Embed Size (px)
Citation preview
Original article 259
Endothelial cell protein C recep
tor gene 6936A/G and 4678G/Cpolymorphisms as risk factors for deep venous thrombosisNaguib Zoheira, Nabiel Eldanasouria, Asmaa A. Abdel-Aala, Karim Adel Hosnyband Wafaa M. Abdel-Ghanya
Endothelial cell protein C receptor (EPCR) enhances the
generation of activated protein C by the thrombin–
thrombomodulin complex. A soluble form of EPCR (sEPCR)
is present in plasma. Two polymorphisms in the EPCR gene
(6936A/G and 4678G/C) have been reported to influence
the risk of venous thromboembolism. We aimed to
investigate the relation between EPCR gene
polymorphisms (6936A/G and 4678C/G) and deep venous
thrombosis (DVT) and their relations to sEPCR level. This
study involved 90 patients with DVT and 90 age and sex-
matched healthy controls. Plasma levels of sEPCR were
measured in 45 cases of the primary DVT by ELISA. PCR-
restriction fragment length polymorphism (RFLP) was used
for detection of EPCR polymorphisms (6936A/G and
4678G/C). Regarding 6936A/G, our results demonstrated
that mutant genotypes (AG, GG) were associated with an
increased risk for DVT [P < 0.001, odds ratio (OR) 4.125, 95%
confidence interval (95% CI) 2.198–7.740] as well as its
mutant allele G (P < 0.001, OR 2.549, 95% CI 1.601–4.061).
The mutant genotypes were associated with increased
levels of sEPCR. Although in 4678G/C, our results
demonstrated that the mutant genotype (CC) was
Copyright © 2016 Wolters Kluwe
0957-5235 Copyright � 2016 Wolters Kluwer Health, Inc. All rights reserved.
considered as a protective factor against DVT (P U 0.014, OR
0.289, 95% CI 0.108–0.776) as well as its mutant allele C
(P U 0.02, OR 0.600, 95% CI 0.388–0.927), but it had no
effect on sEPCR level. Our data suggest that 6936A/G
polymorphism is a risk factor for DVT and is associated with
elevated plasma levels of sEPCR, while 4678G/C
polymorphism plays a role in protection against DVT. Blood
Coagul Fibrinolysis 27:259–265 Copyright � 2016 Wolters
Kluwer Health, Inc. All rights reserved.
Blood Coagulation and Fibrinolysis 2016, 27:259–265
Keywords: deep venous thrombosis, endothelial cell protein C receptor,polymorphisms
aDepartment of Clinical and Chemical Pathology and bDepartment of GeneralSurgery, Faculty of Medicine, Cairo University, Giza, Egypt
Correspondence to Asmaa A. Abdel-Aal, Department of Clinical and ChemicalPathology, Faculty of Medicine, Cairo University, Giza, 12211, EgyptE-mail: [email protected]
Received 30 April 2015 Revised 26 June 2015Accepted 17 July 2015
IntroductionA successful balance between the coagulation and fibri-
nolytic pathways is mandatory for normal haemostasis to
maintain the integrity of the blood vessels after vascular
injury [1]. This balance needs complex interactions
between plasma proteins, platelets, blood flow and the
endothelium [2].
Thrombophilia results when genetic or acquired changes
that enhance the coagulation factors or cause defect in
the fibrinolytic pathway lead to inappropriate clot for-
mation [3]. The predominant clinical manifestation
of thrombophilia is venous thromboembolism (VTE)
[4].
Deep vein thrombosis (DVT) is a common preventable
cause of death in adults affecting as high as 0.1% persons
per year worldwide. Reported rate of DVT among African
pregnant women was 48 cases per 100 000 births per year
[5]. This incidence even rises in the postpartum period
[6]. Furthermore, 41–95% of the emboli causing pulmon-
ary embolism are derived from DVT [7].
The risk factors for DVT include both acquired and
genetic factors. Acquired factors involve prolonged bed
rest, surgery, pregnancy or puerperium, hormonal treat-
ment, varicose veins, long air travel, acute inflammatory
bowel disease, rheumatological diseases, nephrotic syn-
drome and malignancies [8–10].
Genetic risk factors include mutations in factors involved
in the coagulation-fibrinolytic system as those causing
deficiencies of antithrombin, protein C (PC) and protein
S, factor V Leiden, prothrombin 20210A and fibrinogen
10034T [11].
EPCR can be considered as a key component of the PC
pathway, as it can increase the activity of PC/APC via the
thrombin–thrombomodulin complex by five to 20-fold,
leading to markedly elevated anticoagulation activity.
Several mutants of EPCR have been identified with
differential expression levels and function [12]. Soluble
EPCR (sEPCR) is a soluble form of EPCR that is consti-
tuted by metalloprotease cleavage and present in normal
human plasma [13].
There are two identified polymorphisms in the EPCRgene: 6936A/G (rs 867186) and 4678G/C (rs 9574). EPCR
polymorphism 6936A/G (corresponding to 4600A/G)
occurs within the region of EPCR encoded by exon 4,
near the 4600 position. They are single-nucleotide poly-
morphisms (SNPs) representative of two of the four
different haplotypes in the EPCR gene, haplotype 3
(H3) and haplotype 1 (H1), respectively [14].
r Health, Inc. All rights reserved.
DOI:10.1097/MBC.0000000000000402
260 Blood Coagulation and Fibrinolysis 2016, Vol 27 No 3
The aim of this work was to investigate the relationship
between EPCR gene polymorphisms (6936A/G and
4678C/G) and DVT and their relations to sEPCR level
in a group of DVT patients and normal people represent-
ing a sample of Egyptian population.
Patients and methodsThe present study was conducted on 90 patients with
DVT. Patients were diagnosed by Doppler ultrasonogra-
phy and selected among cases referred to the Vascular
Department at Kasr EL-Aini Teaching Hospital, Cairo
University from January 2013 to February 2014. Cases
were divided into two groups A and B; each group
includes 45 cases. Group A was subjected to sEPCR
evaluation, had exclusion criteria including haematolo-
gical diseases, liver and kidney dysfunctions, infections,
autoimmune diseases, tumours, diabetes mellitus and
intake of contraceptives, thrombolytic treatment or oral
anticoagulant treatment. The previous conditions were
excluded because they can alter sEPCR level or may
cause DVT [15].
Group B was not evaluated for sEPCR levels; 15 cases in
this group had the same previous exclusion criteria except
taking oral anticoagulant treatment. The other 30 cases
had secondary causes for DVT; 17 cases had DVT in
pregnancy or puerperium and 13 cases were receiving
contraceptive treatment.
The control group included 90 age and sex-matched
healthy individuals selected among normal people com-
ing for routine check-up and their investigations revealed
normal with no personal or family history of DVT.
They were divided into two groups (A and B); each group
includes 45 participants. Group A was subjected to
sEPCR assay. Group B was not evaluated for sEPCR
level, with 30 cases of them having a history of pregnancy
and taking contraceptive treatment without compli-
cations.
Patients were subjected to routine investigations, includ-
ing complete blood picture, coagulation profile [prothrom-
bin time, concentration, international normalization ratio
(INR) and activated partial thromboplastin time (aPTT)]
and assay of PC, protein S, antithrombin III and lupus
anticoagulant.
They were all subjected to Doppler ultrasonography to
confirm the diagnosis of DVT and follow up the effect of
the treatment.
Finally, PCR-RFLP for the two EPCR polymorphisms
(6936A/G and 4678G/C) was done for cases and control
groups.
Sample collectionA total of 10 ml of peripheral blood was obtained from
each individual. Five millilitres of blood was placed in
EDTA tube for DNA extraction and 5 ml in sodium
Copyright © 2016 Wolters Kluwer
citrate (1/10 volume) tube from which plasma was iso-
lated for sEPCR estimation.
Both EDTA and plasma samples were stored at �208Cfor later use.
Detection of endothelial cell protein C receptorpolymorphisms by PCR-RFLPEPCR polymorphisms (6936A/G) and (4678G/C) were
determined using PCR according to the protocol pub-
lished by Sesin et al. [16] and Medina et al. [17], respect-
ively. Purification of DNA from peripheral blood samples
of patients was done using ‘FavorPrep Genomic DNA
Mini kit’ produced by Favorgen Biotech Lab, Pingtung,
Taiwan and supplied by Medico Trade Company, Giza,
Egypt.
For DNA amplification, Firepol Master Mix ready to load
was produced by Solis BioDyne, Tartu, Estonia and
provided by Delta Trading Company, Cairo, Egypt.
The sequence of the used primers (product of Jena
Bioscience GmbH (Germany) and provided by New Test
Company, Cairo, Egypt) was as following: for EPCR
6936A/G genotype: Forward: 50 CCTACACTTCGCT
GGTCCTGGGCGTCCTGGTCTGC 30 and reverse
50 CAAGTACTTTGTCCACCTCTCC 30.
For EPCR 4678G/C genotype: Forward: 50 GCTTCAGT
CAGTTGGTAAAC 30and Reverse: 50 TCTGGCTTCA
CAGTGAGCTG 30.
All reactions were performed in a total volume of 25 ml
using 1 ml of each primer.
PCR was performed using DNA thermal cycler (PTC-100
programmable thermal controller; MJ Research, Water-
town, Massachusetts, USA). The thermocycler was pro-
grammed for initial heat denaturation at 948C for 5 min;
amplification included 40 cycles with the following pro-
gramme: denaturation at 948C for 1 min, annealing at 608Cfor 1 min, extension at 728C for 1 min. Last cycle extension
was prolonged to 5 min at 728C.
With regard to EPCR polymorphism 6936A/G, after ampli-
fication, the PCR product (290 bp) was digested with PstI
(Thermoscientific, Runcorn, Cheshire, UK) restriction
enzyme, provided by New Test Company (Cairo, Egypt).
For EPCR polymorphism 4678 G/C, after amplification,
the PCR product (314 bp) was digested with DdeI (New
England BioLabs, Hitchin, Hertfordshire, UK) restric-
tion enzyme, provided by Lab Technology Company
(Cairo, Egypt).
The digested products were detected by capillary elec-
trophoresis using QIAxcel instrument and QIAxcel DNA
High-resolution Kit provided by Clini Lab Company
(Figs 1 and 2).
sEPCR levels were estimated using ELISA kit
(WKEA, Med Supplies, China) provided by Leader
Trade Company.
Health, Inc. All rights reserved.
Copyright © 2016 Wolters Kluwer Health, Inc. All rights reserved.
EPCR genotype and risk of DVT confirmed Zoheir et al. 261
Fig. 1
1
(bp) (bp)
400 400
300 300
250 250
Pea
k si
zeP
eak size
200 200
150 150
100 10075 75
P value < 0.001
50 5025 25
500 500
15 15
2 3 4 5 6 7 8 9 10 11 12
Capillary electrophoresis showing endothelial cell protein C receptor polymorphism 6936A/G. Lanes 1, 3, 6, 7, 8, 10: homozygous wild type (AA)showing only one band at 254 bp. Lanes 2, 4, 9, 11, 12: heterozygous mutant genotype (AG) showing 2 bands at 290 bp, 254 bp. Lane 5:homozygous mutant genotype (GG) showing only one band at 290 bp.
Fig. 2
81
[bp]
A01 A02 A03 A04 A05 A06 A07 A08 A09 A10 A11 A12
400
300
250
Pea
k si
ze
200
150
10075
5025
500
15
[bp]
400
300
250
Peak size
200
150
10075
5025
P value = 0.048
500
15
2 3 4 5 6 7 9 10 11 12
Capillary electrophoresis showing endothelial cell protein C receptor polymorphism 4678G/C. Lane 1: DNA marker. Lanes 3, 4, 6 and 9:homozygous wild type (GG) showing only one band at 314 bp. Lanes 2, 5, 7, 8, 11 and 12: heterozygous mutant genotype (GC) showing 2 bands at314 bp, 252 bp. Lane 10: homozygous mutant genotype (CC) showing only one band at 252 bp.
262 Blood Coagulation and Fibrinolysis 2016, Vol 27 No 3
Table 2 Allele frequencies of the two endothelial cell protein Creceptor polymorphisms
Cases Control
Polymorphism Allele % % P OR (95% CI)
EPCR polymorphism (6936A/G)A 59.4% 78.9%G 40.6% 21.1% <0.001 2.549 1.601–4.061
EPCR polymorphism (4678G/C)G 70% 58.3%C 30% 41.7% 0.021 0.600 0.388–0.927
P<0.001 is considered highly significant. CI, confidence interval; EPCR, endo-thelial cell protein C receptor; OR, odds ratio.
Statistical methodsData were analysed using IBM SPSS advanced statistics
version 20 (SPSS Inc., Chicago, Illinois, USA). Numerical
data were expressed as mean and standard deviation or
median and range as appropriate. Qualitative data were
expressed as frequency and percentage. Chi-square test
or Fisher’s exact test was used to examine the relation
between qualitative variables. For quantitative normally
distributed data, comparison between two groups was
done using Student’s t-test. Comparison between three
groups was done using Kruskal–Wallis test [nonpara-
metric analysis of variance (ANOVA)]. Odds ratio (OR)
with 95% confidence interval (CI) were used for risk
estimation. All tests were two-tailed. A P value less than
0.05 was considered significant.
ResultsPatients in this study were 35 men (38.9%) and 55 women
(61.1%) as in controls, so patients and controls were
matched in sex (P ¼ 1.00). The age of DVT cases ranged
from 15 to 69 years with a mean valueþSD of 40.9þ 14.7.
Although the age of controls ranged from 18 to 68 years
with a mean valueþSD of 41.3þ 14.6, cases and controls
were also matched in age (P¼ 0.871). Sixty-two (68.9%)
of the studied patients had DVT on the left lower limb,
while 20 (22.2%) patients had DVT on the right lower
limb and only eight (8.9%) had DVT on both the lower
limbs. Nine (10%) of the studied patients were compli-
cated by pulmonary embolism, while the rest 81 (90%)
had no complications.
Results of endothelial cell protein C receptorpolymorphism 6936A/G genotypingResult of EPCR polymorphisms genotyping in cases and
controls are summarized in Table 1. The mutant gene
(AG, GG) showed higher risk than wild type (AA)
(P< 0.001, OR 4.125, 95% CI 2.198–7.740). The homo-
zygous mutant genotype (GG) showed higher risk than
the homozygous wild type (AA) (P¼ 0.008, OR 9.000,
95% CI 1.777–45.586). Also, the heterozygous mutant
genotype (AG) showed higher risk than the homozygous
Copyright © 2016 Wolters Kluwer
Table 1 Frequencies of endothelial cell protein C receptorpolymorphism in deep vein thrombosis patients compared withhealthy control group
Cases Controls
Polymorphism Genotype No. (%) No. (%) P
EPCR polymorphism (6936A/G) N¼90 N¼90AA 24 (26.7) 54 (60.0) <0.001AG 58 (64.4) 34 (37.8)GG 8 (8.9) 2 (2.2)
EPCR polymorphism (4678G/C) N¼90 N¼90GG 43 (47.8) 32 (35.6) 0.048GC 40 (44.4) 40 (44.4)CC 7 (7.8) 18 (20.0)
P<0.001 is considered highly significant. EPCR, endothelial cell protein Creceptor.
wild type (AA) (P< 0.001, OR 3.838, 95% CI 2.023–
7.284).
Results of endothelial cell protein C receptorpolymorphism 4678G/C genotypingThe homozygous mutant genotype (CC) showed lower
risk than the wild type (GG) (P¼ 0.014, OR 0.289, 95%
CI 0.108–0.776).
Results of allele frequencies of the two EPCR poly-
morphisms are summarized in Table 2.
Results of plasma soluble endothelial cell protein Creceptor assay by ELISAsEPCR level was measured in group (A) patients and
group (A) controls. In patients, sEPCR ranged from 110.0
to 2833.5 ng/l with a median value of 358.5, while in
controls, sEPCR ranged from 74.0 to 1274.0 ng/l with a
median value of 306.5, which was statistically insignif-
icant (P¼ 0.282). A highly significant relation was only
detected between EPCR polymorphism (6936A/G) and
sEPCR levels (Tables 3 and 4) (Figs 3 and 4).
No association was detected between EPCR genotype
and presence of other risk factors of DVT (pregnancy,
puerperium and contraceptives treatment) among the
studied groups (Table 5).
Health, Inc. All rights reserved.
Table 3 Relationship between soluble endothelial cell protein Creceptor and endothelial cell protein C receptor polymorphism(6936A/G)
EPCR polymorphism (6936A/G)
sEPCR (ng/l)
PRange Median
Cases <0.001Homozygous wild AA 110–385 251Heterozygous mutant AG 153–959.5 419Homozygous mutant GG 324–2833.5 823Mutant genotypes (AG and GG) 153.6–2833.5 424.5
Controls <0.001Homozygous wild AA 74–391.5 192.8Heterozygous mutant AG 258–963 576Homozygous mutant GG 1092–1274 1183.3Mutant genotypes (AG and GG) 258–1274 595
P<0.001 is considered highly significant. EPCR, endothelial cell protein Creceptor; sEPCR, soluble endothelial cell protein C receptor.
EPCR genotype and risk of DVT confirmed Zoheir et al. 263
Table 4 Relationship between soluble endothelial cell protein Creceptor and endothelial cell protein C receptor polymorphism(4678G/C)
EPCR polymorphism (4678G/C)
sEPCR (ng/l)
PRange Median
CasesHomozygous wild GG 173.9–2833.5 394.5Heterozygous mutant GC 110–1037.5 345Homozygous mutant CC 153.6-617 536.5 0.936Mutant genotypes (CG and CC) 110–1037.5 345
ControlsHomozygous wild GG 74–391.5 192.8Heterozygous mutant GC 258–963 576 0.475Homozygous mutant CC 105–595 290Mutant genotypes (CG and CC) 105–1274 302
P<0.001 is considered highly significant. EPCR, endothelial cell protein Creceptor; sEPCR, soluble endothelial cell protein C receptor.
Fig. 4
P value = 0.936
CC GC GG
4678G/C
0
500
1000
1500
2000
2500
3000
sEP
CR
DVT group
Relation between soluble endothelial cell protein C receptor level andendothelial cell protein C receptor polymorphism (4678G/C) in deepvein thrombosis cases.
DiscussionIn the present study, we found higher frequencies of the
mutant EPCR (6936A/G) genotypes (AG, GG) in DVT
cases (73.3%) than the control group (40.0%); it showed
higher risk to DVT by four-fold than the wild type (AA)
(P< 0.001, OR 4.125, 95% CI 2.198–7.740). The homo-
zygous mutant genotype (GG) showed increased risk of
DVT by nine-fold compared with the wild type (AA).
Also, the mutant allele (G) showed higher risk than the
wild allele (A) (P< 0.001, OR 2.549, 95% CI 1.601–
4.061).
That was in agreement with the result of studies by
Saposnik et al. [18] and Yin et al. [19].
On the contrary, Xu-dong et al. [7] and Medina et al. [20]
found no significant difference in the frequency of the
GG genotype between the cases and controls. That could
be referred to low frequency of the GG genotype among
their studied groups. These different results could be
Copyright © 2016 Wolters Kluwe
Fig. 3
P value < 0.001
GG GA AA
6936A/G
0
500
1000
1500
2000
2500
3000
sEP
CR
DVT group
Relation of soluble endothelial cell protein C receptor level andendothelial cell protein C receptor polymorphism (6936A/G) in deepvein thrombosis cases.
explained by the fact that genotypes show different
distribution among different ethnic groups.
Due to the difficulty found in selecting patients with
primary DVT and no secondary risk factors, we decided
to include patients with common risk factors (pregnancy,
puerperium and contraceptives treatment). Such factors
are commonly found among normal populations. So, our
study included 17 cases of DVT following pregnancy,
puerperium or contraceptives treatment and 30 normal
women with a history of previous multiple pregnancies or
taking contraceptive pills without complications.
By comparing EPCR 6936A/G genotype in the study
participants with and without these risk factors, there
was no significant difference. So, the role of the G allele
in pathogenesis of DVT is independent of these risk
factors. But the reverse could be incorrect, that is EPCR
genotype could increase the risk of thrombosis during
pregnancy, puerperium or contraceptive treatment. It
could augment the condition of increased resistance to
APC that is normally observed in the second and third
trimesters [21]. Women with inherited thrombophilia had
shown an increased risk of thrombosis up to eight-fold [22].
EPCR 6936A/G causes conformational changes in the
protein due to serine to glycine substitution at residue
219 that is located in the transmembrane domain and
became adjacent to another Gly at residue 218. The Gly–
Gly interaction affects the stability of the helical structure
of transmembrane domain such that the cleavage site is
exposed. Increased shedding of membrane-attached
EPCR occurs after cleavage by matrix metalloprotei-
nases, leading to increased levels of sEPCR in the cir-
culation and subsequently reduced APC because sEPCR
inhibits both APC activity and PC activation by compet-
ing for PC with membrane-associated EPCR [23].
r Health, Inc. All rights reserved.
264 Blood Coagulation and Fibrinolysis 2016, Vol 27 No 3
Table 5 Association between endothelial cell protein C receptorpolymorphism genotypes and risk factors
EPCR polymorphism (6936A/G)
Risk factors
PNo 60 (100%) Yes 30 (100%)
CasesWild-type genotype AA 16 (26.7%) 8 (73.3%) 1.000Mutant genotypes (AG and GG) 44 (73.3%) 22 (26.7%)
EPCR polymorphism (4678G/C) No 60 (100%) Yes 30 (100%) P
ControlsWild-type genotype GG 28 (46.7%) 15 (50%) 0.765Mutant genotypes (GC and CC) 32 (53.3%) 15 (50%)
EPCR, endothelial cell protein C receptor.
On the basis of the previous theory, we analysed sEPCR
levels in relation to EPCR genotypes, and higher levels
were associated with the mutant genotypes (AG and GG).
These results are inconsistent with the previous
researches [7,14,20,24].
With regard to EPCR polymorphism 4678G/C, the homo-
zygous mutant genotype (CC) showed lower risk than the
homozygous wild type (GG), and this was statistically
significant (P¼ 0.014, OR 0.289, 95% CI 0.108–0.776),
that is the homozygous mutant genotype (CC) decreased
the risk to DVT by 0.289 compared with the wild type
(GG). Analysis of sEPCR in relation to EPCR poly-
morphism 4678G/C genotypes in DVT patients revealed
no significant association.
Again, these results were not affected by previously
mentioned risk factors.
In agreement to our result, Karabıyık et al. [24] reported
that 4678G/C may have protective effects against VTE
(P¼ 0.0175, OR 0.82, 95% CI 0.31–2.20). Also, Medina
et al. [20] reported that the carriers of the CC genotype
had a reduced risk of VTE (OR 0.59, 95% CI 0.41–0.84).
Finally, Medina et al. [25] confirmed that individuals
carrying EPCR polymorphism 4678G/C have reduced
VTE risk, increased plasma activated PC levels and
reduced plasma sEPCR levels and those with homozy-
gous mutant EPCR (6936A/G) genotype have an
increased VTE risk and increased plasma sEPCR levels.
No significance relation was found between EPCR gen-
otype and age, sex or family history.
The mechanism explaining the protective role of 4678C
allele against venous thrombosis remains to be identified.
Increased level of APC has been reported in association
with 4678C allele. However, it has to be investigated
whether it causes a rise in APC levels by itself or it is
linked to other genetic variations affecting coagulation or
fibrinolytic system [18].
In conclusion, our data suggest that 6936A/G polymorph-
ism is a risk factor for DVT and is associated with
elevated plasma levels of sEPCR, while 4678G/C
Copyright © 2016 Wolters Kluwer
polymorphism plays a role in protection against DVT
and had no effect on sEPCR level. Larger scale studies
are recommended to support our results.
Despite some limitations, mainly lack of financial sup-
ports that limit the number of our studied groups, this
study still contributes to the understanding of the role of
EPCR polymorphisms in the development of DVT and
provides insight to their frequencies in Egypt.
AcknowledgementsConflicts of interestThere are no conflicts of interest.
References1 Furie B, Furie BC. Mechanisms of thrombus formation. N Engl J Med 2008;
359:938–949.2 Mahdy AM, Webster NR. Perioperative systemic haemostatic agents. Br J
Anaesth 2004; 93:842–858.3 Rosendaal FR. Venous thrombosis: a multicausal disease. Lancet 1999;
353:1167–1173.4 Heit JA, Heit JA. Thrombophilia: common questions on laboratory
assessment and management. Hematology Am Soc Hematol EducProgram 2007; 1:127–135.
5 Gader AA, Haggaz A, Adam I. Epidemiology of deep venous thrombosisduring pregnancy and puerperium in Sudanese women. Vasc Health RiskManag 2009; 5:85–87.
6 Simpson EL, Lawrenson RA, Nightingale AL, Farmer RD. Venousthromboembolism in pregnancy and the puerperium: incidence andadditional risk factors from a London perinatal database. BJOG 2001;108:56–60.
7 Xu-dong C, Lu T, Ming L, Wei J, Hong-kun Z, Cheng-fei Z. Relationshipbetween endothelial cell protein C receptor gene 6936A/G polymorphismsand deep venous thrombosis. Chin Med J 2011; 124:72–75.
8 Franco RF, Reitsma PH. Genetic risk factors for venous thrombosis.Human Genet 2001; 109:369–384.
9 Pestana CI, Torres A, Blanco S, Rojas MJ, Mendez C, Lopez JL, et al. FactorV Leiden and the risk of venous thrombosis, myocardial infarction, andstroke: a case-control study in Venezuela. Genet Test Mol Biomarkers2009; 13:537–542.
10 Prandoni P. Acquired risk factors for venous thromboembolism in medicalpatients. Pathophysiol Haemost Thromb 2006; 35:128–132.
11 Rosendaal FR, Reitsma PH. Genetics of venous thrombosis. J ThrombHaemost 2009; 7 (Suppl 1):301–304.
12 Gandrille S. Endothelial cell protein C receptor and the risk of venousthrombosis. Haematologica 2008; 93:812–816.
13 Saposnik B, Lesteven E, Lokajczyk A, Esmon CT, Aiach M, Gandrille S.Alternative mRNA is favored by the A3 haplotype of the EPCR genePROCR and generates a novel soluble form of EPCR in plasma. Blood2008; 111:3442–3451.
14 Uitte de Willige S, van Marion V, Rosendaal FR, Vos HL, De Visser MCH,Bertina RM. Haplotypes of the EPCR gene, plasma sEPCR levelsand the risk of deep venous thrombosis. J Thromb Haemost 2004;2:1305–1310.
15 Stearns-Kurosawa DJ, Swindle K, D’Angelo A, Della Valle P, Fattorini A,Caron N, et al. Plasma levels of endothelial protein C receptor respond toanticoagulant treatment. Blood 2002; 99:526–530.
16 Sesin CA, Yin X, Esmon CT, Buyon JP, Clancy RM. Shedding ofendothelial protein C receptor contributes to vasculopathy andrenal injury in lupus: in vivo and in vitro evidence. Kidney Int 2005;68:110–120.
17 Medina P, Navarro S, Estelles A, Vaya A, Bertina RM, Espana F.Influence of the 4600A/G and 4678G/C polymorphisms in theendothelial protein C receptor (EPCR) gene on the risk of venousthromboembolism in carriers of the factor V Leiden mutation. ThrombHaemost 2005; 94:389–395.
18 Saposnik B, Reny JL, Gausem P, Emmerich J, Aiach M, Gandrille S. Ahaplotype of the EPCR gene is associated with increased plasma levels ofsEPCR and is a candidate risk factor for thrombosis. Blood 2004;103:1311–1318.
19 Yin G, Jin X, Ming H, Zheng X, Zhang D. Endothelial cell protein C receptorgene 6936A/G polymorphism is associated with venousthromboembolism. Exp Ther Med 2012; 3:989–992.
Health, Inc. All rights reserved.
EPCR genotype and risk of DVT confirmed Zoheir et al. 265
20 Medina P, Navarro S, Estelles A, Vaya A, Woodhams B, Mira Y, et al.Contribution of polymorphisms in the endothelial protein C receptor geneto soluble endothelial protein C receptor and circulating activated protein Clevels, and thrombotic risk. Thromb Haemost 2004; 91:905–911.
21 Ginsberg JS, Bates SM. Management of venous thromboembolism duringpregnancy. J Thromb Haemost 2003; 1:1435–1442.
22 Friederich PW, Sanson BJ, Simioni P, Zanardi S, Huisman MV, Kindt I, et al.Frequency of pregnancy related venous thromboembolism in anticoagulantfactor-deficient women: implications for prophylaxis. Ann Intern Med 1996;125:955–960.
Copyright © 2016 Wolters Kluwe
23 Villoutreix BO, Blom AM, Dahlback B. Structural prediction and analysis ofendothelial cell protein C/activated protein C receptor. Protein Eng 1999;12:833–840.
24 Karabıyık A, Yılmaz E, Egin Y, Akar N. The effects of endothelial protein Creceptor gene polymorphisms on the plasma sEPCR level in venousthrombosis patients. Turk J Hematol 2012; 29:55–62.
25 Medina P, Navarro S, Bonet E, Martos L, Estelles A, Bertina R, et al.Functional analysis of two haplotypes of the human endothelialprotein C receptor gene. Arterioscler Thromb Vasc Biol 2014;34:684–690.
r Health, Inc. All rights reserved.
