Embed Size (px)
DESCRIPTION
VPS70, AUTOPHAGY, UNIVERSITY OF IDAHO, DZIEDZIC, CAPLAN, AUTOPHAGOSOME, YEAST, SACCHAROMYCES CEREVISIAE,
Citation preview
ii
AUTHORIZATION TO SUBMIT
DISSERTATION
This dissertation of Slawomir A Dziedzic, submitted for the degree of Doctor of Philosophy
with a major in Microbiology, Molecular Biology and Biochemistry and titled “A novel
contribution of autophagic proteins to the process of cell death”, has been reviewed in final
form. Permission, as indicated by the signatures and dated given below, is granted to submit
final copies to the College of Graduate Studies for approval.
Major Professor_____________________________________Date_______________
Allan Caplan
Committee
Members _____________________________________Date_______________
Patricia Hartzell
_____________________________________Date_______________
Deborah Stenkamp
_____________________________________Date_______________
Gustavo Arrizabalaga
_____________________________________Date_______________
Douglas Cole
Department
Administrator _____________________________________Date_______________
Gustavo Arrizabalaga
Discipline’s
College Dean _____________________________________Date_______________
Scott Wood
Final Approval and Acceptance by the College of Graduate Studies
_____________________________________Date_______________
Jie Chen
iii
Abstract
Background
Autophagocytosis, also known as a “self eating process” is a mechanism that is mainly used
by eukaryotic cells to recycle nutrients rapidly at the onset of environmental stresses such as
amino acid or nitrogen starvation. Despite the fact that this process has been known for a
number of decades, its mechanism of action remains poorly described. One of the biggest
challenges facing this field is the relationship between this “pro-life” phenomenon and the
increasingly indisputable evidence linking autophagy and cell death. One of the reasons
autophagic cell death (ACD) is questioned is that many of the examples supporting it were
obtained using mutants with defects in normal cell death pathways, while many of the
examples showing that ACD could be prevented used inhibitors that also affected other
processes. One way to avoid this controversy is to develop a new model for studying ACD
that could be manipulated genetically. One candidate organism for such studies is
Saccharomyces cerevisiae. Since autophagy plays many roles in eukaryotic cell and human
pathologies, the results from this analysis could identify novel pathways and gene targets
leading to the development of new drugs and treatments.
Methods
In order to examine autophagy functions in response to different stresses I have performed
phenotypic analyses on 112 specifically chosen yeast deletion mutants. To distinguish
between apoptosis and necrosis I used Annexin V/ PI co-staining. Genetic screening for
suppressors of cell death identified the yeast vacuolar protein sorting 70 (VPS70) and other
iv
members of the transferrin receptor-like protein family (TfRL) including the plant altered
meristem program 1 (AMP1) and human prostate specific membrane antigen (PSMA). By
means of biochemical examination employing western blot analysis together with changes in
the in vivo localization of fluorescent reporters, I monitored how different autophagy
pathways are influenced by death-inducing treatments and how the presence of TfRLs are
able to alter this response.
Results
As a result of these analysis I first determined that yeast treated with zinc underwent a form
of necrosis as they died that was facilitated by a group of autophagy proteins. Second, this
same treatment also induced other autophagy proteins to carry out a process in opposition to
the “pro-death” set so as to prolong yeast survival. Third, I have shown that these two
processes also operated when cells were exposed to other stresses such as nitrogen or leucine
starvation. Finally, apoptosis and necrosis could be suppressed by any one of three TfRLs
including the mammalian Psma.
Conclusion
Based on data I have gathered, I have concluded that Psma and other tested members of the
TfRL family possess in common a novel biological activity which can prolong cell survival
during exposure to several unrelated stresses. Significantly, none of the experiments found
evidence of ACD operating independently of apoptosis and necrosis.
v
Acknowledgements
I would like to express my deep gratitude to my major professor Dr. Allan Caplan, for
incomparable mentorship, providing quality education and the opportunity to participate in
truly exceptional research project. I would also like to thank him for passing to me part of his
vast scientific skills and knowledge as well as for his guidance and friendship outside
academics. I also appreciate help of other members of my committee, Dr. Patricia Hartzell,
Dr. Deborah Stenkamp, Dr. Gustavo Arrizabalaga and Dr. Douglas Cole for their valuable
suggestions and support at various stages of my research. I am especially thankful to Dr.
Patricia Hartzell for the opportunity of using her microscope thorough the course of my
project.
I am indebted to Dr. Andrzej Paszczynski who brought me to University of Idaho. I would
also like to express my gratitude to Dr. Katarzyna Dziewanowska and Dr. Bob Behal for
their help with biochemical analysis, as well as other members of MMBB department who
assisted me on many occasions.
I am very grateful to my parents who encouraged and support me at every step of my carrier.
Finally, I would like to thank my bellowed wife Jowita for her companionship, countless
hours of care and numerous suggestions and ideas which helped me to complete my research
project.
vi
This work is dedicated to my wife Jowita
vii
Table of Contents
Abstract ……………………………………………………………………………………..iii
Acknowledgments …………………………………………………………………………...v
Dedication …………………………………………………………………………………...vi
Table of Contents ……………...………………………………………………………...…vii
List of Tables .………………………………………………………………………………..x
List of Figures …………………………………………………………………………….…xi
List of Abbreviations ……………………………………………………………………...xiv
Chapter 1, Introduction to cellular death pathways …………………………………...1
Modes of cell death …………………………………………………………..2
Necrosis ………………………………………………………………………2
Apoptosis ……………………………………………………………………..3
Necroptosis …………………………………………………………………...7
Parp1-mediated necrotic death ……………………………………………..9
Autophagic cell death ……………………………………………………...10
Macroautophagy …………………………………………………………...12
Microautophagy ……………………………………………………………17
viii
Chaperone-mediated autophagy ………………………………………….18
Autophagy functions ……………………………………………………….18
Does autophagy really have the license to kill? …………………………..20
Chapter 2, Hypothesis and specific aims .......................................................................30
Chapter 3, Materials and methods …………………………………………………….33
Chapter 4, Identification of autophagy genes participating in zinc-induced necrotic
cell death in Saccharomyces cerevisiae ……………………………………45
Introduction ………………………………………………………………...47
Results ………………………………………………………………………50
Discussion …………………………………………………………………..75
Chapter 5, Autophagy proteins play cytoprotective and cytocidal roles in leucine
starvation-induced cell death in Saccharomyces cerevisiae ..…………….78
Introduction ………………………………………………………………...80
Results ………………………………………………………………………84
Discussion …………………………………………………………………100
Chapter 6, A novel effect of Prostate specific membrane antigen, a member of TfRL
protein family, on cell death in yeast .....………………………......……..103
Introduction ……………………………………………………….………105
ix
Results ……………………………………………………………………..108
Discussion …………………………………………………………………134
Chapter 7, Future directions ……………………………………………….…………138
Chapter 8, References …………………………………………………………………146
x
List of Tables
Table 1.1. Diagnostic features of the different death pathways…………..…………..……..25
Table 3.1. Yeast strains used in this study ………………………………………………….42
Table 3.2. Plasmids used in this study ……………………………………………………...43
Table 4.1. Classification of knockout mutant phenotypes ………………………………….60
Table 5.1. Rapamycin reduces the symptoms of death during leucine starvation ………….90
Table 6.1. VPS70 requires many vacuolar proteins to protect cells from Zn2+
..……...….. 118
xi
List of Figures
Figure 1.1. Classification of cell death pathways …………………………………………..26
Figure 1.2. Characterization of autophagy pathways ………………………………………27
Figure 1.3. Non-specific autophagy targets random cytoplasm content for degradation …..28
Figure 1.4. Cvt transport of the premature Ape1 protein to the vacuole …………………...29
Figure 4.1. Zn2+
disrupts cell metabolism and division …………………………………….61
Figure 4.2. Vacuolar inclusions in Zn2+
-treated cells bound DAPI ….……………………..62
Figure 4.3. Zn2+
-induced cell death is dependent on ATG8 ………………………………...63
Figure 4.4. Zn2+
-treated cells failed to expose annexin-binding sites ……………………...64
Figure 4.5. GFP-Atg8 accumulated in perivacuolar vesicles in Zn2+
-treated cells …………65
Figure 4.6. Dual fluorescent protein, ROSELLA
Cyt, was restricted to the cytosol in Zn
2+-
treated cells ……………………………………………………………………..67
Figure 4.7. Zn2+
did not promote the harvesting of either nuclear- or mitochondrially-
targeted ROSELLA ………………………….………………………………….68
Figure 4.8. Ape1-RFP accumulated in perivacuolar vesicles in Zn2+
-treated cells ………...69
Figure 4.9. Classification of phenotypic responses of mutants to excess zinc ……………..71
Figure 4.10. Autophagic mutants were differentially inhibited by Zn+2
…………………....73
Figure 4.11. Mutants of SEY6210 behaved qualitatively like those of BY4741 …………...74
Figure 5.1. Autophagy mutants did not respond uniformly to nutrient deprivation ………..91
Figure 5.2. Annexin V and PI staining in PS populations progresses at different rates
depending on the starvation treatment ………………………………………….92
xii
Figure 5.3. Expressing GFP-Atg8 in PS cells changed the percentages of cells dying
during starvation ………………………………………………………………..93
Figure 5.4. GFP-Atg8 was not harvested or processed by Δatg8 cells during leucine
starvation ……………………………………………………………………….94
Figure 5.5. GFP-Atg8 was not harvested in leucine-starved Δatg8 cells …………………...95
Figure 5.6. HttQ25
-GFP didn’t influence cell death …………………………………………96
Figure 5.7. HttQ25
-GFP didn’t accumulate in vacuoles during leucine starvation ………….97
Figure 5.8. Leucine-starved cells harvested basal levels of Ape1-RFP …………………….98
Figure 6.1. TfRL proteins protect yeast from excess zinc ………………………………...120
Figure 6.2. Psma and Amp1 did not need Vps70 to protect cells from zinc ………………122
Figure 6.3. TfRL proteins protect yeast from treatments that induce necrotic and
apoptotic death ………………………………………………………………...123
Figure 6.4. VPS70 did not alleviate all causes of death …………………………………...125
Figure 6.5. VPS70 suppressed autophagy mutations but not a knockout of the rab-like
gene, YPT7 …………………………………………………………………….126
Figure 6.6. TfRL proteins alter vacuolar morphology and the cell size of yeast ………….127
Figure 6.7. Vps70 was not required for Ape1-RFP harvesting by CVT or autophagic
pathways ……………………………………………………………………...128
Figure 6.8. Vps70 did not suppress the inhibitory effect of Zn2+
Ape1-GFP import into
vacuoles ………………………………………………………………………..129
Figure 6.9. TfRL proteins suppressed the block on GFP-Atg8 import into vacuoles
caused by Zn2+
………………………………………………………………...130
Figure 6.10. PMSA and PSMA-GFP required Atg11 to protect cells from 13 mM Zn2+
….131
xiii
Figure 6.11. Psma-GFP was harvested by an Atg11-dependent process in
Zn2+
-treated cells ……………………………………………………………..132
Figure 6.12. Psma-GFP was harvested during both leucine- and nitrogen-starvation ……133
Figure 7.1. Model describing possible role of Psma in response to Zn2+
………………....145
xiv
List of Abbreviations
ACD – Autophagy cell death
ATG – Autophagy related gene
CMA – Chaperone-mediated autophagy
Cvt – Cytoplasm to vacuole transport
DR – Death receptor
MOB – Mitochondrial outer membrane permeabilization
Parp1 - Poly(ADP-ribose) polymerase 1
PAS – Phagophore assembly site
PCD – Programmable cell death
PI – Propidium iodide
PMN – Piecemeal microautophagy of the nucleus
Psma – Prostate specific membrane antigen
Rap – Rapamycin
TNF – Tumor necrosis factor
Tor – target of rapamycin
1
Chapter 1
Introduction to cellular death pathways
2
Modes of cell death
It is the ultimate fate of every living cell to die. It is sometimes hard to understand that every
cell has the means to do this encoded in its genome. The major role of cell death during
development is to orchestrate morphogenesis and tissue sculpting whereas in mature
organisms it helps to maintain homeostasis and remove cells invaded by pathogens. Because
of its crucial role, many defects in cell death functions are widely associated with many
diseases such as neuron degenerative disorders or cancer.
Historically, cellular death was called necrosis until 1971 when the form of nonpathologic
“shrinking necrosis” was described in certain tissue types (Kerr, 1971). Later on, this was
called apoptosis to distinguish between gene-independent and gene-controlled forms of
death. Nevertheless, as more and more data was gathered it became obvious that this simple
division was not sufficient since other forms of death have been discovered. Because of that,
an effort has been made to create a new taxonomy which would include those new
mechanisms. One such a classification was recently proposed by Degterev and Yuan (2008),
where cellular death pathway were divided into Programmable cell death (PCD) and necrosis
(Figure 1.1).
Necrosis
Necrosis (from Greek “death, the stage of dying) is considered to be an uncontrolled,
premature death of cells or living tissue. The mechanism was described in detail in 1988
(Walker et al, 1988). It is characterized by plasma membrane disruption, organelle swelling,
random DNA degradation, and overall bioenergetic impairment (Zong & Thompson, 2006).
It is a passive process which does not require protein synthesis, energetic input and does not
3
play any known role in homeostasis. In humans, necrosis can be triggered by exposure to
toxins or reactive oxygen metabolites, temperature treatment or nutrient deprivation and
generally by any severe change in physiological conditions (Nicotera et al, 1999; Nicotera &
Lipton, 1999). Despite its relevance in many human diseases, such as Huntington, Parkinson
or Alzheimer syndromes (Price et al, 1998), a detailed molecular outline of events occurring
during necrosis remains to be elucidated.
Due to many challenges and difficulties in working with higher eukaryotes, many studies
related to this death pathway have been carried out in Drosophila melanogaster (Mutsuddi &
Nambu, 1998) or Saccharomyces cerevisiae (Eisenberg et al, 2010b). In yeast, more than a
dozen different agents capable of inducing necrosis have been characterized. Most of them,
like H202, valproic or acetic acid, Mn2+
, Cu2+
or amphotercin B may be also utilized in lower
concentrations to study apoptosis (Liang & Zhou, 2007; Ludovico et al, 2001b; Madeo et al,
1999). Because one of the necrotic hallmarks is membrane permeabilization, the passive
transfer of propidium iodide (a DNA binding dye) through the disruptions is used as a
primary death indicator.
Apoptosis
The word apoptosis (from the Greek “falling off” as in leaves from tree) was introduced in
1972 to describe morphological changes leading to controlled cell demise (Kerr et al, 1972).
The mechanism is characterized by an internucleosomal fragmentation of genomic DNA
(Wyllie, 1980), and cell shrinkage and fragmentation into apoptotic bodies that are rapidly
engulfed by phagocytes (Kerr et al, 1972).
4
Even though the existence of apoptosis was described in the early seventies of the previous
century, its molecular basis was dissected as recently as twenty years ago (Horvitz et al,
1994). Those pioneer studies were mostly done in Caenorhabditis elegans, a transparent
nematode in which 131 cells undergo PCD during development. Interestingly, any disruption
of the cell death machinery results in organisms with additional cells (Hedgecock et al,
1983). The apoptosis in those selected cells is triggered by the transcriptional activation of
egl-1†, which in turn binds to a suppressor of Ced-4, Ced-9, leading to the activation of Ced-
3 which triggers a cascade of reactions resulting in death (Metzstein et al, 1998).
In mammals, apoptosis can be triggered by different stimuli through intrinsic and extrinsic
pathways. Intrinsic mechanisms, which resemble PCD in C. elegans, may be initiated by
“stress signals” such as cytoskeleton disruption, protein synthesis inhibition or DNA damage
(Youle & Strasser, 2008). Extensive studies have led to the identification of various
homologues in mouse and different human cell lines for each of the Ced proteins revealing
complexity of this mechanism in higher eukaryotes. Even though mammalian Egl-1-like
BH3-only members of BCL2 family, like the related proteins in C. elegans, inhibit anti-
apoptotic Ced-9-like proteins via direct interactions (Youle & Strasser, 2008), the more
important role of this protein group is to protect the integrity of mitochondria, thus inhibiting
Bax/Bak pro-apoptotic activation (Cheng et al, 2001). Bax, Bak and Bok, which make up the
Bax family of proteins, possess a BH domain which makes them structurally similar to Bcl2.
Studies in the mouse model revealed that their presence is essential for the initiation of
apoptosis and at the same time suppression of oncogenic transformation (Zong et al, 2001).
Upstream signals, such as DNA damage, activate caspase-8 which in turn cleaves p15 Bid,
creating tBid which by direct interaction with either Bax or Bad results in their
5
oligomerization which leads to mitochondrial outer membrane permeablization (MOMP) (Li
et al, 1998). The presence of MOMP mediates release of cytochrome c or AIF, proteins
which are normally found in between two mitochondrial membranes (Scorrano &
Korsmeyer, 2003). In the cytoplasm, cytochrome c initiates formation of the APAF1
complex, which then activates caspase-9 by changing its conformation. This in turn activates
the group of caspases which are involved in the biochemical chain of events leading to death
(Degterev et al, 2003).
This intrinsic pathway can be compared with the extrinsic pathway that is initiated after the
engagement of pro-inflamatory and pro-apoptotic ligands which bind to surface death
receptors (DR) (Schulze-Osthoff et al, 1998). The best studied death factors belong to the
tumor-necrosis-factor (TNF) protein family which is composed of TNF (TNFα), FasL and
TRAIL (Gonzalvez & Ashkenazi, 2010). Interaction of those factors, which are
predominantly produced by the immune system, with DR triggers the formation of
intercellular death signaling complexes (DISCs), which activate caspase-8 (Micheau &
Tschopp, 2003), thus initiating either the caspase signaling pathway (Amarante-Mendes &
Green, 1999) or mitochondria damage leading to cell death (Barnhart et al, 2003).
Apoptosis is believed to be a universal PCD mechanism present in almost all eukaryotic
organisms. Nevertheless, recent discoveries in plant molecular biology seem to be
questioning this dogma. In a review article, Van Doorn and others (2011) argue that dying
plant cells never exhibit traits characteristic for apoptosis. Even though protoplasts exposed
to stress treatments do shrink, they never form apoptotic bodies when their plasma membrane
is disrupted (Heath, 2000). What is more, proteolytic activity and caspase activation has
never been shown to be associated with apoptosis in plants (Hatsugai et al, 2004). These
6
findings taken together with the fact that chromatin condensation and DNA fragmentation in
plants is associated with other forms of PCD (Lee & Baehrecke, 2001), led to the hypothesis
that apoptosis is not present in those organisms. Instead, the authors proposed two alternative
forms of programmable cell demise: necrosis and vacuolar plant death.
Apoptosis was also discovered in Saccharomyces cerevisiae (Madeo et al, 1997b),
Schizosaccharomyces pombe, as well as in a number of protozoan parasites (Carmona-
Gutierrez et al, 2010). Initially it did not make any sense for the organism composed only of
a single cell to poses any form of programmable cell death. Nonetheless the presence of PCD
in unicellular organisms is often explained as one more feature associated with quorum
sensing, where the death by an individual cell can be beneficial for the whole population
(Büttner et al, 2006). For example, in the wild, any individual cell which comes across
rotting fruit will start a colony composed of organisms carrying virtually the same genotype.
Within time, nutrients from the source will run out and the members of the colony will enter
a dormant, but still metabolically active, state that continues to undergo chronological aging
(Fabrizio & Longo, 2007). Nonetheless even in this phase cells utilizing the last portions of
the available nutrients will sentence the whole colony to its doom. Because of that, it seems
that older cells (particularly those which divided more than twice) preferentially undergo
apoptosis “donating” their portion of amino acids and sugars to the younger ones (Allen et al,
2006)
In yeast, as mentioned previously, apoptosis can be induced by a lower concentration of the
same agents that induce necrosis. The molecular mechanisms for this process are still
unknown. Nonetheless, similar to higher eukaryotes, reactive oxygen species (ROS)
originating from the mitochondrial respiratory chain together with nitric oxide (NO) serve as
7
the two main signals capable of initiating apoptosis (Almeida et al, 2007; Laun et al, 2001).
Only a handful of proteins have been identified to play a role in apoptosis, among which is a
homologue of human caspases, Yca1. Because this doesn’t have the ability to hydrolyze
proteins after an acid residue (aspartate), it is biochemically considered a metacaspase.
Nevertheless, Yca1 is believed to be responsible for the initiation of a process equivalent to
apoptosis in yeast.
One of the earliest hallmarks of apoptosis is a translocation of a phosphatidylethanolamine
from the inner to the outer leaflet of the cellular membrane making it accessible to
fluorescence-tagged annexin V. If cells stain positively both for annexin V and PI then it
implies that they are undergoing late apoptosis, or as it is sometimes known, secondary
necrosis (Carmona-Gutierrez et al, 2010). Other, sometimes less reliable, methods to detect
apoptosis in yeast include DNA nicks staining using TUNEL and DAPI staining which is
being used to measure the level of chromatin condensation (Madeo & Fröhlich, 2008).
Necroptosis
As noted previously, stimulating the DR protein family with any of its ligands leads to the
induction of an extrinsic form of apoptosis (Schulze-Osthoff et al, 1998). Nevertheless, some
studies have shown that cells are still able to undergo some form of gene-regulated death
even when their caspase-3 is inhibited (Degterev et al, 2005). Cells treated in this way failed
to show nuclear fragmentation, plasma membrane disruption, and organelle swelling, and so
seemed to be dying necrotically rather than apoptotically (Matsumura et al, 2000;
Vercammen et al, 1998). This has come to be recognized as a new form of PCD called
programmable necrosis or necroptosis (Degterev et al, 2005).
8
Receptor interacting protein 1 (Rip1) is an essential player that seems to be responsible for
initiating necroptosis (Degterev et al, 2008). Rip1, first discovered in relation to NF-κB
activation, possesses a serine/threonine kinase activity that autophosphorylates at residue Ser
161 (Degterev et al, 2008). However, phosphorylation alone is insufficient to activate the
protein: it also needs an upstream signal from TNF-related apoptosis-inducing ligand
(TRAIL) to trigger additional conformational changes of Rip1 which lead to its dimerization
(Degterev et al, 2005). At the moment, very little is known about Rip1 substrates and the
signaling pathways downstream from it. What has been shown is that upon activation, Rip1
translocates to the mitochondria and then triggers their rapid degeneration, presumably by
disrupting the association of ADP-ATP translocase with cyclophilin D (Temkin et al, 2006).
How this is done remains to be elucidated.
It has been postulated that ROS might be executioners of necroptosis. Nevertheless, their
involvement in the process is likely very cell type specific since antioxidant treatment is
unable to protect some cell lines against necroptosis (Degterev et al, 2005). Similarly,
knockouts of the genes involved in autophagy such as BECLIN1 (homologue to the yeast
AuTophaGy-related gene 6, ATG6) or ATG7, were shown to prevent this type of death in
mammalian cells (Yu et al, 2004). Nonetheless, this is the only, to date, system in which a
direct correlation between autophagy and necroptosis inhibition has been described
(Christofferson & Yuan, 2010).
Although researchers have begun to understand necroptosis, it appears that all of the cases
attributed to it result from pathological conditions. Because this linkage has medical
implications, a screen has been carried out recently that has identified a group of structurally
different, small molecules which can preferentially inhibit necroptosis, but not TNFα-
9
induced apoptosis (Degterev et al, 2005; Teng et al, 2005). The most potent of these
chemicals, Nec-1, is the first described specific inhibitor of Rip1. Its addition protects
neurons against excitotoxins, which are involved in the pathology of neurodegenerative
diseases (for example Alzheimers Disease) and in acute neuronal loss resulting from strokes
(Moskowitz et al, 2010). Excitotoxicity occurs mainly as a result of excessive stimulation by
neurotransmitters such as glutamate, which by binding to the neurotransmitter receptors,
allows excessive amounts of calcium ions to enter the cell and to death (Manev et al, 1989)
Parp1-mediated necrotic death
Poly(ADP-ribose) polymerase 1 (Parp1) is a very important nuclear protein needed for a
genome stability. This enzyme, which is activated by DNA-strand breaks, possesses three
functional domains. Two N-terminal zinc fingers are responsible for binding to the single-
and double-strand DNA brakes. The central automodification domain allows for self
poly(ADP-ribosyl)-ation, while the carboxy-terminal part of the protein can transfer ADP-
ribose subunits from NAD+ to peptide acceptors (Rouleau et al, 2010). Loss of Parp1 results
in cell hypersensitivity to DNA damage. At the same time, its excess can trigger a unique,
non-apoptotic form of PCD (Oei et al, 2005).
In glycolytic cells, Parp1 mediates necrotic cell death resulting from an “energy collapse”
caused by a depletion of NAD+ in the cytosol. In this case, Parp1 acts as a “metabolic sensor”
in the damaged cells which recognizes if ATP can be produced in glucose-dependent and
independent processes. Cell that can run both processes, rather than just one of them, are
resistant to Parp1-mediated DNA-damage induced death. This ATP “sensing” prevents
accumulation of DNA damage in rapidly proliferating cells that would be predisposed to
10
becoming transformed (Zong et al, 2004). In a separate response to secondary DNA damage,
Parp1 triggers the translocation of the apoptosis inducing factor (AIF) from the mitochondria
to the nucleus where it causes nuclear condensation and cell death (Yu et al, 2006b). The
exact nature of this mechanism is unknown, but it has been postulated that Parp1 can either
change mitochondria membrane polarization or bind to a specific factor, in either case
leading to the AIF release (Gagne et al, 2003).
Parp1 inhibitors have proven to be extremely effective in mouse models of various diseases.
They provide significant protection against colitis, neurodegeneration and diabetes mellitus
(de la Lastra et al, 2007) as well as seem to be very promising agents in cancer treatment
since their application selectively kills some tumor cells (Zaremba et al, 2010).
Autophagic cell death
The term “autophagy” (from Greek “self-eating”) was introduced in 1963 to describe the
presence of intracellular single- or double-membrane vesicles containing degenerated
cytoplasmic content (De Duve & Wattiaux, 1966). Early studies on autophagy which were
carried out in rat livers demonstrated that the process could be induced by starvation
(NOVIKOFF et al, 1964). Later on, it became apparent that this process was specifically
triggered by the lack of amino acids and that the degradation mediated by autophagocytosis
was the cell’s way of relieving this (Mortimore & Schworer, 1977).
Even though the early studies were based on morphological changes observed predominantly
in mammalian tissue, most of what we know today about autophagy comes from genetic
analyses carried out in Saccharomyces cerevisiae. In the early nineties, a pioneering analysis
performed by Ohsumi and co-workers showed high levels of similarity between the
11
mechanistic principles of autophagy in yeast and mammals (Takeshige et al, 1992b). This
work was followed by the identification of the first AuTophagy-related Gene, ATG1, that
encoded for a ser/thr protein kinase (Matsuura et al, 1997). Since the recent identification of
ATG34 (Suzuki et al, 2010), more than thirty yeast proteins have been directly and
exclusively assigned to this pathway.
Initially, autophagocytosis was believed to be a process only responsible for the random
degradation of the contents of the cytoplasm. This activity was seen to release free amino
acids and lipids which could be utilized to prolong cell survival during stress (Tsukada &
Ohsumi, 1993b). Within time it became obvious that this was only one of the mechanisms by
which autophagy proceeded. Nowadays, autophagy is very often divided into macrophagy,
microphagy and chaperone-mediated autophagy (CMA). Within the macrophagy category,
researchers distinguish between mechanisms of random sequestration of the intracellular
content (non-specific autophagocytosis) and very specific destruction mechanisms named
according to the nature of the substrate being targeted (e.g. destruction of mitochondria –
mitophagy, ER – ER-phagy, nucleus – nucleophagy, and so on) (Mizushima et al, 2008).
This simple classification is believed to apply to most eukaryotic organisms although yeast
possesses an additional very selective process called cytoplasm to vacuole transport (Cvt)
(Harding et al, 1995b). In most organisms and cell types all of these different forms of
autophagocytosis co-exist in any given time. Nevertheless, the rate of each activity and their
contribution to homeostasis may vary greatly depending on the cell type and environmental
conditions (Cuervo, 2010).
12
Macroautophagy
Different forms of autophagy operate using dissimilar machineries (Figure 1.2). During
mammalian macroautophagy de novo created membranes surround and engulf cytoplasm
within a double membrane vesicle called an autophagosome. This autophagosome is then
delivered to the lysosome. Upon fusion, it forms a so-called autolysosome where lysosomal
enzymes degrade the captured cytoplasmic material (Mizushima et al, 1998). In organisms
which do not posses lysosomes (like yeast), autophagosomes fuse with vacuoles and release
their contents for destruction (Tsukada & Ohsumi, 1993b). The whole mechanism, which
includes vesicle formation, delivery, and lysosomal (vacuolar) fusion is carried out by ATG
proteins and negatively controlled by a tyrosine protein kinase complex called TORC
(Kamada et al, 2000). In normal physiological conditions, macroautophagy operates at a very
low basal level. Nitrogen starvation or treatment with the chemical, rapamycin, leads to
inhibition of the Target Of Rapamycin (Tor or mTor in mammals) inhibitor of autophagy.
This in turn activates another serine/threonine protein kinase Atg1, which forms a ternary
complex with Atg13 and Atg17 to create a scaffold for other ATG proteins thus recruiting
them to the phagophore assembly site (PAS) (Figure 1.3) (Kawamata et al, 2008). Unlike
yeast, mammalian cells possess two Atg1 homologues Unc-51-like kinase 1 (Ulk1) and -2
(Ulk2) and one Atg17 homologue, Fip200. Similar to the yeast system, those three proteins
together with Atg13 create a complex which initiates assembly of the preautophagosome
assembly structure (PAS) (Hara et al, 2008).
Autophagosomes are built at the PAS from ER-originated membranes (Girardi et al, 2011).
This extremely complex process requires formation of the class III phosphatidylinositol 3-
kinase (PtdIns3K) complex, which in yeast contains Atg6, Atg14, Vps15 and Vps34. The
13
main function of this complex is to recruit Atg18, Atg20, Atg21 and Atg24 to the PAS,
where, together with the PtdIns3K, they further employ two ubiquitin-like conjugation
systems, that condense Atg8-phosphatydyloethanoloamine and Atg12-Atg5-Atg16 , which
are the key elements of autophagosome formation (Nice et al, 2002). In mammals, this
mechanism operates in a similar fashion by utilizing homologues of the yeast proteins with
the exception of Atg20 and Atg24 (He & Klionsky, 2009).
When autophagosome formation is complete, all ATG proteins dissociate back to the cytosol
with the exception of Atg8 which remains with the autophagosome and enters the lysosome
or vacuole with the inner-most membrane of the autophagosome. The exact details of this
process still need to be elucidated, but the crucial role of a cysteine protease Atg4 in vesicle
fusion is beyond any doubt (Kirisako et al, 2000). The protein set which is responsible for
autophagosome-lysosome fusion is virtually the same as the one guiding autophagosome
fusion with the vacuole. In both cases, fusion of the two vesicles requires small GTPases,
Ypt7 or Vps21 (mammalian Rab7 and Rab5, respectively), members of the class C
Vps/HOPS complex, SNARE proteins Vam3, Vam7, Vti1 and Ykt6, together with Ccz1 and
Mon1 which are proposed to be guanine exchange factors (GEF) for GTPases (Klionsky,
2005; Nordmann et al, 2010b). Upon fusion, the contents of the autophagosomes are
degraded by acid hydrolases such as proteinases A and B together with lipase Atg15 (Epple
et al, 2001). In yeast the end products of autophagic degradation, amino acids, are then re-
cycled back to the cytosol by a set of vacuolar permeases including Atg22 and Avt4 (Yang &
Klionsky, 2007).
In selective macroautophagy, the cargo is generally recognized by its interaction with a
specific recognition protein. The Cvt pathway shown on Figure 1.4 is probably the most
14
extensively studied type of specific autophagocytosis. Even though Cvt uses many of the
ATG proteins used by other processes (Scott et al, 1996), there are few major differences in
the way Cvt operates in comparison with non-specific macroautophagy. First of all, this
pathway operates constitutively, thus “conventional” autophagy inducers have no effect on
the rate of its activity. Furthermore, this mechanism is known to operate using vesicles
called Cvt-somes that are smaller than conventional autophagosomes (Scott et al, 1996). Cvt
transports four known hydrolases to the vacuole for their maturation rather than degradation
(Kim et al, 1997b). Ape1 is one such aminopeptidase that hydrolases leucine substrates
(Trumbly & Bradley, 1983). Ape1 is synthetized in the cytosol as an inactive proenzyme
(mApe1), which is recognized by a receptor protein, Atg19. This complex is in turned
recognized by an adaptor protein Atg11, which directs it to the PAS, where Atg19 interacts
with Atg8 to initiate Cvt vesicle formation (Scott et al, 2001). The Cvt-some is transported
and fused with the vacuole using (apart from a few exceptions such as a requirement for Ypt7
and Vps15) essentially the same components as non-specific macroautophagy (Noda et al,
2000). Extensive studies, mainly performed by Klionsky’s group, led to identification of
additional Cvt proteins such as Atg21, Atg23 and Atg24 (Lynch-Day & Klionsky, 2010).
Atg21 was shown to be responsible for vesicle formation in place of Atg18 that is not
required for non-specific macrophagy (Barth et al, 2002) Similarly, Atg24 a member of the
nexin family of sorting proteins, and Atg23, a PAS peripheral membrane protein, are only
crucial for Cvt (Harding et al, 1996; Meiling-Wesse et al, 2004).
In higher eukaryotes, selective macroautophagy is exclusively associated with the
preferential destruction of cellular organelles. Nevertheless, recent studies have shown that
autophagy is also involved in selective destruction of ubiquitinated preoteins and protein
15
aggregates (Fujita & Yoshimori, 2011; Jimenez-Sanchez et al, 2011). This mechanism is
mediated by p62, which binds to mono- and poly-ubiquitinated substrates by means of its
ubiquitin-associated (UBA) domain. In turn, this increases the affinity of these complexes
for LC3, the mammalian homologue of yeast Atg8 (Pankiv et al, 2007). Because p62 and
Atg19 share similar N-terminal domains, it is believed that the mammalian protein is in fact a
receptor that operates for its substrates like Atg19 does for Ape1 in yeast (Noda et al, 2008).
Damaged mitochondria tend to release reactive oxygen species (ROS) into the cytosol where
they can damage cell structures and thus trigger death. A specialized type of macroautophagy
called mitophagy is responsible for clearing these dysfunctional organelles from cells. In
yeast, Atg32 is a protein which tags mitochondria for autophagic destruction by binding to
their outer membrane (Okamoto et al, 2009). This protein, in turn, is recognized by Atg11,
which under mitophagy-inducing conditions, acts as an adaptor for the autophagosome.
Relatively little is known about the molecular basis of this process, but a recent genomic
screen has identified another yet mitophagy-related protein of unknown function, Atg33
(Kanki et al, 2009).
When the cells encounter stress conditions characterized by a prolonged lack of amino acids,
it can terminate the energetically expensive process of ribosome biogenesis and protein
translation by a mechanism called ribophagy. Within this process the large ribosomal subunit
is degraded in a ubiquitin protease-dependent manner This mechanism is carried out by a de-
ubiquitinase, Ubp3 (cysteine protease), interacting with its cofactor, Bre5 (Kraft et al, 2008).
In addition, the chaperone-like protein, Cdc48, with its cofactor, Ufd3, have recently been
shown to be involved in ubiquitin tagging of ribosomes (Ossareh-Nazari et al, 2010).
16
Remarkably, the adaptor protein for ribophagy seems to be Atg19, the adaptor also essential
for Cvt (Baxter et al, 2005).
During starvation, or during the unfolded protein response that occurs in response to
inhibition of protein folding, ER structures are destroyed by a gene-regulated process called
ERphagy (Hamasaki et al, 2005). Interestingly enough, under nutrient deprivation, ERphagy
is independent of Atg5 and Atg12, which implies that ER may be delivered to the
vacuole/lysosome using an autophagosome-independent pathway (Mijaljica et al, 2006).
Similarly, preferential degradation of peroxisomes may or may not occur via the
autophagosome machinery (Manjithaya et al, 2010). Peroxisomes are single membrane
organelles with multiple functions including fatty acid biogenesis and detoxification of
hydrogen peroxide. In yeast they are mostly destroyed in an Atg8-independent manner in
response to shifts in carbon source as occurs when cells are transferred from methanol to
glucose (Komatsu & Ichimura, 2010). For historical reasons, the molecular principles of
pexophagy were revealed mostly by studies carried out in Pichia pastoris. Atg30, a receptor
for this process, has been identified and shown to bind to the peroxisomal proteins, Pex3 and
Pex14, causing Atg30 to be autophosphorylated. Activated Atg30 interacts with Atg11,
which triggers the vacuole to engulf the tagged peroxisomes bringing them directly into the
vacuole. Unlike autophagic receptors like Atg19 and p62, Atg30 does not have an Atg8
binding domain, adding support to the notion that pexophagy does not require
autophagosome formation (Farré et al, 2008).
Another specific type of macrophagy is involved in the degradation of certain parts of the
nucleus. This so-called piecemeal microautophagy of the nucleus (PMN) is an Atg11
dependent mechanism within which a nuclear-vacuolar junction is formed mediated by the
17
vacuolar protein, Vac8, and by the nuclear protein, Nvj1 (Roberts et al, 2003). Nutrient
starvation increases the affinity of Nvj1 for Osh1 and Tsc13, which in turn helps Nvj1 to
create holes in the membranes that separate the nucleus from the vacuole (Kvam & Goldfarb,
2004). PMN is not believed to be responsible for nutrient re-cycling, but rather involved in
the regulation of nuclear processes important during stress conditions.
Microautophagy
In mammals, microautophagy is a direct sequestration of cytoplasm content by the lysosome.
Despite the fact that this mechanism has been known for almost half a decade, its exact
mechanism and function in higher eukaryotes still remains unclear (Mijaljica et al, 2011). In
yeast, non-selective microautophagy (NMS) where the vacuole forms a tubular invagination,
has been seen by fluorescence and electron microscopy (Muller et al, 2000). Both in-vitro
and in-vivo studies have revealed that NMS depends on an ATPase activity and on a proton
gradient across the membrane. Furthermore, GTPase together with sources of lipids and
membranes is crucial for the release of the mincoautophagic vesicles into the lumen. The
whole process occurs independently of proteins involved in “regular” vacuolar fusion (Sattler
& Mayer, 2000). NMS can be induced by starvation (Mayer, 2008) and is at least partially
regulated by Tor and by the EGO (exit from rapamycin-induced growth arrest) complex
composed of Ego1, Ego3, Gtr2 (Dubouloz et al, 2005b). Actin (Uttenweiler et al, 2005), not
tubulin (Kunz et al, 2004), seems to be involved in the mechanism of membane invagination,
but how it is used remains unknown.
18
Chaperone-mediated autophagy
CMA is a direct translocation of a target protein to the lysosome lumen so that it can be
degraded. This process was first discovered in human fibroblasts (Dice, 1982) and has
continued to be studied in mammalian tissues. Its basic machinery requires chaperones which
recognize the substrate and deliver it to the lysosome, a receptor which pulls the substrate
into the lysosome lumen, and a substrate that poses the specific recognition motif, KFERQ
(Orenstein & Cuervo, 2010). Hsc70 is a chaperone which can be found both bonded to the
lysosome or in a free form. Hsc70 possesses a strong affinity for the KFERQ sequence and
transports the recognized proteins to a lysosomal receptor, Lamp2a, where it is partially
unfolded before it is transported across the lysosomal membrane for its degradation (Majeski
& Dice, 2004). Similar to macroautophagy, CMA is most effectively induced by stresses
such as nutrient depravation. It was shown that this mechanism can contribute both to the
selective degradation of “unimportant” proteins as well as damaged ones which could
otherwise trigger cell death (Cuervo, 2010). Because of that, and due to the fact that basal
CMA was shown to be important for cell homeostasis (Massey et al, 2006), this pathway has
attracted great interest because stimulating it may be beneficial for treating several human
diseases such as Alzheimer or Parkinson diseases that are characterized by protein misfolding
and aggregation (Li et al, 2011).
Autophagy functions
Autophagy, as one of the primary non-proteosomal degradation pathway plays multiple roles
during both normal and pathological stages of the life of a cell. Because the primary role of
autophagy is to clear the cell of damaged proteins or organelles, this mechanism is
19
indispensable during aging. Studies in Drosophila melanogaster revealed that mutants
lacking Atg7 expression in their central nervous system lived shorter lives than their parents
(Juhász et al, 2007). In addition, over-expression of ATG8 resulted in increased lifespan in
adult organisms (Simonsen et al, 2008). Autophagy is also stimulated in old cells by caloric
restriction, which correlates with the prolonged longevity that this condition produces
(Cavallini et al, 2008).
In addition to being involved in aging, autophagy is considered to be a defense mechanism
against many human diseases ranging from neurodegenerative syndromes to cancer.
Rapamycin treatment, which inhibits Tor leading to autophagy induction, has been shown to
remove otherwise toxic huntingtin aggregates in a mouse model (Ravikumar et al, 2004).
Furthermore, recent studies showed that autophagy is stimulated by ROS and contributes to
clearance of amyloid-β-peptide (the main cause of the condition) in Alzheimer’s disease
(Lipinski et al, 2010). A link between autophagy and cancer was established by the discovery
that Beclin 1 (an essential mammalian autophagy protein) is also a haplo-insufficient tumor
suppressor. Beclin 1 binding to the anti-apoptotic protein Bcl-2, decreases its affinity for
Vps34 and inhibits autophagy. Furthermore beclin 1 mice are more susceptible to different
forms of metastasis (Qu et al, 2003) while its monoallelic loss coincides with more than 50%
of human breast, ovary and prostate cancer cases (Aita et al, 1999). In general, defects in
autophagy lead to the accumulation of damaged mitochondria, ROS and mis-folded proteins,
which in turn may promote DNA damage which in turn results in metastatic transformation
(Mathew & White, 2007). In this regard, autophagy is utilized by the cell to protect itself
from carcinogenesis. Nevertheless, once cancer does begin, autophagy can prolong its
survival by protecting the cells from stresses such as nutrient limitations or hypoxia. This
20
phenomenon is the focus of several new strategies for cancer treatment. Many drugs in
clinical trials nowadays inhibit autophagy and by doing so, lead to tumor regression
(Amaravadi et al, 2007).
Beyond its well described involvement in cell defense mechanisms, autophagy also
participates in various developmental processes in numerous organisms. In yeast, diploid
mutants deficient in autophagocytosis cannot sporulate during starvation (Tsukada &
Ohsumi, 1993b), while ATG1 and ATG3 strains of Drospohila melanogaster die prematurely
before reaching the pupal stage (Juhász et al, 2003). In addition, mice embryos lacking
Beclin 1 are unable to undergo developmental divisions and die prematurely (Mathew et al,
2007).
Does autophagy really have the license to kill?
Autophagic cell death (ACD) is believed to be a form of PCD resulting from excess
autophagy (Some of the diagnostic features of the different death pathways are listed in Table
1.1). It is identified by an increase in autophagosomes accumulation in dying cells (Clarke,
1990). The symptoms of this caspase-independent process are different from the
morphological features seen in cells undergoing apoptosis. During ACD, cells first degrade
their organelles leaving an intact cytoskeleton which is destroyed at a later step (Schweich.JU
& Merker, 1973). Taking into consideration the fact that autophagy in most cases is induced
by various stress conditions (such as starvation), it shouldn’t be a surprise to find it operating
in dying cells. Ironically, this association is being used now as the main argument supporting
the notion that death by autophagy does not exist. It is being suggested that autophagy, which
is primarily a pro-life pathway, is, in these circumstances, being used by the cell as the last
21
line of defense against death, rather than an accelerator or cause of death (Shen et al, 2011a).
Furtermore, recent studies using mammalian tissue cultures have identified numerous
autophagy inducers, none of which is able to induce ACD (Shen et al, 2011b). Nevertheless,
since more and more evidence, mainly from studies carried out in lower eukaryotes, is
pointing to a correlation between autophagy and death, it is way too soon to proclaim “the
end of autophagic cell death”.
Shen and Codogno (2011) have proposed that in order to call the studied mechanism ACD, \
three criteria must be met. First, cell death must occur without involvement of apoptotic
machinery. What is more, death must be accompanied by an increase in autophagic flux and
must be suppressed by chemical or mutations that specifically inhibit autophagy. Because the
interplay between autophagy and apoptosis is well described in the literature (Giansanti et al,
2011), fulfilling these requirements, especially in higher eukaryotes, can be challenging.
Nonetheless results obtained with model organisms missing components of the apoptosis
machinery seem to provide evidence supporting the existence of ACD. A few of these cases
are presented below, but whether these are only exceptions from the general rule or artifacts
generated by improperly designed experiments (Shen et al, 2011a), remains to be determined.
As mentioned above, plants lack the machinery of apoptosis. Instead, their cells can undergo
so-called “vacuolar cell death” which resembles specific macroautophagy (van Doorn et al,
2011). This mechanism is especially important during the development of the plant
vasculatory system including tracheary element formation and secondary cell wall deposition
(Kwon et al, 2010). For example, mutants missing ATG5 in A. thaliana cannot form mature
tracheids due to their inability to undergo vacuolar cell death (Kwon et al, 2010).
22
Like plants, the genome of the soil amoeba, Dicytostelium discoideum, does not contain
genes encoding caspases or members of the Bcl-2 family and therefore it has been
hypothesized that this organism cannot utilize apoptosis. Nonetheless, Dicytostelium uses
some kind of PCD during its development. Subsequently, mutational analysis carried out in
this organism revealed the crucial role of Atg1 in pro-life and pro-death mechanisms. During
starvation, atg1 mutants died faster than their parental strain. On the other hand, the same
knockouts could not die when treated with differentiating factor 1 (Dif-1), the slime mold’s
natural inducer of PCD (Luciani et al, 2011). This suggests that the PCD response involves
autophagocytosis.
Drosophila melanogaster also appears to use ACD in parts of its development. During the
transition from larvae to adult, several tissues such as midgut and salivary glands are
removed (Lee et al, 2002). Salivary gland degradation is accompanied by an increase in
caspase activity and autophagosome formation. This, taken together with the fact that
separate apoptosis and autophagy inhibition only partially delays salivary gland removal,
leads to the conclusion that it is due to involvement of both pathways acting in parallel
(Berry & Baehrecke, 2007). Furthermore, overproducing ATG1 has proved to be sufficient
to carry out organ degradation, even without the induction of apoptosis (Berry & Baehrecke,
2007). Nevertheless, the same ATG1 over-expression in larval fat bodies promotes caspase-
dependent cell death (Scott et al, 2007), and later, during embryogenesis, autophagy assists
apoptotic removal of extra-embryonic amnioserosa (Mohseni et al, 2009).
Few cases of ACD have been reported in mammalian tissues, even though it was first
described there (Edinger & Thompson, 2004). In the central nervous system (CNS),
autophagy is mainly responsible for the removal of otherwise toxic aggregates, thus
23
extending neuronal lifespan. By contrast, hippocampal neural (HCN) stem cells seem to
undergo autophagy dependent cell death in response to insulin starvation. In those conditions,
HCN cells accumulate LC3 and Beclin-1, while deletion of ATG7 inhibits death.
Interestingly, insulin withdrawal does not induce the caspase machinery, effectively
precluding any involvement of apoptosis (Yu et al, 2008).
Depending on the type of the stimuli and development stage, autophagy can also lead to the
growth or demise of cancer cells. Cancer cell lines missing the Bax/Bak system undergo
autophagy dependent death when exposed to DNA damage agents. The rate of death in these
cases can be reduced by either ATG5 or Beclin-1 deletion (Shimizu et al, 2004).
Simultaneously deleting Beclin-1 and ATG7 in mouse L929 cells can suppress caspase-8
induced death (Yu et al, 2004). Several studies have shown that expression of activated Ras
can also result in ACD. For example, in human ovarian surface epithelial cells, induced
expression of H-RasV12
causes growth arrest and death. This process is caspase-independent
and is accompanied by hallmarks characteristic for induced autophagy including LC3
lipidation and p62 degradation (Kuma et al, 2004).
Taken together, those studies may imply that autophagic cell death is an “ancient” form of
death that supports more “conventional” pathways in very specific conditions (e.g. starvation
stress of development). It is possible that over the course of evolution autophagy primarily
lost its dual nature and became, for the most part, an exclusively pro-life pathway.
Nonetheless, it remains very important to study its pro-death properties since inhibiting them
may become an additional way to treat many diseases.
24
In this study we aimed to describe a specific type of autophagy responsible for yeast cell
death in response to external stresses. Chapters 4 and 5 will show that 13 mM zinc treatment
and leucine deprivation induced two possibly parallel autophagy-dependent pathways that
have distinct pro-life and pro-death outcomes. Even though most of the identified genes
participating in these pathways operated during the two treatments, addition of Zn2+
induced
necrotic cell death (ziNCD), while leucine deprivation induced apoptosis. The 6th
chapter of
this work will focus on 3 members of the transferin receptor-like protein family: the yeast
vacuole protein sorting protein, Vps70, the human prostate specific membrane antigen
(Psma) and the Arabidopsis thaliana altered meristem program protein (Amp1) and their
relation to inhibition of cell death in yeast. Over the course of our research we were able to
show that introducing any member of this family into yeast cells resulted in their
desensitization to different death stimuli. One possible mechanism for this phenomenon was
indicated by their ability to overcome the inhibition of vesicle fusion caused by zinc
treatment.
† Since throughout the whole study different genes and proteins from distinct kingdoms are
discussed for the simplicity the convention used in yeast is utilized where protein is noted in
small letters with first capital letter, gene in capital italicized letters and knock-out with
italicized small with first capital letter.
25
Table 1.1. Diagnostic features of the different death pathways (following Shen & Codogno, 2011).
Apoptosis
Non-apoptotic
Autophagic
cell death Necroptosis
Parp-mediated cell
death
Morphology
Chromatin condensed
Cell shrunk
Cell blebbing
Intact cell membrane
Autophagosomes
Autolysosomes
Increased autophagic
flux
Organell swollen
Early cytoplasmic membrane rapture
Main inducers Cell death ligands
DNA damage agents
Starvation
mTOR inhibitors Cell death ligands DNA damage agents
Chemical inhibitors Caspases inhibitors
(zVAD)
Wortmannin
3-methyladenine
Chloroquine
Nec-1 Parp inhibitors
(3-aminobenzamide)
Key regulators involved Caspases
Bcl-2 family members
ATGs
mTOR
Class III Ptdlns3K
Rip1
Rip3
Jnk
Parp
Ampk
Key organelles involved Mitochondria Lysosomes
Autophagosomes Cytoplasmic membrane Nuclei
Key biochemical
features Caspase activation
mTOR suppression
Atg activation and
reaction
TNFR1 activation
Parp activation
ATP depletion
HMGB1 release
26
Figure 1.1. Classification of cell death pathways (following (Degterev & Yuan, 2008)).
27
Figure 1.2. Characterization of autophagy pathways.
28
Figure 1.3 Non-specific autophagy targets random cytoplasm contents for degradation.
An upstream signal (nitrogen starvation or rapamycin treatment) triggers formation of the
double membrane vesicle in the cytoplasm which engulfs random cell contents. Each
autophagosome is delivered to the vacuole (or fuses with a lysosome creating an
autolysosome) releasing its contents for degradation.
29
Figure 1.4. Cvt transport of the premature Ape1 protein to the vacuole. Aggregated
pApe1 is engulfed by a Cvt-some at the phagophore assembly site (PAS) during the
constitutively operating process. Each vesicle is targeted to the vacuole, where the released
pApe1 maturates into fully active mApe1.
30
Chapter 2
Hypothesis and specific aims
31
The following chapters are intended to address three different working hypotheses.
The fourth chapter will investigate whether “Zinc triggers an autophagy regulated form of
cell death”.
Despite the numerous reports from different groups who are studying a variety of
organisms, the existence of autophagy cell death still remains questionable by many
researchers. In addition, despite the facts that zinc has been known for a more than a
decade to be toxic to yeast, the exact mechanism causing death has not beenn determined.
We addressed our hypothesis by:
1. Showing that 13 mM Zn2+
triggers non-apoptotic death.
2. Testing ATG deletion mutants for their response to zinc treatment.
3. Testing the targeting and/or processing of different autophagy reporters in response to
zinc treatment.
In the fifth chapter we hypothesized that “The dual role of autophagy in keeping the
balance between life and death is activated in response to many treatments, and not
only limited to zinc”.
We wanted to test if the two parallel autophagy pathways detected by us during 13 mM
Zn2+
could be operating during other stresses. This would strengthen the argument for
two opposing forms of autophagy. To test our assumption we:
1. Compared the response of different autophagy mutants to leucine and nitrogen
starvation.
32
2. Tested the influence of autophagy induction by rapamycin on the rate of death.
3. Tested autophagy reporters in strains starved for leucine to determine whether they
localize here the way they localize during zinc treatment.
In the sixth chapter we wanted to test the hypothesis that “Psma possesses a novel
enzymatic activity which prolongs yeast cell survival during stress”.
Psma is a protein of unknown function that is being over-expressed in prostate cancer
cells. Despite correlation of expression levels with angiogenesis, nothing is known about
the mechanism Psma controls. One approach addressing this challenge could be to
investigate Psma and its homologues in a model organism such as yeast. To investigate
our hypothesis, we have proposed the following specific aims:
1. To test yeast strains over-producing Psma and its homologues for their effect on the
survival of cells exposed to distinctly different stresses.
2. To use a genetic approach to identify autophagy proteins which could interact
functionally with Psma.
3. To test if Psma (and its homologues) is able to alter trafficking and/ or processing of
autophagy reporters.
4. To localize Psma in yeast with and without exposure to death inducing agent(s).
The results of these experiments will be summarized in a pictorial model shown in Chapter 7.
33
Chapter 3
Materials and methods
34
Bacteria, media, plasmids construction and DNA techniques
Bacterial cultures were grown in standard Luria-Bertani (LB) medium at 37º C supplemented
with ampicilin (200 mg/L), chloramphenicol (34 mg/L) or kanamycin (50 mg/L) when
needed. E. coli competent cells were prepared using RbCl (Hanahan, 1983). Plasmids from
bacterial cultures were extracted by means of alkaline lysis (Birnboim, 1983). When
necessary, DNA manipulations were performed by following standard procedures (Maniatis
et al, 1982) using enzymes purchased from either Invitrogen (Carlsbad, CA) or New England
Biolabs (Beverly, MA).
A Psma-GFP chimera was constructed by the following manipulations. A cDNA clone of
PSMA (Israeli et al, 1993) was kindly provided by Dean Bacich (University of Pittsburg,
PA). The cDNA was isolated from pSPORT1 (Gibco-BRL)) and ligated into pYES2
(Invitrogen, Carlsbad, CA) placing it under control of the GAL1 promoter. Divergent
primers were used to amplify the entire plasmid as a linear molecule using polymerase from
a Phusion Site-Directed Mutagenesis Kit (New England Biolabs, F-541S). One primer (5’
gaaggctgcaacatagatctgtctcttcac 3’) overlapping the 3’ end of the cDNA made a synonymous
change in codon 732 from AUU to AUC, creating a BglII site. The adjacent primer was 5’
ttaccccgcggtggtggtt 3’. The blunt end DNA was then self-ligated and transformed into E. coli
and selected on LB agar (Luria et al, 1960) containing 200 mg mL-1
ampicillin (Sigma,
A9393). After verifying the cDNA sequence, the plasmid was cut with BglII and NotI and
ligated to the open-reading frame of GFP isolated as a BamH1/ NotI fragment from pEGFP-
N2 (BD Biosciences Clontech, 6081-1).
35
In order to identify suppressor genes, a yeast genomic library ((Ramer et al, 1992) ; kindly
provided by Ron Davis and Grace Yen, Stanford University School of Medicine, Stanford,
CA) was transformed into the yeast strain, BY4723, and transformants were selected for
enhanced growth in the presence of 10 mM ZnSO4 without supplementary uracil. Plasmids
were extracted from all clones that passed this screen were extracted and transformed again
into BY4723 to verify that the growth advantage was due to the plasmid gene and not to a
host mutation. The native VPS70 gene was part of a 4346 bp EcoRI fragment of yeast
genome that included flanking intergenic sequences. To remove its native promoter, the open
reading frame was amplified by means of PCR using a set of two primers: forward
(tttcagtcctctgtgtgtaata) and reverse (gacagggaatggatccagtac), and cloned into PCR Blunt 2.0
TOPO vector (Invitrogen, Carlsbad, CA) following the manufacture’s procedures. The
orientation was verified by a set of control digestions and then sub-cloned into pYES2
(Invitrogen, Carlsbad, CA) placing it under control of the GAL1 promoter.
A cDNA of AMP1, a generous gift of Dr. Chris Helliwell, CSIRO, Canberra, was isolated
from pSPORT2 and re-cloned as an Acc651 and BsiW1 into pYES2 (Invitrogen, Carlsbad,
CA).
Yeast strains, plasmids, and media
Saccharomyces cerevisiae strains and plasmids used in this study are listed in Tables 3.1.and
3.2 respectively. Unless otherwise noted, yeast strains were all obtained from an Open
BiosystemsTM
collection of yeast deletion mutants derived from BY4741 (MATa his2 leu2
met15 ura3). A smaller set of BY4742 mutants was the kind gift of Carol Newlon (UMD-
NJ, Newark, NJ). Each mutant strain in these 2 sets has a kanMX cassette in place of the
36
indicated open reading frame. Five additional strains (Shintani et al, 2002), SEY6210,
WPHYD7, AHY001, WHY3 and GSY244 (SEY6210 Δape1::APE1-GFP kanMX) were
kindly provided by Daniel Klionsky (U Michigan, Ann Arbor, MI) and Yoshinori Ohsumi
(The Graduate University of Advanced Studies, Okazaki, Japan). All cells were grown in
minimum medium (either SD or SG; 0.67% yeast nitrogen base without amino acids, 2%
glucose (SD) or 2% galactose (SG) and strain-specific amino acids and nucleotides), or rich
medium (YPD; 1% yeast extract, 2% peptone, 2% dextrose), or SD or SG medium without
leucine (SD-L or SG-L), or in nitrogen depleted minimum media (SD-N or SG-N; 0.17%
yeast nitrogen base without amino acids and ammonium sulfate, 2% glucose (SD-N) or 2%
galactose (SG-N)) at 30° C. When necessary, medium was supplemented with 1.5% agar
and/or 0.22 µM rapamycin (Alexis Biochemicals, R-5000) and/or 1 mM PMSF. When
needed, sterile stocks of CdSO4, ZnSO4, valproic acid, and H202 were added to autoclaved
media at appropriate concentrations. The plasmid carrying the GFP-ATG8 chimera was a
generous gift from Dr. Y. Ohsumi (Suzuki et al, 2001), APE1-RFP was generously provided
by Dr. M. Thumm (Meiling-Wesse et al, 2005), HTTQ25
-GFP was kindly provided by Dr. M.
Sherman (Meriin et al, 2002), and ROSELLA constructs were graciously donated by Dr. R.
Devenish (Rosado et al, 2008). Each was transformed into appropriate yeast strains using
standard protocols (Gietz & Woods, 2006).
Dilution analysis
Cell cultures were grown to mid-log phase in SD medium and diluted to an OD600nm of 0.5
using TE buffer pH 8.0 (10 mM Tris-HCl, 1 mM EDTA). These cells were further diluted 4
times by factors of 10 in 96-well microtiter plates. The cells suspensions were then spotted
onto appropriate solid media using an ethanol sterilized, flame dried 48-pin metal stamp.
37
Each droplet contained approximately 5 µL of culture suspension. Inverted plates were
incubated at 30° C for 4 d and photographed using a BioRad Gel Doc 1000 unit. A minimum
of two replicates were done for each tested strain with cells grown on separate days.
Flow cytometry analysis
Appropriate strains were grown in SD medium to an OD600nm of 0.4, washed twice using TE
buffer pH 8.0 (10 mM Tris-HCl, 1mM EDTA), and resuspended in 50 mM sodium citrate.
For the analysis, cell suspensions were diluted tenfold in 1X FACS solution and analyzed by
BD FACSAria Flow Cytometer equipmed with 488 nm, >20mW solid state laser and 633
nm, >18 MW gas laser. Each experiment examined 30,000 cells. The data obtained was
further evaluated using FlowJoe software.
Survival assay and propidium iodide staining
The parental strain culture was grown to mid-log phase in SD medium supplemented with
appropriate amino acids and nucleotides. At that time two samples were taken and diluted
using fresh SD to an OD600 of 0.05 and grown for 2 h. Afterwards, one culture was treated
with 13 mM ZnSO4 and the other with an equal volume of sterile distilled H2O. Every 2 h,
100 µL of each culture were taken and diluted three and four fold in TE buffer and 100 µL
was spread onto YPD plates. The inverted plates were incubated at 30° C for two days before
colonies were counted in order to calculate the number of viable cells mL-1
. Colony forming
ability (CFA) was measured as the number of colonies at tn relative to the number at t0
expressed as a percentage. Standard deviation bars were generated from 4 independent
experiments. Unless otherwise stated, for the propidium iodide (PI; MP Biomedicals,
195458) staining, an additional 100 µL was removed at each time point, pelleted for 5 min at
38
5000 rpm, resuspended in an equal volume of TE buffer, and brought to 10 µM PI stain using
a 1 mM aqueous stock. After 10 min incubation in the dark, 4 µL of the suspension were
spotted onto a glass slide and immediately covered with a cover glass. Necrotic cells were
counted using a Nikon i80 Eclipse fluorescent microscope equipped with a Lambda LS unit.
Fluorescent microscopy
Appropriate strains were grown in SD (or SG) medium to an OD600nm = 0.2 and then treated
with 13 mM zinc or 25 mM valproic acid and/ or 0.22 µM of rapamycin as needed. For the
starvation experiments, harvested cells were washed twice with TE and then resuspended in
appropriate fresh medium. To visualize vacuoles, harvested cells were incubated for 30 min
in 30º C with 20 µg/ml FM4-64, washed twice with TE and resuspended in appropriate
medium prior to chemical induction. In addition, cultures expressing either ROSELLA,
Psma-GFP or GFP-Atg8 were treated during this time with 1 mM phenylmethylsulfonyl
fluoride (PSMF; USB, 20203) to reduce intravacuolar proteolysis. Dilution tests on both
YPD and SD media showed that 1 mM PMSF had no significant effect on the growth of PS,
Δatg1, Δatg6, Δatg8, or Δatg11 (data not shown). All cultures were then grown for 6 h
before 4 µL of each culture were spotted onto microscope slides previously coated with poly
L-lysine (Sigma-Aldrich, P-4707).
Where possible, cells were distinguished as living or dead based on PI-staining. However,
when other fluorescent molecules were being used, dead cells were distinguished from living
ones by their gross abnormalities that included shrunken cytoplasm, enlarged vacuoles, and a
diameter approximately 10-20% smaller than that of sister cells that did not accumulate PI.
Preliminary analyses showed that only PI-staining cells showed all 3 of these traits. Images
39
were taken using a Nikon i80 Eclipse fluorescent microscope equipped with Lambda LS unit
and Photometrix Cool SNAP ES digital camera. The excitation time for GFP-Atg8 (URA3)
was 500 ms; for GFP-Atg8 (HIS3), 2s; for Ape1-RFP, 2s; for Ape1-GFP 2s; for Psma-GFP,
4s; for ROSELLA, 200 ms.
Annexin staining was carried out on cells that were permeabilized by partially removing their
cell wall as previously described by Madeo et al. (Madeo et al, 1997a) with minor changes.
Cells grown to mid-log phase were washed in sorbitol buffer (1.2 M sorbitol, 0.5 mM MgCl2,
35 mM KH2PO4, pH 6.8), digested with 20 U/ml lyticase (L-8012, Sigma) in sorbitol buffer
for 30 min at 28°C, harvested, and washed in binding buffer (1.2 M sorbitol, 10 mM
Hepes/NaOH, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2). Permeabilized cells were then re-
suspended in 38 μl binding buffer and incubated for 20 min in room temperature with 2 μl
annexin-FITC (640905, BioLegend) and 2 μl (500 μg/ml) PI (195458, MP Biomedicals,
LLC). Cells were harvested, suspended in binding buffer, and examined using a fluorescent
microscope at 520 nm (annexin-FITC) and 620 nm (PI). In order to confirm that our
preparation of annexin-FITC was functional, an additional population of cells was treated for
300 min with 80 mM acetic acid, pH 3.0 (Ludovico et al, 2001a). In order to visualize H2O2
accumulation, permeabilized cells prepared in this way were stained with 10 µM H2DCFDA
(D399, Invitrogen) for 30 min at room temperature according to company protocols before
cells were scored at 522 nm.
DAPI staining of vacuolar inclusions was carried out using standard procedures. (Puchkov,
2010)
40
Protein purification and Immunoblot analysis
Cultures of each yeast strain were grown to OD600nm = 0.2 and treated with 13 mM zinc or
starved and/ or treated with 0.22 µM rapamycin as needed. Strains were then grown for 6
additional hours (unless otherwise stated) before samples containing 5 OD units of cells were
removed, pelleted for 5 min at 5000 rpm, resuspended in an equal volume of TE buffer, spun
again, and finally re-suspended in CSB buffer (200 mM HEPES pH 7.4, 200 mM NaCl) with
1 µM PMSF together with the manufacturer’s recommended amount of complete protease
inhibitor cocktail (Roche Applied Science, 11873580001), and incubated at -20° C overnight.
Cells were disrupted using a Branson Sonifier 450 (10% power, 50% duty cycle, for 4 bursts
of 10 s separated by 3 min chilling on ice). This mixture was then spun for 20 min, 13,000
rpm at 4° C. The supernatant was mixed with sufficient 5-fold concentrated Laemmli buffer
to bring the final solution to 1x. This mixture was then boiled for 10 min at 95° C and spun
at 4° C for 10 min 13,000 rpm. These samples and a Color Plus Protein Ladder (BioLabs, P-
7711S) were separated using an 8.5% SDS-PAGE gel and transferred to a Protran®
nitrocellulose membrane (Whatman, 10402452). The membrane was blocked with
commercial Odyssey Blocking Buffer (Li-COR, 927-40000) overnight at 4° C and developed
with primary rabbit polyclonal anti-GFP antiserum (632377; Clonetech) for proteins
extracted from strains caring either ATG8::GFP or PSMA::GFP, goat polyclonal anti-APE1
(Santa Cruz Biotechnology, SC-26740) antibody for Ape1 processing detection, and primary
rabbit polyclonal anti-actin antibody (Sigma-Aldrich, A2066) as an internal loading control
for teste. Secondary antibodies were IR700-labeled goat anti-rabbit (Rockland, 611-130-122)
and alkaline phosphatase-conjugated donkey anti-goat (Santa Cruz Biotechnology, SC-2037)
antibody, respectively. Membranes developed with IR700 were scanned using a Li-Cor
41
Odyssey Infrared Imaging System (Li-Cor Bioscience), while those treated with alkaline
phosphatase conjugated antibody were developed according to standard methods (Liu et al,
2008) Each western was analyzed using ImageJ (http://rsb.info.nih.gov/ij/index.html). The
intensity of the band representing the protein of interest was normalized to that of actin.
Each western has been replicated at least twice with similar results.
42
Table 3.1. Yeast strains used in this study.
Strain name Genotype Reference
BY4741 MAT a his3 leu2 met15 ura3 Open BiosystemsTM
BY4741 Δ† BY4741 Δ*::KanMX Open Biosystems
TM
Δatg8/ Δyca1 BY4741 Δatg8::KanMX Δyca1::KanMX This study
BY4742 MAT α his3 leu2 met15 ura3 UMD-NJ, Newark, NJ
BY4742 Δ††
BY4742 Δ**::KanMX UMD-NJ, Newark, NJ
BY4741/42 BY4741/BY4742 diploid strain This study
SEY6210 MATα his3 leu2 lys2 suc2 trp1 ura3 (Kim et al, 2001a)
WPHYD7 SEY6210 Δatg8::KanMX (Kim et al, 2001a)
AHY001 SEY6210 Δatg11::KanMX (Kim et al, 2001b)
WHY3 SEY6210 Δatg8 Δatg11::KanMX (Shintani et al, 2002)
GSY244 SEY6210 Δape1::APE1-GFP KanMX (Suzuki et al, 2002)
BY4741/SEY6210 BY4741/SEY6210 diploid strain This study
Δatg8/Δatg8* BY4741 Δatg8::KanMX/ SEY6210
Δatg8::KanMX
This study
YMR243C MAT a his3 leu2 met15 ura3 ZRC1-GFP Invitrogen Carlsband, CA
† A complete list of all mutant strains in this background is presented in the Table 4.1
†† A complete list of all mutant strains in this background is presented on Figure 4.10
43
Table 3.2. Plasmids used in this study.
Name Insert Plasmid
origin
Yeast selection
marker
Reference
pSPORT1 - - - Gibco-BRL
pYES2 - CEN URA3 Invitrogen,
Carlsbad, CA
pYEp - 2µ URA3 (Gietz &
Woods, 2006)
pVPS70 VPS70 2µ URA3 This study
pgal1::VPS70 VPS70 CEN URA3 This study
pgal1::PSMA PSMA CEN URA3 This study
pgal1::AMP1 AMP1 CEN URA3 This study
pRS316-GFP-ATG8† GFP-ATG8 CEN URA3
(Suzuki et al,
2001)
pBC415-GFP-ATG8††
GFP-ATG8 CEN HIS3 This study
pRS316-RPL25-GFP† RPL25-GFP CEN LEU2
(Kraft et al,
2008)
pRS313-APE1-RFP† APE1-RFP CEN URA3
(Meiling-
Wesse et al,
2005)
pAS1NB‑CS‑RG†
CIT2-
ROSELLA
(ROSELLAMit
)
2µ LEU2 (Rosado et al,
2008)
44
pAS1NB‑NAPB35‑RG†
NAB2-
ROSELLA
(ROSELLANuc
)
2µ LEU2 (Rosado et al,
2008)
pAS1NB‑RG†
ROSELLA
(ROSELLACyt
)
2µ LEU2 (Rosado et al,
2008)
pHttQ25
-GFP HttQ25
-GFP 2µ URA3 (Meriin et al,
2002)
All listed plasmids were caring gene encoding β-lactamase, except †encoding NPT2 or
††
CAMR.
45
Chapter 4
Identification of autophagy genes participating in zinc-induced necrotic
cell death in Saccharomyces cerevisiae
The content of this chapter was previously published as: Dziedzic SA, Caplan AB (2011)
Identification of autophagy genes participating in zinc-induced necrotic cell death in
Saccharomyces cerevisiae. Autophagy 7: 490-500
46
Abstract
Eukaryotes use a common set of genes to perform two mechanistically similar autophagic
processes. Bulk autophagy harvests proteins non-selectively and re-uses their constitutents
when nutrients are scarce. In contrast, different forms of selective autophagy target protein
aggregates or damaged organelles that threaten to interfere with growth. Yeast uses one form
of selective autophagy, called cytoplasm-to-vacuole transport (Cvt), to engulf 2 vacuolar
enzymes in vesicles (“Cvt-somes”) from where they are transported to vacuoles for
maturation. While both are dispensable normally, bulk and selective autophagy help sustain
life under stressful conditions. Consistent with this view, knocking out several genes
participating in Cvt and specialized autophagic pathways heightened the sensitivity of
Saccharomyces cerevisiae to inhibitory levels of Zn2+
. The loss of other autophagic genes,
and genes responsible for apoptotic cell death, had no such effect. Unexpectedly, the loss of
members of a third set of autophagy genes heightened cellular resistance to zinc as if they
encoded proteins that actively contributed to zinc-induced cell death. Further studies
showed that both sensitive and resistant strains accumulated similar amounts of H2O2 during
zinc treatments, but that more sensitive strains showed signs of necrosis sooner. Although
zinc-lethality depended on autophagic proteins, studies with several reporter genes failed to
reveal increased autophagic activity. In fact, microscopic analysis indicated that Zn2+
partially inhibited fusion of Cvt-somes with vacuoles. Further studies into how the loss of
autophagic processes suppressed necrosis in yeast might reveal whether a similar process
could occur in plants and animals.
47
Introduction
Cells facing starvation quickly halt their replicative cycles in order to conserve their
remaining resources. As part of the triage that follows, autophagosomes systematically
engulf and dismantle the constituents of the cytoplasm into amino acids and other building
blocks in order to synthesize new macromolecules to sustain cells until exogenous raw
materials became available again. Genetic studies, especially those carried out in yeast, have
revealed that the formation of autophagosomes, the selection of their targets, and the process
that delivers these vesicles to their final destination, involves a minimum of 33 designated
ATG genes. Although none of these genes appear to be essential for growth under
nutritionally-replete conditions, most have proven to be indispensible during starvation (Cao
et al, 2008). During starvation, a form of bulk autophagy appears to harvest material
indiscriminately. During other conditions, some of the same proteins, acting in conjunction
with proteins recruited from other pathways, carry out selective scavenging operations
against damaged or superfluous ribosomes, mitochondria, peroxisomes, or portions of the ER
and the nucleus (van der Vaart et al, 2008). One such process in yeast has been termed the
cytoplasm-to-vacuole (Cvt) pathway (van der Vaart et al, 2008; Xie & Klionsky, 2007). Cvt
appears to harvest naturally aggregating enzymes very selectively in order to transport them
to the vacuole for maturation (Hutchins & Klionsky, 2001; Kageyama et al, 2009; Kim et al,
1997a). Cvt-like pathways have not been described in multicellular organisms, but equally
specialized forms of autophagy operate there to clear away protein aggregates symptomatic
of Huntington’s Disease and Alzheimer’s Disease (Butler et al, 2006; Sarkar et al, 2009).
48
Although most of the attention on autophagy has focused on its ability to extend life, cases
have been described where it appears to be responsible for a form of programmed cell death
characterized by an absence of normal apoptotic landmarks and by an abundant accumulation
of autophagosome-like vesicles. Dictyostelium amoebae die in this way as they differentiate
into the cells comprising fruiting body stalks (Cornillon et al, 1994; Kosta et al, 2004), as do
plant cells undergoing a hypersensitive response (Hofius et al, 2009) and heart tissues as they
age (Nishida et al, 2009). Despite these examples, it has not been possible to determine
whether autophagy is the sole agent of death, or instead is merely acting as an “accomplice”
for another mechanism of cell death (Gonzalez-Polo et al, 2005; Kroemer & Levine, 2008).
The present study explores a complex set of relationships that we have found between
different autophagy pathways and yeast’s tolerance for excessive amounts of zinc. It has
been known for a number of years that high levels of Zn2+
ions inhibit growth of mammalian
cells severely (He et al, 2005) and with increasing exposure, induce an atypical, caspase-
independent form of apoptosis (Hamatake et al, 2000). More recent studies have shown that
this property can be used to kill cancer cells selectively (Magda et al, 2008). The studies in
the current report describe our attempt to characterize possible mechanisms behind this cell
death process using Saccharomyces cerevisiae. Paradoxically, it was possible to increase
either the sensitivity or the resistance of yeast to zinc by knocking out alternative sets of
autophagy genes. None of the sets identified in this screen correlated perfectly with any of
the autophagic processes described previously in this organism. Although we have no
detailed model explaining how zinc kills, we have found evidence that it blocks the fusion of
Cvt-like autophagosomes with the cell vacuole. It seems likely that further studies along
49
these lines could possibly identify how operations carried out by autophagy proteins
predispose cells to become necrotic and die in the presence of excess zinc.
50
Results
Zn2+
-treatment temporarily arrested cell growth
Zinc, like any ion, is cytotoxic when its levels are sufficiently raised. Curiously, in the case
of yeast, the sensitivity of cells to this metal proved to be dependent on the composition of
the medium used. BY4741 grew well on a rich medium, YPD, supplemented with 13 mM
ZnSO4 (Figure 4.1A). However, on standard minimal medium with glucose (SD), colony-
forming ability decreased sharply when Zn2+
levels rose from 10 to 13 mM. As Figure 4.1A
shows, even adding uracil to SD medium slightly increased cell tolerance for zinc.
Further studies revealed that in liquid SD medium, cell division ceased within the first 2 h of
exposure to 13 mM Zn2+
arresting the population with a multi-budded phenotype (Figure
4.1B) looking like mutants missing CDC42 (Richman & Johnson, 2000). This period of
stasis lasted for approximately 6 hours (Figure 4.1C). By this time, 54.0 ± 1.5% of the Zn2+
-
treated cells had accumulated large, refractile aggregates in their vacuoles (arrow, Figure
4.1B), while untreated cells had none. Although we have not performed definitive chemical
analysis on these inclusions, we have determined that they stained with DAPI (Figure 4.2),
like polyphosphate inclusions (Puchkov, 2010), and were less abundant (6.31.5%) in cells
with a deletion of VTC4, a gene needed for polyphosphate accumulation in the vacuole
(Huang et al, 2002). When BY4741 cultures were diluted into medium without supplemental
zinc, the number of cells harboring these inclusions dropped to 32.6 ± 1.9% within 2 h and
continued falling thereafter. Unbudded cells began to appear some time later. On the other
hand, cells that remained under zinc treatment gradually became permeable to propidium-
51
iodide (PI) and lost viability (Figure 4.1C), dropping to 50% of the starting population by 22
h (data not shown).
Apoptotic processes played little role in the death of Zn2+
-treated cells
Nargand et al. (Nargund et al, 2008) found that Cd2+
, an ion chemically related to Zn2+
,
induces metacaspase-dependent apoptotic death. Zn+2
, however, did not. First, if zinc-treated
cells died apoptotically, the loss of the metacaspase gene, YCA1 (Madeo et al, 2002) or of
other apoptosis-associated genes such as AIF1 (Wissing et al, 2004), NUC1 (Buttner et al,
2007), and SVF1 (Brace et al, 2005), would have decreased zinc sensitivity. Instead, these
mutants proved to be as sensitive as their parental strain (PS), BY4741, on Zn+2
-containing
media (Figure 4.3 and data not shown). Second, if zinc treatments induced apoptosis, we
expected to see the frequency of annexin-binding cells to increase, as occurs when cells are
treated with 80 mM acetic acid (Figure 4.4). Instead, the percentage of PI-permeable necrotic
cells increased approximately 8-fold after 6 h of Zn+2
treatment, while the frequency of
annexin-binding, apoptotic ones remained unchanged (Figure 4.4). Although apoptotic genes
contributed little to this kind of death, a knockout of the core autophagic gene, ATG8,
actually increased colony formation significantly (Figure 4.3). Introducing a Δyca1 mutation
into a Δatg8 mutant did not change this level of resistance (data not shown).
Zn2+
partially inhibited the flow of GFP-Atg8 to vacuoles
The above results implied that zinc triggered a previously unexamined form of cell death
mediated, at least in part, by Atg8. Atg8 is essential for the expansion of autophagosomes
(Xie et al, 2008) and over the years, has proven to be a reliable monitor for tracking
autophagic activity (Cheong & Klionsky, 2008). In order to determine whether death was
52
accompanied by a noticeable increase in the number of autophagosomes, a plasmid encoding
an GFP-Atg8 fusion protein (Prick et al, 2006) was introduced into the Δatg8 mutant. This
strain was as sensitive as BY4741 when grown on SD medium with 13 mM Zn+2
(data not
shown), indicating that the chimeric gene retained its attendant functions. Under normal
growing conditions, the fluorescent reporter was distributed throughout the cytoplasm and
nearly absent from the vacuoles (Figure 4.5A). This distribution was reversed when bulk
autophagy was induced with rapamycin. Most of these treated cells had comparatively dark
cytoplasms and intensely fluorescent vacuoles, together with a characteristic increase in
GFP-Atg8 processing (Figure 4.5C). In contrast, cells treated with zinc were
indistinguishable from untreated cells (Figure 4.5A), apart from the polyphosphate-like
inclusions and multi-budded appearance. Cells treated with both agents displayed a mixed
phenotype in which diffuse, fluorescent vacuoles were surrounded by dark cytoplasm, 1-3
intensely glowing vesicles docked close to the vacuole (Figure 4.5A), and levels of GFP-
Atg8 processing similar to those seen with rapamycin alone (Figure 4.5C). The proportion of
the population that fell into each of these phenotypic classes is shown in Figure 4.5B.
These studies clearly showed that zinc did not induce autophagic processes like rapamycin.
In fact, the most parsimonious interpretation of the results tabulated in Figure 4.5B appeared
to be that Zn2+
partially inhibited a late stage in the autophagic process, so that the reporter
was left in the cytoplasm or sequestered in autophagosome-like vesicles that rarely, if ever,
delivered their contents to the vacuole for re-cycling.
53
Zn2+
-treated cells did not harvest common fluorescent reporters of bulk autophagy
activity
It seemed counter-intuitive that Zn2+
killed cells in an ATG8-dependent manner without
increasing the number of visible autophagosomes. We therefore continued our studies using
several different reporter proteins, each one diagnostic for a different form of autophagy. One
particularly useful series of reporters has been built recently by fusing an acid-sensitive GFP
to an acid-stable RFP (Rosado et al, 2008). When autophagy was not induced, the vacuoles
of cells expressing the cytoplasmic variant of this series, ROSELLACyt
, remained dark, even
when observations were continued past 24 h (Figure 4.6). On the other hand, when bulk
autophagy was induced by rapamycin treatment, some of this protein was harvested so that
the vacuoles fluoresced red while the cytoplasm glowed red or green, depending on the
excitation filters used. Zinc did not have this effect. Instead, ROSELLACyt
remained in the
cytoplasm unless cells were treated simultaneously with rapamycin. Note that although GFP-
Atg8 revealed autophagosomes in transit during zinc and rapamycin treatment (Figure 4.5),
no ROSELLACyt
-filled vesicles were seen (Figure 4.6). It is possible that ROSELLACyt
accumulation in autophagosomes was too low to highlight them.
The ROSELLACyt
reporter showed that zinc did not induce bulk autophagy like rapamycin.
Further experiments with ROSELLA proteins targeted to the nucleus (ROSELLANuc
) or to
mitochondria (ROSELLAMit
) demonstrated that zinc similarly failed to induce either
piecemeal nuclear autophagy or mitophagy to any noticeable degree (Figure 4.7). Similarly,
studies with Rpl25-GFP (Kraft et al, 2008), a fusion between a protein of the 60S ribosomal
subunit and GFP, failed to detect signs of ribophagy (data not shown).
54
Zn2+
treatment inhibited entry of APE1 into vacuoles
It is now recognized that cells use different combinations of autophagy proteins to target
different parts of the cell. It has even been suggested that there is no such process as non-
selective autophagy; rather, many of the treatments that have been used might in fact be
causing the simultaneous execution of several (possibly independent) autophagic pathways
(Kraft et al, 2009). In particular, at least half of the gene products responsible for inducible
bulk autophagy in yeast also participate in the far more selective Cvt pathway that transports
a handful of hydrolytic enzymes to the vacuole where they participate in the routine
metabolism of the cell (Lynch-Day & Klionsky, 2010). One of the enzymes brought there in
this way is aminopeptidase 1, product of the gene, APE1. We transformed yeast with
plasmids encoding an Ape1-RFP fusion protein (Meiling-Wesse et al, 2005) and used it to
monitor Cvt-like autophagy. Under normal growth conditions, this reporter accumulated in
low amounts within the vacuole. Rapamycin treatment increased the amount of fluorescent
material in the vacuole considerably (Figure 4.8A). However, while the subcellular
distributions of the ROSELLA and Rpl25-GFP reporter proteins were unaffected by zinc,
Ape1-RFP distributions were. Zn+2
-treated cells showed a 7-fold reduction in Ape1-RFP
processing (Figure 4.8C) and were 9 times more likely than untreated cells to have 1-2 highly
fluorescent vesicles, presumably Cvt-somes, docked onto the surface of otherwise dark
vacuoles (Figure 4.8B). Superficially, the localization and the intensity of fluorescence of
Ape1-RFP in zinc-treated cells resembled those seen in Δmon1 mutants (Figure 4.8A) that
are defective in both autophagosome- and Cvt-some-fusion with vacuoles (Wang et al, 2003).
Significantly, this Zn+2
-imposed block was overcome when bulk autophagy became active:
55
vacuolar filling (Figure 4.8B) and Ape1-RFP processing (Figure 4.8C) proceeded equally in
cells treated with zinc and rapamycin and in cells treated with rapamycin alone.
These results indicated that Zn2+
treatment inhibited one or more of the last steps in the
delivery of Cvt-somes to the vacuole. Since rapamycin suppressed this block, it seems likely
that bulk autophagy either did not depend on a zinc-sensitive fusion process, or compensated
for the reduced efficiency of vesicle-to-vacuole fusion with increased vesicle production.
Either of these models would equally accommodate our previous observation that
ROSELLACyt
, like Ape1-RFP, continued to enter vacuoles when rapamycin-treated cultures
were co-challenged with zinc (Figure 4.6).
Which autophagic pathway contributed to ziNCD?
The studies with the previous sets of reporter proteins failed to find evidence that zinc
treatment induced excessive autophagosome formation and indiscriminate protein harvesting,
one possible mechanism leading to cell death (Kang & Avery, 2008; Yoshimoto, 2010). At
the same time, it was counterintuitive to infer that inhibiting a late step in Cvt would lead to
cell death when genetically inactivating the pathway did not (Harding et al, 1995a). This
prompted us to investigate whether the Δatg8 phenotype was representative of all autophagy
mutants growing on zinc-rich media. For these experiments, we included 20 mg L-1
uracil in
the agar so that we could carry out these tests on plasmid-free strains, and so that we could
detect increased sensitivity as well as increased resistance to zinc.
The autophagy-defective strains that we tested fell into 4 phenotypic classes (Figure 4.9A),
regardless of whether they had been made in BY4741 or BY4742 (Figure 4.10). The
majority, including the atg1 and atg2 mutants, behaved like the parental line when each
56
was grown on ZnSO4-supplemented agar. A smaller number typified by atg12, were more
tolerant, others like atg8 even more so, but a handful including atg11, were more sensitive
to zinc than their parental strain. The make-up of the 4 phenotypic classes is summarized in
Table 4.1.
These differences in growth on solid media were also seen in liquid medium (Figure 4.9B).
By 12 h, each example that we tested showed signs of necrosis, but strains showing the
greatest resistance to zinc (atg8) showed less, while those with the least resistance (atg11)
showed more (Figure 4.9C). Closer examination of these mutants revealed that the number of
cells containing polyphosphate-like inclusions correlated with the number of PI-excluding,
seemingly viable, cells in each culture (Figure 4.9E): atg11 cultures contained the fewest of
these inclusions if one surveyed all cells, but similar numbers if one confined the counts to
intact (PI-) cells. This correlation could imply that cells produced polyphosphates
defensively, perhaps to immobilize vacuolar zinc. Significantly, although there was also
variation in the number of cells accumulating H2O2 after 12 h of zinc treatment (Figure
4.9D), it seemed that each mutant strain had similar numbers of H2O2-accumulating cells
(measured by fluorescence in the presence of H2DCFDA) regardless of their level of zinc
resistance. It was as if zinc sensitivity was either unrelated to this source of damage, or
instead determined by the subsequent response to that damage.
While the correlation was not perfect, most of the strains in class I were mutated in genes
closely associated with the control of nonspecific autophagic responses to starvation and
rapamycin treatment. Many of the strains in classes II and III were mutated in genes that
encoded proteins making-up the core machinery of autophagosomes whereas most of the
57
mutants in class IV encoded proteins that were only required for the Cvt pathway and a few
specialized forms of autophagy. In an attempt to refine our classification scheme and
pinpoint the specific pathways being detected in this assay, we tested mutants that affected a
number of protease and ubiquitination processes (APE1, BSD2, DSK2, LAP3, PEP4, TUL1),
as well as mutations specifically associated with pexophagy (PEX3, PEX14), microphagy
(GTR1, GTR2), mitophagy (AUT1, UTH1), and early steps in the regulation of autophagy
(RAS1, RAS2, SCH9, TOR1). All of these displayed the same level of sensitivity as their
parental strain. On the other hand, strains missing ZRC1, the principle zinc transporter in the
vacuolar membrane, CCZ1, MON1, TLG2, and VPS18 which help autophagosomes and
CVT-somes dock with the vacuole (Furgason et al, 2009; Wang et al, 2002a), BRE5 and
UBP3 that are needed for ribophagy (Kraft et al, 2008), PEX6, a peroxisomal protein
transporter needed to suppress the build-up of reactive oxygen species that leads to necrotic
cell death (Jungwirth et al, 2008), SLM4 (EGO3), which is part of the Cvt pathway and
critical for recovery from rapamycin treatments (Dubouloz et al, 2005a), SNF1, which
regulates the cellular response to nutrient availability (Smets et al, 2010), VPS15 (a regulator
of protein sorting (Sambade et al, 2005)), and VTC4 (a subunit of the polyphosphate
polymerase (Hothorn et al, 2009)), were all more sensitive to Zn2+
than normal (Table 4.1).
Surprisingly few of these genes have been associated with zinc tolerance before, despite the
fact that several intensive screens for the determinants of zinc homeostasis have previously
been carried out. However, most of those screens for zinc sensitivity (Pagani et al, 2007) and
for zinc induced genes (Jin et al, 2008) were conducted on YPD medium where the PS strain
(Figure 4.1A), as well as 4 apoptosis-associated genes and 6 autophagy genes drawn from all
4 classes (data not shown), showed no growth inhibition in the presence of 13 mM zinc.
58
Although most of the autophagy genes in class IV encoded proteins involved specifically in
Cvt, not all Cvt genes were in class IV. Mutants in ATG19, the only known receptor for
bringing proteins into Cvt-somes, fell into class I while mutants in ATG24, a nexin involved
in retrieving SNAREs from endosomes (Hettema et al, 2003), fell into class III. One possible
explanation for these exceptions could be that cells use class IV proteins to build a basic
vesicle that then interacts modularly either with Atg19 to produce a Cvt-some, or with as yet
unidentified gene products to select different sets of substrates for a minimum of 2 alternate
forms of selective autophagy. In this scheme, one of these 2 vesicle-receptor conformations
protected cells from the effects of Zn2+
while the other configuration acting together with
Atg24 contributed to ziNCD.
One question that lingered throughout this study was why these sets of genes hadn’t shown
up in any of the more extensive searches for zinc tolerance pathways (Jin et al, 2008; Pagani
et al, 2007). Some studies may have overlooked the kinds of phenotypes reported here
because they were carried out on rich medium (Figure 4.1A). However, these phenotypes
may also have been masked by genetic differences between strains. SEY6210 (Shintani et al,
2002), for example, proved to be more sensitive to zinc than BY4741 (compare Figure 4.11A
where strains were grown for 5 d with Figure 4.10 where strains were grown for 3 d). We do
not yet have an explanation for the strain-dependent differences in zinc sensitivity, but we
did observe that this sensitivity was recessive in a BY4741/ SEY6210 diploid (Figure 4.11B).
Despite this difference in responsiveness to zinc, SEY6210 responded qualitatively like
BY4741 when its copies of ATG11 or ATG8 were knocked out (Figure 4.11A), but perhaps
not dramatically enough to attract attention during a screen of the entire yeast genome. As a
side-note, a Δatg8 Δatg11 double mutant reproducibly grew better than a knockout of ATG8
59
alone (Figure 4.11A). This synergistic response could indicate that while Atg11 acted
primarily to protect cells, it also participated to a small extent in ziNCD.
60
Table 4.1. Classification of knockout mutant phenotypes.
Phenotypic
class
Zn+2
tolerance
Autophagy mutants Autophagy-associated mutants
I
atg1, atg2, atg3, atg4, atg5, atg9,
atg10, atg13, atg14, atg17,
atg18, atg19, atg22, atg26,
atg27, atg28, atg29, atg31,
atg32, atg33, atg34
ape1, bsd2, dsk2, gtr1, gtr2,
lap3, nvj1, pep4, pex3, pex14,
ras1 ,ras2, rim15, sch9, tor1,
tul1, uth1, vid24, vps38, vps45
(aif1, ald6, coq3, gsy1, nuc1,
svf1, yca1)*
II + atg6, atg7, atg12 vac8 (coq3)
III ++ atg8, atg15, atg16, atg24 -
IV - atg11, atg20, atg21, atg23
bre5, ccz1, mon1, slm4, snf1,
tlg2, vps15, vps18, vtc4, ubp3
(pex6, zrc1)
Autophagy mutants as well as a set of strains with mutations in proteolytic, regulatory, or
vacuolar processes believed to be affiliated with autophagy were grown, diluted, and stamped
as described in Figure 4.1A onto SD agar containing 0.002% uracil with or without 13 mM
ZnSO4. Tolerance (, sensitive; +, tolerant; ++, very tolerant; -, very sensitive) was scored as
illustrated in Figure 4.9. Each strain was tested a minimum of 3 times before being assigned
to the indicated phenotypic class. For comparative purposes, strains with mutations in
pathways believe to be unrelated to autophagy or allied processes are shown in parentheses.
61
Figure 4.1. Zn2+
disrupts cell metabolism and division. (A) The sensitivity of the parental
strain, BY4741, transformed with the plasmid, YEp, was assessed using cultures grown in
SD medium to mid-exponential phase. A sample was serially diluted by factors of 10, and
stamped onto SD or YPD media supplemented with 0, 10, or 13 mM ZnSO4, or 13 mM
ZnSO4 and 0.002% uracil as indicated. This collage was assembled from photographs taken
after 4 d growth at 30°C. (B) The morphological responses to zinc were assayed by growing
the parental strain in SD medium to exponential phase and then treating it with or without 13
mM ZnSO4 for 6 h at 30°C. Left panels show samples of the populations at that time, while
right panels show cells exhibiting the most common phenotypes. The arrow points to a
vacuolar inclusion that can be found in 54.0 ± 1.5% of the zinc treated cells but in none of
the untreated ones. (C) The effect of zinc on cell viability was assessed by growing the
parental strain at 30°C in SD medium to exponential phase, diluting it in fresh SD medium
and after 2 h (indicated by arrow), adding ZnSO4 to bring the culture to 13 mM. Samples
were removed every 2 h, spread onto YPD agar, and incubated for 2 d to count the number of
colony forming units. The left scale shows the average percent change (± SD) for 4
independent replicates. Solid line, untreated cells; broken line, Zn2+
-treated ones. The right
scale shows the percent of cells (± SD) at each time point that accumulated PI. Black bars,
untreated cells; white bars, treated cells.
62
Figure 4.2. Vacuolar inclusions in Zn2+
-treated cells bound DAPI. BY4741 PS cells were
grown to an OD600 = 0.2, treated with 13 mM ZnSO4 for 6 h, and stained with 3 µM DAPI.
The photograph shows an example of the results obtained in 3 independent experiments.
Yellow arrows point to the stained nuclei, red arrows point to the stained mitochondria, and
white arrows point to stained vacuolar inclusions, in representative cells. Both the location
and the fluorescence of the material were characteristic of polyphosphates 19
. Moreover,
Δvtc4 strains, which are characteristically defective in polyphosphate accumulation in
vacuoles, accumulated fewer inclusions.
63
Figure 4.3. Zn2+
-induced cell death is dependent on ATG8. The parental strain (PS), and
two derivatives with deletions of either ATG8 or YCA1, all transformed with the plasmid,
YEp, were grown, diluted, and stamped as described in Figure 4.1A onto SD agar with or
without 13 mM ZnSO4. Growth was scored after 4 d at 30°C.
64
Figure 4.4. Zn2+
-treated cells failed to expose annexin-binding sites. BY4741 PS cells
were grown to an OD600 = 0.2, treated with 13 mM ZnSO4 for 6 h, and spheroplasted as
described in Materials and Methods. The wall-less cells were subsequently stained with both
annexin-FITC (green fluorescence) and PI (red fluorescence) following standard procedures 61
.The numbers inserted in upper right of each panel represent the average number SD of
necrotic (PI-staining) or apoptotic (annexin-staining) cells based on 3 independent
experiments, with 44-72 cells/ treatment.
65
Figure 4.5. GFP-Atg8 accumulated in perivacuolar vesicles in Zn2+
-treated cells. ∆atg8
transformed with a plasmid encoding ATG8::GFP was grown to an OD600 = 0.2 and then
treated with 1.0 mM PMSF (which had did not significantly inhibit yeast growth when added
to SD agar) together with 13 mM ZnSO4, 0.22 µM rapamycin (Rap), or both agents as
indicated. (A) Cells were photographed after 6 h using fluorescence microscopy. Note that
zinc partially inhibited the entrance of fluorescent material into the vacuole during rapamycin
treatment. Note also that the vacuolar inclusions in Zn2+
-treated cells never fluoresced at this
wavelength indicating they did not entrap GFP. (B) Frequencies of the diagrammed
phenotypes (± SD) in 3 independent experiments, 50 cells/ experiment. (C) Western analysis
carried out on approximately 5 OD units of cells from each indicated treatment using
antibodies to GFP or actin. The table shows the signal intensity of GFP-Atg8 and free GFP
normalized to that of actin.
66
67
Figure 4.6. Dual fluorescent protein, ROSELLACyt
, was restricted to the cytosol in Zn2+
-
treated cells. PS cells transformed with a plasmid encoding cytoplasmic ROSELLA (Rosado
et al, 2008) were grown to mid-exponential phase and treated for 16 h with 1.0 mM PMSF
together with 13 mM ZnSO4 or 0.22 µM rapamycin (Rap) as indicated. Only rapamycin- and
rapamycin with zinc-treatments brought ROSELLA into vacuoles causing them to fluoresce
red.
68
Figure 4.7. Zn2+
did not promote the harvesting of either nuclear- or mitochondrially-
targeted ROSELLA. BY4741 PS cells transformed with plasmids encoding either NAB35-
ROSELLA (ROSELLANuc
; a reporter targeted to the nucleus) or CIT2-ROSELLA
(ROSELLAMit
; a reporter targeted to the mitochondrion) 19
, were grown to an OD600 = 0.2
and then treated with1 mM PSMF and 13 mM ZnSO4 for 6 h. Vacuolar inclusions are
prominent in both images at this time but neither the encoded proteins, nor a ribosome-
targeted reporter, Rpl25-GFP 20
(data not shown), accumulated in vacuoles, even after 24 h
(data not shown).
69
Figure 4.8. Ape1-RFP accumulated in perivacuolar vesicles in Zn2+
-treated cells. PS
cells transformed with a plasmid encoding Ape1-RFP were grown to an OD600 = 0.2 and then
treated with 1.0 mM PMSF together with 13 mM ZnSO4 or 0.22 µM rapamycin (Rap), or
both as indicated. (A) Left panels show representative views of the population after 6 h.
Right panels show detailed view of dividing cells. Ape1-RFP accumulated in vesicles (CVT-
somes) during zinc treatment, or when expressed in a Δmon1 background. Rapamycin
stimulated the accumulation of this material in the vacuole of PS cells, overcoming the
blockade induced by zinc. (B) Frequencies of the diagrammed phenotypes (± SD) in 3
independent experiments, 90-140 cells/ experiment. (C) Western analysis carried out on
approximately 5 OD units of cells from each indicated treatment using antibodies to Ape1 or
actin. The table shows the signal intensity of pre-Ape1 and Ape1 normalized to that of actin.
70
71
Figure 4.9. Classification of phenotypic responses of mutants to excess zinc. (A) Indicated strains were grown, diluted, and stamped as described in Figure 4.1A onto SD agar
containing 0.002% uracil with or without 13 mM ZnSO4. The mutants shown were
representative of the phenotypic class (I-IV). PS (parental strain) was BY4741. (B)
Representatives of each class were cultured in SD + uracil medium with (right panel) and
without (left panel) 13 mM ZnSO4 for the hours indicated. The vertical arrow indicates that
zinc was added after 2 h. At each sampling time, aliquots were withdrawn, diluted in TE
buffer, and plated onto YPD medium. The number of colony-forming cells in each
population was determined after 2 d growth at 30°C. Δatg1, dash-dot line; Δatg6, dotted line;
Δatg8, solid line; Δatg11,dash-dot-dot line; PS, dashed line. (C) Percent PI-staining cells
after 12 hr in SD+uracil with (right) and without (left) 13 mM ZnSO4. (D) Percent
permeabilized cells prepared from indicated mutants treated 12 h with and without 13 mM
ZnSO4 and stained with 10 µM H2DCFDA for 30 min at room temperature. (E) Percent cells
with indicated genotypes harboring inclusions after 12 h treatment with and without 13 mM
ZnSO4. The bars indicate the number of inclusions in both PI-negative and total cells. PI-
negative (intact) cells tended to accumulate more polyphosphate-like inclusions than did total
PI-positive cells.
72
73
Figure 4.10. Autophagic mutants were differentially inhibited by Zn+2
. BY4741 PS cells
together with 8 knockout mutants were grown in SD + 0.002 % uracil, diluted by factors of
10, and replica plated onto SD medium containing 0.002% uracil with or without 13 mM
ZnSO4. For the sake of consistency, the same experiments were carried on mutations in a
BY4742 background. Pictures were taken after 3 d. The white spaces were introduced to
show that figures were constructed from tests carried out on different plates containing the
same media.
74
Figure 4.11. Mutants of SEY6210 behaved qualitatively like those of BY4741. (A) SEY6210 and 3 autophagy mutants were cultured on SD medium supplemented with 0.002%
histidine, 0.01% leucine, 0.003% lysine, 0.002% tryptophan, and 0.002% uracil for 5 d. The
asterisk denotes strains derived from a SEY6210 parent. Note that SEY6210 was more
inhibited by 13 mM Zn+2
than BY4741 grown for only 3 d (Figure 4.10). Note too, that
strains missing both ATG8 and ATG11 grew better than strains missing either of the genes
alone. (B) Diploid strains were grown for 3 d on the same medium as in Figure 4.11A. Note
that the sensitivity of SEY6210 was recessive to the tolerance of BY4741.
75
Discussion
The Cvt pathway was first identified in screens searching for the machinery that transports
APEI from the cytoplasm to vacuoles (Wang et al, 1996). As new details emerged, it became
apparent that Cvt operates with smaller vesicles than bulk autophagy (140-160 nm vs. 300-
900 nm) but nevertheless uses many, but not all, of the proteins used by nonspecific
autophagy, together with several proteins unique to itself. Currently, only 2 proteins, Ape1
and the α-mannosidase, Ams1, are known to be harvested by this pathway during normal
growth. However, the Cvt proteins Atg11 and Atg19 acting together with some of the
components of bulk autophagy, are involved in harvesting leucine aminopeptidase III in
response to nitrogen starvation (Kageyama et al, 2009). Additionally, Atg11 combines with
proteins used in bulk autophagy to direct autophagosomes to engulf mitochondria and
peroxisomes (Nazarko et al, 2009); (Kanki & Klionsky, 2008).
Based on the phenotype of mutants falling into class IV, yeast employed another Cvt-like
form of autophagy to protect itself from some of the effects of excess zinc. Unlike Cvt, this
process did not depend on the Cvt receptor, Atg19, yet still acted selectively since neither
ROSELLA-based reporters nor GFP-Atg8 were harvested to any significant extent in PS
cells during zinc treatment. What proved more problematic than finding that autophagy could
extend life during zinc stress was finding evidence for 2 classes of autophagy proteins (II and
III) that somehow hastened necrotic cell death. Unlike apoptotic cell death, ziNCD did not
depend on any of the apoptosis-associated genes tested, and was not accompanied by the
characteristic apoptotic process that exposures annexin-binding sites on the plasma
76
membrane. Unlike the pathways for necrotic cell death, which have proven hard to define
unambiguously (Golstein & Kroemer, 2007), ziNCD depended heavily on an easily
delineated subset of genes associated with the most basic steps in autophagosome assembly.
Yet unlike autophagic cell death, we failed to find unusual numbers of autophagosomes or
evidence that cytoplasmic, mitochondrial, nuclear, or ribosomal reporter proteins were being
harvested indiscriminately as a result of autophagic “karoshi” (death from overwork). We are
left proposing that ziNCD might be operating by re-directing the baseline population of Cvt-
some-like vesicles to selectively harvest proteins that were not substrates previously. In this
model that we are tentatively proposing, the harvesting of these targets causes more harm
than would occur if the proteins had been left untouched. Further investigations may provide
other explanations.
Further investigations will also be needed to explain how zinc actually induced necrotic cell
death. We do not think ziNCD was initiated by the block that Zn+2
imposed on Cvt-some
fusion with vacuoles since, as far as we can tell, these treatments merely phenocopied several
viable yeast mutations including Δmon1 (Figure 4.8A). We do not believe ziNCD was
triggered by the vacuolar accumulation of polyphosphate-like aggregates since more of these
accumulated in intact, presumably viable, cells than in ones beginning to take in PI (Figure
4.9D). We also do not believe that cells died because zinc inhibited one or more vital
processes in a non-autophagic part of the metabolome since these would still be inhibited
after class II and III autophagy genes were knocked out. The only factor that we have
identified so far that might be creating the condition responsible for inducing ziNCD is the
rise in H2O2 in Zn+2
-treated cells (Figure 4.9C).
77
Starting from this point, we speculate that the phenotypes studied here arose through the
following scenario. It is possible that an operation carried out by a Cvt-like pathway
employing Atg11, Atg20, Atg21, Atg23, and Tlg2 (Abeliovich et al, 1999; Lynch-Day &
Klionsky, 2010) was activated to clear away protein aggregates formed through the action of
reactive oxygen species (Kim et al, 2010) or the direct effect of zinc on protein solubility
(Bush et al, 1994; Zaworski & Gill, 1988). Harvesting these aggregates afforded cells some
degree of protection, however at the same time as this defense was activated, a parallel
process involving class II and III proteins was turned on and targeted against a separate set of
proteins or organelles that actively prevented cells from becoming necrotic. In this scenario,
it does not matter that the vesicles harvesting these anti-necrosis proteins are unable to
deliver their contents to the vacuole because their fusion pathways are inhibited: the
catastrophe is inevitable once the “life-sustaining” substrates are compartmentalized in
autophagosomes and thereby prevented from carrying out their function.
We believe that further investigations into the multiple roles of autophagy-associated genes
in yeast’s response to zinc may ultimately have bearing on whether selective or
nonselectiveautophagy is directly responsible for cell death in other organisms as some
propose (Hofius et al, 2009) (Nishida et al, 2009; Samara et al, 2008), or whether autophagic
processes inadvertently upset the balance holding other, pro-death processes in check
(Kroemer & Levine, 2008; Levine & Kroemer, 2009). Our studies were not intended to
address this debate, but nevertheless, may still prove useful as a tool to establish how ziNCD
operates in one cell-type so that experiments can be designed to look for similar events
elsewhere.
78
Chapter 5
Autophagy proteins play cytoprotective and cytocidal roles in leucine
starvation-induced cell death in Saccharomyces cerevisiae
The content of this chapter was previously submitted for publication as: Dziedzic SA, Caplan
AB (2011) Autophagy proteins play cytoprotective and cytocidal roles in leucine starvation-
induced cell death in Saccharomyces cerevisiae. Autophagy
79
Abstract
Autophagy is essential for prolonging yeast survival during nutrient deprivation, however
this report shows that some autophagy proteins may also be accelerating population death in
those conditions. While leucine starvation caused YCA1-mediated apoptosis characterized by
increased annexin V staining, nitrogen deprivation triggered necrotic death characterized by
increased propidium iodide uptake. Although a Δatg8 strain died faster than its parental strain
during nitrogen starvation, this mutant died slower than its parent during leucine starvation.
Conversely, a Δatg11 strain died slower than its parent during nitrogen starvation, but faster
during leucine starvation. Curiously, although GFP-Atg8 complemented the Δatg8 mutation,
this protein made ATG8 cells more sensitive to nitrogen starvation, and less sensitive to
leucine starvation. These results were difficult to explain if autophagy only extended life but
could be an indication that a second form of autophagy could concurrently facilitate either
apoptotic or necrotic cell death.
80
Introduction
Studies of yeast have distinguished two sequences of events leading to growth arrest and to
death. One sequence, typified by the process induced when yeast have been deprived of
polyamines, culminates with the breakup of the plasma membrane so that previously
excluded dyes like propidium iodide (PI) are able to enter the cell (Eisenberg et al, 2009).
Although some PI+ cells can repair this damage and survive if stress is removed (Davey & P.,
2011), most cells that begin to take up PI continue to deteriorate until they succumb to
necrosis. Other treatments including exposure to low levels of H2O2, produce a more
complex series of changes involving chromatin condensation, DNA breakage (Madeo et al,
2002), and membrane rearrangements that expose phosphatidylserine to exogenously
provided annexin V (Madeo et al, 1997a). These events herald apoptotic death, but in most
cases, cellular degeneration continues as cells undergo late apoptosis/ secondary necrosis
(Buttner et al, 2008).
In the literature there is also a 3rd
pathway called autophagic cell death (ACD). Autophagy
was initially defined as the cell’s primary response to nutrient deprivation or to the
pharmacological agent, rapamycin. When these treatments set autophagy in motion, vesicles
called autophagosomes harvested cytoplasmic proteins and organelles and delivered them to
vacuoles or lysosomes to be disassembled into amino acids and lipids useful for preserving
life until external nutrients are restored. However, in a handful of cases (Bursch et al, 1996;
Chera et al, 2009; Kroemer et al, 2009), these autophagosomes were the only visible
responses to stress prior to the demise of the cell (Schweichel & Merker, 1973). Some have
inferred that such cells, lacking any of the hallmarks of apoptosis or necrosis, died from
81
excessive, non-specific harvesting of organelles and proteins that compromised their ability
to maintain essential homeostatic processes. However, persuasive arguments have been made
that death might not have resulted from increased autophagic activity, but because
autophagic activity failed to prevent it (Kroemer & Levine, 2008; Shen & Codogno, 2011).
For many, the resolution of this debate hinges on whether or not cells with defective
autophagy genes are able to survive conditions that kill normal cells (Thorburn, 2011).
A study using yeast recently presented evidence for just such a case (Dziedzic & Caplan,
2011). Cells treated with 13 mM Zn2+
died necrotically unless any one of 7 autophagy genes
was inactivated. At the same time, inactivation of other autophagy genes accelerated cell
death, while the inactivation of the remaining genes had no effect on survival at all. Based on
the mutants’ phenotypes, it was suggested that the autophagic proteins could be sorted into 4
classes representing 4 combinatorial modules. When acting on their own, two of these
modules carried out necrotic cell death. When joined with a 3rd
module, the machinery
performed starvation-induced, non-selective autophagy. Finally, when all of the modules
were functionally joined, autophagy harvested a few proteins selectively including the
vacuolar protein aminopeptidase 1 and delivered them to the yeast vacuole. Yet, despite this
evidence that autophagic proteins played an active part in cell death, the dying cells did not
harvest typical reporters of autophagic activity like ROSELLA (Rosado et al, 2008) or
Rpl25-GFP (Kraft et al, 2008) that would have been expected if indiscriminate autophagy
caused ACD. It appeared instead that a selective autophagic process that could not be tracked
with any of the tested autophagy reporters enabled cells to go necrotic.
This was by no means the first evidence indicating that autophagy contributed to necrotic cell
death. Samara et al. found that the loss of the C. elegans gene homologous to ATG1 reduced
82
the number of cells dying necrotically (Samara et al, 2008). More recently, Shin et al. found
that inhibiting autophagy inhibited the necrotic death of macrophages infected with a
Mycoplasm tuberculosis mutant (Shin et al, 2010). In at least one study, inhibiting the mouse
equivalents of the yeast genes ATG7 and ATG8 blocked autophagic harvesting of catalase,
and by doing so, prevented necrotic death resulting from a catastrophic increase in reactive
oxygen-caused damage (Yu et al, 2006a). The contribution of autophagy to zinc-induced
necrotic cell death (ziNCD) in yeast (Dziedzic & Caplan, 2011) might therefore not be as
unusual as it at first seems, but merely an extreme example of the cell’s response to a number
of lethal treatments.
Most of what we now understand about autophagy began with studies of how the process
manifested itself during nitrogen starvation (Schworer & Mortimore, 1979; Takeshige et al,
1992a). We therefore proceeded to test whether the phenotypic differences between mutants
during ziNCD correlated with phenotypic differences during nitrogen starvation, and with the
less understood response to leucine starvation. Although the two forms of starvation might be
expected to cause similar forms of damage, they in fact have been previously shown to elicit
very different responses. Thus, leucine-starved cells accumulate almost as many
autophagosomes as cells starved for all nitrogen and amino acid sources (Takeshige et al,
1992a), yet based on the vacuole-dependent processing of GFP-Atg8 and prApe1, and on the
up-regulation of Atg4 and Atg8, amino acid-starved cells autophagically process less protein
than nitrogen-starved ones (Ecker et al, 2010). Defective autophagy may account for the
observation that leucine-starved cells lose colony-forming ability faster (Boer et al, 2008)
than nitrogen-starved ones (Klosinska et al, 2011).
The present study found additional ways that the two forms of starvation differed from each
83
other. We show that, like zinc treatments, nitrogen starvation caused the vast majority of
cells to become permeable to propidium iodine (PI), a trait associated with necrosis. Leucine-
starved populations, on the other hand, consisted of a mixture of cells. Some only
accumulated PI, some only stained with annexin V (a phenotype associated with early
apoptosis), and some stained with both, like cells undergoing late apoptosis/ secondary
necrosis. Leucine-starved populations failed to harvest autophagic reporter proteins
efficiently yet at least some autophagic gene knockout mutations that extended the life of
zinc treated cells, extended the life of leucine-starved ones. Despite these contributions by
autophagy proteins, we found no evidence for a unique form of death attributable to ACD.
Based on these studies, it was concluded that autophagic processes aided both apoptotic and
necrotic death, but did not bias which death pathway was used during each stress.
84
Results
The loss of ATG8 and ATG11 had opposite effects on cell survival during leucine and
nitrogen starvations
Previous studies showed that autophagic mutants displayed 1 of 3 different phenotypes when
grown on excess zinc (Dziedzic & Caplan, 2011). Some mutants like Δatg29 had no effect on
zinc tolerance. Others like Δatg8 were more resistant to zinc than the parental strain, while a
handful like Δatg11 were more sensitive. These studies and others led to the suggestion that
autophagic proteins participated in competing processes, some responsible for extending life,
and some able to shorten it. The current set of experiments indicated that the colony-forming
ability (CFA) of Δatg8 cells harboring the URA3 plasmid, YEp (Ma et al, 1987) declined
rapidly during nitrogen starvation while Δatg11 cells with the same vector survived longer
than the other lines for the first 3 d (Figure 5.1A). During leucine starvation, these
phenotypes were reversed (Figure 5.1D). In fact, the initial responses of Δatg8 and Δatg11
towards leucine starvation resembled the responses of these two mutants to zinc treatment,
with the notable difference being that all genotypes eventually succumbed to amino acid
deprivation whereas Δatg8 cells formed colonies in the presence of 13 mM Zn2+
. One
explanation for such phenotypes was that these autophagy proteins participated in two
diametrically opposed pathways of which one reduced CFA.
Autophagy mutations accelerated both necrotic and apoptotic modes of death
Previous studies reported that zinc-treated cells predominantly died through necrosis, based
on PI accumulation, on their failure to bind annexin V, and on the fact that survival was not
85
affected by the loss of any one of 4 genes involved in apoptosis (Dziedzic & Caplan, 2011).
By comparison, leucine-starved populations of PS cells showed a complex spectrum of
phenotypes even after only 3h (Figure 5.2). At that time, some cells took up PI, but twice as
many bound annexin V. By 12 h, an even larger number stained with both treatments (Figure
5.1E) indicating that by then, many apoptotic cells had begun to undergo late apoptosis/
secondary necrosis (Eisenberg et al, 2010a) as happens to cells that had been treated with
H2O2 (Dziedzic & Caplan, 2011). Interestingly, deletion of ATG8 had little effect on the
number of cells initially undergoing necrosis, and instead reduced the number of cells dying
apoptotically or showing late apoptosis/ secondary necrosis (Figure 5.1E). In contrast,
deletion of ATG11 had its greatest effect on the number of cells dying necrotically and from
late apoptosis/ secondary necrosis. This observation, that autophagic mutations affected
necrotic death in one case, and apoptotic death in another, implied that these proteins were
not wedded to either cell death process, nor part of a unique death pathway on their own.
Instead, the operation of these proteins impartially accelerated whichever mechanism killed
cells during each particular stress.
We then extended this comparison of zinc-induced and leucine starvation-induced death to
include other mutants. During leucine-starvation, each strain was monitored at the time when
PS cells showed a 30% loss in CFA (Figure 5.1). However, rather than focusing on the
change in CFA over time, we analyzed the pathway by which the mutants died based on PI
uptake and annexin V binding at a single time point. For the most part, the additionally tested
autophagic mutants responded as they did on zinc-supplemented media. Two knock-out
mutations that reduced necrotic death during zinc treatment (Δatg7 and Δatg15), delayed the
loss of CFA and reduced annexin V staining during leucine starvation. One that had no effect
86
on zinc tolerance (Δatg19), had no effect on survival during leucine starvation. Yet there
were notable exceptions to this correlation. The loss of the yeast metacaspase gene, YCA1,
had no effect on zinc-induced necrotic cell death, but increased CFA from the PS’s 69% 4
to the Δyca1 CFA of 93% 3 during leucine-starvation induced apoptotic death (Figure
5.1F). In addition, Δtor1 and Δatg29 mutants behaved like the parental strain on zinc-rich
medium, but like Δatg8 during leucine starvation suggesting, perhaps, that nutrient recycling
was only relevant to surviving the latter stress.
Different pro-life processes operated during leucine and nitrogen starvation
The responses of mutants to nitrogen-starvation were generally mirror-images of their
responses to the other stresses. Whereas leucine starved cells died quickly over the course of
hours (Figure 5.1D), cells that were concurrently deprived of all other potential nitrogen
donors including leucine, died slowly over the course of days (Figure 5.1A). While the
Δatg11 mutation accelerated death during leucine starvation (Figure 5.1A), this mutation
sustained population growth during the first few days of nitrogen starvation (Figure 5.1D).
Further studies indicated Δatg7, Δatg19, and Δyca1 mutations neither benefited nor harmed
nitrogen starved cells during the first 24 h (Figure 5.1C). Consideration of all these
phenotypes suggested that the kind of autophagy that sustained life during zinc treatment and
leucine starvation worked against the survival of PS cell during the onset of nitrogen
starvation. After day 3, this pro-death activity was either suppressed or over-shadowed by the
contribution of Atg11 (as well as Atg8, 15, and 29) to survival.
Nitrogen-starved cells were also assayed for PI accumulation and annexin V staining. As was
done to study leucine starvation, we wanted to produce a snapshot of the initial responses to
87
stress and so assayed phenotypes after 24 h, when most members of populations of
particularly mutants like Δatg8 were still viable. At this time, most cell death was
accompanied by necrosis (Figure 5.1B and 5.1C). This PI+ phenotype continued to
predominate at 6 d (Figure 5.2), when the CFA of PS cells had dropped to 860.9% (Figure
5.1A). At 6 d, this PI+ phenotype also dominated populations of starving Δatg11 cells (PI
+
cells made up 151.1%, PI+/ annexin V
+ made up 2.50.7%, and annexin V
+ ones made up
0.90.2% of the population; data not shown). The fact that PI+/ annexin V
+ cells remained
scarce throughout this time course suggested that the onset of apoptosis was being delayed
because cells were mounting a more successful response to nitrogen-starvation than they
were able to mount against leucine-starvation, possibly because of the way that autophagy
was being performed during each stress.
The autophagy reporter protein GFP-Atg8 perturbed cell death during starvation
Unexpectedly, independent evidence for the existence of competing autophagic pathways
came from studies employing a common reporter protein, GFP-Atg8, under the control of the
native ATG8 promoter (Prick et al, 2006). This reporter is incorporated into autophagosomes,
and processed in the vacuole to release free GFP and functional Atg8 (Prick et al, 2006).
Before using this construct to monitor autophagy, we carried out a routine analysis to verify
that the additional Atg8 would not affect the cell death processes of the transformants.
Surprisingly, it did. During nitrogen starvation, a parental strain with the reporter developed
2.5-fold more PI+, and fewer surviving, cells than a strain with an unaugmented vector
(Figure 5.3). Conversely, leucine-starved PS cells expressing GFP-Atg8 showed 25% less PI
staining, and 25% more CPA, than cells carrying the vector alone. We then assayed Δatg8
cells with the same construct. Here, the reporter merely returned both cell necrosis and cell
88
survival to PS levels indicating that the chimeric protein compensated for the loss of native
Atg8. If Atg8 was involved in a single process, it would be difficult to accommodate the
similar effects that adding GFP-Atg8 and deleting the endogenous gene had on cell survival.
An alternative interpretation for what was found was that excess Atg8 protein, coming from
both the original and the introduced genes, reduced competition for a rate-limiting molecule
needed by two or more opposing forms of autophagy. Leveling this playing field, in turn,
benefited a life-promoting pathway in leucine-starved cells, and a death-promoting process in
nitrogen starved ones.
Despite genetic and biochemical analyses indicating that at least 2 forms of autophagy
operated in GFP-Atg8 expressing cells, we could not detect changes in the localization of the
reporter in the Δatg8 strain (Figure 5.4). While nitrogen-starved cells acquired green-
fluorescing vacuoles (Figure 5.4A) and showed enhanced GFP-Atg8 processing (Figure
5.4B), the vacuoles of leucine-starved ones were nearly as dark as those in cells during
normal growth (Figure 5.4A). The appearance of these vacuoles differed from those in a
previous report (Ecker et al, 2010). However, those studies were carried out in an ATG8
strain. In PS cells with that genotype, we too found fluorescence accumulated in vacuoles
during leucine-starvation (Figure 5.5). In fact, had we only analyzed the PS strain, we might
have concluded that leucine-starvation had induced macrophagy. After considering the
phenotypes of Δatg8 cells, a more nuanced explanation might be that the combined Atg8 and
GFP-Atg8 level artificially augmented the pro-life pathway, allowing it either to eliminate
mis-translated or mis-folded proteins, or to re-cycle the limiting amino acid more quickly.
89
Leucine-starved cells were less sensitive to rapamycin
After failing to see evidence for GFP-Atg8 processing in Δatg8 cells, we attempted to
visualize autophagic events with an alternative reporter, HttQ25
-GFP, an approximately 34 kD
reporter built from the first 17 amino acids of the human protein, huntingtin, with 25
glutamine residues fused to a FLAG-tagged GFP, that was expressed in yeast from a GAL1
promoter (Meriin et al, 2002). The polyglutamine sequence on this reporter enables it to form
unstable aggregates in vitro (Walters & Murphy, 2009). Preliminary experiments in galactose
medium showed this protein was not toxic to yeast (data not shown), nor did it alter the
percentages of cells that stained with either annexin V or PI during nitrogen or leucine
starvation (compare strains with this reporter shown in Figure 5.6 with the percentages of PI+
cells in Figures 5.1B and E). Although this reporter was harvested during nitrogen starvation
(Figure 5.7A), it too failed to accumulate in vacuoles, or to show evidence of increased
proteolytic degradation, during leucine starvation (Figure 5.7B).
We then turned to Ape1-RFP (Meiling-Wesse et al, 2005), a substrate for non-specific
autophagy, as well as for one very selective process called cytoplasm-to-vacuole transport
(Kageyama et al, 2009). As shown in Figure 5.8A, this protein was harvested constitutively
during nutrient-replete conditions, but vacuolar accumulation increased 20-30-fold more
during either rapamycin treatment or nitrogen starvation (Figure 5.8B). The amount of
processed Ape1 protein also increased during these conditions, although this increase was not
dramatic (Figure 5.8C).
90
Table 5.1. Rapamycin reduces the symptoms of death during leucine starvation.
The table shows the percent of cells ( standard deviation) staining with annexin V or
annexin V and PI (upper white rows) or with PI alone (lower colored rows) for PS and
mutant cultures starved for nitrogen for 24 hrs, or leucine for 12 hrs with (+) and without (-)
0.22 mM rapamycin as indicated. Each experiment was repeated 3 times. Note that
Δatg29::YEp did not respond to rapamycin during this treatment.
SD-N SD-L
Rapamycin - + - +
PS::YEp 1.3 ± 1.1 1.0 ± 0.7 23.2 ± 2 9.0 ± 1.8
3.5 ± 1.0 4.9 ± 1.3 5.3 ± 2.3 1.8 ± 0.7
Δatg8::YEp 1.3 ± 0.7 1.0 ± 0.8 10.3 ± 2 5.8 ± 1.2
11.3 ± 2 13.3 ± 1 3.1 ± 2.0 1.3 ± 0.7
Δatg11::YEp 2.1 ± 0.9 1.0 ± 0.5 36.4 ± 3 24.3 ± 2
3.7 ± 1.8 4.6 ± 0.8 11.6 ± 2 2.4 ± 0.7
Δatg29::YEp 1.3 ± 0.8 1.0 ± 0.7 10.7 ± 1 10.8 ± 1
11.5 ± 1 11.1 ± 1 1.5 ± 0.6 1.3 ± 0.3
91
Figure 5.1. Autophagy mutants did not respond uniformly to nutrient deprivation. (A and D) BY4741 and its derivatives
bearing deletions of the indicated genes were transformed with a vector, YEp 25
, and grown in SD medium to an OD600nm of
approximately 0.4, harvested, washed, and then diluted to 0.04 OD600nm using either SD-leucine (SD-L) or SD-nitrogen sources (SD-
N) as described in Materials and Methods. Samples were removed every 12 h (SD-L) or 72 h (SD-N), plated onto YPD medium and
incubated 2 d at 30° C to assay for survivors. This recovery was normalized to the number of survivors at 0 h. Each point is the
average and standard deviation of 3-4 experiments. (B-C and E-F) Cells were removed from each culture after 12 h (SD-L) and 24 h
(SD-N) starvation, permeabilized, treated simultaneously with PI and annexin V, and viewed microscopically at 520 nm (annexin-
FITC) and 620 nm (PI) 13
. Each value is the average percentage (and standard deviation) of stained cells within a population of 100-
200 cells based on 3-4 independent experiments. The %CFA (the percentage of cells surviving relative to the initial cell number) at the
time of sampling is shown below each mutant.
92
Figure 5.2. Annexin V and PI staining in PS populations progresses at different rates
depending on the starvation treatment. The bar graph shows the percentage of PS cells
staining with annexin V, PI, or both after 3 and 12 h incubation in SD-L, or after 6, 24, and
144 h in SD-N.
93
Figure 5.3. Expressing GFP-Atg8 in PS cells changed the percentages of cells dying
during starvation. PS and Δatg8 cells were transformed with YEp or a plasmid expressing
GFP-Atg8, starved and stained with PI, and scored. Because of the presence of GFP, it was
not possible to score for annexin V-staining cells in these experiments. Each average (and
standard deviation) was derived from 3-4 independent experiments, each counting 100-200
cells. The table shows the %CFA of each strain at the time of sampling.
94
Figure 5.4. GFP-Atg8 was not harvested or processed by Δatg8 cells during leucine
starvation. (A) The photos show representative cells that were pre-grown in SD and then
stained for 30 min with FM4-64. Stained cells were then washed and starved for 12 h (SD-L)
or 24 h (SD-N) and examined. (B) Proteins were extracted from cultures harvested at the
same times as in A, separated by PAGE, transferred to duplicate membranes, and treated
with antibodies to visualize GFP or actin. The amounts of GFP-Atg8 and GFP relative to
actin are shown in the lower table.
95
Figure 5.5. GFP-Atg8 was not harvested in leucine-starved Δatg8 cells. The photos show
representative ATG8 and Δatg8 cells that were stained with FM4-64 for 30 min, washed, and
resuspended in SD-L medium. After 3 h starvation, cells were removed and viewed as
described in the Materials and Methods. Fluorescence was only seen in vacuoles of ATG8
cells.
96
Figure 5.6. HttQ25
-GFP didn’t influence cell death. PS and mutant cells were transformed
with YEp or a plasmid expressing HttQ25
-GFP, pre-grown in SD, and then starved in SG
medium, and stained with PI as in Figure 5.2, and scored. Because of the presence of GFP, it
was not possible to score for annexin V-staining cells in these experiments. Each average
(and standard deviation) was derived from 3-4 independent experiments, each counting 100-
200 cells. Additional experiments (data not shown) demonstrated that substituting galactose
for glucose had no effect on the percentage of PS cells dying during either starvation. The
frequencies of cell death shown here by each mutant were statistically similar to those shown
in Figure 5.1.
97
Figure 5.7. HttQ25
-GFP didn’t accumulate in vacuoles during leucine starvation. (A) The
photos show representative PS cells expressing HttQ25
-GFP after 12 h starvation in SG-L
medium, or 24 h in SG-N. Starvation media also contained 1.0 mM PSMF to inhibit vacuolar
proteolysis. Cells were pre-grown in SD, stained with FM4-64 for 30 min, washed, and
resuspended in the appropriate SG medium before starving them for the indicated times.
Fluorescence was only seen in vacuoles of nitrogen-starved cells. (B) Proteins were extracted
from cultures harvested at the times indicated above (but starved in the absence of PSMF),
separated by PAGE, transferred to duplicate membranes, and treated with antibodies to
visualize GFP or actin. The amounts of HttQ25
-GFP relative to actin are shown in the lower
table. While nitrogen starvation reduced HttQ25
-GFP, leucine starvation had no significant
effect.
98
Figure 5.8. Leucine-starved cells harvested basal levels of Ape1-RFP. (A) Representative
cells in cultures expressing Ape1-RFP after 12 h (SD-L) and 24 h (SD-N) starvation in the
presence or absence of 0.22 µM rapamycin. (B) Average percentage of the population (
standard deviations) showing the indicated phenotypes. Each value was derived from looking
at 100-200 cells in 3 independent experiments. (C) Proteins were extracted from cultures
harvested at the times indicated above, separated by PAGE, transferred to duplicate
membranes, and treated with antibodies to visualize Ape1 or actin. The amounts of Ape1-
RFP and Ape1 relative to actin are shown in the lower table.
99
100
Discusion
Nitrogen starvation-induced autophagy (also known as macroautophagy) has been the model
for uncovering most of what we know about the contribution that this process makes to cell
survival (Abeliovich & Klionsky, 2001). This pathway is negatively regulated by the TOR
complex (Noda & Ohsumi, 1998). Neither the deletion of TOR1 (Figure 5.1C), nor
simultaneous treatment with rapamycin (Table 5.1), a chemical inhibitor of Tor1 (Noda &
Ohsumi, 1998), affected cell death during nitrogen starvation indicating that the kinase was
already fully inhibited by nitrogen starvation. On the other hand, both the deletion of TOR1
and treatments with rapamycin halved the rate of death during leucine starvation (Figure 5.1F
and Table 5.1). This confirmed what others have noted (Ecker et al, 2010): leucine starved
cells survive longer if non-selective autophagy is induced, but are unable to induce this form
of autophagy effectively without pharmacological help.
Rapamycin treatments provided further evidence that autophagy proteins operated differently
during the two deprivation conditions. As shown in Table 5.1, the life-extending process
induced during nitrogen starvation and rapamycin treatment depended upon Atg8 and Atg29,
and not on Atg11. This verified that the pro-life process operating throughout this treatment
was almost certainly synonymous with canonical macroautophagy (Abeliovich & Klionsky,
2001). In contrast, the life-extending process activated during leucine starvation depended on
Atg11 suggesting that this type of autophagy operated selectively (Lynch-Day & Klionsky,
2010), like the one that protected cells from excess zinc (Dziedzic & Caplan, 2011). Also like
zinc-stressed cells, leucine starved ones appeared to simultaneously carry out a death-
101
promoting process, although in this case, one dependent not only on Atg8, but also on Atg29.
Both proteins are considered vital for macroautophagy (Lynch-Day & Klionsky, 2010).
Despite this sensitivity to increases in autophagic activity, the Ape1-RFP reporter failed to
reveal increased protein harvesting during leucine starvation (Figure 5.8A-C). In fact, leucine
starvation partially de-sensitized cells to rapamycin treatment so that there were nearly 3-fold
fewer-than-expected cells with intensely fluorescent vacuoles, and nearly half as much
processed Ape1 protein produced. Interestingly, leucine starved melanoma cells behave
much like leucine-starved yeast: both fail to induce autophagy significantly, both die from
caspase-dependent apoptosis, and neither is induced to full autophagy capacity by rapamycin
(Sheen et al, 2011).
Overall, these experiments demonstrated that mutational studies were able to reveal what our
current set of reporter proteins could not. Without the autophagy mutants, we would have no
reason to suppose autophagy operated during either zinc treatment or leucine starvation since
none of the standard reporters showed extensive accumulation in the vacuoles of the treated
cells. The genetic studies, by contrast, revealed that cells carried out 2 different processes in
each of these conditions. One process protected cells from damage, and one process acted to
accelerate cell death. The balance between these pathways could be shifted towards
extending life by treating cells with rapamycin, or in either direction by expressing GFP-
ATG8. However, at this time, we still cannot say which proteins operate in each pathway.
Based on the small survey reported here, Atg29 played a much more important role
protecting cells from the effects of leucine starvation than it did protecting cells from the
effects of zinc (Dziedzic & Caplan, 2011). Moreover, while Atg11 operated in processes that
protected cells during zinc treatment and leucine starvation, it appeared to interfere or
102
compete with life-extending processes during nitrogen starvation. More subtly, the loss of
Atg15, a vacuolar lipase that extends the lifespan of cells during caloric restriction (Tang et
al, 2008), switched the primary pathway of death during nitrogen starvation from necrosis to
apoptosis. It is possible that cells that are unable to breakdown their autophagosomes in the
vacuole, and thus unable to recycle the autophagosome contents, are dying like cells starved
for leucine.
The second outcome of these studies is to add to the growing evidence that autophagy
operates differently, if at all, during leucine starvation (Ecker et al, 2010; Sheen et al, 2011).
This deviation from the pathway operating during nitrogen starvation might have hastened
the process that caused so many cells to show signs of late apoptosis/ secondary necrosis. A
complete understanding of the basis for this defect, and of how pro-life and pro-death
autophagic pathways differ, must await the identification of new reporters, ones capable of
tracking what appear to be highly selective operations. Until such time, our current
interpretation of the results presented here is that cells are able to use different combinations
of autophagy proteins to harvest different cell constituents, and by so doing, affect the factors
that specifically trigger either necrotic or apoptotic death.
103
Chapter 6
A novel effect of Prostate specific membrane antigen, a member of the
TfRL family, on cell death in yeast
104
Abstract
Prostate specific membrane antigen (Psma) is a trans-membrane member of the Transferrin
receptor-like protein family (TfRL) that is heavily over-expressed in some of the more
aggressive forms of prostate cancer. Even though its enzymatic activities have been
characterized in other parts of the body, its role in malignancy remains to be elucidated.
Recently we have identified a yeast member of the TfRL family, vacuole protein sorting 70
(Vps70), which when present in extra copies, increases the resistance of yeast cells to zinc-
induced necrotic cell death (ziNCD). Remarkably, Psma together with a plant TfRL member,
altered meristem program 1 (Amp1), showed similar responses when introduced to yeast
exposed to zinc. What is more, all three proteins prolonged cell survival in such distinct
stresses as nitrogen starvation or valproic acid treatment. Their presence did not alter the
highly selective Cytoplasm to vacuole (Cvt) form of autophagy, but instead triggered
transport of the general autophagy reporter GFP-Atg8 to the vacuole during zinc treatments
that otherwise inhibit such transport. Psma’s protective ability depended on the specific
autophagy adaptor protein, Atg11. Based on these findings, we have hypothesized that the
Psma pro-life property in yeast depends on its specific targeting to the vacuole, where Psma
controls autophagy-like vesicle fusion leading to the degradation of a pro-death molecule, or
the activation of a pro-life one, thus prolonging cell survival exposed to stress.
105
Introduction
Transferrin receptors span the plasma membrane of nearly every vertebrate cell. Their large
extracellular domain binds transferrin while a much shorter intracellular domain mediates the
endocytotic process that imports the complex into the cell where the iron is ultimately
released allowing the receptors to cycle back to the cell surface (Collawn et al, 1993). While
transferrin receptors are unique to vertebrates (Lambert, 2011), they are viewed as a
relatively recent branch of a more ancient family of transferrin receptor-like proteins (TfRLs)
that are present in animals, as well as in organisms predating the evolutionary appearance of
transferrin itself. (Tinoco et al, 2008) TfRLs cannot bind transferrin (Davis et al, 2005) and
no other polypeptide ligand for them has been found. One of the 3 yeast TfRLs is VPS70,
first found during a screen for knockout mutations that abolished the import of common
metabolic enzymes like carboxypeptidase Y into vacuoles. (Bonangelino et al, 2002)
Knockouts of plant genes most like a TfRL affect a variety of processes that increase the size
of the shoot apical meristem in Arabidopsis, accelerate the maturation of rice leaves, and
reduce embryonic dormancy in maize. (Helliwell et al, 2001; Kawakatsu et al, 2009; Suzuki
et al, 2008) Very little is known about how any of these TfRL proteins operate at the
molecular level. By comparison, one particular member of the vertebrate gene family, most
commonly referred to today as glutamate carboxypeptidase or prostate-specific membrane
antigen (Psma), has been extensively studied because its expression level correlates with the
aggressiveness of the prostate cancer. (Israeli et al, 1994; Sweat et al, 1998) The sequences of
most TfRLs only show short runs of similar or identical amino acids. In this case, Psma is 21
and 26% identical respectively to Vps70 of yeast and Amp1 of Arabidopsis. (Lambert &
106
Mitchell, 2007) Like transferrin receptors, Psma has a large, extracellular domain, a single
membrane-spanning peptide, and a short intracellular domain. Unlike transferrin receptors,
Psma has a functional protease domain that hydrolyzes folate polyglutamate (the form of
most intracellular folate) to folate monoglutamate (Pinto et al, 1996) and N-acetyl
aspartylglutamate (the third most prevalent neurotransmitter in vertebrate nervous systems
(Neale et al, 2011)) to glutamate and N-acetyl aspartate. (Carter et al, 1996) Neither of these
activities are unique to Psma so it is still unclear what its role is in cells and mutational
analyses have added little to clarify this. There are reports that mice harboring knock-outs of
this gene are viable, (Bacich et al, 2002) but also other reports have shown that homozygotes
die quite early, before most neuronal development begins. (Han et al, 2009; Tsai et al, 2003)
Because Psma is linked to cancerous growth and to neuronal functions, its functional
domains have been mapped out in great detail. Mutational studies have been performed to
identify critical amino acid residues in its active site, in the binding of its Zn2+
co-factor,
(Davis et al, 2005) and in post-translational modifications needed for full enzyme stability
and activity. (Ghosh & Heston, 2003) While most of the histidine residues responsible for
zinc binding to Psma are conserved in the homologues, (Helliwell et al, 2001) few of the
asparagines where glycosylation occurs are. (Kawakatsu et al, 2009) Moreover, many of the
essential arginine residues in the active site of Psma (Davis et al, 2005) are missing from
Vps70 and the plant proteins, and neither of the latter two sets of proteins have been shown
to have any kind of enzymatic activity.(Lambert & Mitchell, 2007) In the absence of proven
biochemical activities, interpretations of the diverse phenotypes of the plant mutants have
relied on the assumption that the homologous proteins functioned like Psma as peptidases
acting on folate polyglutamate or as yet unidentified N-acetyl aspartylglutamate-like
107
peptides. This assumption does little to explain the known phenotypes of Δvps70 strains of
yeast. As noted previously, this mutation was recovered in a screen for strains unable to
import a peptidase, carboxypeptidase Y, into vacuoles. (Bonangelino et al, 2002) While most
mutants recovered from this screen displayed visible changes in vacuole formation or
vacuole-associated phenotypes, Δvps70 cells behaved very much like their wild-type parent,
regardless of how they were grown. A subsequent screen, however, showed that these yeast
were sensitive to the expression of a variant of the first exon of huntingtin containing 53
glutamine residues. (Willingham et al, 2003) Proteins like this form aggregates and
inclusions that can be toxic unless dissolved by chaperones (Carmichael et al, 2000) or
removed by autophagy (Iwata et al, 2005). Thus, it would seem that in order to protect cells
from this protein, Vps70 or products that it produces, has to be able to carry out chaperone-
like or autophagy-like activities that Psma has not been seen to do.
In this paper, we report on phenotypic alterations occurring in yeast cells expressing extra
copies of VPS70, or the homologous genes, PSMA and AMP1. Our studies showed that the
encoded proteins could, to different degrees, suppress both necrotic or apoptotic death
resulting from exposure to excess zinc, valproic acid, or to nitrogen and leucine starvation,
four very different physiological stresses for cells. Further analyses showed that these TfRLs
depended on the autophagy adaptor protein, Atg11 (Yorimitsu & Klionsky, 2005) and on
additional gene products that mediate vesicular fusion with vacuoles. Since this protection
was not dependent on many other autophagy proteins, we are forced to suggest that these
TfRLs may have delayed cell death by enhancing the harvesting and/or turnover of selective
proteins by a novel vacuolar import mechanism.
108
Results
Extrachromosomal copies of VPS70 suppressed zinc-induced cell death
We recently reported that high levels of Zn2+
arrested yeast growth within 2 h, and initiated
necrotic death within 8 h, of treatment. (Dziedzic & Caplan, 2011) Quite unexpectedly, zinc-
induced necrotic cell death (ziNCD) could be suppressed by deleting any one of 7 autophagy
genes, or accelerated by knocking out any of 4 others. These results appeared to indicate that
cells were dying from autophagic cell death (ACD), but we failed to find evidence that zinc
treatments stimulated harvesting of any of the fluorescent reporters that ACD is expected to
induce. (Thorburn, 2011) In order to explore the genetic pathways underlying ziNCD, a
search was carried out for genes able to suppress it. Plasmids were prepared from a yeast
genomic library (Ramer et al, 1992) and transformed into a common yeast strain, BY4723.
(Brachmann et al, 1998) Out of approximately 3,000 transformed lines recovered using this
library, 1 was found that grew reproducibly on SD medium containing 10 mM ZnSO4. The
plasmid it contained not only protected BY4723 from high levels of exogenous Zn2+
, but
every other yeast strain tested. For example, BY4741 carrying this plasmid grew on medium
supplemented with 13 mM Zn2+
while a strain harboring a vector alone did not (compare
Figure 6.1A and B). Sequence analysis revealed that the cloned genomic fragment contained
a single intact open reading frame encoding the vacuolar sorting protein, Vps70. The
putative open reading frame for this gene was isolated and inserted into pYES2 (Invitrogen,
Carlsbad, CA) placing it under the control of the GAL1 promoter. We observed that cells
109
transformed with this 2µ-based plasmid grew as well on SD medium with 13 mM Zn2+
as
cells carrying the original genomic clone (Figure 6.1B).
Transferrin receptor-like proteins suppressed several forms of cell death
Vps70 is a member of a family of Transferrin Receptor-like (TfRL) proteins represented in
all eukaryotic kingdoms, including fungi and plants that lack transferrin itself.(Lambert &
Mitchell, 2007) Arabidopsis plants missing its equivalent gene, AMP1, which is 21.2%
identical to Vps70, have abnormally enlarged shoot meristems (Helliwell et al, 2001;
Kawakatsu et al, 2009; Suzuki et al, 2008) accompanied by changes in leaf morphology and
in the levels of several of the major growth and stress-response regulatory molecules.
(Griffiths et al, 2011; Saibo et al, 2007; Suzuki et al, 2008) While some deletions of a
mammalian member of this gene family, PMSA, which is 19.4% identical to yeast protein,
are homozygous lethal, (Han et al, 2009) others are viable, behaviorally normal, but less
susceptible to stroke (Bacich et al, 2005) and additionally, defective in integrin-mediated
endothelial cell invasiveness and angiogenesis. (Conway et al, 2006) In order to determine
whether these proteins also protected yeast from zinc-induced necrosis, cDNAs encoding
AMP1 (Helliwell et al, 2001) and PSMA (Israeli et al, 1993) were cloned into pYES2 and
transformed into yeast. None of these plasmids altered the growth rate or final density of
cultures growing in SD medium (Figure 6.1A and 6.1D), yet each reduced the inhibitory
effect of excess zinc (Figure 6.1B and 6.1E). However, assaying for Zn2+
-induced uptake of
propidium iodide (PI; a characteristic of cells undergoing early necrosis) indicated that the 3
genes did not reduce the onset of death equally: whereas VPS70 reduced the percentage of
cells permeable to PI after 6 h treatment from 203.4% to less than 3.81.6%, AMP1 and
PSMA only halved the percentage of cells taking up the dye (Figure 6.1C). Since Psma must
110
dimerize in order to function as a carboxypeptidase, (Schulke et al, 2003) we also
investigated whether either of the two foreign genes required the host’s endogenous copy of
Vps70 in order protect cells. Figure 6.2 shows, to the contrary, that the CFA and PI uptake
of Δvps70 cells expressing TfRL proteins were statistically indistinguishable from those in
the corresponding parental strains (Figure 6.1C).
Quite unexpectedly, these TfRL proteins not only delayed the onset of zinc-induced cell
death, but delayed death caused by several other treatments as well. For example, nitrogen-
deprived cells, like Zn2+
-treated ones, die necrotically, but only after several days in
starvation medium (Dziedzic and Caplan, submitted). Nevertheless, whereas 9 d of this kind
of treatment reduced the colony forming ability (CFA) of parental cells to 52±6%, strains
carrying extrachromosomal copies of TfRLs died to 76±4 – 99±14%, depending on the TfRL
gene provided (Figure 6.3A). Revealingly, the protection that Vps70 offered did not negate
the need for Atg8 (Figure 6.4A), a protein required for efficient recycling of amino acids
during starvation (Kirisako et al, 1999; Lang et al, 1998) suggesting that even though Vps70
prolonged life in an autophagic-like fashion, it could not substitute for autophagy.
Most of the cells dying from Zn2+
treatments and nitrogen starvation stained with PI or PI +
annexin V rather than with annexin V alone indicating that they had died necrotically
((Dziedzic & Caplan, 2011); Dziedzic and Caplan, submitted). Surprising, the TfRL genes
also reduced cell death from exposure to 25 mM valproic acid (Mitsui et al, 2005) (Figure
6.3C), a histone deacetylase inhibitor, (Gottlicher et al, 2001) and to leucine starvation
(Figure 6.3E) where a significant percentage of the population stained only with annexin V
(Figure 6.3 D and F), characteristic of early apoptosis. (Carmona-Gutierrez et al, 2010)
111
Significantly, we did find 2 lethal conditions that were not reversed by VPS70. One of the
first steps in the execution of apoptosis in mammals involves translocation of the protein Bax
from the cytoplasm to the outer mitochondrial membrane to create channels that release
cytochrome c into the cytosol.(Wolter et al, 1997) Yeast lacks a homologue to Bax, but does
encode proteins that function in a similar way in the cell death pathway. (Buttner et al, 2011)
With their help, yeast carrying a galactose-regulated BAX transgene die apoptotically when
cultured under inducing conditions. (Polcic & Forte, 2003) An episomal copy of the native
VPS70 gene was introduced into a strain harboring BAX, but failed to suppress this galactose-
induced death (Figure 6.4B). This demonstrated that Vps70 did not prolong life by blocking
responses to apoptotic signal molecules emanating from permeabilized mitochondria.
The second failure that we found involved resistance to Cd2+
ions. Vps70 shares 15.3 and
16.9% identity with two more abundant transferrin receptor-like proteins, Tre1 and Tre2, that
are estimated respectively to have 396 and 300 molecules/ cell compared to Vps70 with 112
molecules/ cell. (Ghaemmaghami et al, 2003) Strains missing TRE1 and TRE2 are
hypersensitive to cadmium while double-mutants expressing either gene from a low-copy
plasmid re-acquire wild-type levels of cadmium resistance.(Stimpson et al, 2006) By
comparison, strains missing VPS70 (data not shown), or strains carrying the gene on a high
copy plasmid, only grew like the PS on medium containing 40 mM Cd2+
(Figure 6.4C).
Taking into account these observations and the fact that TfRLs protected cells from several
physiologically unrelated treatments suggested that the TfRLs didn’t prolong life by
eliminating a specific toxic condition that initiated death, or suppressing enzymes in the
pathway that executed it, but rather by alleviating particular kinds of damage caused by some
treatments that ultimately triggered cell death.
112
TfRLs protected autophagy-deficient cells, but still depended upon genes involved in
vacuolar fusion
Yeast strains without a functional VPS70 gene are viable under routine growth conditions
and most stresses tested. In particular, the Δvps70 mutant behaved like the PS during leucine-
starvation (Figure 6.3C), valproic acid treatment (Figure 6.3E), and when cultured with 13
mM Zn2+
(Figure 6.2). However, Δvps70 cells died quickly during nitrogen starvation
(Figure 6.3A), and began to show significant permeability to PI after only 24 h (Figure 6.3B).
The sensitivity to nitrogen starvation that Δvps70 cells showed resembled the phenotype of
cells with defects in starvation-induced autophagy (Tsukada & Ohsumi, 1993a) raising the
possibility that TfRLs exerted their effects by modulating that pathway. In order to test this,
the plasmid encoding VPS70 was transformed into representative autophagy mutants (Figure
6.5) and tested for growth on 13 mM Zn2+
. Contrary to expectations, the effect of Vps70 was
additive to the sensitivity or resistance of the tested mutations. For example, Δatg8 was more
resistant than the PS to Zn2+
and still more resistant when additional copies of VPS70 were
added. Similarly, Δatg11 was more sensitive than the PS, but addition of the pGAL1::VPS70
made it as resistant as the PS with that plasmid. Table 6.1 expands on this list. Δatg21 cells
were more sensitive to Zn2+
than the PS(Tsukada & Ohsumi, 1993a), Δatg1, Δatg17, Δatg22,
and Δtor1 were as sensitive as PS cells, and Δatg5, Δatg6, and Δatg7 were more resistant to
zinc. (Dziedzic & Caplan, 2011) Each acquired the same level of tolerance as the PS when
each was augmented with the additional VPS70 gene. These 10 genes are essential
participants in either selective or nonselective autophagy, or involved in both, (Lynch-Day &
Klionsky, 2010) yet VPS70 needed none of these to prolong cell life. The simplest
113
conclusion is that although Vps70 participated in an autophagy-like pathway, it worked
independently of any of the known autophagic processes.
Similar studies were done with several other genes in order to identify potential partners in
this protective process (Table 6.1). VPS70 enhanced zinc tolerance in strains missing genes
involved in apoptosis (AIF1, NUC1, SVF1, and YCA1), ubiquitination (BRE5, BSD2, TRE1,
and TUL1), transcriptional responses to oxidative or ionic stress (ASK10 and SSN8), and
some genes involved in vacuolar protein sorting (VPS11). On the other hand, other vacuolar
sorting proteins (VPS4 and VPS21) were required, directly or indirectly, for the cell’s
response to extrachromosomal copies of VPS70, as were a number of proteins involved in
endosome-endosome or autophagosome-vacuole fusion processes (CCZ1, MON1, VPS16,
VPS18, and YPT7). Cells missing ZRC1, the major transporter responsible for sequestering
Zn2+
in vacuoles, (Kamizono et al, 1989) also couldn’t respond to VPS70, possibly because
the accumulating ion caused more damage than any defense system could handle.
Expression of tTfRLs altered cell morphology
Two additional points came to light as we continued to study cells expressing TfRLs. First,
staining with FM4-64, a dye that visualizes vacuolar membranes (Vida & Emr, 1995)
showed that PS or Δvps70 cells with the vector YEp, had 1-3 vacuoles with enlarged lumens
(Figure 6.6A-E), but cells expressing any of the TfRL proteins had 3-6 small vacuoles.
Often, vacuolar fragmentation of this kind is accompanied by increased sensitivity to Mn2+
,
Zn2+
, and other growth inhibitory molecules that have to be sequestered or detoxified in the
vacuole for the cells to tolerate them, (Banuelos et al, 2010) but this is the very opposite of
the phenotypes we have seen.
114
Second, we noticed that cells expressing TfRLs tended to be smaller than those with the
vector (Figure 6.6). Based on measurements of 30,000 cells per strain (Figure 6.6F), 58.9%
of PS and 64.3% of Δvps70 cells, each with YEp, fell to the left of an arbitrarily chosen
reference line. By comparison, 87.4%, 92.1%, and 86.0% of cells with pGAL1::VPS70,
pGAL1::AMP1, and pGAL1::PSMA fell to the left of that position. Similar shifts towards
smaller cells have been seen when cells are given extra copies of CLN3, (Cross, 1988) or
contain reduced numbers of functional ribosomes.(Jorgensen et al, 2002)
TfRLs increased the efficiency of protein import into the vacuole
One of the conclusions of the genetic analysis recorded in Table 6.1 was that Vps70
performed an autophgy-like process independently of all autophagy genes tested. In order to
visualize similarities and differences between the Vps70-mediated process and canonical
autophagic abilities, we investigated whether TfRL proteins altered harvesting of either of 2
widely used reporter proteins, Ape1-GFP (Suzuki et al, 2002) or GFP-Atg8. (Suzuki et al,
2001)
Ape1 assembles into small aggregates that are continuously engulfed by small vesicles at a
unique cellular domain called the pre-autophagosomal structure (PAS). (Baba et al, 1997;
Suzuki et al, 2002) These “Cvt-somes” are then delivered to the vacuole through a selective
form of autophagy called the cytoplasm-to-vacuole (Cvt) pathway. (Klionsky et al, 1992)
When cells are starved for nitrogen or treated with rapamycin, Atg8 is recruited to the PAS to
create larger autophagosomes that are capable of performing nonselective, bulk harvesting of
cytoplasmic proteins. (Huang et al, 2000) The chromosomal copy of VPS70 could be deleted
without affecting the delivery of GFP-Atg8 to the vacuole, either during normal growth, or
115
when autophagy has been stimulated with rapamycin (Figure 6.7) demonstrating that VPS70
was not required for Cvt-some or autophagosome formation or operation.
Previous studies indicated that high levels of zinc blocked the fusion of Ape1-loaded Cvt-
somes with vacuoles. (Dziedzic & Caplan, 2011) As a result, PS cells accumulated
fluorescently tagged versions of Ape1 (Suzuki et al, 2002) in 1-2 small subcellular structures,
often close to the vacuole, while the vacuoles themselves remained dark (Figure 6.8). The
introduction of VPS70 into this strain did little to change this: it did not noticeably increase
Ape1-GFP uptake into the vacuole during normal growth, unlike treatment with rapamycin,
nor did it overcome the block that prevented Cvt-somes from fusing with vacuoles (Figure
6.8). Vps70 also did not alter vacuolar accumulation of Zrc1-GFP, a reporter built from the
principal vacuolar zinc transporter (Miyabe et al, 2001), nor did it change the cytosolic
location of another reporter, ROSELLA (Rosado et al, 2008) (data not shown). Thus, not
only was Vps70 not required for Cvt or nonspecific autophagy, additional copies of the gene
were not sufficient to induce either process.
Yet a different result was obtained when cells expressing GFP-Atg8 were examined. Cells
expressing this reporter generally had fluorescent cytosols and vacuoles. Zn2+
-treated cells
appeared quite similar save that they had intensely fluorescent PASs. When
extrachromosomal copies of any one of the 3 TfRL genes were introduced, much of the
cytoplasmic reporter was moved to vacuoles so that the cytoplasm was dark and the PAS less
distinct (Figure 6.9). However, the 3 TfRL proteins did not perform equally well either
because their activities, turnover, or localizations differed. In SD medium, and SD medium
with zinc, cells producing Vps70 and Psma together with GFP-Atg8 had dark cytoplasms and
glowing vacuoles (Figure 6.9). By comparison, cells with AMP1 had some fluorescent
116
material in their vacuoles, but most was in their cytosol like PS cells. Since Vps70 exerted
effects in Δatg8 cells (Table 6.1), it seems likely that GFP-Atg8 was being carried into
vacuoles as cargo rather than as a participant in a conventional autophagy process.
Psma-GFP entered the vacuole when other reporters could not.
Although each of the TfRLs has similar structure, each is believed to be targeted to different
parts of their host cells. Vps70 has not been localized yet, but the process it affects, targeting
of carboxypeptidase Y to vacuoles, indicates it could be associated with the late golgi, the
vacuole, or with the endosome-like vesicles that shuttle in-between. (Vida et al, 1993) On the
other hand, Amp1 accumulates in the ER (Vidaurre et al, 2007) and Psma accumulates
predominantly in the plasma membrane in mammalian cells.(Christiansen et al, 2005)
In order to determine where Psma localized in yeast, a reporter was built that fused GFP to
the C-terminal domain of Psma. Based on the accumulation of PI in dying cells, his chimera
protected cells from Zn2+
as well as Psma (Figure 6.10) but it did not show membrane
targeting during normal growth (Figure 6.11). On the other hand, when cells were treated
with 13 mM Zn2+
, or starved for leucine or nitrogen (Figure 6.12), much of the reporter
translocated to the lumen of the vacuole. Since 7 other cytoplasmic or organelle-associated
reporters including GFP-Atg8 failed to relocate in this way during Zn2+
treatment or leucine
starvation (Dziedzic & Caplan, 2011) (Dziedzic and Caplan, submitted), this reporter had to
have been using a novel mechanism, one possibly related to the specialized autophagic
processes that contribute to the competing pathways of protection and death at work during
those treatments (Dziedzic & Caplan, 2011) (Dziedzic and Caplan, submitted).
117
Despite its similarities to Vps70, this reporter did differ strikingly in its dependency on other
proteins. Vps70 protected all of the autophagic mutants tested (Table 6.1). In contrast,
Psma, and Psma-GFP, required Atg11 (but not Atg8) to protect cells from 13 mM Zn2+
(Figure 6.10) and to overcome the blockade that Zn2+
imposed on autophagic vesicle fusion
with vacuoles (Figure 6.11). It may that this heterologous protein needed assistance to get
into the vacuole, but once there, was able to perform like its yeast homologue.
118
Table 6.1. VPS70 requires many vacuolar proteins to protect cells from Zn2+
. Strains of
BY4741 with knockout mutations in the indicated genes and transformed with YEp or VPS70
were assayed for growth as shown in Figure 6.5. The growth of the PS was set at - and other
phenotypes were judged relative to that based on 2-3 independent experiments. -, very little
or no growth detected after 4 d; +/-, weak growth when 104 cells were applied in the first
position; ++, growth in the 2 left-most dilutions; +++, growth in the 3 left-most dilutions;
++++, growth in the 4 left-most dilutions.
119
Table 6.1. VPS70 requires many vacuolar proteins to protect cells from Zn2+
Distinguishing
Deletion in
Strain
Functional Role
Of Gene
-
VPS70
+
VPS70
(PS) (-) (-) (+++)
TOR1 Negative regulator of autophagy (Klionsky et al, 2010) - +++
ATG1 Negative regulator of autophagy (Klionsky et al, 2010) - +++
ATG5 Part of an E3 ligase for Atg8 (Klionsky et al, 2010) ++ +++
ATG6 Part of a PtdIns kinase (Klionsky et al, 2010) ++ +++
ATG7 E1 enzyme for Atg8 and 12 (Klionsky et al, 2010) ++ +++
ATG8 Required for autophagosome expansion (Klionsky et al, 2010) +++ ++++
ATG11 Scaffold protein for selective autophagy (Klionsky et al, 2010) - +++
ATG17 Modulator of size of autophagosome (Klionsky et al, 2010) - +++
ATG21 PtdIns(3)P binding protein (Klionsky et al, 2010) - +++
ATG22 Amino acid effluxer for vacuole (Klionsky et al, 2010) - +++
AIF1 Positive regulator of apoptosis (Wissing et al, 2004) - +++
NUC1 Positive regulator of apoptosis (Vincent et al, 1988) - +++
SVF1 Negative regulator of apoptosis (Vander Heiden et al, 2002) - +++
YCA1 Apoptotic metacaspase (Madeo et al, 2002) - +++
ASK10 Subunit of RNA polymerase II (Page et al, 1996) ++ +++
SNF1 Positive regulator of autophagy,
metabolism, and proteolysis (Petranovic et al, 2010) - -
SSN8 RNA polymerase II-associated kinase (Carlson et al, 1984) - +++
VPS4 ATPase required for vacuolar protein sorting (Robinson et al,
1988)
- +/-
VPS11 Vacuolar membrane protein involved in protein
Sorting (Robinson et al, 1988) - +++
VPS16 Endosome-to-vacuole docking and fusion (Robinson et al, 1988) - +/-
VPS18 Vesicle-to-vacuole docking and fusion (Robinson et al, 1988) +/- +/-
VPS21 Rab-like GTPase involved in protein sorting (Robinson et al,
1988)
++ +++
VPS33 ATP-binding protein required for vesicle
docking and fusion (Robinson et al, 1988) - +++
VPS70 Vacuolar protein sorting (Bonangelino et al, 2002) - +++
TRE1 Regulator of transporter turnover (Stimpson et al, 2006) - ++++
MON1 GEF-subunit for ypt7 (Nordmann et al, 2010a) - -
CCZ1 GEF-subunit for ypt7 (Nordmann et al, 2010a) - -
YPT7 Rab-like GTPase involved in endosome-endosome
Fusion (Wichmann et al, 1992) - -
BRE5 De-ubiquitinase involved in ER-to-Golgi transport (Cohen et al,
2003) - +++
BSD2 Facilitates degradation of metal transporter (Liu et al, 1997) - +++
TUL1 E3 ligase involved in protein sorting (Reggiori & Pelham, 2002) - +++
ZRC1 Primary vacuolar transporter of Zn2+
(Kamizono et al, 1989) - -
120
Figure 6.1. TfRL proteins protect yeast from excess zinc. (A) PS::VPS70 is a clone of the
native gene in YEp while the others plasmids consist of open reading frames transcribed
from the GAL1 promoter in pYES2. The growth of the parental strain (PS) or Δvps70
transformed with the indicated plasmids was assessed using cultures first grown in SD
medium to mid-exponential phase, then serially diluted by factors of 10, and stamped onto
SD agar. As shown above each photograph, the first dilution had approximately 104 cells and
the last approximately 100 cells. (B) The same dilutions used in panel (A) were replica
stamped onto SD medium supplemented with 13 mM ZnSO4. The collages in panels (A) and
(B) were assembled from photographs taken after 4 d growth at 30°C. C. Propidium iodide
staining was carried out on cultures grown in SD medium to an OD600nm of approximately 0.4
and then diluted into fresh medium supplemented with 13 mM ZnSO4. Each culture was
121
sampled after 6 h, treated with PI, and viewed microscopically at 620 nm (PI). 13
Each value
is the average and standard deviation of 3-4 independent experiments, each counting 100-200
cells. The probability that the results were similar to PS: *, p<0.001; **, p<0.004; ***,
p<0.016. (D) Cultures were prepared as in (C), but diluted into SD medium without a Zn2+
supplement. Samples were removed every 2 or 12 h as indicated, spread onto YPD agar, and
incubated for 2 d to determine colony forming ability (CFA) at tn as a percentage of colony
forming ability at t0. The left scale shows the average percent change (± SD) from the initial
population size for 4 independent replicates. (E) Cultures were prepared as in (C) diluted
into SD medium with 13 mM Zn2+
. Cultures were sampled and recorded as in (D).
122
Figure 6.2. PSMA and AMP1 did not need VPS70 to protect cells from zinc. PS and
Δvps70 cells transformed with YEp or with plasmids encoding VPS70, PSMA, and AMP1
were grown with 13 mM Zn2+
and assayed for CFA and for PI accumulation as described in
the legend for Figure 6.1C. Each value is the average and standard deviation of 3
independent experiments, each counting 100-200 cells The probability that the results were
similar to PS: *, p<0.001; **, p<0.025; ***, p<0.01.
123
Figure 6.3. TfRL proteins protect yeast from treatments that induce necrotic and
apoptotic death. (A), (C), and (E) Cultures of the PS or Δvps70 transformed with YEp or
with pYES2 expressing each of the indicated genes were grown in SD medium to an OD600nm
of approximately 0.4 and then diluted into nitrogen- and amino acid-free SD (A), or SD
medium without leucine (C), or SD medium containing 25 mM valproic acid (E). Samples
were removed at the indicated times, spread onto YPD agar, and incubated for 2 d to
determine colony forming ability (CFA) at tn as a percentage of colony forming ability at t0.
The left scale shows the average percent change (± SD) from the initial population size for 3
independent replicates. (B), (D) and (F) Cultures were sampled after 24 h (B), 12 h (D), and
42 h (F), permeabilized, treated with both PI and annexin V, and excited at 520 nm (annexin-
FITC) and 620 nm (PI).(Dziedzic & Caplan, 2011) Each value is the average and standard
deviation of 3-4 independent experiments, each counting 100-200 cells. The percent CFA (±
SD) for each sample is shown below each set of bars.
124
125
Figure 6.4. VPS70 did not alleviate all causes of death. (A) Cultures of PS or Δatg8 with
YEp or pgal1::VPS70 were grown as in Figure 6.3A and sampled every 12 h on YPD agar.
CFA was determined after 2 d. The left scale shows the average percent change (± SD) from
the initial population size for 3 independent replicates. (B) Cultures of the yeast strain, CLM
282, carrying a pgal1::BAX transgene(Polcic & Forte, 2003) and either YEp or YEp with the
native VPS70 transgene were grown in S medium with 2% raffinose (SR) to mid-exponential
phase, then serially diluted by factors of 10, and stamped onto SR agar or SR agar with 0.5%
galactose. As shown above each photograph, the first dilution had approximately 104 cells
and the last approximately 100 cells. Photographs were taken after 4 d. (C) Cultures of PS
with YEp or YEp with the native VPS70 gene were grown in SD, diluted, and applied as
described in Figure 6.2A to SD or SD with 40 µM CdSO4. Pictures were taken after 3 d
growth at 30C.
126
Figure 6.5. VPS70 suppressed autophagy mutations but not a knockout of the rab-like
gene, YPT7. Each strain was grown, diluted, and replicated onto SD or SD with 13 mM
ZnSO4 as detailed in Figure 6.1. As shown above each photograph, the first dilution had
approximately 104 cells and the last approximately 10
0 cells.The collages were assembled
from photographs taken after 4 d growth at 30°C.
127
Figure 6.6. TfRL proteins alter vacuolar morphology and the cell size of yeast. (A-E)
Vacuolar morphology of the PS containing YEP (A), pgal1::VPS70 (B), pgal1::AMP1 (C),
pgal1::PSMA (D), or Δvps70 with YEp (E) was assessed by growing cells in YPD at 30° C
to an OD600nm of approximately 0.4, concentrated by centrifugation, and resuspended in YPD
supplemented with 20 µg/ml FM 4-64 for vacuole membrane visualization. After incubating
cells for 30 min, cells were collected by centrifugation, resuspended in TE buffer, washed a
second time in the same way, then diluted in SD to an OD600nm= 0.2, and grown for 4 h.
Stained cells were viewed microscopically using an excitation wavelength of 520 nm. (F)
Cells were grown in SD to an OD600nm of 0.4, washed twice and resuspended into 50 mM
citrate buffer. A 10-fold dilution was analyzed by flow cytometry. Based on counts of
30,000 cells/ strain, 58.9% of cells with YEp fell to the left of the arbitrary reference line.
Under the same conditions, 87.4% pgal1::VPS70; 92.1% pgal1::AMP1; 86.0%
pgal1::PSMA; and 64.3% Δvps70 with YEp fell to the left of that position.
128
Figure 6.7. VPS70 was not required for Ape1-RFP harvesting by Cvt or autophagic
pathways. Strains were transformed with pAPE1::APE-RFP and grown in SD to mid-log
phase, then concentrated by centrifugation and resuspended in SD with or without 0.22 µM
rapamycin as indicted. Photographs were taken after 6 h culture at 30C. Without
rapamycin, Cvt harvested the reporter equally well in PS cells and ones missing VPS70. With
rapamycin, harvesting was performed by non-selective, bulk autophagy.
129
Figure 6.8. Vps70 did not suppress the inhibitory effect of Zn2+
Ape1-GFP import into
vacuoles. Strains were transformed with pAPE1::APE-GFP and pgal1::VPS70 and grown in
SD to mid-log phase, then concentrated by centrifugation and resuspended in YPD
containing 20 mg/ mL FM4-64 for 30 min at 30C. Cells were next concentrated by
centrifugation, washed twice in TE buffer, and suspended in SD without additional
supplements, or with 0.22 µM rapamycin, or with 13 mM Zn2+
as indicted. Photographs
were taken after 6 h culture at 30C. In SD medium, most of the green fluorescent material in
either PS::YEp or PS::pgal1-VPS70 cells accumulated in vacuoles and the PAS, or only in
the vacuole when cells were treated with rapamycin, or only in the PAS in the presence of
Zn2+
.
130
Figure 6.9. TfRL proteins suppressed the block on GFP-Atg8 import into vacuoles
caused by Zn2+
. Strains were transformed with pATG8::GFP-ATG8 and one of the TfRL
gene constructs and grown in SD to mid-log phase, then concentrated by centrifugation and
resuspended in YPD containing 20 mg/ mL FM4-64 for 30 min at 30C. Cells were next
concentrated by centrifugation, washed twice in TE buffer, and suspended in SD with 1.0
mM PMSF with and without 13 mM Zn2+
. Photographs were taken after 6 h culture at 30C.
PS::YEp cells had fluorescent cytoplasms and dark vacuoles. In comparison to PS::YEp, all
3 constructs promoted harvesting of GFP-Atg8 into vacuoles in SD with and without zinc,
but pgal1::VPS70 and pgal1::PSMA were noticeably more effective than pgal1::AMP1 where
much of the fluorescent protein was concentrated in vesicles adjacent to the vacuole.
131
Figure 6.10. PSMA and PSMA-GFP required Atg11 to protect cells from 13 mM Zn2+
.
PS, Δatg8, and Δatg11 cells transformed with PSMA or PSMA-GFP were pregrown in SG to
mid log phase, cells were harvested, washed twice in TE buffer and inoculated into SD
medium with 13 mM Zn2+
, and assayed after 6 h for PI accumulation as described in the
legend for Figure 6.1C. Each value is the average and standard deviation of 3 independent
experiments, each counting 100-200 cells.
132
Figure 6.11. Psma-GFP was harvested by an ATG11-dependent process in Zn2+
-treated
cells. Strains transformed with pgal1::PSMA-GFP were grown in galactose medium to mid-
log phase, then concentrated by centrifugation and resuspended in YPD containing 20 mg/
mL FM4-64 for 30 min at 30C. Cells were next concentrated by centrifugation, washed
twice in TE buffer, and suspended in SD with 1.0 mM PMSF with and without 13 mM Zn2+
.
Photographs were taken after 6 h culture at 30C. The reporter entered vacuoles in zinc-
treated PS or Δatg8 cells, but accumulated in 1-3 vesicles docked to the vacuole in Δatg11
ones.
133
Figure 6.12. Psma-GFP was harvested during both leucine- and nitrogen-starvation.
Strains transformed with pgal1::PSMA-GFP were grown in galactose medium to mid-log
phase, then concentrated by centrifugation and resuspended in YPD containing 20 µg/ mL
FM4-64 for 30 min at 30C. Cells were next concentrated by centrifugation, washed twice in
TE buffer, and suspended in SD with 1.0 mM PMSF but without additional nitrogen and
amino acid sources (SD-N), or without leucine (SD-L). Photographs were taken after 24 h or
12 h culture at 30C, respectively. Unlike previous studies (Dziedzic and Caplan,
submitted), the reporter entered vacuoles in both cases.
134
Discussion
It is possible that more nuanced explanations for each of the effects will yet be found, but at
this time, the most parsimonious assumption is that all of the phenotypes shown by these
TfRL proteins in yeast stem from their effect on a single pathway that brings molecules into
the vacuole that if left outside, would delay cell division during normal growth, and during
certain stresses, contribute to necrotic or apopotic death. While enhanced protein recycling
would account for extended cell survival during starvation, it could not explain how Vps70
saved zinc-treated cells since survival in those conditions did not require Atg22, the major
transporter responsible for exporting free amino acids to the cytosol (Yang et al, 2006) for re-
use (Table 6.1). This leaves open the possibility that a novel form of selective autophagy or
autophagy-like process was at work, able to harvest GFP-Atg8 and possibly Psma-GFP as
cargo.
Since the effect of Vps70 depended on proteins like Ccz1, Mon1, Vps16, Vps18, Vps33, and
Ypt7 that are involved in vesicle fusion, TfRLs presumably operated through a vesicle
intermediate. It is not clear what kinds of molecules could be harvested to produce the effects
that were observed, but they must have been chosen highly selectively since Vps70 did not
cause the established reporters to enter vacuoles during Zn2+
treatment or leucine starvation.
This selectivity argued against TfRLs activating bulk autophagy, while the failure to affect
Ape1-GFP uptake argued against a similar effect on Cvt.
135
Does the uniform distribution of Psma-GFP in yeast which was so different from what has
been seen in mammalian cells (Christiansen et al, 2005) invalidate extrapolating these effects
to mammalian cells? It seems unlikely, although this can only be proven experimentally.
The effects of this protein were qualitatively similar to the effects produced by Vps70. It
seems improbable that these shared abilities were merely fortuitous. However, whereas
Vps70 did not require assistance from tested autophagy genes in yeast, Psma needed
assistance from Atg11 both for cell protection and for vacuolar localization (Figure 6.12).
There is no known Atg11 in non-fungal species, but there are autophagy adapter proteins that
might substitute. (Johansen & Lamark, 2011) Moreover, Psma may need assistance in
entering vacuoles, but may be able to enter mammalian lysosomes (the equivalent organelle)
without this particular kind of help. Finally, Psma is normally glycosylated in mammalian
cells. (Barinka et al, 2004) The mis-localization and Atg11 requirement may both result from
the lack of appropriate modifications in yeast.
Understanding the underlying mechanism by which TfRL proteins work is not needed to
appreciate how our observations alone could clarify how TfRL proteins might be
participating in plant development. For example, the loss of AMP1 or its homologues in rice
and maize have been shown to cause precocious leaf maturation and seed germination,
enlarged meristems, and a bewildering array of secondary effects. (Griffiths et al, 2011;
Kawakatsu et al, 2009; Suzuki et al, 2008) Most researchers have explained these as epistatic
changes resulting from changes in production or catabolism of the regulatory hormone,
abscisic acid (ABA). If the Amp1-like proteins affect protein harvesting in plants as they
seem to do in yeast, then an alternative explanation for some, if not all of the phenotypes,
displayed by these mutants would be that the developmental changes resulted from an
136
inability to remove some proteins meant to function for short periods of time such as signal
molecules controlling germination or the number of programmed cell divisions, or cyclins
controlling the length of the cell cycle. (Ho et al, 2008) A corollary of this hypothesis is that
over-producing TfRL proteins would accelerate the destruction of some cell cycle proteins
causing one or more phases of the cell cycle to begin prematurely, resulting in smaller cell
sizes as seen in Figure 6.6.
The present studies could also change the way we have been viewing Psma expression in
cancer cells. At various times, increased expression of Psma has been correlated with
invasiveness (Ghosh et al, 2005), tumor angiogenesis (Anilkumar et al, 2006; Silver et al,
1997), and with an increased propensity for cells to become aneuploid (Rajasekaran et al,
2008), but it has proven conceptually difficult to explain how these phenotypes could be
linked to the only known activity of the protein: its role in liberating glutamic acid from
folylpoly-g-glutamates (Pinto et al, 1996) and from the C-terminus of the neural peptide, N-
acetylaspartylglutamate. (Carter et al, 1996) However, the phenotypes caused by Psma
expression in yeast could provide a model to account for most if not all of the phenotypes
seen in mammalian cells. Premature cell division, or failure to delay division until
chromosome segregation has been completed could contribute to increased aneuploidy.
Errors in signaling, especially relating to the turnover of angiostatins (Nussenbaum &
Herman, 2010), could stimulate angiogenesis, and all of these changes plus invasiveness
could be exasperated by any factor that prevented cells from dying apoptotically when
detached from their original substratum and the surface of their neighbors. (Reddig &
Juliano, 2005)
137
Finally, the results in this paper also add substance to a previous proposal that PSMA could
be a multifunctional protein.(Rajasekaran et al, 2005) This proposal was based primarily on
its unique glutamate carboxypeptidase activity, on its structural similarity to receptor
proteins, and on its functional links with the actin cytoskeleton and integrin signaling via its
interaction with filamin. (Conway et al, 2006) Since yeast and plants lack integrins, one
would have to assume either that each homologue exerts pleiotropic effects through its own,
particular set of domains, or that, contrary to expectations for proteins differing at
approximately 80% of their residues, the primary abilities of this family lie with a few
preserved domains that operate an yet unidentified, cell pathway. The results in the present
paper support the latter argument.
138
Chapter 7
Future directions
139
Autophagocytosis is a pro-life mechanism which, by recycling non-essential proteins,
prolongs cell survival during amino acid starvation. Nevertheless, a growing body of
evidence obtained by studying different organisms has suggested that this protective
mechanism in some cases may be leading to death when excessively induced. This form of
response, which has been called autophagic cell death (ACD), is doubted by many
researchers who believe that autophagy per se cannot trigger death, but rather modulates
other pathways such as apoptosis or necrosis. Because of that there is a need for extensive
studies into the potential interplay between the pro-life and hypothesized pro-death natures of
autophagocytosis.
The work of this thesis was aimed at characterizing such a dual role in Saccharomyces
cerevisiae undergoing two distinct stress treatments, one resulting from exposure to 13 mM
zinc sulfate and one from leucine deprivation. Within the course of this study we identified
two possibly parallel pathways utilizing different sets of autophagy proteins shortening or
prolonging survival of the yeast strains treated with zinc. This metal treatment triggered ROS
formation which in turn led to the non-apoptotic form of death. The biochemical analysis
utilizing commonly used fluorescent reporters did not reveal an increase in autophagic flux,
which suggested that death was not caused by ACD as it is traditionally understood.
Nonetheless, data obtained genetically showed that death could be the result of a specific
autophagy pathway for which a reporter has yet to be found.
Similar to zinc, leucine starvation also caused autophagy-controlled death yet did not change
the location of any of the common autophagy reporters that were tested (Chapter 5). Even
though the outcome of both treatments could be suppressed by addition of the autophagy-
induced, rapamycin, leucine starvation triggered apoptosis rather than necrosis. This
140
suggested the possibility that depending on the environment conditions, cell can utilize
various sets of autophagy proteins which by their actions trigger necrotic or apoptotic
responses.
In chapter 6 the relation of a yeast protein of unknown function (Vps70), together with other
members of the transferrin receptor-like protein family, one from humans (Psma) and one
from plants (Amp1), to different modes of death was described. Through the course of this
project we discovered that increasing the VPS70 copy number leads to decreased sensitivity
to various dissimilar treatments that would otherwise shorten the life span of the parental
strain (PS). Remarkably, a similar effect was observed when mammalian or plant proteins
sharing approximately 20% amino acid identity were introduced into yeast. One of the
significant conclusions that has come from this work is that a GFP tagged version of Psma
has proven to be the only fluorescence reporter out of nine that have been tested which was
actively targeted to the vacuole in response to zinc treatment (Figure 6.11). This transport,
and the protection that vacuolar localization required, depended on the specific autophagy
adapter, Atg11 (Figure 5.10).
A model has built that summarizes theses observations. As shown in Figure 7.1, 13 mM
Zn2+
(or leucine starvation) triggers cell damage and a response to that. Firstly, Psma it is
targeted into the vacuolar membrane in an Atg11 dependent manner. This in turn does one of
two things. Either it leads to the harvesting of a pro-life factor which is activated or able to
act in the vacuole to turn on a pro-life response or Psma helps vacuoles harvest a cytoplasmic
pro-death factor so that it can be subsequently degraded in the vacuole.
141
Even though we tried to answer as many questions as possible related to this phenomena we
found, it has not yet been possible to fill in all of the details or to distinguish how Psma
works.
It is crucial to identify additional proteins that interact with Vps70 in yeast and with Psma in
humans in order to prolong cell longevity. Deletion mutation analysis revealed that Vps70
functions (and by analogy, Psma and Amp1) depended on a handful of other, better
characterized proteins, since without their presence its protective phenotype against zinc was
absent (Table 6.1). It is possible that Vps70 physically interacts with them, and therefore this
should be tested using yeast two-hybrid analysis. Due to the fact that results obtained using
fluorescent markers hint that Vps70 may be involved in facilitating vacuolar traffic, it would
be particularly interesting to test if it binds to Ccz1, Mon1, or Ypt7, proteins which are
believed to be involved in all vesicle-vacuole fusions (Wang et al, 2002b). In addition since
these 3 proteins were previously shown to be important for pexophagy (Polupanov et al,
2011), it might be important to test whether Vps70 is not altering this specific autophagy
pathway while facilitating survival of the cells exposed to stress. This could be tested both by
genetic means, for example, by testing for interactions between Vps70 and Vps34 (Grunau et
al, 2011) or Sar1 (Schroder et al, 2008), and cytological ones using RFP-SKL as a pathway
marker (Bugnicourt et al, 2008).
Chapters 3 and 4 showed that both zinc treatment and leucine starvation triggered a response
that included inhibition of Cvt-some (or Cvt-some-like) fusion with vacuoles. In chapter 6 we
showed that the presence of Vps70 (as well as Psma and Amp) can at least partially (Figure
6.5) remove this blockage and at the same time extend cell survival (Figures 6.1 and 6.2). It
is then possible that in order to live longer during both treatments, cells must harvest and
142
transport to the vacuole (lysosome) a pro-death factor, for its destruction or harvest a pro-life
factor so that it can become active. One possible method to identify this component would be
to harvest cells with and without extra copies of genes of interest after both have been
exposed to the zinc treatments or to leucine starvation, extract their vacuoles, and analyze
their protein contents using electrospray ionization tandem mass spectrometry (Sarry et al,
2007), looking for differences in protein profiles between the two strains . The proteins
discovered through this type of analysis could then be tested by yeast two-hybrid techniques
for potential Vps70 interactions, and be knocked out and/or over-expressed in a parental
strain cells to prove their importance.
Totally unexpected, but potentially medically relevant, was the relation between the presence
of extra copies of all three genes and the smaller cell size. This phenotype can suggest that
over-expression of the PSMA in prostate cancer cells might similarly alter their cell cycle.
The obvious question here would be if this smaller size gives the cells an advantage during
starvation or zinc treatment or if this is simply an interesting, but irrelevant by-product of
over-producing Psma protein . One way to test for that in yeast would be to examine other
mutant strains showing similar size reduction for their response to stressors. A yeast two-
hybrid analysis against peptides important for cycle progression such as CDC28 (Reed &
Wittenberg, 1990) or WIH1 (Russell et al, 1989) could reveal whether any of them interact
with Psma, Vps70 or Amp1. Using flow-cytometry to measure DNA content (Sazer &
Sherwood, 1990), it might also be possible to characterize the exact phase which is affected
by the presence of the protein of interest relative to the parental strain. Since we already
know many of the proteins controlling the completion of one phase and initiating the
beginning of the next, knowing which phase is most affected could provide us with genes we
143
should begin to study with the methods above. Finding them could in turn open new avenues
leading to the design of new strategies which to alter this mechanism towards malignant cell
death.
In addition to size, as shown in Figure 6.3, extra copies of VPS70, PSMA and AMP1 affect
the distribution of the yeast vacuolar dye FM4-64 indicating differences in morphology of
this organelle compared to the PS. It appeared that the vacuole was fragmented. It would be
interesting to determine whether this increased the overall fusion area able to harvest pro-
death components more efficiently. This hypothesis could be further supported by an electron
microscopic analysis to directly measure vacuolar surface area. It would also be worthwhile
to produce multiple vacuoles in the PS using different concentrations of natamycin (te
Welscher et al, 2010) to see if this duplicates the effect that protects cells from zinc, or if
Vps70 could still prevent death triggered by zinc or starvation if the vacuole was already split
into several parts.
The main challenge encountered while running projects described in all chapters was the lack
of a suitable florescent reporter that could be used to monitor specifically pro-death or pro-
life pathway. In chapter 6 it was proposed that PSMA-GFP could be such a marker associated
with mechanism leading to cell survival since it was being transported to the vacuole each
time cells were living longer in response to the stressor (Figures 6.6 and 6.7). Nonetheless,
one could easily argue that because Psma influenced the cell response to the stimuli this is
not a proper reporter. Recently, a Japanese group showed that their dKeima GFP chimera can
be transported to the lysosome with an autophagy-dependent but autophagosome-
independent manner (Katayama et al, 2011). This could be a potential route of at least one of
144
the pathways I found and thus should be tested both with and without Vps70 (and Psma and
Amp1) present in the cell exposed to stress.
145
Figure 7.1. Model describing possible role of Psma in response to Zn2+
. Zinc treatment results in cellular damage which induces
sequestration of the Psma cytoplasmic protein into specific autophagy vesicles in an Atg11-dependent manner. These vesicles are
brought to and fused with the cell vacuole in a process controlled by the Rab protein, Ypt7, activated by Mon1/Ccz1 (Ypt7 GEFs).
The presence of Psma in the vacuole membrane in one case triggers the harvesting of the pro-life factor which matures to increase cell
life span. Alternatively, Zn2+
treatment induce the formation of a pro-death factor in the cytoplasm which leads to death. Psma in the
vacuole membrane activates pathway(s) which sequester this and degrade it in the vacuolar lumen
146
Chapter 8
References
147
Abeliovich H, Darsow T, Emr SD (1999) Cytoplasm to vacuole trafficking of aminopeptidase I
requires a t-SNARE-Sec1p complex composed of Tlg2p and Vps45p. Embo J 18: 6005-6016
Abeliovich H, Klionsky DJ (2001) Autophagy in yeast: mechanistic insights and physiological
function. Microbiol Mol Biol Rev 65: 463-479.
Aita VM, Liang XH, Murty VV, Pincus DL, Yu W, Cayanis E, Kalachikov S, Gilliam TC, Levine B
(1999) Cloning and genomic organization of beclin 1, a candidate tumor suppressor gene on
chromosome 17q21. Genomics 59: 59-65
Allen C, Büttner S, Aragon AD, Thomas JA, Meirelles O, Jaetao JE, Benn D, Ruby SW, Veenhuis M,
Madeo F, Werner-Washburne M (2006) Isolation of quiescent and nonquiescent cells from yeast
stationary-phase cultures. J Cell Biol 174: 89-100
Almeida B, Buttner S, Ohlmeier S, Silva A, Mesquita A, Sampaio-Marques B, Osório NS, Kollau A,
Mayer B, Leão C, Laranjinha J, Rodrigues F, Madeo F, Ludovico P (2007) NO-mediated apoptosis in
yeast. J Cell Sci 120: 3279-3288
Amarante-Mendes GP, Green DR (1999) The regulation of apoptotic cell death. Braz J Med Biol Res
32: 1053-1061
Amaravadi RK, Yu D, Lum JJ, Bui T, Christophorou MA, Evan GI, Thomas-Tikhonenko A,
Thompson CB (2007) Autophagy inhibition enhances therapy-induced apoptosis in a Myc-induced
model of lymphoma. J Clin Invest 117: 326-336
Anilkumar G, Barwe SP, Christiansen JJ, Rajasekaran SA, Kohn DB, Rajasekaran AK (2006)
Association of prostate-specific membrane antigen with caveolin-1 and its caveolae-dependent
internalization in microvascular endothelial cells: implications for targeting to tumor vasculature.
Microvasc Res 72: 54-61
Baba M, Osumi M, Scott SV, Klionsky DJ, Ohsumi Y (1997) Two distinct pathways for targeting
proteins from the cytoplasm to the vacuole/lysosome. J Cell Biol 139: 1687-1695
Bacich DJ, Ramadan E, O'Keefe DS, Bukhari N, Wegorzewska I, Ojeifo O, Olszewski R, Wrenn CC,
Bzdega T, Wroblewska B, Heston WD, Neale JH (2002) Deletion of the glutamate carboxypeptidase
II gene in mice reveals a second enzyme activity that hydrolyzes N-acetylaspartylglutamate. J
Neurochem 83: 20-29
Bacich DJ, Wozniak KM, Lu XC, O'Keefe DS, Callizot N, Heston WD, Slusher BS (2005) Mice
lacking glutamate carboxypeptidase II are protected from peripheral neuropathy and ischemic brain
injury. J Neurochem 95: 314-323
148
Banuelos MG, Moreno DE, Olson DK, Nguyen Q, Ricarte F, Aguilera-Sandoval CR, Gharakhanian E
(2010) Genomic analysis of severe hypersensitivity to hygromycin B reveals linkage to vacuolar
defects and new vacuolar gene functions in Saccharomyces cerevisiae. Curr Genet 56: 121-137
Barinka C, Sacha P, Sklenar J, Man P, Bezouska K, Slusher BS, Konvalinka J (2004) Identification of
the N-glycosylation sites on glutamate carboxypeptidase II necessary for proteolytic activity. Protein
Sci 13: 1627-1635
Barnhart BC, Alappat EC, Peter ME (2003) The CD95 type I/type II model. Semin Immunol 15: 185-
193
Barth H, Meiling-Wesse K, Epple UD, Thumm M (2002) Mai1p is essential for maturation of
proaminopeptidase I but not for autophagy. FEBS Lett 512: 173-179
Baxter BK, Abeliovich H, Zhang X, Stirling AG, Burlingame AL, Goldfarb DS (2005) Atg19p
ubiquitination and the cytoplasm to vacuole trafficking pathway in yeast. J Biol Chem 280: 39067-
39076
Berry D, Baehrecke E (2007) Growth arrest and autophagy are required for salivary gland cell
degradation in Drosophila. Cell 131: 1137-1148
Birnboim HC (1983) A rapid alkaline extraction method for the isolation of plasmid DNA. Methods
Enzymol 100: 243-255
Boer VM, Amini S, Botstein D (2008) Influence of genotype and nutrition on survival and
metabolism of starving yeast. Proc Natl Acad Sci U S A 105: 6930-6935
Bonangelino CJ, Chavez EM, Bonifacino JS (2002) Genomic screen for vacuolar protein sorting
genes in Saccharomyces cerevisiae. Mol Biol Cell 13: 2486-2501
Brace JL, Vanderweele DJ, Rudin CM (2005) Svf1 inhibits reactive oxygen species generation and
promotes survival under conditions of oxidative stress in Saccharomyces cerevisiae. Yeast 22: 641-
652
Brachmann CB, Davies A, Cost GJ, Caputo E, Li J, Hieter P, Boeke JD (1998) Designer deletion
strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-
mediated gene disruption and other applications. Yeast 14: 115-132
Bugnicourt A, Mari M, Reggiori F, Haguenauer-Tsapis R, Galan JM (2008) Irs4p and Tax4p: two
redundant EH domain proteins involved in autophagy. Traffic 9: 755-769
149
Bursch W, Ellinger A, Kienzl H, Torok L, Pandey S, Sikorska M, Walker R, Hermann RS (1996)
Active cell death induced by the anti-estrogens tamoxifen and ICI 164 384 in human mammary
carcinoma cells (MCF-7) in culture: the role of autophagy. Carcinogenesis 17: 1595-1607
Bush AI, Pettingell WH, Multhaup G, d Paradis M, Vonsattel JP, Gusella JF, Beyreuther K, Masters
CL, Tanzi RE (1994) Rapid induction of Alzheimer A beta amyloid formation by zinc. Science 265:
1464-1467
Butler D, Nixon RA, Bahr BA (2006) Potential compensatory responses through
autophagic/lysosomal pathways in neurodegenerative diseases. Autophagy 2: 234-237
Buttner S, Bitto A, Ring J, Augsten M, Zabrocki P, Eisenberg T, Jungwirth H, Hutter S, Carmona-
Gutierrez D, Kroemer G, Winderickx J, Madeo F (2008) Functional mitochondria are required for
alpha-synuclein toxicity in aging yeast. J Biol Chem 283: 7554-7560
Buttner S, Eisenberg T, Carmona-Gutierrez D, Ruli D, Knauer H, Ruckenstuhl C, Sigrist C, Wissing
S, Kollroser M, Frohlich KU, Sigrist S, Madeo F (2007) Endonuclease G regulates budding yeast life
and death. Molecular cell 25: 233-246
Buttner S, Ruli D, Vogtle FN, Galluzzi L, Moitzi B, Eisenberg T, Kepp O, Habernig L, Carmona-
Gutierrez D, Rockenfeller P, Laun P, Breitenbach M, Khoury C, Frohlich KU, Rechberger G,
Meisinger C, Kroemer G, Madeo F (2011) A yeast BH3-only protein mediates the mitochondrial
pathway of apoptosis. Embo J 30: 2779-2792
Büttner S, Eisenberg T, Herker E, Carmona-Gutierrez D, Kroemer G, Madeo F (2006) Why yeast
cells can undergo apoptosis: death in times of peace, love, and war. J Cell Biol 175: 521-525
Cao Y, Cheong H, Song H, Klionsky DJ (2008) In vivo reconstitution of autophagy in
Saccharomyces cerevisiae. J Cell Biol 182: 703-713
Carlson M, Osmond BC, Neigeborn L, Botstein D (1984) A suppressor of SNF1 mutations causes
constitutive high-level invertase synthesis in yeast. Genetics 107: 19-32
Carmichael J, Chatellier J, Woolfson A, Milstein C, Fersht AR, Rubinsztein DC (2000) Bacterial and
yeast chaperones reduce both aggregate formation and cell death in mammalian cell models of
Huntington's disease. Proc Natl Acad Sci U S A 97: 9701-9705
Carmona-Gutierrez D, Eisenberg T, Buttner S, Meisinger C, Kroemer G, Madeo F (2010) Apoptosis
in yeast: triggers, pathways, subroutines. Cell death and differentiation 17: 763-773
150
Carter RE, Feldman AR, Coyle JT (1996) Prostate-specific membrane antigen is a hydrolase with
substrate and pharmacologic characteristics of a neuropeptidase. Proc Natl Acad Sci U S A 93: 749-
753
Cavallini G, Donati A, Gori Z, Bergamini E (2008) Towards an understanding of the anti-aging
mechanism of caloric restriction. Curr Aging Sci 1: 4-9
Cheng EH, Wei MC, Weiler S, Flavell RA, Mak TW, Lindsten T, Korsmeyer SJ (2001) BCL-2,
BCL-X(L) sequester BH3 domain-only molecules preventing BAX- and BAK-mediated
mitochondrial apoptosis. Mol Cell 8: 705-711
Cheong H, Klionsky DJ (2008) Biochemical methods to monitor autophagy-related processes in
yeast. Methods Enzymol 451: 1-26
Chera S, Buzgariu W, Ghila L, Galliot B (2009) Autophagy in Hydra: a response to starvation and
stress in early animal evolution. Biochim Biophys Acta 1793: 1432-1443
Christiansen JJ, Rajasekaran SA, Inge L, Cheng L, Anilkumar G, Bander NH, Rajasekaran AK
(2005) N-glycosylation and microtubule integrity are involved in apical targeting of prostate-specific
membrane antigen: implications for immunotherapy. Molecular cancer therapeutics 4: 704-714
Christofferson D, Yuan J (2010) Necroptosis as an alternative form of programmed cell death.
Current Opinion in Cell Biology 22: 263-268
Clarke PG (1990) Developmental cell death: morphological diversity and multiple mechanisms. Anat
Embryol (Berl) 181: 195-213
Cohen M, Stutz F, Dargemont C (2003) Deubiquitination, a new player in Golgi to endoplasmic
reticulum retrograde transport. J Biol Chem 278: 51989-51992
Collawn JF, Lai A, Domingo D, Fitch M, Hatton S, Trowbridge IS (1993) YTRF is the conserved
internalization signal of the transferrin receptor, and a second YTRF signal at position 31-34
enhances endocytosis. J Biol Chem 268: 21686-21692
Conway RE, Petrovic N, Li Z, Heston W, Wu D, Shapiro LH (2006) Prostate-specific membrane
antigen regulates angiogenesis by modulating integrin signal transduction. Mol Cell Biol 26: 5310-
5324
Cornillon S, Foa C, Davoust J, Buonavista N, Gross JD, Golstein P (1994) Programmed cell death in
Dictyostelium. Journal of cell science 107 ( Pt 10): 2691-2704
151
Cross FR (1988) DAF1, a mutant gene affecting size control, pheromone arrest, and cell cycle
kinetics of Saccharomyces cerevisiae. Mol Cell Biol 8: 4675-4684
Cuervo AM (2010) Chaperone-mediated autophagy: selectivity pays off. Trends Endocrinol Metab
21: 142-150
Davey HM, P. H (2011) Red but not dead? Membranes of stressed Saccharomyces cerevisiae are
permeable to propidium iodide. Environ Microbiology 13: 163-171
Davis MI, Bennett MJ, Thomas LM, Bjorkman PJ (2005) Crystal structure of prostate-specific
membrane antigen, a tumor marker and peptidase. Proc Natl Acad Sci U S A 102: 5981-5986
De Duve C, Wattiaux R (1966) Functions of lysosomes. Annu Rev Physiol 28: 435-492
de la Lastra C, Villegas I, Sanchez-Fidalgo S (2007) Poly(ADP-ribose) polymerase inhibitors: New
pharmacological functions and potential clinical implications. Current Pharmaceutical Design 13:
933-962
Degterev A, Boyce M, Yuan J (2003) A decade of caspases. Oncogene 22: 8543-8567
Degterev A, Hitomi J, Germscheid M, Ch'en I, Korkina O, Teng X, Abbott D, Cuny G, Yuan C,
Wagner G, Hedrick S, Gerber S, Lugovskoy A, Yuan J (2008) Identification of RIP1 kinase as a
specific cellular target of necrostatins. Nature Chemical Biology 4: 313-321
Degterev A, Huang Z, Boyce M, Li Y, Jagtap P, Mizushima N, Cuny G, Mitchison T, Moskowitz M,
Yuan J (2005) Chemical inhibitor of nonapoptotic cell death with therapeutic potential for ischemic
brain injury. Nature Chemical Biology 1: 112-119
Degterev A, Yuan J (2008) Expansion and evolution of cell death programmes. Nat Rev Mol Cell Biol
9: 378-390
Dice JF (1982) Altered degradation of proteins microinjected into senescent human fibroblasts. J Biol
Chem 257: 14624-14627
Dubouloz F, Deloche O, Wanke V, Cameroni E, De Virgilio C (2005a) The TOR and EGO protein
complexes orchestrate microautophagy in yeast. Molecular cell 19: 15-26
Dubouloz F, Deloche O, Wanke V, Cameroni E, De Virgilio C (2005b) The TOR and EGO protein
complexes orchestrate microautophagy in yeast. Mol Cell 19: 15-26
152
Dziedzic SA, Caplan AB (2011) Identification of autophagy genes participating in zinc-induced
necrotic cell death in Saccharomyces cerevisiae. Autophagy 7: 490-500
Ecker N, Mor A, Journo D, Abeliovich H (2010) Induction of autophagic flux by amino acid
deprivation is distinct from nitrogen starvation-induced macroautophagy. Autophagy 6: 879-890
Edinger AL, Thompson CB (2004) Death by design: apoptosis, necrosis and autophagy. Curr Opin
Cell Biol 16: 663-669
Eisenberg T, Carmona-Gutierrez D, Buttner S, Tavernarakis N, Madeo F (2010a) Necrosis in yeast.
Apoptosis 15: 257-268
Eisenberg T, Carmona-Gutierrez D, Büttner S, Tavernarakis N, Madeo F (2010b) Necrosis in yeast.
Apoptosis
Eisenberg T, Knauer H, Schauer A, Buttner S, Ruckenstuhl C, Carmona-Gutierrez D, Ring J,
Schroeder S, Magnes C, Antonacci L, Fussi H, Deszcz L, Hartl R, Schraml E, Criollo A, Megalou E,
Weiskopf D, Laun P, Heeren G, Breitenbach M, Grubeck-Loebenstein B, Herker E, Fahrenkrog B,
Frohlich KU, Sinner F, Tavernarakis N, Minois N, Kroemer G, Madeo F (2009) Induction of
autophagy by spermidine promotes longevity. Nature cell biology 11: 1305-1314
Epple UD, Suriapranata I, Eskelinen EL, Thumm M (2001) Aut5/Cvt17p, a putative lipase essential
for disintegration of autophagic bodies inside the vacuole. J Bacteriol 183: 5942-5955
Fabrizio P, Longo VD (2007) The chronological life span of Saccharomyces cerevisiae. Methods Mol
Biol 371: 89-95
Farré JC, Manjithaya R, Mathewson RD, Subramani S (2008) PpAtg30 tags peroxisomes for turnover
by selective autophagy. Dev Cell 14: 365-376
Fujita N, Yoshimori T (2011) Ubiquitination-mediated autophagy against invading bacteria. Curr
Opin Cell Biol 23: 492-497
Furgason ML, MacDonald C, Shanks SG, Ryder SP, Bryant NJ, Munson M (2009) The N-terminal
peptide of the syntaxin Tlg2p modulates binding of its closed conformation to Vps45p. Proc Natl
Acad Sci U S A 106: 14303-14308
Gagne J, Hunter J, Labrecquet B, Chabot B, Poirier G (2003) A proteomic approach to the
identification of heterogeneous nuclear ribonucleoproteins as a new family of poly(ADP-ribose)-
binding proteins. Biochemical Journal 371: 331-340
153
Ghaemmaghami S, Huh WK, Bower K, Howson RW, Belle A, Dephoure N, O'Shea EK, Weissman
JS (2003) Global analysis of protein expression in yeast. Nature 425: 737-741
Ghosh A, Heston WD (2003) Effect of carbohydrate moieties on the folate hydrolysis activity of the
prostate specific membrane antigen. Prostate 57: 140-151
Ghosh A, Wang X, Klein E, Heston WD (2005) Novel role of prostate-specific membrane antigen in
suppressing prostate cancer invasiveness. Cancer Res 65: 727-731
Giansanti V, Torriglia A, Scovassi AI (2011) Conversation between apoptosis and autophagy: "Is it
your turn or mine?". Apoptosis 16: 321-333
Gietz RD, Woods RA (2006) Yeast transformation by the LiAc/SS Carrier DNA/PEG method.
Methods Mol Biol 313: 107-120
Girardi JP, Pereira L, Bakovic M (2011) De novo synthesis of phospholipids is coupled with
autophagosome formation. Med Hypotheses 77: 1083-1087
Golstein P, Kroemer G (2007) Cell death by necrosis: towards a molecular definition. Trends in
biochemical sciences 32: 37-43
Gonzalez-Polo RA, Boya P, Pauleau AL, Jalil A, Larochette N, Souquere S, Eskelinen EL, Pierron G,
Saftig P, Kroemer G (2005) The apoptosis/autophagy paradox: autophagic vacuolization before
apoptotic death. Journal of cell science 118: 3091-3102
Gonzalvez F, Ashkenazi A (2010) New insights into apoptosis signaling by Apo2L/TRAIL.
Oncogene 29: 4752-4765
Gottlicher M, Minucci S, Zhu P, Kramer OH, Schimpf A, Giavara S, Sleeman JP, Lo Coco F, Nervi
C, Pelicci PG, Heinzel T (2001) Valproic acid defines a novel class of HDAC inhibitors inducing
differentiation of transformed cells. Embo J 20: 6969-6978
Griffiths J, Barrero JM, Taylor J, Helliwell CA, Gubler F (2011) ALTERED MERISTEM
PROGRAM 1 is involved in development of seed dormancy in Arabidopsis. PLoS One 6: e20408
Grunau S, Lay D, Mindthoff S, Platta HW, Girzalsky W, Just WW, Erdmann R (2011) The
phosphoinositide 3-kinase Vps34p is required for pexophagy in Saccharomyces cerevisiae. Biochem J
434: 161-170
Hamasaki M, Noda T, Baba M, Ohsumi Y (2005) Starvation triggers the delivery of the endoplasmic
reticulum to the vacuole via autophagy in yeast. Traffic 6: 56-65
154
Hamatake M, Iguchi K, Hirano K, Ishida R (2000) Zinc induces mixed types of cell death, necrosis,
and apoptosis, in molt-4 cells. Journal of biochemistry 128: 933-939
Han L, Picker JD, Schaevitz LR, Tsai G, Feng J, Jiang Z, Chu HC, Basu AC, Berger-Sweeney J,
Coyle JT (2009) Phenotypic characterization of mice heterozygous for a null mutation of glutamate
carboxypeptidase II. Synapse 63: 625-635
Hanahan D (1983) Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166: 557-
580
Hara T, Takamura A, Kishi C, Iemura S, Natsume T, Guan JL, Mizushima N (2008) FIP200, a ULK-
interacting protein, is required for autophagosome formation in mammalian cells. J Cell Biol 181:
497-510
Harding TM, Hefner-Gravink A, Thumm M, Klionsky DJ (1996) Genetic and phenotypic overlap
between autophagy and the cytoplasm to vacuole protein targeting pathway. J Biol Chem 271: 17621-
17624
Harding TM, Morano KA, Scott SV, Klionsky DJ (1995a) Isolation and characterization of yeast
mutants in the cytoplasm to vacuole protein targeting pathway. J Cell Biol 131: 591-602
Harding TM, Morano KA, Scott SV, Klionsky DJ (1995b) Isolation and characterization of yeast
mutants in the cytoplasm to vacuole protein targeting pathway. J Cell Biol 131: 591-602
Hatsugai N, Kuroyanagi M, Yamada K, Meshi T, Tsuda S, Kondo M, Nishimura M, Hara-Nishimura
I (2004) A plant vacuolar protease, VPE, mediates virus-induced hypersensitive cell death. Science
305: 855-858
He C, Klionsky DJ (2009) Regulation mechanisms and signaling pathways of autophagy. Annu Rev
Genet 43: 67-93
He ZL, Yang XE, Stoffella PJ (2005) Trace elements in agroecosystems and impacts on the
environment. J Trace Elem Med Biol 19: 125-140
Heath MC (2000) Hypersensitive response-related death. Plant Mol Biol 44: 321-334
Hedgecock EM, Sulston JE, Thomson JN (1983) Mutations affecting programmed cell deaths in the
nematode Caenorhabditis elegans. Science 220: 1277-1279
155
Helliwell CA, Chin-Atkins AN, Wilson IW, Chapple R, Dennis ES, Chaudhury A (2001) The
Arabidopsis AMP1 gene encodes a putative glutamate carboxypeptidase. Plant Cell 13: 2115-2125
Hettema EH, Lewis MJ, Black MW, Pelham HR (2003) Retromer and the sorting nexins Snx4/41/42
mediate distinct retrieval pathways from yeast endosomes. Embo J 22: 548-557
Ho MS, Ou C, Chan YR, Chien CT, Pi H (2008) The utility F-box for protein destruction. Cell Mol
Life Sci 65: 1977-2000
Hofius D, Schultz-Larsen T, Joensen J, Tsitsigiannis DI, Petersen NH, Mattsson O, Jorgensen LB,
Jones JD, Mundy J, Petersen M (2009) Autophagic components contribute to hypersensitive cell
death in Arabidopsis. Cell 137: 773-783
Horvitz HR, Shaham S, Hengartner MO (1994) The genetics of programmed cell death in the
nematode Caenorhabditis elegans. Cold Spring Harb Symp Quant Biol 59: 377-385
Hothorn M, Neumann H, Lenherr ED, Wehner M, Rybin V, Hassa PO, Uttenweiler A, Reinhardt M,
Schmidt A, Seiler J, Ladurner AG, Herrmann C, Scheffzek K, Mayer A (2009) Catalytic core of a
membrane-associated eukaryotic polyphosphate polymerase. Science 324: 513-516
Huang D, Moffat J, Andrews B (2002) Dissection of a complex phenotype by functional genomics
reveals roles for the yeast cyclin-dependent protein kinase Pho85 in stress adaptation and cell
integrity. Mol Cell Biol 22: 5076-5088
Huang WP, Scott SV, Kim J, Klionsky DJ (2000) The itinerary of a vesicle component, Aut7p/Cvt5p,
terminates in the yeast vacuole via the autophagy/Cvt pathways. J Biol Chem 275: 5845-5851
Hutchins MU, Klionsky DJ (2001) Vacuolar localization of oligomeric alpha-mannosidase requires
the cytoplasm to vacuole targeting and autophagy pathway components in Saccharomyces cerevisiae.
J Biol Chem 276: 20491-20498
Israeli RS, Powell CT, Corr JG, Fair WR, Heston WD (1994) Expression of the prostate-specific
membrane antigen. Cancer Res 54: 1807-1811
Israeli RS, Powell CT, Fair WR, Heston WD (1993) Molecular cloning of a complementary DNA
encoding a prostate-specific membrane antigen. Cancer Res 53: 227-230
Iwata A, Christianson JC, Bucci M, Ellerby LM, Nukina N, Forno LS, Kopito RR (2005) Increased
susceptibility of cytoplasmic over nuclear polyglutamine aggregates to autophagic degradation. Proc
Natl Acad Sci U S A 102: 13135-13140
156
Jimenez-Sanchez M, Thompson F, Zavodsky E, Rubinsztein DC (2011) Autophagy and
polyglutamine diseases. Prog Neurobiol
Jin YH, Dunlap PE, McBride SJ, Al-Refai H, Bushel PR, Freedman JH (2008) Global transcriptome
and deletome profiles of yeast exposed to transition metals. PLoS genetics 4: e1000053
Johansen T, Lamark T (2011) Selective autophagy mediated by autophagic adapter proteins.
Autophagy 7: 279-296
Jorgensen P, Nishikawa JL, Breitkreutz BJ, Tyers M (2002) Systematic identification of pathways
that couple cell growth and division in yeast. Science 297: 395-400
Juhász G, Csikós G, Sinka R, Erdélyi M, Sass M (2003) The Drosophila homolog of Aut1 is essential
for autophagy and development. FEBS Lett 543: 154-158
Juhász G, Erdi B, Sass M, Neufeld TP (2007) Atg7-dependent autophagy promotes neuronal health,
stress tolerance, and longevity but is dispensable for metamorphosis in Drosophila. Genes Dev 21:
3061-3066
Jungwirth H, Ring J, Mayer T, Schauer A, Buttner S, Eisenberg T, Carmona-Gutierrez D, Kuchler K,
Madeo F (2008) Loss of peroxisome function triggers necrosis. FEBS Lett 582: 2882-2886
Kageyama T, Suzuki K, Ohsumi Y (2009) Lap3 is a selective target of autophagy in yeast,
Saccharomyces cerevisiae. Biochem Biophys Res Commun 378: 551-557
Kamada Y, Funakoshi T, Shintani T, Nagano K, Ohsumi M, Ohsumi Y (2000) Tor-mediated
induction of autophagy via an Apg1 protein kinase complex. J Cell Biol 150: 1507-1513
Kamizono A, Nishizawa M, Teranishi Y, Murata K, Kimura A (1989) Identification of a gene
conferring resistance to zinc and cadmium ions in the yeast Saccharomyces cerevisiae. Mol Gen
Genet 219: 161-167
Kang C, Avery L (2008) To be or not to be, the level of autophagy is the question: dual roles of
autophagy in the survival response to starvation. Autophagy 4: 82-84
Kanki T, Klionsky DJ (2008) Mitophagy in yeast occurs through a selective mechanism. J Biol Chem
283: 32386-32393
Kanki T, Wang K, Baba M, Bartholomew CR, Lynch-Day MA, Du Z, Geng J, Mao K, Yang Z, Yen
WL, Klionsky DJ (2009) A genomic screen for yeast mutants defective in selective mitochondria
autophagy. Mol Biol Cell 20: 4730-4738
157
Katayama H, Kogure T, Mizushima N, Yoshimori T, Miyawaki A (2011) A sensitive and quantitative
technique for detecting autophagic events based on lysosomal delivery. Chem Biol 18: 1042-1052
Kawakatsu T, Taramino G, Itoh J, Allen J, Sato Y, Hong SK, Yule R, Nagasawa N, Kojima M,
Kusaba M, Sakakibara H, Sakai H, Nagato Y (2009) PLASTOCHRON3/GOLIATH encodes a
glutamate carboxypeptidase required for proper development in rice. Plant J 58: 1028-1040
Kawamata T, Kamada Y, Kabeya Y, Sekito T, Ohsumi Y (2008) Organization of the pre-
autophagosomal structure responsible for autophagosome formation. Mol Biol Cell 19: 2039-2050
Kerr JF (1971) Shrinkage necrosis: a distinct mode of cellular death. J Pathol 105: 13-20
Kerr JF, Wyllie AH, Currie AR (1972) Apoptosis: a basic biological phenomenon with wide-ranging
implications in tissue kinetics. Br J Cancer 26: 239-257
Kim CH, Jeon HM, Lee SY, Jeong EK, Ju MK, Park BJ, Park HG, Lim SC, Han SI, Kang HS (2010)
Role of reactive oxygen species-dependent protein aggregation in metabolic stress-induced necrosis.
Int J Oncol 37: 97-102
Kim J, Huang WP, Klionsky DJ (2001a) Membrane recruitment of Aut7p in the autophagy and
cytoplasm to vacuole targeting pathways requires Aut1p, Aut2p, and the autophagy conjugation
complex. J Cell Biol 152: 51-64
Kim J, Kamada Y, Stromhaug PE, Guan J, Hefner-Gravink A, Baba M, Scott SV, Ohsumi Y, Dunn
WA, Klionsky DJ (2001b) Cvt9/Gsa9 functions in sequestering selective cytosolic cargo destined for
the vacuole. J Cell Biol 153: 381-396
Kim J, Scott SV, Oda MN, Klionsky DJ (1997a) Transport of a large oligomeric protein by the
cytoplasm to vacuole protein targeting pathway. J Cell Biol 137: 609-618
Kim J, Scott SV, Oda MN, Klionsky DJ (1997b) Transport of a large oligomeric protein by the
cytoplasm to vacuole protein targeting pathway. J Cell Biol 137: 609-618
Kirisako T, Baba M, Ishihara N, Miyazawa K, Ohsumi M, Yoshimori T, Noda T, Ohsumi Y (1999)
Formation process of autophagosome is traced with Apg8/Aut7p in yeast. J Cell Biol 147: 435-446
Kirisako T, Ichimura Y, Okada H, Kabeya Y, Mizushima N, Yoshimori T, Ohsumi M, Takao T,
Noda T, Ohsumi Y (2000) The reversible modification regulates the membrane-binding state of
Apg8/Aut7 essential for autophagy and the cytoplasm to vacuole targeting pathway. J Cell Biol 151:
263-276
158
Klionsky DJ (2005) The molecular machinery of autophagy: unanswered questions. J Cell Sci 118: 7-
18
Klionsky DJ, Codogno P, Cuervo AM, Deretic V, Elazar Z, Fueyo-Margareto J, Gewirtz DA,
Kroemer G, Levine B, Mizushima N, Rubinsztein DC, Thumm M, Tooze SA (2010) A
comprehensive glossary of autophagy-related molecules and processes. Autophagy 6
Klionsky DJ, Cueva R, Yaver DS (1992) Aminopeptidase I of Saccharomyces cerevisiae is localized
to the vacuole independent of the secretory pathway. J Cell Biol 119: 287-299
Klosinska MM, Crutchfield CA, Bradley PH, Rabinowitz JD, Broach JR (2011) Yeast cells can
access distinct quiescent states. Genes Dev 25: 336-349
Komatsu M, Ichimura Y (2010) Selective autophagy regulates various cellular functions. Genes Cells
15: 923-933
Kosta A, Roisin-Bouffay C, Luciani MF, Otto GP, Kessin RH, Golstein P (2004) Autophagy gene
disruption reveals a non-vacuolar cell death pathway in Dictyostelium. J Biol Chem 279: 48404-
48409
Kraft C, Deplazes A, Sohrmann M, Peter M (2008) Mature ribosomes are selectively degraded upon
starvation by an autophagy pathway requiring the Ubp3p/Bre5p ubiquitin protease. Nature cell
biology 10: 602-610
Kraft C, Reggiori F, Peter M (2009) Selective types of autophagy in yeast. Biochim Biophys Acta
1793: 1404-1412
Kroemer G, Galluzzi L, Vandenabeele P, Abrams J, Alnemri ES, Baehrecke EH, Blagosklonny MV,
El-Deiry WS, Golstein P, Green DR, Hengartner M, Knight RA, Kumar S, Lipton SA, Malorni W,
Nunez G, Peter ME, Tschopp J, Yuan J, Piacentini M, Zhivotovsky B, Melino G (2009)
Classification of cell death: recommendations of the Nomenclature Committee on Cell Death 2009.
Cell death and differentiation 16: 3-11
Kroemer G, Levine B (2008) Autophagic cell death: the story of a misnomer. Nat Rev Mol Cell Biol
9: 1004-1010
Kuma A, Hatano M, Matsui M, Yamamoto A, Nakaya H, Yoshimori T, Ohsumi Y, Tokuhisa T,
Mizushima N (2004) The role of autophagy during the early neonatal starvation period. Nature 432:
1032-1036
159
Kunz JB, Schwarz H, Mayer A (2004) Determination of four sequential stages during
microautophagy in vitro. J Biol Chem 279: 9987-9996
Kvam E, Goldfarb DS (2004) Nvj1p is the outer-nuclear-membrane receptor for oxysterol-binding
protein homolog Osh1p in Saccharomyces cerevisiae. J Cell Sci 117: 4959-4968
Kwon S, Cho H, Jung J, Yoshimoto K, Shirasu K, Park O (2010) The Rab GTPase RabG3b functions
in autophagy and contributes to tracheary element differentiation in Arabidopsis. Plant Journal 64:
151-164
Lambert LA (2011) Molecular evolution of the transferrin family and associated receptors. Biochim
Biophys Acta
Lambert LA, Mitchell SL (2007) Molecular evolution of the transferrin receptor/glutamate
carboxypeptidase II family. Journal of molecular evolution 64: 113-128
Lang T, Schaeffeler E, Bernreuther D, Bredschneider M, Wolf DH, Thumm M (1998) Aut2p and
Aut7p, two novel microtubule-associated proteins are essential for delivery of autophagic vesicles to
the vacuole. Embo J 17: 3597-3607
Laun P, Pichova A, Madeo F, Fuchs J, Ellinger A, Kohlwein S, Dawes I, Fröhlich KU, Breitenbach
M (2001) Aged mother cells of Saccharomyces cerevisiae show markers of oxidative stress and
apoptosis. Mol Microbiol 39: 1166-1173
Lee C, Cooksey B, Baehrecke E (2002) Steroid regulation of midgut cell death during Drosophila
development. Developmental Biology 250: 101-111
Lee CY, Baehrecke EH (2001) Steroid regulation of autophagic programmed cell death during
development. Development 128: 1443-1455
Levine B, Kroemer G (2009) Autophagy in aging, disease and death: the true identity of a cell death
impostor. Cell death and differentiation 16: 1-2
Li H, Zhu H, Xu CJ, Yuan J (1998) Cleavage of BID by caspase 8 mediates the mitochondrial
damage in the Fas pathway of apoptosis. Cell 94: 491-501
Li W, Yang Q, Mao Z (2011) Chaperone-mediated autophagy: machinery, regulation and biological
consequences. Cell Mol Life Sci 68: 749-763
Liang Q, Zhou B (2007) Copper and manganese induce yeast apoptosis via different pathways. Mol
Biol Cell 18: 4741-4749
160
Lipinski M, Zheng B, Lu T, Yan Z, Py B, Ng A, Xavier R, Li C, Yankner B, Scherzer C, Yuan J
(2010) Genome-wide analysis reveals mechanisms modulating autophagy in normal brain aging and
in Alzheimer's disease. Proceedings of the National Academy of Sciences of the United States of
America 107: 14164-14169
Liu XF, Supek F, Nelson N, Culotta VC (1997) Negative control of heavy metal uptake by the
Saccharomyces cerevisiae BSD2 gene. J Biol Chem 272: 11763-11769
Liu XH, Liu TB, Lin FC (2008) Monitoring autophagy in Magnaporthe oryzae. Methods Enzymol
451: 271-294
Luciani M, Giusti C, Harms B, Oshima Y, Kikuchi H, Kubohara Y, Golstein P (2011) Atg1 allows
second-signaled autophagic cell death in Dictyostelium. Autophagy 7: 501-508
Ludovico P, Sousa MJ, Silva MT, Leao C, Corte-Real M (2001a) Saccharomyces cerevisiae commits
to a programmed cell death process in response to acetic acid. Microbiology 147: 2409-2415
Ludovico P, Sousa MJ, Silva MT, Leão C, Côrte-Real M (2001b) Saccharomyces cerevisiae commits
to a programmed cell death process in response to acetic acid. Microbiology 147: 2409-2415
Luria SE, Adams JN, Ting RC (1960) Transduction of lactose-utilizing ability among strains of E.
coli and S. dysenteriae and the properties of the transducing phage particles. Virology 12: 348-390
Lynch-Day MA, Klionsky DJ (2010) The Cvt pathway as a model for selective autophagy. FEBS Lett
584: 1359-1366
Ma H, Kunes S, Schatz PJ, Botstein D (1987) Plasmid construction by homologous recombination in
yeast. Gene 58: 201-216
Madeo F, Frohlich E, Frohlich KU (1997a) A yeast mutant showing diagnostic markers of early and
late apoptosis. J Cell Biol 139: 729-734
Madeo F, Fröhlich E, Fröhlich KU (1997b) A yeast mutant showing diagnostic markers of early and
late apoptosis. J Cell Biol 139: 729-734
Madeo F, Fröhlich E, Ligr M, Grey M, Sigrist SJ, Wolf DH, Fröhlich KU (1999) Oxygen stress: a
regulator of apoptosis in yeast. J Cell Biol 145: 757-767
Madeo F, Fröhlich KU (2008) Apoptosis in yeast. Preface. Biochim Biophys Acta 1783: 1271
161
Madeo F, Herker E, Maldener C, Wissing S, Lachelt S, Herlan M, Fehr M, Lauber K, Sigrist SJ,
Wesselborg S, Frohlich KU (2002) A caspase-related protease regulates apoptosis in yeast. Molecular
cell 9: 911-917
Magda D, Lecane P, Wang Z, Hu W, Thiemann P, Ma X, Dranchak PK, Wang X, Lynch V, Wei W,
Csokai V, Hacia JG, Sessler JL (2008) Synthesis and anticancer properties of water-soluble zinc
ionophores. Cancer Res 68: 5318-5325
Majeski AE, Dice JF (2004) Mechanisms of chaperone-mediated autophagy. Int J Biochem Cell Biol
36: 2435-2444
Manev H, Favaron M, Guidotti A, Costa E (1989) Delayed increase of Ca2+ influx elicited by
glutamate: role in neuronal death. Mol Pharmacol 36: 106-112
Maniatis T, Fritsch E, Sambrook D (1982) Molecular cloning: a laboratory manual, New York:
Cold Spring Harbor.
Manjithaya R, Nazarko TY, Farré JC, Subramani S (2010) Molecular mechanism and physiological
role of pexophagy. FEBS Lett 584: 1367-1373
Massey AC, Kaushik S, Sovak G, Kiffin R, Cuervo AM (2006) Consequences of the selective
blockage of chaperone-mediated autophagy. Proc Natl Acad Sci U S A 103: 5805-5810
Mathew R, Kongara S, Beaudoin B, Karp C, Bray K, Degenhardt K, Chen G, Jin S, White E (2007)
Autophagy suppresses tumor progression by limiting chromosomal instability (vol 21, pg 1367,
2007). Genes & Development 21: 1701-1701
Mathew R, White E (2007) Why sick cells produce tumors: the protective role of autophagy.
Autophagy 3: 502-505
Matsumura H, Shimizu Y, Ohsawa Y, Kawahara A, Uchiyama Y, Nagata S (2000) Necrotic death
pathway in Fas receptor signaling. Journal of Cell Biology 151: 1247-1255
Matsuura A, Tsukada M, Wada Y, Ohsumi Y (1997) Apg1p, a novel protein kinase required for the
autophagic process in Saccharomyces cerevisiae. Gene 192: 245-250
Mayer A (2008) CELL-FREE RECONSTITUTION OF MICROAUTOPHAGY IN YEAST.
Autophagy: Lower Eukaryotes and Non-Mammalian Systems, Pt a 451: 151-162
162
Meiling-Wesse K, Bratsika F, Thumm M (2004) ATG23, a novel gene required for maturation of
proaminopeptidase I, but not for autophagy. FEMS Yeast Res 4: 459-465
Meiling-Wesse K, Epple UD, Krick R, Barth H, Appelles A, Voss C, Eskelinen EL, Thumm M
(2005) Trs85 (Gsg1), a component of the TRAPP complexes, is required for the organization of the
preautophagosomal structure during selective autophagy via the Cvt pathway. J Biol Chem 280:
33669-33678
Meriin AB, Zhang X, He X, Newnam GP, Chernoff YO, Sherman MY (2002) Huntington toxicity in
yeast model depends on polyglutamine aggregation mediated by a prion-like protein Rnq1. J Cell Biol
157: 997-1004
Metzstein MM, Stanfield GM, Horvitz HR (1998) Genetics of programmed cell death in C. elegans:
past, present and future. Trends Genet 14: 410-416
Micheau O, Tschopp J (2003) Induction of TNF receptor I-mediated apoptosis via two sequential
signaling complexes. Cell 114: 181-190
Mijaljica D, Prescott M, Devenish RJ (2006) Endoplasmic reticulum and Golgi complex:
Contributions to, and turnover by, autophagy. Traffic 7: 1590-1595
Mijaljica D, Prescott M, Devenish RJ (2011) Microautophagy in mammalian cells: revisiting a 40-
year-old conundrum. Autophagy 7: 673-682
Mitsui K, Nakagawa D, Nakamura M, Okamoto T, Tsurugi K (2005) Valproic acid induces apoptosis
dependent of Yca1p at concentrations that mildly affect the proliferation of yeast. FEBS Lett 579:
723-727
Miyabe S, Izawa S, Inoue Y (2001) The Zrc1 is involved in zinc transport system between vacuole
and cytosol in Saccharomyces cerevisiae. Biochem Biophys Res Commun 282: 79-83
Mizushima N, Levine B, Cuervo AM, Klionsky DJ (2008) Autophagy fights disease through cellular
self-digestion. Nature 451: 1069-1075
Mizushima N, Noda T, Yoshimori T, Tanaka Y, Ishii T, George MD, Klionsky DJ, Ohsumi M,
Ohsumi Y (1998) A protein conjugation system essential for autophagy. Nature 395: 395-398
Mohseni N, McMillan S, Chaudhary R, Mok J, Reed B (2009) Autophagy promotes caspase-
dependent cell death during Drosophila development. Autophagy 5: 329-338
163
Mortimore GE, Schworer CM (1977) Induction of autophagy by amino-acid deprivation in perfused
rat liver. Nature 270: 174-176
Moskowitz M, Lo E, Iadecola C (2010) The Science of Stroke: Mechanisms in Search of Treatments.
Neuron 67: 181-198
Muller O, Sattler T, Flotenmeyer M, Schwarz H, Plattner H, Mayer A (2000) Autophagic tubes:
Vacuolar invaginations involved in lateral membrane sorting and inverse vesicle budding. Journal of
Cell Biology 151: 519-528
Mutsuddi M, Nambu JR (1998) Neural disease: Drosophila degenerates for a good cause. Curr Biol
8: R809-811
Nargund AM, Avery SV, Houghton JE (2008) Cadmium induces a heterogeneous and caspase-
dependent apoptotic response in Saccharomyces cerevisiae. Apoptosis 13: 811-821
Nazarko TY, Farre JC, Subramani S (2009) Peroxisome size provides insights into the function of
autophagy-related proteins. Mol Biol Cell 20: 3828-3839
Neale JH, Olszewski RT, Zuo D, Janczura KJ, Profaci CP, Lavin KM, Madore JC, Bzdega T (2011)
Advances in understanding the peptide neurotransmitter NAAG and appearance of a new member of
the NAAG neuropeptide family. J Neurochem 118: 490-498
Nice DC, Sato TK, Stromhaug PE, Emr SD, Klionsky DJ (2002) Cooperative binding of the
cytoplasm to vacuole targeting pathway proteins, Cvt13 and Cvt20, to phosphatidylinositol 3-
phosphate at the pre-autophagosomal structure is required for selective autophagy. J Biol Chem 277:
30198-30207
Nicotera P, Leist M, Manzo L (1999) Neuronal cell death: a demise with different shapes. Trends
Pharmacol Sci 20: 46-51
Nicotera P, Lipton SA (1999) Excitotoxins in neuronal apoptosis and necrosis. J Cereb Blood Flow
Metab 19: 583-591
Nishida K, Kyoi S, Yamaguchi O, Sadoshima J, Otsu K (2009) The role of autophagy in the heart.
Cell death and differentiation 16: 31-38
Noda NN, Kumeta H, Nakatogawa H, Satoo K, Adachi W, Ishii J, Fujioka Y, Ohsumi Y, Inagaki F
(2008) Structural basis of target recognition by Atg8/LC3 during selective autophagy. Genes Cells
13: 1211-1218
164
Noda T, Kim J, Huang WP, Baba M, Tokunaga C, Ohsumi Y, Klionsky DJ (2000) Apg9p/Cvt7p is an
integral membrane protein required for transport vesicle formation in the Cvt and autophagy
pathways. J Cell Biol 148: 465-480
Noda T, Ohsumi Y (1998) Tor, a phosphatidylinositol kinase homologue, controls autophagy in
yeast. J Biol Chem 273: 3963-3966
Nordmann M, Cabrera M, Perz A, Brocker C, Ostrowicz C, Engelbrecht-Vandre S, Ungermann C
(2010a) The Mon1-Ccz1 complex is the GEF of the late endosomal Rab7 homolog Ypt7. Curr Biol
20: 1654-1659
Nordmann M, Cabrera M, Perz A, Bröcker C, Ostrowicz C, Engelbrecht-Vandré S, Ungermann C
(2010b) The Mon1-Ccz1 complex is the GEF of the late endosomal Rab7 homolog Ypt7. Curr Biol
20: 1654-1659
NOVIKOFF AB, ESSNER E, QUINTANA N (1964) GOLGI APPARATUS AND LYSOSOMES.
Fed Proc 23: 1010-1022
Nussenbaum F, Herman IM (2010) Tumor angiogenesis: insights and innovations. J Oncol 2010:
132641
Oei S, Keil C, Ziegler M (2005) Poly(ADP-ribosylation) and genomic stability. Biochemistry and
Cell Biology-Biochimie Et Biologie Cellulaire 83: 263-269
Okamoto K, Kondo-Okamoto N, Ohsumi Y (2009) Mitochondria-anchored receptor Atg32 mediates
degradation of mitochondria via selective autophagy. Dev Cell 17: 87-97
Orenstein SJ, Cuervo AM (2010) Chaperone-mediated autophagy: molecular mechanisms and
physiological relevance. Semin Cell Dev Biol 21: 719-726
Ossareh-Nazari B, Bonizec M, Cohen M, Dokudovskaya S, Delalande F, Schaeffer C, Van Dorsselaer
A, Dargemont C (2010) Cdc48 and Ufd3, new partners of the ubiquitin protease Ubp3, are required
for ribophagy. EMBO Rep 11: 548-554
Pagani MA, Casamayor A, Serrano R, Atrian S, Arino J (2007) Disruption of iron homeostasis in
Saccharomyces cerevisiae by high zinc levels: a genome-wide study. Mol Microbiol 65: 521-537
Page N, Sheraton J, Brown JL, Stewart RC, Bussey H (1996) Identification of ASK10 as a multicopy
activator of Skn7p-dependent transcription of a HIS3 reporter gene. Yeast 12: 267-272
165
Pankiv S, Clausen TH, Lamark T, Brech A, Bruun JA, Outzen H, Øvervatn A, Bjørkøy G, Johansen
T (2007) p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein
aggregates by autophagy. J Biol Chem 282: 24131-24145
Petranovic D, Tyo K, Vemuri GN, Nielsen J (2010) Prospects of yeast systems biology for human
health: integrating lipid, protein and energy metabolism. FEMS Yeast Res 10: 1046-1059
Pinto JT, Suffoletto BP, Berzin TM, Qiao CH, Lin S, Tong WP, May F, Mukherjee B, Heston WD
(1996) Prostate-specific membrane antigen: a novel folate hydrolase in human prostatic carcinoma
cells. Clin Cancer Res 2: 1445-1451
Polcic P, Forte M (2003) Response of yeast to the regulated expression of proteins in the Bcl-2
family. Biochem J 374: 393-402
Polupanov AS, Nazarko VY, Sibirny AA (2011) CCZ1, MON1 and YPT7 genes are involved in
pexophagy, the Cvt pathway and non-specific macroautophagy in the methylotrophic yeast Pichia
pastoris. Cell Biol Int 35: 311-319
Price DL, Sisodia SS, Borchelt DR (1998) Genetic neurodegenerative diseases: the human illness and
transgenic models. Science 282: 1079-1083
Prick T, Thumm M, Kohrer K, Haussinger D, Vom Dahl S (2006) In yeast, loss of Hog1 leads to
osmosensitivity of autophagy. Biochem J 394: 153-161
Puchkov EO (2010) Brownian motion of polyphosphate complexes in yeast vacuoles:
characterization by fluorescence microscopy with image analysis. Yeast 27: 309-315
Qu X, Yu J, Bhagat G, Furuya N, Hibshoosh H, Troxel A, Rosen J, Eskelinen E, Mizushima N,
Ohsumi Y, Cattoretti G, Levine B (2003) Promotion of tumorigenesis by heterozygous disruption of
the beclin 1 autophagy gene. Journal of Clinical Investigation 112: 1809-1820
Rajasekaran AK, Anilkumar G, Christiansen JJ (2005) Is prostate-specific membrane antigen a
multifunctional protein? Am J Physiol Cell Physiol 288: C975-981
Rajasekaran SA, Christiansen JJ, Schmid I, Oshima E, Ryazantsev S, Sakamoto K, Weinstein J, Rao
NP, Rajasekaran AK (2008) Prostate-specific membrane antigen associates with anaphase-promoting
complex and induces chromosomal instability. Molecular cancer therapeutics 7: 2142-2151
Ramer SW, Elledge SJ, Davis RW (1992) Dominant genetics using a yeast genomic library under the
control of a strong inducible promoter. Proc Natl Acad Sci U S A 89: 11589-11593
166
Ravikumar B, Vacher C, Berger Z, Davies J, Luo S, Oroz L, Scaravilli F, Easton D, Duden R, O'Kane
C, Rubinsztein D (2004) Inhibition of mTOR induces autophagy and reduces toxicity of
polyglutamine expansions in fly and mouse models of Huntington disease. Nature Genetics 36: 585-
595
Reddig PJ, Juliano RL (2005) Clinging to life: cell to matrix adhesion and cell survival. Cancer
Metastasis Rev 24: 425-439
Reed SI, Wittenberg C (1990) Mitotic role for the Cdc28 protein kinase of Saccharomyces cerevisiae.
Proc Natl Acad Sci U S A 87: 5697-5701
Reggiori F, Pelham HR (2002) A transmembrane ubiquitin ligase required to sort membrane proteins
into multivesicular bodies. Nature cell biology 4: 117-123
Richman TJ, Johnson DI (2000) Saccharomyces cerevisiae cdc42p GTPase is involved in preventing
the recurrence of bud emergence during the cell cycle. Mol Cell Biol 20: 8548-8559
Roberts P, Moshitch-Moshkovitz S, Kvam E, O'Toole E, Winey M, Goldfarb DS (2003) Piecemeal
microautophagy of nucleus in Saccharomyces cerevisiae. Mol Biol Cell 14: 129-141
Robinson JS, Klionsky DJ, Banta LM, Emr SD (1988) Protein sorting in Saccharomyces cerevisiae:
isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol
Cell Biol 8: 4936-4948
Rosado CJ, Mijaljica D, Hatzinisiriou I, Prescott M, Devenish RJ (2008) Rosella: a fluorescent pH-
biosensor for reporting vacuolar turnover of cytosol and organelles in yeast. Autophagy 4: 205-213
Rouleau M, Patel A, Hendzel MJ, Kaufmann SH, Poirier GG (2010) PARP inhibition: PARP1 and
beyond. Nat Rev Cancer 10: 293-301
Russell P, Moreno S, Reed SI (1989) Conservation of mitotic controls in fission and budding yeasts.
Cell 57: 295-303
Saibo NJ, Vriezen WH, De Grauwe L, Azmi A, Prinsen E, Van der Straeten D (2007) A comparative
analysis of the Arabidopsis mutant amp1-1 and a novel weak amp1 allele reveals new functions of the
AMP1 protein. Planta 225: 831-842
Samara C, Syntichaki P, Tavernarakis N (2008) Autophagy is required for necrotic cell death in
Caenorhabditis elegans. Cell death and differentiation 15: 105-112
167
Sambade M, Alba M, Smardon AM, West RW, Kane PM (2005) A genomic screen for yeast vacuolar
membrane ATPase mutants. Genetics 170: 1539-1551
Sarkar S, Ravikumar B, Floto RA, Rubinsztein DC (2009) Rapamycin and mTOR-independent
autophagy inducers ameliorate toxicity of polyglutamine-expanded huntingtin and related
proteinopathies. Cell death and differentiation 16: 46-56
Sarry JE, Chen S, Collum RP, Liang S, Peng M, Lang A, Naumann B, Dzierszinski F, Yuan CX,
Hippler M, Rea PA (2007) Analysis of the vacuolar luminal proteome of Saccharomyces cerevisiae.
FEBS J 274: 4287-4305
Sattler T, Mayer A (2000) Cell-free reconstitution of microautophagic vacuole invagination and
vesicle formation. Journal of Cell Biology 151: 529-538
Sazer S, Sherwood SW (1990) Mitochondrial growth and DNA synthesis occur in the absence of
nuclear DNA replication in fission yeast. J Cell Sci 97 ( Pt 3): 509-516
Schroder LA, Ortiz MV, Dunn WA (2008) The membrane dynamics of pexophagy are influenced by
Sar1p in Pichia pastoris. Mol Biol Cell 19: 4888-4899
Schulke N, Varlamova OA, Donovan GP, Ma D, Gardner JP, Morrissey DM, Arrigale RR, Zhan C,
Chodera AJ, Surowitz KG, Maddon PJ, Heston WD, Olson WC (2003) The homodimer of prostate-
specific membrane antigen is a functional target for cancer therapy. Proc Natl Acad Sci U S A 100:
12590-12595
Schulze-Osthoff K, Ferrari D, Los M, Wesselborg S, Peter ME (1998) Apoptosis signaling by death
receptors. Eur J Biochem 254: 439-459
SCHWEICH.JU, MERKER H (1973) MORPHOLOGY OF VARIOUS TYPES OF CELL DEATH
IN PRENATAL TISSUES. Teratology 7: 253-266
Schweichel JU, Merker HJ (1973) The morphology of various types of cell death in prenatal tissues.
Teratology 7: 253-266
Schworer CM, Mortimore GE (1979) Glucagon-induced autophagy and proteolysis in rat liver:
mediation by selective deprivation of intracellular amino acids. Proc Natl Acad Sci U S A 76: 3169-
3173
Scorrano L, Korsmeyer SJ (2003) Mechanisms of cytochrome c release by proapoptotic BCL-2
family members. Biochem Biophys Res Commun 304: 437-444
168
Scott RC, Juhász G, Neufeld TP (2007) Direct induction of autophagy by Atg1 inhibits cell growth
and induces apoptotic cell death. Curr Biol 17: 1-11
Scott SV, Guan J, Hutchins MU, Kim J, Klionsky DJ (2001) Cvt19 is a receptor for the cytoplasm-to-
vacuole targeting pathway. Mol Cell 7: 1131-1141
Scott SV, Hefner-Gravink A, Morano KA, Noda T, Ohsumi Y, Klionsky DJ (1996) Cytoplasm-to-
vacuole targeting and autophagy employ the same machinery to deliver proteins to the yeast vacuole.
Proc Natl Acad Sci U S A 93: 12304-12308
Sheen JH, Zoncu R, Kim D, Sabatini DM (2011) Defective regulation of autophagy upon leucine
deprivation reveals a targetable liability of human melanoma cells in vitro and in vivo. Cancer Cell
19: 613-628
Shen H, Codogno P (2011) Autophagic cell death Loch Ness monster or endangered species?
Autophagy 7: 457-465
Shen S, Kepp O, Kroemer G. (2011a) The end of autophagic cell death? Autophagy, Vol. 7.
Shen S, Kepp O, Michaud M, Martins I, Minoux H, Métivier D, Maiuri MC, Kroemer RT, Kroemer
G (2011b) Association and dissociation of autophagy, apoptosis and necrosis by systematic chemical
study. Oncogene 30: 4544-4556
Shimizu S, Kanaseki T, Mizushima N, Mizuta T, Arakawa-Kobayashi S, Thompson C, Tsujimoto Y
(2004) Role of Bcl-2 family proteins in a non-apoptotic programmed cell death dependent on
autophagy genes. Nature Cell Biology 6: 1221-1228
Shin DM, Jeon BY, Lee HM, Jin HS, Yuk JM, Song CH, Lee SH, Lee ZW, Cho SN, Kim JM,
Friedman RL, Jo EK (2010) Mycobacterium tuberculosis eis regulates autophagy, inflammation, and
cell death through redox-dependent signaling. PLoS Pathog 6: e1001230
Shintani T, Huang WP, Stromhaug PE, Klionsky DJ (2002) Mechanism of cargo selection in the
cytoplasm to vacuole targeting pathway. Developmental cell 3: 825-837
Silver DA, Pellicer I, Fair WR, Heston WD, Cordon-Cardo C (1997) Prostate-specific membrane
antigen expression in normal and malignant human tissues. Clin Cancer Res 3: 81-85
Simonsen A, Cumming RC, Brech A, Isakson P, Schubert DR, Finley KD (2008) Promoting basal
levels of autophagy in the nervous system enhances longevity and oxidant resistance in adult
Drosophila. Autophagy 4: 176-184
169
Smets B, Ghillebert R, De Snijder P, Binda M, Swinnen E, De Virgilio C, Winderickx J (2010) Life
in the midst of scarcity: adaptations to nutrient availability in Saccharomyces cerevisiae. Curr Genet
56: 1-32
Stimpson HE, Lewis MJ, Pelham HR (2006) Transferrin receptor-like proteins control the
degradation of a yeast metal transporter. Embo J 25: 662-672
Suzuki K, Kamada Y, Ohsumi Y (2002) Studies of cargo delivery to the vacuole mediated by
autophagosomes in Saccharomyces cerevisiae. Developmental cell 3: 815-824
Suzuki K, Kirisako T, Kamada Y, Mizushima N, Noda T, Ohsumi Y (2001) The pre-autophagosomal
structure organized by concerted functions of APG genes is essential for autophagosome formation.
Embo J 20: 5971-5981
Suzuki K, Kondo C, Morimoto M, Ohsumi Y (2010) Selective transport of alpha-mannosidase by
autophagic pathways: identification of a novel receptor, Atg34p. J Biol Chem 285: 30019-30025
Suzuki M, Latshaw S, Sato Y, Settles AM, Koch KE, Hannah LC, Kojima M, Sakakibara H, McCarty
DR (2008) The Maize Viviparous8 locus, encoding a putative ALTERED MERISTEM
PROGRAM1-like peptidase, regulates abscisic acid accumulation and coordinates embryo and
endosperm development. Plant Physiol 146: 1193-1206
Sweat SD, Pacelli A, Murphy GP, Bostwick DG (1998) Prostate-specific membrane antigen
expression is greatest in prostate adenocarcinoma and lymph node metastases. Urology 52: 637-640
Takeshige K, Baba M, Tsuboi S, Noda T, Ohsumi Y (1992a) Autophagy in yeast demonstrated with
proteinase-deficient mutants and conditions for its induction. J Cell Biol 119: 301-311
Takeshige K, Baba M, Tsuboi S, Noda T, Ohsumi Y (1992b) Autophagy in yeast demonstrated with
proteinase-deficient mutants and conditions for its induction. J Cell Biol 119: 301-311
Tang F, Watkins JW, Bermudez M, Gray R, Gaban A, Portie K, Grace S, Kleve M, Craciun G (2008)
A life-span extending form of autophagy employs the vacuole-vacuole fusion machinery. Autophagy
4: 874-886
te Welscher YM, Jones L, van Leeuwen MR, Dijksterhuis J, de Kruijff B, Eitzen G, Breukink E
(2010) Natamycin inhibits vacuole fusion at the priming phase via a specific interaction with
ergosterol. Antimicrob Agents Chemother 54: 2618-2625
Temkin V, Huang Q, Liu H, Osada H, Pope R (2006) Inhibition of ADP/ATP exchange in receptor-
interacting protein-mediated necrosis. Molecular and Cellular Biology 26: 2215-2225
170
Teng X, Degterev A, Jagtap P, Xing X, Choi S, Denu R, Yuan J, Cuny G (2005) Structure-activity
relationship study of novel necroptosis inhibitors. Bioorganic & Medicinal Chemistry Letters 15:
5039-5044
Thorburn A (2011) I think autophagy controls the death of my cells: what do I do to get my paper
published? Autophagy 7: 455-456
Tinoco AD, Peterson CW, Lucchese B, Doyle RP, Valentine AM (2008) On the evolutionary
significance and metal-binding characteristics of a monolobal transferrin from Ciona intestinalis.
Proc Natl Acad Sci U S A 105: 3268-3273
Trumbly RJ, Bradley G (1983) Isolation and characterization of aminopeptidase mutants of
Saccharomyces cerevisiae. J Bacteriol 156: 36-48
Tsai G, Dunham KS, Drager U, Grier A, Anderson C, Collura J, Coyle JT (2003) Early embryonic
death of glutamate carboxypeptidase II (NAALADase) homozygous mutants. Synapse 50: 285-292
Tsukada M, Ohsumi Y (1993a) Isolation and characterization of autophagy-defective mutants of
Saccharomyces cerevisiae. FEBS Lett 333: 169-174
Tsukada M, Ohsumi Y (1993b) Isolation and characterization of autophagy-defective mutants of
Saccharomyces cerevisiae. FEBS Lett 333: 169-174
Uttenweiler A, Schwarz H, Mayer A (2005) Microautophagic vacuole invagination requires
calmodulin in a Ca2+-independent function. J Biol Chem 280: 33289-33297
van der Vaart A, Mari M, Reggiori F (2008) A picky eater: exploring the mechanisms of selective
autophagy in human pathologies. Traffic (Copenhagen, Denmark) 9: 281-289
van Doorn WG, Beers EP, Dangl JL, Franklin-Tong VE, Gallois P, Hara-Nishimura I, Jones AM,
Kawai-Yamada M, Lam E, Mundy J, Mur LA, Petersen M, Smertenko A, Taliansky M, Van
Breusegem F, Wolpert T, Woltering E, Zhivotovsky B, Bozhkov PV (2011) Morphological
classification of plant cell deaths. Cell Death Differ 18: 1241-1246
Vander Heiden MG, Choy JS, VanderWeele DJ, Brace JL, Harris MH, Bauer DE, Prange B, Kron SJ,
Thompson CB, Rudin CM (2002) Bcl-x(L) complements Saccharomyces cerevisiae genes that
facilitate the switch from glycolytic to oxidative metabolism. J Biol Chem 277: 44870-44876
Vercammen D, Brouckaert G, Denecker G, Van de Craen M, Declercq W, Fiers W, Vandenabeele P
(1998) Dual signaling of the Fas receptor: Initiation of both apoptotic and necrotic cell death
pathways. Journal of Experimental Medicine 188: 919-930
171
Vida TA, Emr SD (1995) A new vital stain for visualizing vacuolar membrane dynamics and
endocytosis in yeast. J Cell Biol 128: 779-792
Vida TA, Huyer G, Emr SD (1993) Yeast vacuolar proenzymes are sorted in the late Golgi complex
and transported to the vacuole via a prevacuolar endosome-like compartment. J Cell Biol 121: 1245-
1256
Vidaurre DP, Ploense S, Krogan NT, Berleth T (2007) AMP1 and MP antagonistically regulate
embryo and meristem development in Arabidopsis. Development (Cambridge, England) 134: 2561-
2567
Vincent RD, Hofmann TJ, Zassenhaus HP (1988) Sequence and expression of NUC1, the gene
encoding the mitochondrial nuclease in Saccharomyces cerevisiae. Nucleic acids research 16: 3297-
3312
Walker NI, Harmon BV, Gobé GC, Kerr JF (1988) Patterns of cell death. Methods Achiev Exp Pathol
13: 18-54
Walters RH, Murphy RM (2009) Examining polyglutamine peptide length: a connection between
collapsed conformations and increased aggregation. J Mol Biol 393: 978-992
Wang CW, Stromhaug PE, Kauffman EJ, Weisman LS, Klionsky DJ (2003) Yeast homotypic
vacuole fusion requires the Ccz1-Mon1 complex during the tethering/docking stage. J Cell Biol 163:
973-985
Wang CW, Stromhaug PE, Shima J, Klionsky DJ (2002a) The Ccz1-Mon1 protein complex is
required for the late step of multiple vacuole delivery pathways. J Biol Chem 277: 47917-47927
Wang CW, Stromhaug PE, Shima J, Klionsky DJ (2002b) The Ccz1-Mon1 protein complex is
required for the late step of multiple vacuole delivery pathways. J Biol Chem 277: 47917-47927
Wang YX, Zhao H, Harding TM, Gomes de Mesquita DS, Woldringh CL, Klionsky DJ, Munn AL,
Weisman LS (1996) Multiple classes of yeast mutants are defective in vacuole partitioning yet target
vacuole proteins correctly. Mol Biol Cell 7: 1375-1389
Wichmann H, Hengst L, Gallwitz D (1992) Endocytosis in yeast: evidence for the involvement of a
small GTP-binding protein (Ypt7p). Cell 71: 1131-1142
Willingham S, Outeiro TF, DeVit MJ, Lindquist SL, Muchowski PJ (2003) Yeast genes that enhance
the toxicity of a mutant huntingtin fragment or alpha-synuclein. Science 302: 1769-1772
172
Wissing S, Ludovico P, Herker E, Buttner S, Engelhardt SM, Decker T, Link A, Proksch A,
Rodrigues F, Corte-Real M, Frohlich KU, Manns J, Cande C, Sigrist SJ, Kroemer G, Madeo F (2004)
An AIF orthologue regulates apoptosis in yeast. J Cell Biol 166: 969-974
Wolter KG, Hsu YT, Smith CL, Nechushtan A, Xi XG, Youle RJ (1997) Movement of Bax from the
cytosol to mitochondria during apoptosis. J Cell Biol 139: 1281-1292
Wyllie AH (1980) Glucocorticoid-induced thymocyte apoptosis is associated with endogenous
endonuclease activation. Nature 284: 555-556
Xie Z, Klionsky DJ (2007) Autophagosome formation: core machinery and adaptations. Nature cell
biology 9: 1102-1109
Xie Z, Nair U, Klionsky DJ (2008) Dissecting autophagosome formation: the missing pieces.
Autophagy 4: 920-922
Yang Z, Huang J, Geng J, Nair U, Klionsky DJ (2006) Atg22 recycles amino acids to link the
degradative and recycling functions of autophagy. Mol Biol Cell 17: 5094-5104
Yang Z, Klionsky DJ (2007) Permeases recycle amino acids resulting from autophagy. Autophagy 3:
149-150
Yorimitsu T, Klionsky DJ (2005) Atg11 links cargo to the vesicle-forming machinery in the
cytoplasm to vacuole targeting pathway. Mol Biol Cell 16: 1593-1605
Yoshimoto K (2010) Physiological roles of autophagy in plants: Does plant autophagy have a pro-
death function? Plant Signal Behav 5
Youle RJ, Strasser A (2008) The BCL-2 protein family: opposing activities that mediate cell death.
Nat Rev Mol Cell Biol 9: 47-59
Yu L, Alva A, Su H, Dutt P, Freundt E, Welsh S, Baehrecke E, Lenardo M (2004) Regulation of an
ATG7-beclin 1 program of autophagic cell death by caspase-8. Science 304: 1500-1502
Yu L, Wan F, Dutta S, Welsh S, Liu Z, Freundt E, Baehrecke EH, Lenardo M (2006a) Autophagic
programmed cell death by selective catalase degradation. Proc Natl Acad Sci U S A 103: 4952-4957
Yu S, Andrabi S, Wang H, Kim N, Poirier G, Dawson T, Dawson V (2006b) Apoptosis-inducing
factor mediates poly(ADP-ribose) (PAR) polymer-induced cell death. Proceedings of the National
Academy of Sciences of the United States of America 103: 18314-18319
173
Yu S, Baek S, Brennan R, Bradley C, Park S, Lee Y, Jun E, Lookingland K, Kim E, Lee H, Goudreau
J, Kim S (2008) Autophagic Death of Adult Hippocampal Neural Stem Cells Following Insulin
Withdrawal. Stem Cells 26: 2602-2610
Zaremba T, Thomas H, Cole M, Plummer E, Curtin N (2010) Doxorubicin-induced suppression of
poly(ADP-ribose) polymerase-1 (PARP-1) activity and expression and its implication for PARP
inhibitors in clinical trials. Cancer Chemotherapy and Pharmacology 66: 807-812
Zaworski PG, Gill GS (1988) Precipitation and recovery of proteins from culture supernatants using
zinc. Anal Biochem 173: 440-444
Zong W, Ditsworth D, Bauer D, Wang Z, Thompson C (2004) Alkylating DNA damage stimulates a
regulated form of necrotic cell death. Genes & Development 18: 1272-1282
Zong WX, Lindsten T, Ross AJ, MacGregor GR, Thompson CB (2001) BH3-only proteins that bind
pro-survival Bcl-2 family members fail to induce apoptosis in the absence of Bax and Bak. Genes
Dev 15: 1481-1486
Zong WX, Thompson CB (2006) Necrotic death as a cell fate. Genes Dev 20: 1-15
![e Governance%5B1%5D%5B1%5D[1]](https://img.dokumen.tips/doc/110x75/577d33c21a28ab3a6b8ba828/e-governance5b15d5b15d1.jpg)
![Diverticulosis%5B1%5D %5BAutosaved%5D[1]](https://img.dokumen.tips/doc/110x75/577d38db1a28ab3a6b989f85/diverticulosis5b15d-5bautosaved5d1.jpg)
