This article was downloaded by: [Otterbein University]On: 08 April 2013, At: 04:08Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK

Journal of Biomaterials Science,Polymer EditionPublication details, including instructions for authors andsubscription information:http://www.tandfonline.com/loi/tbsp20

Effects of Poly(L-lysine),Poly(acrylic acid) andPoly(ethylene glycol) on theAdhesion, Proliferation andChondrogenic Differentiation ofHuman Mesenchymal Stem CellsHongxu Lu a , Likun Guo b , Naoki Kawazoe c , TetsuyaTateishi d & Guoping Chen ea Graduate School of Pure and Applied Sciences,University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki305-8577, Japan; Biomaterials Center, National Institutefor Materials Science, 1-1 Namiki, Tsukuba, Ibaraki305-0044, Japanb Biomaterials Center, National Institute for MaterialsScience, 1-1 Namiki, Tsukuba, Ibaraki 305-0044, Japanc Biomaterials Center, National Institute for MaterialsScience, 1-1 Namiki, Tsukuba, Ibaraki 305-0044, Japand Biomaterials Center, National Institute for MaterialsScience, 1-1 Namiki, Tsukuba, Ibaraki 305-0044, Japane Graduate School of Pure and Applied Sciences,University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki305-8577, Japan; Biomaterials Center, National Institutefor Materials Science, 1-1 Namiki, Tsukuba, Ibaraki305-0044, JapanVersion of record first published: 02 Apr 2012.

To cite this article: Hongxu Lu , Likun Guo , Naoki Kawazoe , Tetsuya Tateishi & GuopingChen (2009): Effects of Poly(L-lysine), Poly(acrylic acid) and Poly(ethylene glycol) on theAdhesion, Proliferation and Chondrogenic Differentiation of Human Mesenchymal StemCells, Journal of Biomaterials Science, Polymer Edition, 20:5-6, 577-589

To link to this article: http://dx.doi.org/10.1163/156856209X426402

PLEASE SCROLL DOWN FOR ARTICLE

Full terms and conditions of use: http://www.tandfonline.com/page/terms-and-conditions

This article may be used for research, teaching, and private study purposes.Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expresslyforbidden.

The publisher does not give any warranty express or implied or make anyrepresentation that the contents will be complete or accurate or up to date. Theaccuracy of any instructions, formulae, and drug doses should be independentlyverified with primary sources. The publisher shall not be liable for any loss,actions, claims, proceedings, demand, or costs or damages whatsoever orhowsoever caused arising directly or indirectly in connection with or arising outof the use of this material.

Dow

nloa

ded

by [

Otte

rbei

n U

nive

rsity

] at

04:

08 0

8 A

pril

2013

Journal of Biomaterials Science 20 (2009) 577–589www.brill.nl/jbs

Effects of Poly(L-lysine), Poly(acrylic acid)and Poly(ethylene glycol) on the Adhesion,

Proliferation and Chondrogenic Differentiationof Human Mesenchymal Stem Cells

Hongxu Lu a,b, Likun Guo b, Naoki Kawazoe b, Tetsuya Tateishi b

and Guoping Chen a,b,∗

a Graduate School of Pure and Applied Sciences, University of Tsukuba, 1-1-1 Tennodai,Tsukuba, Ibaraki 305-8577, Japan

b Biomaterials Center, National Institute for Materials Science, 1-1 Namiki,Tsukuba, Ibaraki 305-0044, Japan

Received 20 February 2008; accepted 31 March 2008

AbstractMicroenvironments, composed of many kinds of cytokines and growth factors plus extracellular matriceswith diverse electrostatic properties, play key roles in controlling cell functions in vivo. In this study, threekinds of water-soluble polymers, positively charged poly(L-lysine) (PLL), negatively charged poly(acrylicacid) (PAAc) and neutral poly(ethylene glycol) (PEG), were compared based on their effects on the adhe-sion, spread, proliferation and chondrogenic differentiation of human mesenchymal stem cells (MSCs). TheMSCs were seeded and cultured in the presence of polymers of different concentrations applied by methodsusing coating, mixing or covering. The effects of the water-soluble polymers depended on their electrostaticproperties and method of application. The methods were in the order of coating, mixing and covering interms of high to low influence. A low concentration of PLL promoted MSC adhesion, spread, proliferationand chondrogenic differentiation, while a high concentration of PLL was toxic. The PEG-coated surface fa-cilitated cell aggregation and spheroid formation by inhibiting cell adhesion. A high concentration of mixedPEG (10 µg/ml) promoted cell proliferation in serum-free medium. PAAc showed no obvious effects onMSC adhesion, spread, proliferation, or chondrogenic differentiation.© Koninklijke Brill NV, Leiden, 2009

KeywordsMesenchymal stem cell, chondrogenic differentiation, cell function, tissue engineering, water-soluble poly-mer

* To whom correspondence should be addressed. Tel.: (81-29) 860-4496; Fax: (81-29) 860-4714; e-mail:guoping.chen@nims.go.jp

© Koninklijke Brill NV, Leiden, 2009 DOI:10.1163/156856209X426402

Dow

nloa

ded

by [

Otte

rbei

n U

nive

rsity

] at

04:

08 0

8 A

pril

2013

578 H. Lu et al. / Journal of Biomaterials Science 20 (2009) 577–589

1. Introduction

Cell-function manipulation is very important for tissue engineering when somaticcells or stem cells are cultured in three-dimensional scaffolds. Scaffolds have beendeveloped to mimic the natural microenvironments where cells reside. In vivo, cellsare surrounded with specific microenvironments consisting of soluble molecules,such as cytokines and growth factors, as well as non-soluble extracellular matri-ces [1]. The extracellular microenvironment plays a key role in controlling cellularbehavior. The biological interactions between cells and microenvironments suchas the interaction between cell-growth factors and receptors, or extracellular ma-trix (ECM) proteins and integrins, have been well studied to elucidate their effectson cell functions such as adhesion, proliferation and differentiation [2–4]. Besidesbiological interaction, the ECM also interacts with cells through electrostatic inter-action because of the diversity of electrostatic properties of the ECM. For example,glycosaminoglycans, one kind of ECM, are negatively charged because of the pres-ence of carboxyl and surface groups in their molecules [5, 6].

To mimic in vivo microenvironments, numerous bioactive factors such as cell-growth factors and cell-adhesion factors have been immobilized on the surfacesof cell-culture substrates or tissue-engineering scaffolds [7–9]. Water-soluble poly-mers with different electrostatic properties have also been used for surface modifi-cation of biomaterials and scaffolds to investigate the effect of surface electrostaticproperties on cell functions [10–13]. However, the detailed effects of free water-soluble polymers on the functions of stem cells have not been well explained.

In this study, water-soluble polymers with different electrostatic properties wereused to investigate the effects of electrostatic properties on the functions of hu-man mesenchymal stem cells (MSCs). MSCs were cultured on the surfaces ofpolystyrene cell-culture plates in the presence of positively charged, neutral, or neg-atively charged water-soluble polymers. The polymers were applied to the cultureby methods involving coating, mixing, or covering. The adhesion, proliferation andchondrogenic differentiation of MSCs were examined to evaluate the effects in-duced by the charge of the water-soluble polymers.

2. Materials and Methods

2.1. Preparation of Polymer Solution

The following three kinds of water-soluble polymers were used: poly(acrylic acid)(PAAc, 450 kDa, Wako, Osaka, Japan) as a negatively charged polymer, poly(L-lysine) (PLL, 70–150 kDa, Sigma–Aldrich, St. Louis, MO, USA) as a positivelycharged polymer, and poly(ethylene glycol) (PEG, 300–500 kDa, Wako) as a neu-tral polymer. The water-soluble polymers were dissolved in Milli-Q water by stir-ring overnight and their concentrations were adjusted to 1.0 mg/ml. The polymersolutions were sterilized by filtration through a filter having a pore size of 0.22 µm.

Dow

nloa

ded

by [

Otte

rbei

n U

nive

rsity

] at

04:

08 0

8 A

pril

2013

H. Lu et al. / Journal of Biomaterials Science 20 (2009) 577–589 579

2.2. Cell Culture

Human bone-marrow-derived mesenchymal stem cells (MSCs) were obtained fromCambrex (Walkersville, MD, USA) at passage 2. The cells were seeded in T-75culture flasks and cultured using the proliferation medium from Cambrex underan atmosphere of 5% CO2 at 37◦C. The proliferation medium contained 440 mlMSC basal medium, 50 ml mesenchymal cell growth supplement, 10 ml 200 mML-glutamine and 0.5 ml penicillin/streptomycin mixture. The cells were furthersubcultured twice after confluence. Passage 4 MSCs were collected by treat-ment with trypsin/EDTA solution. The cells were then suspended in serum-plusDMEM, serum-free DMEM, or chondrogenic differentiation medium. The cellswere washed once with serum-free DMEM before preparation of the cell sus-pension solution in serum-free DMEM or chondrogenic differentiation medium.The serum-free DMEM was composed of Dulbecco’s modified Eagle’s medium(Sigma–Aldrich) with 4500 mg/l glucose, 584 mg/l glutamine, 100 U/ml penicillin,100 µg/ml streptomycin, 0.1 mM non-essential amino acids, 0.4 mM proline and50 mg/l ascorbic acid. The serum-plus DMEM was prepared by adding 10% fetalbovine serum (FBS) to the serum-free medium DMEM. The chondrogenic differ-entiation medium was composed of serum-free DMEM supplemented with 10−7 Mdexamethasone, 1% ITS+1 and 10 ng/ml TGF-β3 (Sigma–Aldrich). The TGF-β3was thawed and supplemented immediately before use.

2.3. Application of Water-Soluble Polymers and Cell Seeding

The water-soluble polymers were applied to the cell culture by three methods: coat-ing, mixing and covering (Fig. 1). Two concentrations of polymers, 10 and 1 µg/ml,were used to check the effect of polymer concentration. In the coating method,aqueous solutions of water-soluble polymers of 50 or 5 µg/ml were added to thewells of 96-well polystyrene cell-culture plates (20 µl/well). The plates were air-dried for 2 days on a clean bench, and then the cell suspension (5.0 × 104 cells/ml)was added to each well of the PLL-, PAAc-, PEG-coated and non-modified plates(100 µl/well). In the mixing method, the water-soluble polymer solutions were

Figure 1. Scheme of the three methods of applying water-soluble polymers: (a) coating method,(b) mixing method and (c) covering method.

Dow

nloa

ded

by [

Otte

rbei

n U

nive

rsity

] at

04:

08 0

8 A

pril

2013

580 H. Lu et al. / Journal of Biomaterials Science 20 (2009) 577–589

first mixed with cell-suspension, and then the mixture solution was added to the96-well polystyrene cell-culture plates (100 µl/well). The final cell density was5.0 × 104 cells/ml and the final polymer concentrations were 10 and 1 µg/ml. Inthe covering method, the cell suspension (5.0 × 104 cells/ml) was added to the 96-well polystyrene cell-culture plates (100 µl/well) and cultured for 1 day. Then, onthe second day, the medium was replaced with the medium containing water-solublepolymers of 10 and 1 µg/ml.

2.4. Cell Adhesion and Proliferation

Cell adhesion and proliferation were measured using the WST-1 assay (Roche Diag-nostics, Indianapolis, IN, USA). This is a colorimetric assay for the quantificationof cell viability and proliferation that is based on the cleavage of a tetrazoliumsalt (WST-1) by mitochondrial dehydrogenases in viable cells. Increased enzymeactivity leads to an increase in the amount of formazan dye, which is measuredwith a spectrophotometer. 96-well cell-culture plates were used. The MSCs wereseeded in 96-well cell-culture plates as above and cultured under an atmosphereof 5% CO2 at 37◦C for 3 h, 1 and 3 days. After each incubation period, the cul-ture medium was aspirated and 100 µl fresh medium was added along with 10 µlWST-1. For all time points, a standard curve was developed by plating serially di-luted cells in 100 µl medium and 10 µl WST-1. The plates were then incubated foran additional 4 h at 37◦C. After incubation, the absorbance of the samples againstthe background control on a microtiter plate reader (Bio-Rad Benchmark Plus™Microplate Spectrophotometer) was obtained at a wavelength of 440 nm with areference wavelength of 650 nm. Under each condition 6 wells were used for themeasurement to calculate the means and standard deviations. A two-tailed t-testwas used to examine the statistical differences. A value of P < 0.01 was consid-ered statistically significant.

2.5. Chondrogenic Differentiation

The chondrogenic differentiation culture was done in 6-well polystyrene cell-culture plates. In the coating method, the aqueous solutions of water-soluble poly-mers were added to the wells of the plates (200 µl/well). The plates were air-driedfor 2 days on a clean bench. Then, the cell suspension (2.0 × 105 cells/ml) wasadded to each well of the PLL-, PAAc-, PEG-coated and non-modified plates(5 ml/well). In the mixing method, the water-soluble polymer solutions werefirst mixed with the cell suspension, and then the mixture solution was added tothe 6-well polystyrene cell-culture plates (5 ml/well). The final cell density was2.0 × 105 cells/ml and the final polymer concentrations were 10 and 1 µg/ml. Inthe covering method, the cell suspension solution (2.0 × 105 cells/ml) was added tothe 6-well polystyrene cell-culture plates (5 ml/well) and cultured for 1 day. Then,the medium was replaced with media containing water-soluble polymers of 10 and1 µg/ml. The MSCs were cultured in chondrogenic differentiation medium for 2weeks. The medium was replaced every 2 days. During the medium replacement,

Dow

nloa

ded

by [

Otte

rbei

n U

nive

rsity

] at

04:

08 0

8 A

pril

2013

H. Lu et al. / Journal of Biomaterials Science 20 (2009) 577–589 581

2 ml of old medium was carefully removed and 2 ml of fresh chondrogenic dif-ferentiation medium was added. In the covering and mixing methods, the mediumwas mixed with the polymer before being added to the wells, while in the coatingmethod no polymer was added.

2.6. RNA Isolation and Real-Time PCR

After being cultured in chondrogenic differentiation medium for 14 days, the cellswere washed with PBS, and 1 ml of Isogen reagent (Nippon Gene, Toyama, Japan)was added to each well. The insoluble residue was frozen in liquid nitrogen andcrushed into powder by an electric crusher. The powder from each sample wasreturned to the corresponding Isogen solution and the total RNA was extracted fol-lowing the manufacturer’s protocol. 1 µg total RNA was reversely transcribed intocDNA using random hexamer (Applied Biosystems) in 20 µl reaction. An aliquot(1 µl) of 10-times diluted reaction solution was used for each 25 µl real-time PCRreaction together with 300 nM forward and reverse primers and 150 nM probesand qPCR Master Mix (Eurogenetic). Primers and probes were for 18S, GAPDH,types I, -II and -X collagen, sox 9 and aggrecan. Real-time PCR analysis was per-formed using the 7500 Real-Time PCR System (Applied Biosystems). After aninitial incubation step of 2 min at 50◦C and denaturation for 10 min at 95◦C, 40cycles (95◦C for 15 s, 60◦C for 1 min) PCR were performed. Reactions were per-formed in triplicate. GAPDH recombinant RNA levels were used as endogenouscontrols and gene expression levels relative to 18S were calculated using the com-parative Ct method. Three wells under each condition were used for measurementto calculate the means and standard deviations. The primer and probe sequences(Applied Biosystems) were according to Martin et al. [14] and Schaefer et al. [15],as shown in Table 1.

3. Results

The MSCs were cultured in serum-free and serum-plus media in the presence ofPLL, PAAc and PEG by three methods: coating, covering and mixing. Micrographsof the MSCs cultured in serum-free medium for 3 days are shown in Fig. 2. Thecoating method showed a greater effect on cell morphology than did the other twomethods. The cells on the surface coated with 10 µg/ml PLL did not attach to thesurface and showed a circular morphology. The cells on the PEG-coated surfaceaggregated and formed spheroids, especially on the surface coated with 10 µg/mlPEG. The cells adhered and spread on the surfaces coated with PAAc and a low con-centration of PLL (1 µg/ml). In the mixing and covering methods, the cells showedalmost the same morphologies on the surfaces as did those on the polystyrene cell-culture plate surfaces (control) except for the high concentration of PLL. The cellsadhered and spread on the surfaces when the water-soluble polymers were appliedby the mixing and covering methods at concentrations of both 1 and 10 µg/ml. Dur-ing culture with a high PLL concentration in the covering and mixing methods,

Dow

nloa

ded

by [

Otte

rbei

n U

nive

rsity

] at

04:

08 0

8 A

pril

2013

582 H. Lu et al. / Journal of Biomaterials Science 20 (2009) 577–589

Table 1.Primers and probes used for real-time PCR analysis

Gene Primer 5′ → 3′ Probe 5′ → 3′

18S F: GCCGCTAGAGGTGAAATTCTTG CCGGCGCAAGACGGACCAGAR: CATTCTTGGCAAATGCTTTCG

GAPDH F: ATGGGGAAGGTGAAGGTCG CGCCCAATACGACCAAATCCGTTGACR: TAAAAGCAGCCCTGGTGACC

Type I F: CAGCCGCTTCACCTACAG CCGGTGTGACTCGTGCAGCCATCcollagen R: TTTTGTATTCAATCACTGTCTTGCC

Type II F: GGCAATAGCAGGTTCACGTACA CCGGTATGTTTCGTGCAGCCATCCTcollagen R: CGATAACAGTCTTGCCCCACTT

Aggrecan F: TCGAGGACAGCGAGGCC ATGGAACACGATGCCTTTCACCACGAR: TCGAGGGTGTAGCGTGTAGAGA

Sox 9 F: CACACAGCTCACTCGACCTTG CCCACGAAGGGCGACGATGGR: TTCGGTTATTTTTAGGATCATCTCG

Type X F: CAAGGCACCATCTCCAGGAA TCCCAGCACGCAGAATCCATCTGAcollagen R: AAAGGGTATTTGTGGCAGCATATT

some cells were dead, indicating that the high concentration of PLL was toxic tothe cells.

The micrographs of MSCs cultured in serum-plus medium for 3 days are shownin Fig. 3. The results were similar to those of the cells cultured in the serum-freemedium. The water-soluble polymers showed a greater effect on cell adhesion andspread by the coating method than by the covering and mixing methods. Onlya small amount of cells adhered to the surface coated with 10 µg/ml PLL, althoughcells did adhere and spread on the surface coated with 1 µg/ml PLL. The PEG-coated surface promoted cell aggregation and spheroid formation. The higher theconcentration of PEG, the greater the number of spheroids that was formed. Thecells adhered and spread well on PAAc-coated surfaces at concentrations of both 1and 10 µg/ml. The cells on the surfaces with the covering and mixing methods werealmost the same as those on the control surface except for 10 µg/ml PLL. In com-paring cell adhesion and morphology cultured in serum-free and serum-plus media,there was no evident difference except for the culture with a high concentration ofPLL and the coated PEG. With the high concentration of PLL and the coated PEG,the cells adhered and spread more in the serum-plus medium than they did in theserum-free medium. The supplement of serum reduced the toxicity of the PLL andthe inhibitory effect of PEG.

The cell numbers were determined by WST-1 assay after culture for 3 h, 1 and2 days (Fig. 4). Serum-plus medium promoted cell adhesion and proliferation com-pared to that in the serum-free medium in spite of the supplement of water-solublepolymers. A high concentration of PLL showed an inhibitory effect in all groups,

Dow

nloa

ded

by [

Otte

rbei

n U

nive

rsity

] at

04:

08 0

8 A

pril

2013

H. Lu et al. / Journal of Biomaterials Science 20 (2009) 577–589 583

Figure 2. Phase-contrast micrographs of MSCs cultured in serum-free medium with or without wa-ter-soluble polymers for 3 days. (a) Coating, 10 µg/ml PLL; (b) mixing, 10 µg/ml PLL; (c) covering,10 µg/ml PLL; (d) coating, 1 µg/ml PLL; (e) mixing, 1 µg/ml PLL; (f) covering, 1 µg/ml PLL; (g) coat-ing, 10 µg/ml PAAc; (h) mixing, 10 µg/ml PAAc; (i) covering, 10 µg/ml PAAc; (j) coating, 1 µg/mlPAAc; (k) mixing, 1 µg/ml PAAc; (l) covering, 1 µg/ml PAAc; (m) coating, 10 µg/ml PEG; (n) mix-ing, 10 µg/ml PEG; (o) covering, 10 µg/ml PEG; (p) coating, 1 µg/ml PEG; (q) mixing, 1 µg/ml PEG;(r) covering, 1 µg/ml PEG and (s) control (without polymers). Scale bar = 500 µm.

Dow

nloa

ded

by [

Otte

rbei

n U

nive

rsity

] at

04:

08 0

8 A

pril

2013

584 H. Lu et al. / Journal of Biomaterials Science 20 (2009) 577–589

Figure 3. Phase-contrast micrographs of MSCs cultured in serum-plus medium with or without wa-ter-soluble polymers for 3 days. (a) Coating, 10 µg/ml PLL; (b) mixing, 10 µg/ml PLL; (c) covering,10 µg/ml PLL; (d) coating, 1 µg/ml PLL; (e) mixing, 1 µg/ml PLL; (f) covering, 1 µg/ml PLL; (g) coat-ing, 10 µg/ml PAAc; (h) mixing, 10 µg/ml PAAc; (i) covering, 10 µg/ml PAAc; (j) coating, 1 µg/mlPAAc; (k) mixing, 1 µg/ml PAAc; (l) covering, 1 µg/ml PAAc; (m) coating, 10 µg/ml PEG; (n) mix-ing, 10 µg/ml PEG; (o) covering, 10 µg/ml PEG; (p) coating, 1 µg/ml PEG; (q) mixing, 1 µg/ml PEG;(r) covering, 1 µg/ml PEG and (s) control (without polymers). Scale bar = 500 µm.

Dow

nloa

ded

by [

Otte

rbei

n U

nive

rsity

] at

04:

08 0

8 A

pril

2013

H. Lu et al. / Journal of Biomaterials Science 20 (2009) 577–589 585

Figure 4. Cell adhesion and proliferation of MSCs as determined by a WST-1 assay. Cells werecultured for 3 h, 1 and 2 days. (a) Coating, serum-free medium; (b) coating, serum-plus medium;(c) mixing, serum-free medium; (d) mixing, serum-plus medium; (e) covering, serum-free mediumand (f) covering, serum-plus medium. Data represent the average ± SD of six samples. ∗Significantdifference (P < 0.01).

especially in the serum-free medium. Almost no cells adhered or proliferated in theserum-free medium with a high concentration of coated, mixed, or covered PLL.A low concentration of PLL promoted adhesion and proliferation when the cellswere cultured in the serum-plus medium. The effect of the PEG depended on itsconcentration and method of application. The PEG applied by the coating methodhad the most evident effect compared to that of the mixing and covering methods.Cell adhesion and proliferation were inhibited when PEG was coated on the sub-strate. For the mixing method in the serum-free medium, a high concentration ofPEG promoted cell adhesion and proliferation while a low concentration of PEGsuppressed adhesion and proliferation. However, there was no such effect in theserum-plus medium. The PEG applied by the covering method had no evident ef-fect. The PAAc showed no effect on cell adhesion and proliferation when beingapplied with any of the three methods. The three methods used to apply the water-soluble polymers had an effect on cell adhesion and proliferation in the order ofcoating, mixing and covering.

The MSCs were cultured in chondrogenic differentiation medium with the water-soluble polymers applied using the coating, mixing and covering methods. Cell

Dow

nloa

ded

by [

Otte

rbei

n U

nive

rsity

] at

04:

08 0

8 A

pril

2013

586 H. Lu et al. / Journal of Biomaterials Science 20 (2009) 577–589

Figure 5. Phase-contrast micrographs of MSCs cultured in chondrogenic differentiation medium for14 days. (a) Coating, 10 µg/ml PLL; (b) mixing, 10 µg/ml PLL; (c) covering, 10 µg/ml PLL; (d) coat-ing, 1 µg/ml PLL; (e) mixing, 1 µg/ml PLL; (f) covering, 1 µg/ml PLL; (g) coating, 10 µg/ml PAAc;(h) mixing, 10 µg/ml PAAc; (i) covering, 10 µg/ml PAAc; (j) coating, 1 µg/ml PAAc; (k) mixing,1 µg/ml PAAc; (l) covering, 1 µg/ml PAAc; (m) coating, 10 µg/ml PEG; (n) mixing, 10 µg/ml PEG;(o) covering, 10 µg/ml PEG; (p) coating, 1 µg/ml PEG; (q) mixing, 1 µg/ml PEG; (r) covering, 1 µg/mlPEG and (s) control (without polymers). Scale bar = 2 mm.

morphology after 14 days culture is shown in Fig. 5. After confluence, the cellsheets detached from the substrate and aggregated. At a high concentration of PLL,cell debris and small spheroids were observed. This might be due to the toxicity ofthe high concentration of PLL. Under all the other conditions, the cells detached andformed spheroids in the order of coating, mixing and covering. The coating methodshowed the greatest effect on cell detachment and spheroid formation. PLL showedthe most evident effect on cell sheet detachment and spheroid formation. Cell sheetsdetached and spheroids formed even by the mixed PLL. The high concentration ofwater-soluble polymers promoted the cell sheet detachment and spheroid formation.The MSCs cultured on the control surface partially detached and aggregated.

The MSCs cultured on the coated surfaces for 14 days were harvested and theexpression of genes encoding type I collagen, type II collagen, type X collagen, sox9 and aggrecan was analyzed by real-time PCR (Fig. 6). Type I collagen was ex-pressed by the cells cultured on all the coated and control surfaces. MSCs culturedon coated PLL at a low concentration expressed a high level of genes encodingtype II collagen, type X collagen, sox 9 and aggrecan. The coated PLL at a lowconcentration promoted chondrogenic differentiation of hMSCs. The cells culturedon the surfaces coated with PEG, PAAc, and a high concentration of PLL also ex-

Dow

nloa

ded

by [

Otte

rbei

n U

nive

rsity

] at

04:

08 0

8 A

pril

2013

H. Lu et al. / Journal of Biomaterials Science 20 (2009) 577–589 587

Figure 6. Real-time PCR results of mRNA expression of (a) type I collagen, (b) type II collagen,(c) aggrecan, (d) sox 9 and (e) type X collagen of the MSCs cultured on polymer-coated and con-trol (without polymers) surfaces in chondrogenic differentiation medium for 14 days. The data arenormalized to 18S. Data represent the average ± SD of three samples.

pressed genes encoding type X collagen, sox 9 and aggrecan. However, very lowlevels of type II collagen were expressed by cells cultured on these surfaces. Geneexpression was also analyzed for the mixing and covering methods. The two meth-ods had no obvious effect on chondrogenic differentiation (data not shown).

4. Discussion

The effects of the influence of positively charged, negatively charged and neutralwater-soluble polymers on adhesion, proliferation and chondrogenic differentiationof mesenchymal stem cells were investigated. Three methods were used to applythe polymers: coating, mixing and covering. The effects of the three methods werein the order of coating, mixing and covering. The coating method had the most sig-nificant effects on cell functions. The mixing method showed some effects, whilethe covering method had no effect. The results might reflect that the coating methodcould provide direct interaction between the coated polymers and the cells, while,using the covering method, the polymers might be isolated by extracellular matricessecreted by the cells because the cells were cultured for 1 day before the supple-ment of the water-soluble polymers. The mixing method might be controlled by the

Dow

nloa

ded

by [

Otte

rbei

n U

nive

rsity

] at

04:

08 0

8 A

pril

2013

588 H. Lu et al. / Journal of Biomaterials Science 20 (2009) 577–589

adsorption competition of the polymers and the extracellular matrices during cellculture.

At low concentration, the positively charged PLL promoted cell adhesion andproliferation, especially in the serum-plus medium. The promotive effect of PLLmight be due to the electrostatic attraction between the positively charged polymersand the negatively charged cells. When adsorbed by the culture plate surface, thenumber of positively charged sites available for cell binding increases. However,PLL at high concentration (10 µg/ml) showed toxicity to the MSCs that might becaused by the fusion of the cell membrane. At low concentration, the PLL facilitatedchondrogenic differentiation of the MSCs. The MSCs cultured on the surface coatedwith a low concentration of PLL expressed a high level of genes encoding type IIcollagen, sox 9 and aggrecan. In our previous study, we also found that that thesurface grafted with positively charged polyallylamine promoted the chondrogenicdifferentiation of MSCs. It has been reported that PLL promotes chondrogenesisof limb mesenchymal cells that might be caused by the electrostatic interactionbetween the PLL and the cartilage extracellular matrices [16].

PEG, a low toxic and low antigenic poly-ether-diol, has been approved bythe FDA for several medical and food industry applications [17]. PEG hydrogelshave been extensively explored as tissue-engineering scaffolds because of their hy-drophilicity, biocompatibility and intrinsic resistance to protein adsorption and celladhesion [18]. Under serum-free or low serum conditions, it has been reported thata proper concentration of PEG was able to stimulate the growth of mammalian cells[19]. Our results also proved that PEG (10 µg/ml) could promote the proliferationof MSCs in the serum-free medium, although the adhesion of MSCs was partiallyinhibited by coated PEG. The PEG applied by the coating, mixing, and coveringmethods had no evident effect on the chondrogenesis of MSCs. However, it hasbeen reported that PEG-grafted surfaces promoted pellet formation and chondro-genic differentiation of MSCs [11]. PEG-grafted surfaces can completely block celladhesion to facilitate strong cell–cell interaction. Nonetheless, the mixed and cov-ered PEG had no effect on cell adhesion and the coated PEG only partially blockedMSC adhesion.

PAAc showed no obvious effects on the adhesion, proliferation and chondro-genic differentiation of MSCs. Neither a promotive nor an inhibitory effect wasdetected. Therefore, PAAc should be a good candidate polymer for surface modifi-cation and functionalization because of its mild properties relative to cell functionand its carboxyl groups that are useful for the immobilization of growth factors andother factors [20].

5. Conclusions

The effects of chargeable water-soluble polymers on the functions of MSCs de-pended on their electrostatic properties and method of application. The coatingmethod had the most significant effect, the mixing method had a moderate effect,

Dow

nloa

ded

by [

Otte

rbei

n U

nive

rsity

] at

04:

08 0

8 A

pril

2013

H. Lu et al. / Journal of Biomaterials Science 20 (2009) 577–589 589

and the covering had the least effect. A low concentration of PLL had a promotiveeffect on the adhesion, proliferation, and chondrogenic differentiation of MSCs,while a high concentration of PLL was toxic. Coated PEG suppressed cell adhe-sion, while a high concentration of PEG (10 µg/ml) promoted cell proliferation inserum-free medium. PAAc showed no obvious effects on the adhesion, prolifera-tion and chondrogenic differentiation of MSCs. These results might provide someimportant information for the design of biomaterials and scaffolds for use in tissueengineering.

Acknowledgements

This work was supported in part by the New Energy and Industrial Technology De-velopment Organization of Japan and in part by the Ministry of Education, Culture,Sports, Science and Technology of Japan.

References

1. B. Alberts, A. Johnson, J. Lewis, M. Raff, K. Roberts and P. Walter, Molecular Biology of theCell, 4th edn. Garland, New York, NY (2002).

2. Y. Ito, Biomaterials 20, 2333 (2000).3. S. Ng, Y. N. Wu, Y. Zhou, Y. E. Toh, Z. Z. Ho, S. M. Chia, J. H. Zhu, H. Q. Mao and H. Yu,

Biomaterials 26, 3153 (2005).4. M. J. Sherratt, D. V. Bax, S. S. Chaudhry, N. Hodson, J. R. Lu, P. Saravanapavan and C. M. Kielty,

Biomaterials 26, 7192 (2005).5. J. K. Mouw, N. D. Case, R. E. Guldberg, A. H. K. Plaas and M. E. Levenston, Osteoarthritis

Cartil. 13, 828 (2005).6. J. S. Pieper, T. Hafmans, J. H. Veerkamp and T. H. van Kuppevelt, Biomaterials 21, 581 (2000).7. J. M. Curran, R. Chen and J. A. Hunt, Biomaterials 27, 4783 (2006).8. B. G. Keselowsky, D. M. Collard and A. J. García, Proc. Natl. Acad. Sci. USA 102, 5953 (2005).9. C. R. Wittmer, J. A. Phelps, W. M. Saltzman and P. R. V. Tassel, Biomaterials 28, 851 (2007).

10. H. Ai, S. A. Jones and Y. M. Lvov, Cell Biochem. Biophys. 39, 23 (2003).11. L. Guo, N. Kawazoe, Y. Fan, Y. Ito, J. Tanaka, T. Tateishi, X. Zhang and G. Chen, Biomaterials

29, 23 (2008).12. J. H. Lee, J. W. Lee, G. Khang and H. B. Lee, Biomaterials 18, 351 (1997).13. B. Li, Y. Ma, S. Wang and P. M. Moran, Biomaterials 26, 4956 (2005).14. I. Martin, M. Jakob, D. Schäfer, W. Dick, G. Spagnoli and M. Heberer, Osteoarthritis Cartil. 9,

112 (2001).15. J. F. Schaefer, M. L. Millham, B. D. Crombrugghe and L. Buckbinder, Osteoarthritis Cartil. 11,

233 (2003).16. W. A. Woodward and R. S. Tuan, Dev. Genet. 24, 178 (1999).17. J. Fu, J. Fiegel, E. Krauland and J. Hanes, Biomaterials 23, 4425 (2002).18. G. H. Underhill, A. A. Chen, D. R. Albrecht and S. N. Bhatia, Biomaterials 28, 256 (2007).19. Y. Shintani, K. Iwamoto and K. Kitano, Appl. Microbiol. Biotechnol. 27, 533 (1988).20. B. Li, Y. Ma, S. Wang and P. M. Moran, Biomaterials 26, 1487 (2005).

Dow

nloa

ded

by [

Otte

rbei

n U

nive

rsity

] at

04:

08 0

8 A

pril

2013