1992) Genes & Deu. 6,730-744 19. Reitman, M., Lee, E., Westphal, H., and Felsenfeld, G. (1990) Nature 348,

20. Reitman, M., Lee, E., Westphal, H., and Felsenfeld, G. (1993) Mol. Cell. Biol.

21. Reitman, M., Grasso, J. A,, Blumenthal, R., and Lewit, P. (1993) Genomics 18,

22. Chung, J. H., Whiteley, M., and Felsenfeld, G. (1993) Cell 74, 505-514 23. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith,

J. A., and Struhl, K. (eds) (1993) Current Protocols in Molecular Biology, Wilev. New York

9. Felsenfeld, G. (1992) Nature 366,219-224

H. (1980) Cell 20,451460

Acad. Sci. U. S. A. 83, 4312-4316

749-752

13,3990-3998

61&626

24. Lieber, M . R., Hesse, J. E., Nickol, J . M., and Felsenfeld, G. (1987) J. Cell Biol. 106. 1055-1065

25. De Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., and Subramani, S.

26. Reitman, M., and Felsenfeld, G. (1988) Proc. Natl. Acad. Sci. U. S. A. 86,

27. Evans, T., and Felsenfeld, G. (1989) Cell 68, 877-885 28. Bresnick, E. H., and Felsenfeld, G. (1993) J. Biol. Chem. 268, 18824-18834 29. Jackson, D. P., Evans, T., Nickol, J. M., and Felsenfeld, G. (1989) Genes & Deu.

30. Gallarda, J. L., Foley, K. P., Yang, Z., and Engel J. D. (1989) Genes & Deu. 3,

31. Sawadogo, M., and Roeder, R. G. (1985) Cell 43, 165-175 32. Miller, I. J., and Bieker, J. J. (1993) Mol. Cell. Biol. 13, 2776-2786 33. Hartzog, G. A,, and Myers, R. M. (1993) Mol. Cell. Biol. 13, 4 4 5 6 34. Merika, M., and Orkin, S. H. (1993) Mol. Cell. Biol. 13, 3999-4010 35. KO, L. J., and Engel, J. D. (1993) Mol. Cell. Biol. 13, 4011-4022 36. Yamamoto, M., KO, L. J., Leonard, M. W., Beug, H., Orkin, S., and Engel, J . D.

37. %an, D. Y. H., Solomon, W. B., London, I. M., and Lee, D. P. (1989) Proc. Natl.

38. Ney, P. A., Sorrentino, B. P., McDonagh, K. T., and Nienhuis, A. W. (1990) Genes

39. Bodine, D. M., and Ley, T. J. (1987) EMBO J. 6,2997-3004 40. Kollias, G., Wrighton, N., Hurst, J., and Grosveld, F. (1987) Cell 46, 89-94 41. Tmdel, M., and Costantini, F. (1987) Genes & Deu. 1,954-961 42. Orkin, S. H. (1992) Blood 80,575-581 43. %ai, S.-F., Martin, D. I. K., Zon, L. I., DAndrea, A. D., Wong, G. G., and Orkin

44. Pevny, L., Simon, M. C., Robertson, E., Klein, W. H., Tsai, S.-F., DAgati, V.,

45. Barton, M. C., Madani, N., and Emerson, B. M. (1993) Genes & Deu. 7, 1796-

46. Gong, Q., and Dean, A. (1993) Mol. Cell. Biol. 13, 911-917 47. Davidson, I., Xiao, J. H., Rosales, R., Staub, A., and Chambon, P. (1988) Cell

48. Mitchell, P. J., Wang, C., and Tjian, R. (1987) Cell 60, 847-861 49. Jane, S . M., Gumucio, D. L., Ney, P. A., Cunningham, J. M., and Nienhuis, A.

W. (1993) Mol. Cell. Biol. 13, 3272-3281 50. Hardison, R., Xu, J., Jackson, J., Mansberger, J., Selifonova, O., Grotch, B.,

Biesecker, J., Petrykowska, H., and Miller, W. (1993) Nucleic Acids Res. 21, 1265-1272

51. Hug, B. A., Moon, A. M., and Ley, T. J. (1992) Nucleic Acids Res. 20,5771-5778 52. Philipsen, S., Pruzina, S., and Grosveld, F. (1993) EMBO J. 12, 1077-1085 53. Strauss, E. C., and Orkin, S. H. (1992) Proc. Natl. Acad. Sei. U. S. A. 89,

54. Moon, A. M., and Ley, T. J. (1991) Blood 77,2272-2284 55. Fraser, P., Pmzina, S., Antoniou, M., and Grosveld, F. (1993) Genes & Deu. 7 ,

(1987) Mol. Cell. Biol. 7, 725-737

6267-6271

3, 1860-1873

184k1859

(1990) Genes & Deu. 4, 1650-1662

Acad. Sci. U. S. A. 86,2554-2558

& Deu. 4,993-1006

S. H. (1989) Nature 339,446-451

Orkin, S. H., and Costantini, F. (1991) Nature 349, 257-260

1809

64,931-942

5809-5813

106-113

Documents

Enhancer Activity of Upstream Hypersensitive Site 2 of the Chicken