Page 1 of 14

Article DOI: https://doi.org/10.3201/eid2602.190505

Multiplex Mediator Displacement Loop-Mediated Isothermal Amplification for Detection of Treponema pallidum and

Haemophilus ducreyi Appendix

Assay Optimization

Oligonucleotide and Primer Design

For the Treponema pallidum and Haemophilus ducreyi loop-mediated isothermal

amplification (TPHD-LAMP) assay, we redesigned and further optimized oligonucleotides

previously described by Knauf et al. (1) for detecting T. pallidum and by Becherer et al. (2) for

detecting H. ducreyi to improve assay performance. In brief, we designed primers from GenBank

sequences of the 16S ribosomal RNA gene of H. ducreyi and the polA gene of T. pallidum using

PrimerExplorer V5 (Fujitsu, http://primerexplorer.jp) software.

Mediator displacement (MD) LAMP (2) for the simultaneous detection of multiple

targets requires MD probes and fluorogenic universal reporter (UR) molecules for signal

generation. An MD probe is comprised of a universal mediator (Med) combined with a modified

Loop F (LF) or Loop B (LB) primer. The modified primer (LB/LF_Medc) contains target-

specific primer sequences (LF or LB) at the 3′-end and a universal sequence at the 5′-end (Medc)

that is complementary to the mediator. We designed MD probes in silico with Visual OMP

version 7.8.42.0 (DNA Software, https://www.dnasoftware.com) software, as described

previously (2), and used URs described by Lehnert et al. (4) and Becherer et al. (2).

Oligonucleotides were synthesized and cartridge purified by Biomers (https://www.biomers.net)

(Appendix Table 1).

Page 2 of 14

LAMP Primer Sets

The MD LAMP included 6 primers per target, as described by Nagamine et al. (5), and an

MD probe comprised of LB_Medc or LF_Medc, a Med, and a UR (2). We list oligonucleotides

and UR sequences in Appendix Table 1. Standard concentration (1×) of primers, Med probes,

and UR for TPHD-LAMP is 1.6 μmol/L of each forward inner primer (FIP) and backward inner

primer (BIP), 0.6 µmol/L LF and 0.2 µmol/L LF_Medc, or 0.6 µmol/L LB and 0.2 µmol/L

LB_Medc, 0.2 µmol/L of each F3 and B3, 0.1 µmol/L Med, and 0.05 μmol of UR. We used the

same 6-primer set for singleplex LAMP assays, which contained 1.6 µmol/L of each FIP and

BIP, 0.8 µmol/L of each LF and LB, and 0.2 µmol/L of each F3 and B3. We performed the

singleplex LAMP assays using the intercalating dye SYBR green.

Primer Titration for TPHD-LAMP

To simultaneously amplify 2 targets in 1 reaction vessel successfully, both primer sets

must perform equally. In a biplex LAMP reaction with an unbalanced assay, the more efficient

assay will inhibit the amplification of the second target partially by binding the polymerase to the

amplicon (3). Experiments using the standard 1× concentration of primers, mediator, and UR

showed that the amplification of H. ducreyi is faster than the amplification of T. pallidum (data

not shown). Consequently, the assay efficiency for H. ducreyi amplification is higher and might

influence the amplification of T. pallidum. We also performed target titration and found that low

T. pallidum concentrations, 3×103 copies/reaction, combined with high H. ducreyi

concentrations, 3×105 copies/reaction, led to false-negative signals for T. pallidum (Appendix

Table 2).

To solve this problem, we optimized the primer, Med, and UR concentrations used in

TPHD-LAMP to focus on sensitivity and time to positive (tp) and increase the support of the

amplification of T. pallidum. We increased the concentration of primers, Med, and UR of the T.

pallidum component to 1.25× and 1.5× and left the concentrations for the H. ducreyi component

at the standard 1× concentration per reaction. Both concentrations for T. pallidum component

showed better results; the concentration of 1.25× demonstrated best results and tp. When we

combined 3×103 copies/reaction of T. pallidum with 3×105 copies/reaction of H. ducreyi, we

could still detect positive signals for both targets (data not shown). We fixed 1.25× concentration

for T. pallidum component and 1× concentration for H. ducreyi component of the TPHD LAMP

and used these for the subsequent testing of clinical samples (Appendix Table 3).

Page 3 of 14

Plasmid Design

To determine analytical performance parameters of the assay and primer optimization, we

obtained plasmid targets from Eurofins Scientific (https://www.eurofins.com) to use as

quantified standard. Plasmids contained 300 bp of a defined conserved region of the 16S gene for

H. ducreyi and the polA gene for T. pallidum. We diluted plasmid DNA in 10 mM Tris (pH 8) to

adjust concentrations.

Clinical Performance of the TPHD-LAMP

Reference Assays

We performed a TaqMan real-time PCR targeting a 67-bp fragment of the T. pallidum

polymerase I (polA) gene using previously described primers and probes (7). We used a plasmid

containing the amplified fragment of the polA gene as a quantification standard covering the

range 101–106 gene copies, but modified the reaction mix. In brief, the reaction encompassed 10

µL TaqMan Universal Master Mix II without Uracil-N glycosylase (Applied Biosystems,

https://www.thermofisher.com) and 1.8 µL each of 10 µmol/L primer and the hydrolysis probe.

We completed the reaction with 1 µL of the genomic DNA sample, independent of the DNA

concentration. We used molecular-grade water to adjust the reaction volume to 20 µL and used

the following cycling conditions: 50°C for 2 m, 95°C for 10 m, then 40 cycles each at 95°C for

15 s and 60°C for 60 s.

We retrieved ortholog sequence data of the Haemophilus 16S rRNA gene from GenBank

(Appendix Figure 1, Appendix Table 4) and aligned the genes by using Geneious R11

(https://www.geneious.com). We used V-Xtractor

(http://www.cmde.science.ubc.ca/mohn/software.html), a Perl-based high-throughput software

tool, to locate the hypervariable regions of the 16S rRNA sequences using the Hidden Marcov

Models option. In silico, we searched for regions that discriminate H. ducreyi from ortholog 16S

rRNA gene sequences. We found suitable target sequences in the V8 region of the 16S rRNA

gene and designed primers to target that region. Prior to use in the qPCR, we ran a PCR using the

newly designed sense primer 5′-TAT ACA GAG GGC GGC AAA CC and the antisense primer

5′-CCA ATC CGG ACT TAG ACG TAC. Sanger sequencing of the 66-bp product confirmed

the amplification of the targeted sequence of the 16S rRNA gene of H. ducreyi. We cloned the

Page 4 of 14

product and used it to generate a plasmid quantification standard for the qPCR covering a 101–

106 gene copies. Subsequently, we designed a hydrolysis probe FAM-5′ CAA AGG GGA GCG

AAT CTC AC-TAMRA and used it to perform the TaqMan qPCR using the same reaction mix

and cycling conditions as described for the polA qPCR.

LAMP and qPCR assays used the same DNA extracts and included appropriate negative

controls. Because of sample restrictions, we analyzed samples as duplicates. All reactions of the

polA and H. ducreyi qPCR were run on a StepOnePlus Real-Time PCR System (Applied

Biosystems). We analyzed raw data by using the StepOne Software version 2.3 (Life

Technologies, https://www.thermofisher.com). We considered positive reactions to be those with

exponential increase of delta-Rn, a value that corresponds to the intensity of fluorescence. We

excluded samples that increased in fluorescence above the threshold but failed exponential

increase.

Validation of TPHD-LAMP in Clinical Samples

To validate the TPHD-LAMP, we used clinical samples to determine the sensitivity and

specificity for T. pallidum and H. ducreyi, which we calculated by using the following formulas:

% Sensitivity = TPTP+FN

× 100

% Specificity = TNTN+FP

× 100

Positive predictive value (%) = TPTP+FP

× 100

Negative predictive value (%) = TNTN+FN

× 100

where TP (true positive) means positive results were confirmed with PCR; TN (true

negative) means negative results were confirmed with PCR; FP (false positive) means PCR

results were negative; and FN (false negative) means PCR results were positive. We calculated

positive predictive values and negative predictive values for TP, TN, FP, and FN of TPHD-

LAMP of clinical samples (Appendix Table 5) and for singleplex LAMP assays of clinical

samples (Appendix Table 6).

Page 5 of 14

Assessment of Analytical Performance

Analytical Sensitivity and Specificity

We described how we calculated values for the limit of detection (LOD) of the TPHD-

LAMP in the main article (Appendix Figure 2). We determined the linearity of the biplex assays,

containing both targets, was R2(H. ducreyi) = 0.97 and R2(T. pallidum) = 0.95.

We generated analytical specificity data by in silico analysis. Then we tested a panel

including Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas

aeruginosa, Enterobacter cloacae, Salmonella enterica (Paratyphi and Typhi), Streptococcus

pneumoniae, Streptococcus pyogenes, Staphylococcus aureus, Corynebacterium diphtheria,

Corynebacterium ulcerans, Proteus mirabilis, and Enterococcus faecalis. We tested the

specificity of primer sets for the single T. pallidum and H. ducreyi components of the TPHD-

LAMP, and for TPHD-LAMP assay. In all cases, assays were negative within 60 m for single

components (data not shown) and for TPHD-LAMP (Appendix Figure 3), demonstrating high

analytical specificity.

Interassay and Intraassay Variability

Interassay variability describes reproducibility and intraassay variability describes

repeatability of assays. We calculated interassay and intraassay variability of the TPHD-LAMP

assay by using 3 batches of biplex LAMP mix, individually prepared on 3 separate days,

processed in different runs, and ran each batch in 3 replicates. First, we evaluated TPHD-LAMP

assays that contained 3×104 copies/reaction of a single target; then we tested them for

simultaneous detection of both targets in the sample. We determined tp as the time of the

maximum increase of fluorescence, calculated by the first derivative of the fluorescence

intensity, as previously described (2,6). We calculated the SD for tp by the scattering of

measurement values between triplicates.

For assays containing a single target, the TPHD-LAMP interassay coefficients of

variation (CVs) were 0.9 % for H. ducreyi and 2.6 % for T. pallidum. The intraassay CVs were 0

for H. ducreyi and 3.5 % for T. pallidum. For assays containing both pathogens, the interassay

CVs were 0.2 % for H. ducreyi and 2.8 % for T. pallidum and the intraassay CVs were 0.5 % for

H. ducreyi and 2.0 % for T. pallidum. The tp for H. ducreyi were almost constant around 7 m

Page 6 of 14

independent of the presence of T. pallidum (Appendix Figure 4). In contrast, tp for T. pallidum

increased from 11.4 m ±0.4 m in assays without H. ducreyi to 30.4 m ± 0.8 m for TPHD-LAMP

in assays containing both targets.

References

1. Knauf S, Lüert S, Šmajs D, Strouhal M, Chuma IS, Frischmann S, et al. Gene target selection for loop-

mediated isothermal amplification for rapid discrimination of Treponema pallidum subspecies.

PLoS Negl Trop Dis. 2018;12:e0006396. PubMed https://doi.org/10.1371/journal.pntd.0006396

2. Becherer L, Bakheit M, Frischmann S, Stinco S, Borst N, Zengerle R, et al. Simplified real-time

multiplex detection of loop-mediated isothermal amplification using novel mediator displacement

probes with universal reporters. Anal Chem. 2018;90:4741–8. PubMed

https://doi.org/10.1021/acs.analchem.7b05371

3. SantaLucia J Jr. Physical principles and visual-OMP software for optimal PCR design. Methods Mol

Biol. 2007;402:33–4. PubMed https://doi.org/10.1007/978-1-59745-528-2_1

4. Lehnert M, Kipf E, Schlenker F, Borst N, Zengerle R, von Stetten F. Fluorescence signal-to-noise

optimisation for real-time PCR using universal reporter oligonucleotides. Anal Methods.

2018;10:3444–54. https://doi.org/10.1039/C8AY00812D

5. Nagamine K, Hase T, Notomi T. Accelerated reaction by loop-mediated isothermal amplification using

loop primers. Mol Cell Probes. 2002;16:223–9. PubMed https://doi.org/10.1006/mcpr.2002.0415

6. Martineau RL, Murray SA, Ci S, Gao W, Chao S-H, Meldrum DR. Improved performance of loop-

mediated isothermal amplification assays via swarm priming. Anal Chem. 2017;89:625–32.

PubMed https://doi.org/10.1021/acs.analchem.6b02578

7. Chen C-Y, Chi K-H, George RW, Cox DL, Srivastava A, Rui Silva M, et al. Diagnosis of gastric

syphilis by direct immunofluorescence staining and real-time PCR testing. J Clin Microbiol.

2006;44:3452–6. PubMed https://doi.org/10.1128/JCM.00721-06

Page 7 of 14

Appendix Table 1. Sequences of primers, mediator displacement probes, and universal reporters for loop-mediated isothermal amplification for Treponema pallidum and Haemophilus ducreyi* Target, description Sequence, 5′→3′ Reference Haemophilus ducreyi F3 ATGTTGGGTTAAGTCCCGC This work B3 TCCAATCCGGACTTAGACGT This work FIP CATCCCCACCTTCCTCCAGTTTTTATCCTTTGTTGCCAGCATG This work BIP CATGGCCCTTACGAGTAGGGCCCCCTTTGCAGGTTTGCC This work LF GCAGTCTCCTTTGAGTTCCCA This work LB TACACACGTGCTACAATGGCg This work LB_Medc1 GGTCGTAGAGCCCAGAACGAGATGAGTGGTACACACGTgcTACAATGGCg This work Med1 CCACTCATCTCGTTCTGGGCTCTACGACC This work UR1 BMN-Q-535-ATTGCGGGAGATGAGACCCGCAA-dTFAM-

TGTTGGTCGTAGAGCCCAGAACGA-C3 (2,6)

Treponema pallidum F3 GATTGGTCCTAAGACGGC This work B3 GGAATACAACAGGAATCTTCGA This work FIP CAGCGCTTCTTTTAAGGAATAGGTATGCACATCTTCTCCACTG This work BIP TGTGGGAAGAAAGATGCATTTTTTTAAAAAACACATGGTACATCGT This work LF CGATAAATACCATCAAGTGTGCCA This work LB CGTTCACTCATTGAGTTGCGTG This work LF_Medc2 CACTGACCGAACTGAGCTCCTGAGGCATGGTTTTCGATAAATACCATCAAGTGTGCCA This work Med2 CCATGCCTCAGGAGCTCAGTTCGGTCAGTG (2)

UR2 BMN-Q-535-CACCGGCCAAGACGCGCCGG-dT-Atto-647N-GTGTTCACTGACCGAACTGGAGCA-C3

(2,6)

*Underlined sequences illustrate complementary regions between LF/LB_Medc and mediator (Med). Bold text indicates nucleotides in complementary regions of mediator and universal reporters. Indices 1 and 2 indicate complementary sequences in Med and Medc or UR. BIP, backward inner primer; FIP, forward inner primer; LB, Loop B; LF, Loop F; UR, universal reporter.

Appendix Table 2. Positive results for Treponema pallidum and Haemophilus ducreyi in 3 TPHD-LAMP assays before primer titration* T. pallidum, concentration H. ducreyi, concentration No. H. ducreyi–positive No. T. pallidum–positive 3×103 copies/reaction 3×105 copies/reaction 3 0 3×105 copies/reaction 3×105 copies/reaction 3 3 3×105 copies/reaction 3×103 copies/reaction 3 3 3×103 copies/reaction 3×103 copies/reaction 3 3 3×104 copies/reaction 3×104 copies/reaction 3 3 0 0 0 0 *Positive results reflect number of positive results in 3 reactions at each combined concentration of Treponema pallidum and Haemophilus ducreyi loop-mediated isothermal amplification (LAMP).

Appendix Table 3. Primer composition for the biplex loop-mediated isothermal amplification of Treponema pallidum and Haemophilus ducreyi for the clinical validation. Target Oligonucleotide Concentration, µmol/L H. ducreyi F3 0.20

B3 0.20 FIP 1.60 BIP 1.60 LF 0.80 LB 0.60

LB _Medc1 0.20 Med1 0.10

T. pallidum F3 0.25 B3 0.25 FIP 2.00 BIP 2.00 LF 0.75 LB 1.00

LF _Medc2 0.25 Med2 0.13

Page 8 of 14

Appendix Table 4. Ortholog sequence data of the Haemophilus 16S rRNA gene retrieved from GenBank and used for the H. ducreyi TaqMan qPCR design GenBank accession no. Pathogen Strain no. DQ851143_1 Haemophilus simiae ROG53 AF224307_1 Haemophilus quentini NA CP008740_1 Haemophilus influenzae 2019 CP008740_1_2 Haemophilus influenzae 2019 AY613457_1 Haemophilus influenzae M8943 AY613451_1 Haemophilus influenzae M9741 CP007470_1_6 Haemophilus influenzae 477 CP007470_1_5 Haemophilus influenzae 477 CP007470_1_4 Haemophilus influenzae 477 CP007470_1_3 Haemophilus influenzae 477 CP007470_1 Haemophilus influenzae 477 CP007470_1_2 Haemophilus influenzae 477 EF399173_1 Unclutured bacterium SJTU_F_12_59 AB597550_1 Unclutured gamma proteobacterium NA AB597543_1 Unclutured gamma proteobacterium NA AB597538_1 Unclutured gamma proteobacterium NA FQ312002_1_6 Haemophilus parainfluenza T3T1 FQ312002_1_2 Haemophilus parainfluenza T3T1 FQ312002_1 Haemophilus parainfluenza T3T1 FQ312002_1_5 Haemophilus parainfluenza T3T1 CP006956_1 Bibersteinia trehalosi USDA-ARS-USMARC-190 CP006956_1_2 Bibersteinia trehalosi USDA-ARS-USMARC-190 CP006956_1_6 Bibersteinia trehalosi USDA-ARS-USMARC-190 CP006955_1_4 Bibersteinia trehalosi USDA-ARS-USMARC-189 CP003745_1_3 Bibersteinia trehalosi USDA-ARS-USMARC-192 CP006955_1_2 Bibersteinia trehalosi USDA-ARS-USMARC-189 CP006955_1 Bibersteinia trehalosi USDA-ARS-USMARC-189 CP003745_1 Bibersteinia trehalosi USDA-ARS-USMARC-192 CP006944_1 Mannheimia varigena USDA-ARS-USMARC-1312 CP006944_1_5 Mannheimia varigena USDA-ARS-USMARC-1312 CP006953_1_3 Mannheimia varigena USDA-ARS-USMARC-1388 CP006953_1 Mannheimia varigena USDA-ARS-USMARC-1388 CP006943_1_2 Mannheimia varigena USDA-ARS-USMARC-1296 CP006943_1_5 Mannheimia varigena USDA-ARS-USMARC-1296 CP006943_1_6 Mannheimia varigena USDA-ARS-USMARC-1296 CP006943_1_3 Mannheimia varigena USDA-ARS-USMARC-1296 LN795822_1 Mannheimia sp. MG13 AF053895_1 Mannheimia sp. HPA102 AF053890_1 Mannhaimia glucosida UT18 KU051693.1 Mannheimia haemolytica A2 CP011099_1_6 Mannheimia haemolytica 89010807N CP004753_2_6 Mannheimia haemolytica USDA-ARS-USMARC-185 CP005972_1_6 Mannheimia haemolytica D153 CP023044_1_4 Mannheimia haemolytica 191 CP006574_1_4 Mannheimia haemolytica D174 CP023043_1_2 Mannheimia haemolytica 193 CP005972_1 Mannheimia haemolytica D153 DQ301920_1 Mannheimia haemolytica PHL213 CP005383_1_6 Mannheimia haemolytica M42548 CP006957_2_6 Mannheimia haemolytica USDA-ARS-USMARC-184 CP006957_2_4 Mannheimia haemolytica USDA-ARS-USMARC-184 CP006957_2_2 Mannheimia haemolytica USDA-ARS-USMARC-184 GQ358868_1 Uncultured bacterium clone 8837-D0-O-7D M75079_1 Haemophilus ducreyi 35000 M75084_1 Haemophilus ducreyi KC57 M75078_1 Haemophilus ducreyi CPI 542 CP015434_1_5 Haemophilus ducreyi GHA9 CP015434_1 Haemophilus ducreyi GHA9 AE017143_1_2 Haemophilus ducreyi 35000 ST16SrRNA_3_1490596 Haemophilus ducreyi 1490596 AF525028_1 Haemophilus ducreyi isolate Amsterdam CP015432_1 Haemophilus ducreyi GHA5 CP015426_1_2 Haemophilus ducreyi VAN3 NR_044741_1 Haemophilus ducreyi CIP 54.2 CP015425_1_2 Haemophilus ducreyi VAN2 NZ_CP015429 Haemophilus ducreyi GHA1 CP015430_1_5 Haemophilus ducreyi GHA2

Page 9 of 14

GenBank accession no. Pathogen Strain no. CP015430_1_6 Haemophilus ducreyi GHA2 CP015430_1 Haemophilus ducreyi GHA2 AY513483_1 Haemophilus ducreyi ATCC 33921 HE681373_1 Uncultured bacterium clone 7q_13 AY005034_1 Haemophilus sp. clone BJ021 AF224283_1 Actinobacillus pleuropneumoniae MCCM 00189 LK985384_1 Haemophilus parahaemolyticus isolate G321 AF224285_1 Actinobacillus capsulatus CCUG 37035 CP009158_1_6 Haemophilus parasuis SH03 CP005384_1 Haemophilus parasuis ZJ0906 CP001321_1 Haemophilus parasuis SH0165 CP001321_1_6 Haemophilus parasuis SH0165 CP001321_1_4 Haemophilus parasuis SH0165 CP001321_1_5 Haemophilus parasuis SH0165 CP001321_1_3 Haemophilus parasuis SH0165 CP005384_1_3 Haemophilus parasuis ZJ0906 CP005384_1_4 Haemophilus parasuis ZJ0906 CP005384_1_5 Haemophilus parasuis ZJ0906 CP020085_1_5 Haemophilus parasuis CL120103 CP015099_1_5 Haemophilus parasuis SC1401 CP020085_1_6 Haemophilus parasuis CL120103 CP015099_1_2 Haemophilus parasuis SC1401 CP015099_1 Haemophilus parasuis SC1401 CP020085_1_4 Haemophilus parasuis CL120103 CP020085_1 Haemophilus parasuis CL120103 AB559648_1 Uncultured bacterium clone c_GA_H2 AF371853_1 Uncultured bacterium clone bp-2130-s959–2 DQ926692_1 Actinobacillus porcitonsillarum 73706 DQ926691_1 Actinobacillus porcitonsillarum 71123 DQ381154_1 Pasteurella caballi NSVL 84679 AF224291_1 Pasteurella caballi MCCM 00841 HF565184_1 Actinobacillus sp. MK-2012 HF565188_1 Actinobacillus sp. MK-2012 HF565186_1 Actinobacillus sp. MK-2012 KC834743_1 Actinobacillus pleuropneumoniae TJ12 KC834744_1 Actinobacillus pleuropneumoniae HB13 NR_115546_2 Actinobacillus pleuropneumoniae Shope 4074 D30030_1 Actinobacillus pleuropneumoniae NA CP022715_1_2 Actinobacillus pleuropneumoniae KL 16 CP022715_1_4 Actinobacillus pleuropneumoniae KL 16 CP000569_1_3 Actinobacillus pleuropneumoniae L20 serotype 5b CP000569_1_2 Actinobacillus pleuropneumoniae L20 serotype 5b CP000569_1 Actinobacillus pleuropneumoniae L20 serotype 5b CP001091_1_6 Actinobacillus pleuropneumoniae serotype 7, str. AP76 CP000687_1_6 Actinobacillus pleuropneumoniae serotype 3, str. JL03 CP000687_1_5 Actinobacillus pleuropneumoniae serotype 3, str. JL03 CP001091_1_4 Actinobacillus pleuropneumoniae serotype 7, str. AP76 D30032_1 Actinobacillus pleuropneumoniae NA D30031_1 Actinobacillus pleuropneumoniae NA AY749139_1 Actinobacillus genomo sp. 52418–03 AY749138_1 Actinobacillus genomo sp. 52418–03 AF247722_1 Actinobacillus lignieresii F 127 AY749137_1 Actinobacillus genomo sp. 24593–01 AF247723_1 Actinobacillus lignieresii F 264 CP003875_1_6 Actinobacillus suis H91–0380 LT906456_1 Actinobacillus suis NCTC12996 LT906456_1_3 Actinobacillus suis NCTC12996 CP009159_1_6 Actinobacillus suis ATCC 33415 CP007715_1_4 Actinobacillus equuli subsp. equuli 19392 CP007715_1_3 Actinobacillus equuli subsp. equuli 19392 AY749144_1 Actinobacillus equuli subsp. haemolyticus 27368–01 AY749142_1 Actinobacillus equuli subsp. haemolyticus 23611–01 AY749141_1 Actinobacillus equuli subsp. haemolyticus 23596–01 CP007715_1_2 Actinobacillus equuli subsp. equuli 19392 AY749140_1 Actinobacillus equuli subsp. haemolyticus 23337–01

Page 10 of 14

Appendix Table 5. Sensitivity and specificity of biplex loop-mediated isothermal amplification of Treponema pallidum and Haemophilus ducreyi in samples from 293 patients with suspected T. pallidum infection Characteristics Sample size, no. Treponema pallidum, no. Haemophilus ducreyi, no. All samples 293 True positive 50 142 True negative 224 116 False positive 10 21 False negative 9 13 Positive predictive value, % 83.3 87.1 Negative predictive value, % 96.1 89.9 Lihir Island 57 True positive 19 13 True negative 34 39 False positive 2 0 False negative 2 4 Positive predictive value, % 90.5 100 Negative predictive value, % 94.4 90.7 Karkar Island 184 True positive 25 99 True negative 144 59 False positive 8 20 False negative 7 6 Positive predictive value, % 75.8 83.2 Negative predictive value, % 95.4 90.8 Ghana 52 True positive 6 30 True negative 46 18 False positive 0 1 False negative 0 3 Positive predictive value, % 100 96.8 Negative predictive value, % 100 85.7

Appendix Table 6. Sensitivity and specificity of singleplex loop-mediated isothermal amplification for Treponema pallidum and Haemophilus ducreyi in samples from 293 patients with suspected T. pallidum infection Results Treponema pallidum, no. Haemophilus ducreyi, no. True positive 46 141 True negative 229 103 False positive 5 34 False negative 13 14 Positive predictive value, % 90.2 80.6 Negative predictive value, % 94.6 88.0

Page 11 of 14

Appendix Figure 1. Nucleotide sequence identity chart for variable regions 7–9 and dendrogram for

variable regions 1–9 of orthologue sequence data of the 16S rRNA gene of Haemophilus ducreyi.

Sequence differences are highlighted. The region inside the dotted line V7 represents variable region 7,

the region inside dotted line V8 represents variable region 8, and the region inside dotted line V9

represents the variable region 9 of the 16S rRNA gene. Sequences in green band denote H. ducreyi

specific sequences. The S-box indicates the binding region of sense primer and the AS-box indicates the

binding region of the antisense primer for the optimized qPCR for H. ducreyi. Sequences were aligned

using Geneious (https://www.geneious.com). GenBank accession numbers correspond to the data shown

in Appendix Table 4.

Page 12 of 14

Appendix Figure 2. Limit of detection (LOD) for Treponema pallidum and Haemophilus ducreyi loop-

mediated isothermal amplification (TPHD-LAMP) assay. The probability of successful amplification of a

given copy number was predicted using Probit analysis. Lower and upper bounds, illustrated as dashed

lines, represent 95% CI. A) LOD for H. ducreyi in samples without T. pallidum. B) LOD for T. pallidum in

samples without H. ducreyi. C) LOD for H. ducreyi in the presence of 3×105 copies T. pallidum plasmid

DNA. D) LOD for T. pallidum in the presence of 3×105 copies H. ducreyi plasmid DNA.

Page 13 of 14

Appendix Figure 3. Analytical specificity of Treponema pallidum and Haemophilus ducreyi loop-

mediated isothermal amplification (TPHD-LAMP) assay against a selected panel of pathogens. A) FAM-

readout gain for H. ducreyi; B) Cy5-readout gain for T. pallidum.

Page 14 of 14

Appendix Figure 4. Interassay and intraassay variance of Treponema pallidum and Haemophilus ducreyi

loop-mediated isothermal amplification (TPHD-LAMP) assay illustrated for the amplification of 1 target

and of both targets in the sample. The mean value of time to positive (tp) is plotted against target and type

of variability. The variability is illustrated by error bars, which reflect SD values. A) Variance in the

presence of 3×104 copies/reaction of 1 target, either T. pallidum or H. ducreyi in the sample. B) Variance

in the presence of 3×104 copies/reaction of T. pallidum and 3×104 copies/reaction H. ducreyi in the

sample.