Proc. Natl. Acad. Sci. USAVol. 93, pp. 7143-7148, July 1996Genetics

ECA39, a conserved gene regulated by c-Myc in mice, is involvedin G1/S cell cycle regulation in yeast

(genetic target/Saccharomyces cerevisiae)

OREN SCHULDINER*, AMIR EDEN*, TAMAR BEN-YOSEF*, OFRA YANuKA, GioRA SIMCHEN, AND NIssIM BENVENISTYtDepartment of Genetics, Institute of Life Sciences, The Hebrew University of Jerusalem, Givat-Ram, Jerusalem 91904, Israel

Communicated by Philip Leder, Harvard Medical School, Boston, MA, March 20, 1996 (received for review December 5, 1995)

ABSTRACT The c-myc oncogene has been shown to playa role in cell proliferation and apoptosis. The realization thatmyc oncogenes may control the level of expression of othergenes has opened the field to search for genetic targets for Mycregulation. Recently, using a subtraction/coexpression strat-egy, a murine genetic target for Myc regulation, called ECA39,was isolated. To further characterize the ECA39 gene, we setout to determine the evolutionary conservation of its regula-tory and coding sequences. We describe the human, nematode,and budding yeast homologs of the mouse ECA39 gene.Identities between the mouse ECA39 protein and the human,nematode, or yeast proteins are 79%, 52%, and 49%, respec-tively. Interestingly, the recognition site for Myc binding,located 3' to the start site of transcription in the mouse gene,is also conserved in the human homolog. This regulatoryelement is missing in the ECA39 homologs from nematode oryeast, which also lack the regulator c-myc. To understand thefunction ofECA39, we deleted the gene from the yeast genome.Disruption ofECA39 which is a recessive mutation that leadsto a marked alteration in the cell cycle. Mutant haploids andhomozygous diploids have a faster growth rate than isogenicwild-type strains. Fluorescence-activated cell sorter analysesindicate that the mutation shortens the G1 stage in the cellcycle. Moreover, mutant strains show higher rates of UV-induced mutations. The results suggest that the product ofECA39 is involved in the regulation of G1 to S transition.

The c-myc oncogene has been implicated in cell proliferation,differentiation, apoptosis, and malignant transformation (1-4).Studies of cultured cells have delineated a relationship betweenthe expression of c-myc and the progression of cells from theresting state (Go) to the growth phase (G1) of the cell cycle (5, 6).Such progression is accompanied by a sharp induction of thisprotooncogene, an induction brought about by a number ofgrowth factors and conditions that influence a cell to leave theresting state and enter the cell cycle. In addition, c-myc has alsobeen implicated in the induction of apoptosis (7,8). The inductionof cell death is suggested to be an obligatory component of c-mycaction that accompanies proliferation. The attractive biologicalrationale for a "dual signal" of proliferation and death is that itmay intrinsically suppress transformation.The realization that myc oncogenes are transcription factors

has opened the field to search for genetic targets for Mycregulation. Recently, using a subtraction/coexpression strategy, amurine genetic target for Myc regulation was isolated (9, 10). Thegene, called ECA39, is highly expressed early in embryogenesisand in several c-myc-based tumors (10). The gene bears afunctional c-Myc binding sequence located 3' to its transcriptionstart site. This sequence is required for the binding of a nuclearprotein complex that includes c-Myc. In addition, the c-Mycbinding site is essential for expression of a reporter gene inchimeric constructs transfected into c-myc-overexpressing cells

(10). Moreover, modulation of c-myc in COS-7 cells and inembryonic stem cells affects expression of the ECA39 gene (10).Thus, ECA39 seems to be a direct genetic target for myc activityin the mouse. To further characterize the ECA39 gene, wedetermined the evolutionary conservation of its regulatory andcoding sequences. ECA39 is conserved in various eukaryotes,among them the budding yeast, Saccharomyces cerevisiae. Inter-estingly, the recognition site for Myc binding is also conserved inthe human homolog but is missing in the homologs from yeast andnematode, which also lack c-myc. To uncover the biologicalfunction of the ECA39 gene in mammalian cells, we deleted itshomolog from the yeast genome. This mutation resulted in anovel cell cycle phenotype, whereby cells grew 25% faster, witha shorter G, stage. We conclude that the product of ECA39 isinvolved in cell cycle regulation.

MATERIALS AND METHODSHuman cDNA Library Screening and Nucleotide Sequenc-

ing. A human fetal brain cDNA library (no. HL-1065b, Clon-tech) constructed in Agtl1 was screened with a 600-bp frag-ment from the 5' region of mouse-ECA39 cDNA. The screen-ing was carried out as described (11). Two overlapping clones,containing inserts of 1.2 kb and 2.6 kb of length, were isolated.Sequencing was done by the Sanger dideoxynucleotide chaintermination method (12), using the Sequenase version 2.0 T7DNA polymerase kit (United States Biochemical). Primersflanking the cloned cDNA and specific internal primers wereused. DNA sequences were analyzed using the GCG computerprogram (Genetics Computer Group, Madison, WI).

Yeast Strains and Media. YPH857 (ura3-52, lys2-801,ade2-101, trplA63, his3A200, leu2A1, cyh2R) (13) and YPH858are MATa and MATa isogenic strains, respectively. YPD, SC(synthetic complete), and dropout media were prepared asdescribed (14). Canavanine (Can) was added to a final con-centration of 60 mg/liter (14).DNA and RNA Analyses. Yeast genomic DNA was extracted

as described (14). Total RNA was extracted as previouslydescribed (11). Southern and Northern blot analyses wereperformed as described (15, 16). Radiolabeling ofDNA probeswas performed by random priming (17) using [a-32P]dCTP(3000 Ci/mM; 1 Ci = 37 GBq; Rotem Industries, Israel).Gene Disruption. ECA39 gene was amplified from S. cer-

evisiae DNA with specific oligonucleotide primers (5' oli-gomer: GGCACTATAAAGAGAGCTAG; 3' oligomer: CAA-AGCTTCTCGTTGTTGTG) using standard PCR methodol-ogy. The 1.8-kb PCR product was cloned into a Bluescript SK-plasmid. A vector for ECA39 gene disruption was constructed bydeleting a Van91I-EcoNI fragment and inserting an XhoI frag-

Abbreviation: FACS, fluorescence-activated cell sorter.Data deposition: The sequences reported in this paper have beendeposited in the GenBank data base (accession no. U21550, V21551 andV42443).*O.S., A.E., and T.B.-Y. contributed equally to this work.tTo whom reprint requests should be addressed.

7143

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement" inaccordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

July

11,

202

0

Proc. Natl. Acad. Sci. USA 93 (1996)

ment [from pRS426 (18)] containing the URA3 gene (see Fig.3A). A fragment for homologous recombination was obtained bypartial digestion of the gene disruption vector with NotI and ClaIand then introduced into the YPH857 yeast strain by LiActransformation as previously described (19). The MATa mutant(eca39A::URA3) was mated to YPH858 to obtain a diploid,heterozygous strain that was then sporulated to obtain MATa

eca39A strains. Diploid, homozygous strains, lacking the ECA39gene, were obtained by matingMATa eca39A andMATa eca39Astrains. Gene disruption was confirmed both on the DNA andRNA levels.Growth Curves. The cells were grown overnight in liquid

Ura- medium and then inoculated into 15 ml SC medium toa final concentration of 5 x 106 cells per ml. Cell number was

1Ia.Human

MouseNematodeYeast

HumanMouseNematodeYeast

TI

R.... PNPS; I

c1IIr m6

' _'' I iii*/II .I.S.

I101

PQ "rn~I IE

151

s * .

Q HEQNYt 3 KG ;i y: 'E3

I. EI K B

301

ML ......

M ......

KASRILSKLT. . qEEESDWTISQVESWES*

JWeSSKFGVRKIL HN*VLPGEQCGALTKVAQWIAVmNYGNWS

401Human VLS*Yeast KTVADLN*

FIG. 1. Conservation of ECA39 protein. Amino acid sequences of human, mouse, nematode (C. elegans) and yeast (S. cerevisiae) are compared.The human, mouse, and nematode sequences were predicted from the ECA39 cDNA sequences determined by us, whereas the yeast sequence waspredicted from the DNA sequence of the genomic clone as determined by Johnston et al. (22). A black background indicates fully conserved residues.

HumanMouseNematodeYeast

HumanMouseNematodeYeast

201HumanMouseNematodeYeast

251HumanMouseNematodeYeast

HumanMouseNematodeYeast

HumanMouseNematodeYeast

7144 Genetics: Schuldiner et al.

J

Dow

nloa

ded

by g

uest

on

July

11,

202

0

Proc. Natl. Acad. Sci. USA 93 (1996) 7145

determined every 2 hr either by OD at 600 nm or by countingthe cells under the microscope. The results were normalized inthe following manner: [logOD(t) - logOD(t = 0)]. Generationtime was calculated as follows: Tgen = log2/slope.

Fluorescence-Activated Cell Sorter (FACS) Analysis. Todetermine the growth rates and generation times, fresh cul-tures of eca39A and of ECA39 cells were grown in similarconditions, and the optical densities of the cultures weremeasured every 90 min. Samples for FACS analysis were takenduring the logarithmic phase of growth. Samples were preparedas described (20, 21): aliquots of 107 cells each were sonicated,washed in Tris buffer, spun briefly, and resuspended in 70%ethanol. Before staining, the samples were agitated at roomtemperature for 6 hr and incubated overnight at 37°C with RNaseA and 30 min with pepsin. Staining with propidium iodide wasperformed just before the FACS analysis. Measurements wereperformed on Becton Dickinson FACScan in FL3 emission.

Determination of UV-Induced Mutation Rate. Cells weregrown overnight in liquid SC medium and then inoculated intoSC medium to a final concentration of 5 x 107 cells per ml. Thecells were further grown in 30°C for 2 hr. The cells were washedtwice, resuspended in water, and finally sonicated for 20 sec.The concentration of the cultures was determined by countingthe cells under the microscope. Cells (5 x 106) were plated induplicate on SC plates containing Can (60 mg/liter) to deter-mine the frequencies of mutations in the arginine permeasegene, CANI. To determine the survival rate, 200 cells wereplated, in duplicate, on SC plates without Can. The plates wereexposed toUV irradiation in increasing doses and then incubatedin the dark in 30°C for 2-3 days until colonies appeared. Colonieswere counted and mutation rate was calculated relative to thenumber of cells surviving the same UV dose.

RESULTSEvolutionary Conservation of ECA39 Gene. As a step to

characterize ECA39, a genetic target for Myc regulation, wehave studied its evolutionary conservation. The ECA39 gene ishighly expressed in mouse brain during embryogenesis. Toisolate the human homolog of the ECA39 gene, a human fetalbrain cDNA library was screened with a mouse cDNA probeunder nonstringent conditions. Two overlapping cDNA cloneswere isolated and mapped. To examine the level of homologybetween the human and the mouse genes, the nucleotidesequences of the coding region and some untranslated portionswere determined (Fig. 1). Comparison between the predictedamino acid sequences of the mouse and human gene productsrevealed strong conservation of 79% identity. In the Caeno-rhabditis elegans genome project, a gene homologous to ECA39was identified by Waterston et al. (23). Thus, we coulddetermine the entire nucleotide sequence of the nematodehomolog (Fig. 1). A 52% identity was revealed between themouse and nematode protein sequences. Furthermore, in theS. cerevisiae genome project a gene homologous to ECA39 wasidentified by Johnston et al. (22) and assigned ORF YHR208w(Fig. 1). Again, a high identity level of 49% was revealedbetween the yeast and the mouse protein sequences. Thissuggested that a gene that serves as a genetic target for c-Mycin vertebrates is conserved in nonvertebrates.The mouse ECA39 gene is highly expressed in dividing cells

and during embryogenesis (10). Similarly, the yeast ECA39gene is expressed at high levels in dividing cells (logarithmic phaseof growth) and at low levels in nondividing cells (stationary phaseof growth) (Fig. 2). To examine the pattern of ECA39 geneexpression during the cell cycle, haploid MATa cells were syn-chronized with a mating hormone. Detailed study at differentstages of the cell cycle showed that ECA39 mRNA is present athigh levels throughout the cell cycle (data not shown).

Disruption of ECA39 in Yeast. Deletion of most of theECA39 gene was carried out by one-step replacement (24)

ECA39 -: W ^

ACTI -~ 99:

FIG. 2. Expression pattern of ECA39. Expression of ECA39 islower in stationary-phase cells than in logarithmic growing cells. Anasynchronous culture of haploid strain YPH857 (13) was grown inliquid yeast extract/peptone/dextrose medium (14). Samples of ap-proximately the same cell numbers were taken in logarithmic phase (2x 107 cells per ml) and stationary phase of growth (2 X 108 cells perml). Total RNA was extracted (11) and separated on 1%o agaroseformaldehyde gel (16). The gel was then blotted and hybridized withan ECA39 probe. Amounts of RNA loaded on the gel were comparedby hybridization with a probe containing the ACT] gene.

using a URA3 disruption vector (Fig. 3A). Deletions(eca39l::URA3) were introduced into MATat haploid strains,which were mated to wild-type MATa to obtain heterozygotes.These were sporulated to obtainMATa eca39/ haploid strains.The gene disruption was verified at the DNA as well as theRNA level (Fig. 3). In the experiments described below, fiveindependent mutant strains were used and they were com-pared with appropriate control strains. In the isogenic controlstrains, the marker URA3 was introduced as a homologousinsertion to correct the ura3-52 mutation (similar results wereobtained when URA3 was introduced as a nonhomologousinsertion during transformation with the eca395::URA3 con-struct or as a centromeric plasmid). At least two independentdisruption mutants were used in each experiment.

Faster Growth Rate of eca39A Mutants. The mutant eca39.ihaploid strains grow faster than the control strains (Fig. 4A).Isogenic control strains carry the gene URA3 on a centromericplasmid or integrated into the genome. The generation timecalculated for eca39A (the deletion mutant) is 24% shorter thanfor the control strains [113 + 2.1 min (n = 16) comparedwith 140± 1.9 min (n = 5), respectively]. Similar, though less pronounced,differences have been observed in rich yeast extract/peptone/dextrose medium. The diploid strains, heterozygous for thedeletion, grow at the same rate as the wild type, whereas thehomozygous deletion strains grow faster [the generation time is27% shorter (Fig. 4B)]. This indicates that the mutation isrecessive and that it affects both haploid and diploid life stages.To rescue the phenotype, we have isolated a genomic clone

of ECA39 gene and introduced it on a centromeric plasmid toeca39/\ cells. The transformed cells grow at a slower rate thantheir control counterparts (Fig. 4C). Although the generationtime is 12% longer in the ECA-39 transformed cells than thatof control eca39/ strains, the phenotype was not fully rescued.We have also introduced either sense or antisense constructsof ECA39 gene under the inducible GAL promoter. Yet ourattempts to express high levels of sense ECA39 have failed andwe could only induce high levels of the antisense transcript(data not shown). It seems that the cells with the mutantphenotype grow faster and "rescued" cells (expressing ECA39 inhigh levels) may have a short-term disadvantage and thus be lost.We verified that fast growth was associated with the deletion

genotype (eca39A) through the dissection of 40 tetrads ob-tained from sporulation of a deletion heterozygote(ECA39/eca391::URA3). Each tetrad, dissected and grown onSC medium (14), consisted of two large Ura+ colonies (fastgrowing cells) of eca391 genotype and two small Ura colo-nies (slow growing cells) (data not shown). The results indicatea strong linkage between fast growth rate and eca39A.

Cell Cycle Analysis. Mutant and control cultures weresorted into cells at different stages of the cell cycle, as defined

Genetics: Schuldiner et al.

Dow

nloa

ded

by g

uest

on

July

11,

202

0

Proc. Natl. Acad. Sci. USA 93 (1996)

Native gene

Disruption '

Van 911 ECA39 EcNl........ ..:... ..l.:~;..........

I I I II I IiI I %

vector ________________I___I

Disrupted gene 4 IRA.1 I

HaploidI a a I

ECA39 genotype ' + - - I5r+T T- _

Diploid... :. .. .... ..... . ..... . . ... .. .... i .. g : : ;: ... ..... .... n..............* . :. ... . :. . . .... .... . -.- ..

* ... > .:: :..: .. ... :. ::..... : : : : :. ;;: :..................... : ::: :... ..... . - ,, ... j . . - . j .-

tg<>v<_2>

:'.!'--..: .-F

.:

;.t .: :-}.i ,. :. ,4. .,. ,,--t,, ..... . .

_w."..........;....,. :. ...:

.. ..

Disrupted,gene

Native

gene

"b9Po ,r9)>:\C, \O

ECA39 --

ACT] * P. 4.

FIG. 3. Analysis of yeast strains with a deletion of ECA39 from the genome. (A) Schematic representation of the construct used for deletionof most of the ECA39 gene (eca39A). The region between Van91I and EcoNI was replaced by URA3. (B) Southern blot analysis of haploid anddiploid strains with the mutation eca39A&. DNA was isolated from MATa and MATa wild-type and mutant haploid strains and from wild-type,heterozygous, and homozygous mutant cells. DNA was digested with KpnI, blotted, and hybridized with a fragment of ECA39 gene upstream tothe homologous recombination region. (C) Northern blot analysis of total RNA from wild-type and mutant eca39A& haploid strains. The probe usedwas a Van9lI-EcoNI fragment of ECA39 gene.

by DNA content. FACS analysis of asynchronous culturesindicated a shorter G1 stage in the eca39A cells (Fig. 5 A andB). In the mutant strains, the length of G1 was calculated to beless than two-thirds of that in the control, whereas other stageswere not affected. The length of the cell cycle stages in the mutantcells was verifled in synchronized cultures.

Transition from G1 to S may be also controlled by cell size.To examine a possible effect of the eca39A mutation on cellsize, we determined the cell volume at different stages of thecell cycle. During G1, the average size of the mutant cells was65% of the size of isogenic nonmutant cells. As shown in Fig.SC, the decrease in average size derived from the dearth oflarge G1 cells in the mutant. The range of sizes and theaverage size of cells at G2+M and at the beginning of G1 was

similar in mutant and control strains. We suggest that somewild-type G1 cells grow larger than the minimum sizenecessary for entry into S phase, but the short Gi phase ofthe eca39A mutants does not allow them to attain the largersizes. Nonetheless, the mutant cells at the end of G1 are largeenough to enter S phase and they reach the end of mitosis ata normal size. Furthermore, the finding that mutant cells are

not dramatically smaller than wild-type cells, unlike Schizo-saccharomycespombe weel strains (25), for instance, suggeststhat a checkpoint for ensuring a minimal cell size at the Gt/Stransition is intact.UV-Induced Mutations. Mammalian cells have been shown

to monitor DNA integrity at the G1/S transition point (26, 27).We therefore examined spontaneous and UV-induced muta-

A

B+I+

-I-I-

C

7146 Genetics: Schuldiner et al.

*. ...f.:::::::

+/-r-

Dow

nloa

ded

by g

uest

on

July

11,

202

0

Proc. Natl. Acad. Sci. USA 93 (1996) 7147

A 1

.1L*_ 1.SD)

OUlOt:1 0

B

.ID

Ch

CD)

55

@5

Uo

LA Wild type|/L.2 eca39& | ,,

1. -- .

.

.8 . ,,.

. f,

A-

Wild type

u)

z

0 1 2 3 4 5 6 7 8 9 10Time (hours)

a 2iG 460 6oeFluorescence

BWild type

eca39A

eca39A

352 450 550

Fluorescence

GI S G2+MFZ! IIZ2

C

@5

8¢.CD

Time (hours)

0 1 2 3 4 5 6 7 8 9 10

Time (hours)

FIG. 4. Growth rates of ECA39 and eca39A mutant strains. (A)Growth curves of URA+, ECA39 (WT), and eca39A haploid strains. Cellnumber was determined either by optical density or by counting cellsunder the microscope. The results were normalized in the followingmanner: [logOD(t) - logOD(t = 0)]. Error bars represent SE (n = 5for mutant strains and n = 3 for wild-type strains). The generation timecalculated, from repeated experiments, for the mutant strains was 24%shorter than that of the wild-type strains [113 2.1 min (n = 16) and 140t 1.9 min (n = 5) (mean SE), respectively]. The difference ingeneration time between the two strains is highly significant: P < 10-5).(B) Growth curves ofeca39A andEC439 diploid strains. Generation timefor the homozygous mutant strains is 27% shorter than that of thewild-type strains. Each point represents the mean oftwo experiments. (C)Growth curves ofeca39A[TRPI,EC439] and eca39A[TRPJ] strains. Gen-eration time for eca39A cells transformed with EC439 genomic clone (ina centromeric plasmid) is 12% longer than that of their control strains.Each point represents the mean ± SE of five to six experiments. (Cellsgrew slower in this experiment than inA and B because the medium wasdeficient in tryptophan as well as uracil.)

tions in the CANM gene (coding for arginine permease) ineca39A and in isogenic ECA39 strains (Fig. 6). The eca39Amutant cells accumulate mutations at rates higher than iso-genic ECA39 control strains, though they show similar killingcurves byUV light (data not shown). These results suggest thatwhen G1 is shorter, DNA damage is not fully repaired.Deletion ofECA39 had no effect on other cellular phenotypes,such as mating and sporulation efficiencies, sensitivity to heatshock, or cellular morphology (data not shown).

eca39A

Cell size (FSC)

FIG. 5. The G1 stage of the cell cycle is shorter in haploid eca391mutant cells. (A) CellularDNA content ofeca39A andECA39 strains wasmeasured in asynchronous logarithmically growing cultures by FACS.The fraction of G1 cells (containing n DNA) is smaller in the eca39Astrain. (B) Schematic representation of cell cycle stages in haploid eca39Acells compared with control (ECA39). Quantitative analysis (BectonDickinson) determined the fraction of cells containing n DNA (=G1stage of the cell cycle), 2n DNA (=G2+M), or an intermediate amountof DNA (=S). A smaller fraction of the cells was found in G1 in eca39Acultures than in control strains. Knowing the generation time for thesecultures, one can calculate the length of each stage of the cell cycle. (C)Cell size ofeca39A mutant and wild-type haploid yeast strains. The resultsare presented as DNA content versus forward light scatter (FSC) as aparameter for cell size. n, Cells in GI; 2n, cells in G2+M.

DISCUSSIONmyc genes are major regulators in the cell. It has been suggestedthat they play a central role in cell proliferation and differentia-tion (1, 2). Deletion of either c-myc or N-myc results in lethalityduring mouse embryogenesis (28-30), and expression of at leastone member of the myc family may be essential for survival of thecell (30). In accordance with their apparent importance, mycgenes are highly conserved among vertebrates (31-33). Yet it issurprising that myc genes, which have a central role in highereukaryotes, have not been found in lower invertebrates such asyeast, fruit flies, nematodes, and sea urchins (34-37). [It has beensuggested that c,myc is conserved in the sea star, which has closephylogenic ties with vertebrates (38).] Because myc genes havebeen shown to function as transcription factors, regulatingthelevels of expression of other genes, it is intriguing to examinewhether the genes and pathways that they regulate are present inlower eukaryotes. If the target genes for Myc regulation inmammals are indeed conserved in lower eukaryotes, it wouldappear that Myc proteins regulate genes and pathways commonto all eukaryotes. Thus, during evolution, in parallel with theappearance of myc genes, their putative target genes acquiredelements that allowed them to be regulated by Myc proteins.

e, .-.k

Genetics: Schuldiner et aL

Dow

nloa

ded

by g

uest

on

July

11,

202

0

Proc. Natl. Acad. Sci. USA 93 (1996)

, 1200 F7~7 lip9 - -- --- Wi1d type/IniB 1000- *eC3A/

H 800

600

400

E 200

U -- ---I

0 2 4 6 8 10 12 14 16 18

UV irradiation (J/m2)

FIG. 6. Mutation frequencies in haploid eca39A mutant and inwild-type cells. At the logarithmic phase of growth, cells were exposedto UV irradiation in increasing doses. The cells were sonicated andplated, in duplicates, on Can-containing plates (14) to determine thefrequencies of mutations in the arginine permease gene, CAN1. Theresults presented are the averages of three independent experiments.

The ECA39 gene, which has been shown to be transcrip-tionally regulated by c-Myc in the mouse, is highly conservedamong different eukaryotes. Here, we have shown conserva-tion of the ECA39 gene among human, mouse, nematode, andyeast (Fig. 1). Such conservation suggests that this target ofMyc activity existed in evolution before the appearance of mycgenes. Careful examination of the sequences of ECA39 ho-mologs has shown that the human ECA39 gene harbors afunctional c-Myc binding site, suggesting that in the human, asin the mouse, ECA39 expression is regulated by c-myc. Theelement that is conserved in the 5' untranslated region in themouse and human genes is missing from the invertebratehomologs (data not shown). These observations suggest thatthe ECA39 gene exists in many (or all) eukaryotes but func-tions as a target for Myc regulation only in higher eukaryotes.To study the function ofECA39, we have disrupted the gene

in the budding yeast. The mutant strains have faster growthrates, a shorter G1 stage, and a higher rate of mutations. Ourdata suggest that ECA39 may be involved in the control of cellproliferation, regulating the G1 to S transition in the cell cycle.Interestingly, when the human p53, a G1 checkpoint protein inmammals (39), was introduced into budding yeast, it slowedthe growth rate of the cells (40). It has been suggested that thep53 gene is a target for c-Myc regulation (41), as is murineECA39 (10). In view of the cell-cycle phenotype of the yeasteca39A mutant, we propose that myc genes, which are highlyexpressed during embryogenesis and are essential for normalembryonic development, have a dual function. They inducecell proliferation, but, to guarantee reliable replication, theyalso induce checkpoint mechanisms. The combination ofgrowth inducers and inhibtors results in faster, error-freegrowth. As the mouse ECA39 is highly expressed duringembryogenesis, it may perform an essential function in pro-tecting the fast growing cells from accumulating mutations.We expect that in mammalian cells, as in yeast, mutations inECA39 would result in enhanced proliferation at the cost ofincreasing the rate of mutation due to failure to repair DNAdamage before entry into S phase. Thus, the effects of mamma-lian ECA39 on the cell cycle balance the enhanced proliferationpromoted by other proteins that are induced by c-Myc. p53 hasbeen shown to mediate c-Myc-induced apoptosis in mouse fibro-blasts (8). Because mouse ECA39 is a target for Myc regulationand yet, its presence seems to delay cell proliferation, it is possiblethat ECA39, like p53, may be involved in the pathway mediatingthe effect of c-Myc on apoptosis in mammalian cells.

Note added in proof. Our recent results indicate a role for ECA39 in theregulation of metabolism of amino acids. Thus, its effects on the cell cyclemay be mediated through the levels of specific amino acids metabolites.

We thank Dr. Robert Waterston for the nematode ECA39 cDNAclones. We are grateful to Ittai Ben-Porth, Dr. Shoshana Klein, and Dr.Drora Zenvirth for their valuable assistance and for critical reading ofthe manuscript. We were supported by Grant 3811 from The CouncilFor Tobacco Research, by Grant 93-00017 from the United States-Israel Binational Science Foundation (Jerusalem), and by The Leu-kemia Research Foundation. N.B. is an Alon fellow.

1. Cole, M. D. (1986) Annu. Rev. Genet. 20, 361-384.2. Luscher, B. & Eisenman, R. N. (1990) Genes Dev 4, 2025-2035.3. Evan, G. I. & Littlewood, T. D. (1993) Curr. Opin. Genet. Dev. 3,44-49.4. Amati, B. & Land, H. (1994) Curr. Opin. Genet. Dev 4, 102-108.5. Kelly, K., Cochran, B. H., Stiles, C. D. & Leder, P. (1983) Cell 35,

603-610.6. Kelly, K. & Siebelnlist, U. (1986) Annu. Rev. Immunol. 4, 317-338.7. Evan, G. I., Wyllie,-A. H., Gilbert, C. S., Littlewood, T. D., Land, H.,

Brooks, M., Waters, C. M., Penn, L. Z. & Hancock, D. C. (1992) Cell69, 119-128.

8. Hermeking, H. & Eick, D. (1994) Science 265, 2091-2093.9. Benvenisty, N., Ornitz, D. M., Bennett, G. L., Sahagan, B. G., Kuo, A.

Cardiff, R. D. & Leder, P. (1992) Oncogene 7, 2399-2405.10. Benvenisty, N., Leder, A., Kuo, A. & Leder, P. (1992) Genes Dev. 6,

2513-2523.11. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D., Seidman, J. G.,

Smith, J. A. & Struhl, K. (1992) Short Protocols in Molecular Biology(Wiley, New York).

12. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Sci.USA 74, 5463-5467.

13. Spencer, F., Hugerat, Y., Simchen, G., Hurko, O., Connelly, C. &Hieter, P. (1994) Genomics 22, 118-126.

14. Rose, M. D., Winston, F. & Hieter, P. (1990) Methods in YeastGenetics (Cold Spring Harbor Lab. Press, Plainview, NY).

15. Southern, E. M. (1975) J. Mol. Biol. 98, 503-517.16. Thomas, P. (1981) Proc. Natl. Acad. Sci. USA 77, 5201-5205.17. Feinberg, A. P. & Vogelstein, B. (1983) Anal. Biochem. 132, 6-13.18. Crisrianson, T. W., Sikorski, R. S., Dante, M., Shero, J. H. & Hieter,

P. (1992) Gene 110, 119-122.19. Ito, H., Fukuda, Y., Murata, K. & Kimura, A. (1983) J. Bacteriol. 153,

163-168.20. Hutter, K. J. & Eipel, H. E. (1979) J. Gen. Microbiol. 113, 369.21. Gerring, S. L., Spencer, F. & Hieter, P. (1990) EMBO J. 9, 4347-4358.22. Johnston, M., Andrews, S., Brinkman, R., Cooper, J., Ding, H., et al.

(1994) Science 265, 2077-2082.23. Waterston, R., Martin, C., Craxton, M., Huynh, C., Coulson, A.,

Hillier, L., Durbin, R., Green, P., Shownkeen, R., Halloran, N.,Metzstein, M., Hawkins, T., Wilson, R., Berks, M., Du, Z., Thomas,K., Thierry-Mieg, J. & Sulston, J. (1992) Nat. Genet. 1, 114-123.

24. Rothstein, R. (1991) Methods Enzymol. 194, 281-301.25. Russell, P. & Nurse, P. (1987) Cell 49, 559-567.26. Hartwell, L. (1992) Cell 71, 543-546.27. Hartwell, L. H. & Kastan, M. B. (1994) Science 266, 1821-1828.28. Stanton, B. R., Perkins, A. S., Tessarollo, L., Sassoon, D. A. & Parada,

L. F. (1992) Genes Dev. 6, 2235-2247.29. Charron, J., Malynn, B. A., Fisher, P., Stewart, V., Jeannotte, L., Goff,

S. P., Robertson, E. J. & Alt, F. W. (1992) Genes Dev. 6, 2248-2257.30. Davis, A. C., Wims, M., Spotts, G. D., Hann, S. R. & Bradley, A.

(1993) Genes Dev. 7, 671-682.31. Bernard, O., Cory, S., Gerondakis, S. Webb, E. & Adams, J. M. (1983)

EMBO J. 12, 2375-2383.32. Schreiber-Agus, N., Horner, J., Torres, R., Chiu, F. C. & DePinho,

R. A. (1993) Mol. Cell. Biol. 13, 2765-2775.33. Schreiber-Agus, N., Torres, R., Horner, J., Jamrich, M. & DePinho,

R. A. (1993) Mol. Cell. Biol. 13, 2456-2468.34. Shilo, B.-Z. & Weinberg, R. A. (1982) Proc. Natl. Acad. Sci. USA 78,

6789-6792.35. Mifflin, D. & Robinson, J. J. (1988) Biosci. Rep. 8, 415-419.36. Sarid, J. & Leder, P. (1988) Nucleic Acids Res. 16, 4725.37. Blackwood, E. M. & Eisenman, R. N. (1991) Science 251, 1211-1217.38. Walker, C. W., Boom, J. D. G. & Adams, A. G. (1992) Oncogene 7,

2007-2012.39. Perry, M. E. & Levine, A. J. (1993) Curr. Opin. Genet. Dev. 3, 50-54.40. Nigro, J. M., Sikorski, R., Reed, S. I. & Vogelstein, B. (1992) Mol.

Cell. Biol. 12, 1357-1365.41. Ronen, D., Rotter, V. & Reisman, D. (1991) Proc. Natl. Acad. Sci.

USA 88, 4128-4132.

7148 Genetics: Schuldiner et al.

Dow

nloa

ded

by g

uest

on

July

11,

202

0