DUPLICATION AND POLYMORPHISM WITH PARTICULAR REFERENCE … · DUPLICATION AND POLYMORPHISM WITH PARTICULAR REFERENCE TO REGULATORS OF COMPLEMENT ACTIVATION By Craig Anthony McLure

- 1 -

DUPLICATION AND POLYMORPHISM WITH

PARTICULAR REFERENCE TO REGULATORS

OF COMPLEMENT ACTIVATION

By

Craig Anthony McLure

BSc (Molecular Genetics)

A thesis submitted to the University of Western Australia for the

degree of Doctor of Philosophy

Centre for Molecular Immunology and Instrumentation

2005

- 2 -

- 3 -

DEDICATION

This thesis is dedicated to my parents John and Helen.

- 4 -

- 5 -

SUMMARY

For the convenience of the reader, detailed figures and tables have been enlarged and

compiled in Appendix 2, at the end of this thesis.

This thesis is presented as an approach to identify, annotate and detect genomic

duplication and polymorphism within large genomic regions. To demonstrate this, I

have used as a model, the genomic region known as the Regulators of Complement

Activation (RCA).

The RCA complex is located on the long arm of chromosome 1 at position 1q32 and is a

reservoir of complement regulatory proteins. The genes of the RCA share many

similarities implying that all have arisen through multiple complex duplication events.

My analysis of this region in the following chapters demonstrates the complexity of this

duplication and identifies the many functional units within the RCA.

It was my aim at the beginning of these studies to demonstrate an approach that could

define the Ancestral Haplotypes (AHs) of the RCA gene cluster. To do this, extensive

genomic analysis was required and the ever-increasing availability of genomic sequence

has made this thesis possible. Each of the chapters serves to address the following aims

set out at the beginning of this thesis:

1. Further characterise the relationship between the genes (Complement Control

proteins-CCPs) and domains of the Regulators of Complement Activation

(RCA).

2. Identify and examine the duplicated elements within the RCA.

- 6 -

3. Examine the effects of retroviruses and other insertions and deletions (indels) in

generating the divergence of duplicated genes.

4. Investigate the applicability of the Genomic Matching Technique (GMT) to

define AH within the region.

5. Examine association of AHs with CCP implicated diseases.

6. Determine the GMT applicability in non-human species.

In addressing the aims listed above, the following observations were made:

1. Short Consensus Repeats (SCRs) from all human and non-human CCPs can be

broadly classified as belonging to one of eleven subfamilies “a,b,c,d,e,f,g,h,i,j &

k” (Chapter 1 & 3).

2. Subfamilies patterns are maintained throughout CCPs. (Chapter 1, 2 & 3).

3. The association of particular subfamilies forms the functional domains. (Chapter

1, 2 & 3).

a. “ajef”- recognition, “bkd” - function & “ch”- membrane attachment.

4. Complement Receptor 1-like (CR1L) genomic sequence contains at least 5

additional, unreported SCRs (e, f, b, k, d). Chapter 1.

5. Primate Complement Receptor 1 (CR1) and CR1L contain a duplication of eight

rather than seven SCRs (Chapter 2).

a. Discovery of the genomic remnants from twelve previously unidentified

SCRs in human and chimpanzee CR1 and CR1L.

6. CR1 and Complement Receptor 2 (CR2) share an additional set. (Chapter 2).

a. “dg” or “dg-like”

7. The differences between CR1 and CR1L are explained by many complex

duplications, retroviral insertions and SCR deletion. (Chapter 1 and 3).

8. Species have evolved by duplicating critical functional domains (Chapter 3).

- 7 -

9. Divergence of duplicated domains adds complexity and functionality (Chapter

3).

10. The GMT can identify genomic polymorphism in the RCA alpha block

(CR1/MCP duplicons), (Chapter 4).

11. RCA alpha block profiles segregate through 3-generations. (Chapter 4).

12. CR1 and CR1L polymorphic amplicons confirmed by sequencing. (Chapter 4).

13. There are at least 20 distinct ancestral haplotypes for the RCA alpha block.

(Chapter 4).

14. Frequency distribution of AHs CR1.02 and CR1.08 differ in Recurrent

Spontaneous Abortion (RSA) and Psoriasis Vulgaris (PV).

15. The GMT is applicable to the DQ alpha and beta genes of the canine MHC and

appear promising in determining parentage, AHs and disease association

(Chapter 5).

This thesis consists of six chapters, each containing a manuscript, which has been

published in, submitted to, or in preparation for an international, peer-reviewed journal.

Each chapter is preceded by an introduction, which serves to link the chapters together

and acknowledge the specific contributions by co-authors and colleagues.

- 8 -

- 9 -

TABLE OF CONTENTS

TITLE 1

DEDICATION 2

SUMMARY 3

TABLE OF CONTENTS 9

ACKNOWLEDGEMENTS 15

PUBLICATIONS ARISING FROM THIS THESIS 17

DECLARATION 19

ABBREVIATIONS 21

GLOSSARY 25

INTRODUCTION 31

1. Evolution and Diversity

2. The Human Major Histocompatability Complex (MHC),

Polymorphic Frozen Blocks (PFBs) and Ancestral

Haplotypes (AHs).

2.1. MHC Polymorphism and PFBs

2.2. MHC AHs

3. Identifying MHC AHs using Haplospecific Features

3.1. The Genomic Matching Technique (GMT)

3.2. Haplospecific Profiles through Electrophoretic Separation of

Amplicons

3.3. Applications of the Block Profiles and Advantages over

Conventional Sequence Based Typing (SBT)

31

32

33

- 10 -

4. The Regulators of Complement Activation (RCA)

4.1. Complement Control Proteins (CCPs)

4.2. Short Consensus Repeats (SCRs)

4.3. SCR combinations of CCP functional domains and their

regulatory mechanisms

4.4. Evolution of the CCPs and SCRs

4.5. PFBs within the RCA

4.5.1. Frozen Blocks

4.5.2. RCA Polymorphism

4.6. RCA disease associations and pathogen interactions

4.6.1. Complement related disease

4.6.2. Pathogen Interactions

5. Major Discoveries

5.1. Evolution of the SCRs and CCPs

5.2. Diversity of duplication – Monomers, Tetramers, Octamers and

Segments

5.2.1. SCR Subfamilies – The monomers

5.2.2. Subfamily relationships – Dimers, Tetramers and Octomers

5.2.3. Segmental Duplications

5.3. Degeneration

5.3.1. Genomic analysis reveals five highly conserved, apparently

untranscribed SCRs of CR1L (Chapter 1)

5.3.2. Genomic analysis reveals a duplication of eight rather than

seven SCRs in primate CR1 and CR1L: evidence for an

additional degenerate subfamily. (Chapter 2)

35

46

- 11 -

5.4. Human CR1: A model for CCP evolution

5.5. Divergence – RCA Polymorphism

5.5.1. Single Nucleotide Polymorphisms

5.5.2. Conserved subfamily motifs define the critical SNPs of CR1

5.5.3. SNP Haplotypes

5.5.4. Genomic Matching Technique (GMT) haplotypes

5.5.5. Sequencing Results

6. Other Observations

6.1. DLA DQ and DR Typing in the Canine

6.2. Other Projects

53

CHAPTERS 57

PRELUDE TO CHAPTER 1 59

CHAPTER 1

MS 0014 – McLure, C., R. Dawkins, J.

Williamson, R. Davies, J. Berry, N. Longman-

Jacobsen, R. Laird and S. Gaudieri (2004). "Amino

acid patterns within short consensus repeats define

conserved duplicons shared by genes of the RCA

complex." Journal of Molecular Evolution 59(2):

143-157.

61


CHAPTER 2 MS 0406 – McLure, C., J. Williamson, B. Stewart,

P. Keating and R. Dawkins (2004). "Genomic

analysis reveals a duplication of eight rather than

seven SCRs in Primate CR1 and CR1L: Evidence

81

- 12 -

for an additional set shared between CR1 and CR2."

Immunogenetics 56(9): 631-638.


CHAPTER 3 MS 0402 – McLure, C., J. Williamson, B. Stewart,

P. Keating and R. Dawkins (2005). "Indels and

imperfect duplication have driven the evolution of

human CR1 and CR1-like from their precursor CR1

alpha: Importance of functional sets." Hum

Immunol 66(3): 258-273.

93


CHAPTER 4 MS 0408 - McLure, C., J. Williamson, L. Smyth,

S. Agrawal, S. Lester, J. Millman, P. Keating, B.

Stewart, and R. Dawkins (In Press). "Extensive

genomic polymorphism of the CR1 region: RCA

ancestral haplotypes, function and disease"

Immunogenetics

113


CHAPTER 5 MS 0504 - McLure, C., P. Kesners, S. Lester,

D.Male, C. Amadou, J. Dawkins, B. Stewart, J.

Williamson and R. Dawkins. (In Press).

"Haplotyping of the canine MHC without the need

for DLA typing". Intl J. Immunogenetics

147


CHAPTER 6 MS 0507 - McLure, C., J. Dawkins, B. Stewart,

and R. Dawkins. (In preparation). "Identification of

169

- 13 -

traits and function in livestock by genomic

matching: Genetically determining homozygous and

heterozygous polled cattle".

CONCLUSIONS AND FUTURE DIRECTIONS 183

APPENDICES 189

APPENDIX 1 Sequences submitted to Genbank 191

APPENDIX 2 Enlarged Figures And Tables 217 Chapter 1 – MS0014 Figures And Tables 219

Figure 1- Characteristic amino acid patterns of

eleven SCR groups

Chapter 2 – MS406 Figures And Tables 223 Figure 1 - Relationship of additional SCRs.

Chapter 3 – MS0402 Figures And Tables 227 Figure 1a - Sets of SCR subfamilies reveal

relationships between Complement

Control proteins.

Figure 2a - Multiple duplications and divergence

following segmental duplication of

CR1 and MCP precursors.

Figure 2b –Domain and segmental duplications

within primate CR1 explain the

genomic expansion of CR1 and

CR1L not seen in the rodent.

Figure 3a - Analysis of genomic sequence of

CR1L against CR1.

Figure 4 - Phylogenetic and genomic analyses

define a model for the evolution of

- 14 -

Hosa CR1 and CR1L.

Table 1 - SCR alignments from nine SCR

groups found in Crry, CR1 and

CR1L.

Chapter 4 – MS0408 Figures And Tables 241 Figure 1 - Multiple binding and amplification

by primer pairs.

Figure 4 - Segregation of ancestral haplotypes Figure 6 - Sequencing reveals the complexity

of the haplospecific element and

differences between CR1 and CR1-

like.

Figure 7 – Polymorphism within SCR

submfamilies

Chapter 5 – MS0504 Figures And Tables 251 Figure 2 – Canine MHC genotyping report

Chapter 6 – MS 0507 Figures And Tables 255 Figure 1 - Pedigree of 920 Cattle. Figure 2 - Beef Breeder database for

phenotypic and genotypic data management.

BIBLIOGRAPHY 261

EXAMINERS REPORTS 283

RESPONSE TO EXAMINERS REPORTS 297

- 15 -

ACKNOWLEDGEMENTS

Special thanks must go to my supervisors; (i) Professor Roger Dawkins for his

expertise, inspirational guidance and continual encouragement, (ii) Dr Brent (Charlie)

Stewart for his veterinarian, computational and statistical expertise and (iii) Dr Silvana

Gaudieri for her tuition in bioinformatics and genetics.

To my once fellow student, good friend and colleague, Dr Joseph Williamson, thanks

for your many contributions to this thesis, the company during those late nights in the

lab and of course the many good laughs. Here’s to many more home brews! To all the

past and present laboratory and administrative staff, fellow students, board members

and associates of the C.Y. O’Connor ERADE Village Foundation and the Centre for

Molecular Immunology and Instrumentation, I thank you all very much.

Special thanks must go to the C.Y. O’Connor ERADE Village Foundation, the

Australian Research Council, Equitec, Genetic Technologies and the University of

Western Australia for providing scholarships, research funding and travel awards.

Finally I would like to acknowledege the love and support of my family and friends. To

my parents, John and Helen, my sister Sherrin, my brother-in-law Brendan and my

girlfriend Emily, I sincerlely thank you all for the many years of support and

encouragement you have provided.

- 16 -

- 17 -

PUBLICATIONS ARISING FROM THIS THESIS

McLure, C., R. Dawkins, J. Williamson, R. Davies, J. Berry, N. Longman-Jacobsen, R.

Laird and S. Gaudieri (2004). "Amino acid patterns within short consensus repeats

define conserved duplicons shared by genes of the RCA complex." Journal of

Molecular Evolution 59(2): 143-157.

McLure, C., J. Williamson, B. Stewart, P. Keating and R. Dawkins (2004). "Genomic

analysis reveals a duplication of eight rather than seven SCRs in Primate CR1 and

CR1L: Evidence for an additional set shared between CR1 and CR2."


McLure, C., J. Williamson, B. Stewart, P. Keating and R. Dawkins (2005). "Indels and

imperfect duplication have driven the evolution of human CR1 and CR1-like from

their precursor CR1 alpha: Importance of functional sets." Hum Immunol 66(3):

258-273.

McLure, C., J. Williamson, L. Smyth, S. Agrawal, S. Lester, J. Millman, P. Keating, B.

Stewart, and R. Dawkins (In Press). "Extensive genomic polymorphism of the CR1

region: RCA ancestral haplotypes, function and disease". Immunogenetics

McLure, C., P. Kesners, S. Lester, D.Male, C. Amadou, J. Dawkins, B. Stewart,

J.Williamson and R. Dawkins. (In Press). "Haplotyping of the Canine MHC without

the need for DLA typing". Intl J. Immunogenetics

McLure, C., J. Dawkins, B. Stewart, and R. Dawkins. (In preparation). " Identification of

traits and function in livestock by genomic matching: Genetically determining

homozygous and heterozygous polled cattle".

- 18 -

- 19 -

DECLARATION

I certify that this thesis does not contain material which has been accepted for the award

of any degree or diploma in any university or other institution and, to the best of my

knowledge and belief, contains no material previously published or written by another

person, except where due reference is made in the text.

Craig A McLure BSc (Molecular Genetics) Professor Roger L Dawkins MD, DSc, FRACP, FRCPA, FRCP

- 20 -

- 21 -

ABBREVIATIONS

AH Ancestral haplotypes

AP Alternative Pathway

APO Apolipoproteins

BAC Bacterial artificial chromosome

Bf Properdin factor B

BLAST Basic local alignment search tool

BMT Bone marrow transplantation

bp Base pair

C2 Complement component 2



C4BP Complement component 4 binding protein

CCP Complement control protein

cM Centimorgan

CP Classical pathway

CR1 Complement receptor 1

CR1α Complement Receptor 1 alpha

CR1β Complement Receptor 1 beta

CR1L Complement receptor 1-like

CR2 Complement Receptor 2

Crry Complement regulatory related protein

DAA Decay accelerating activity

DAF Decay accelerating factor

- 22 -

DDBJ DNA databank of Japan

DLA Dog leukocyte antigen

DNA Deoxyribonucleic acid

EBV Epstein-Barr virus

e-CR1 Erythrocyte bound complement receptor 1

EH Extended haplotype

EMBL European molecular biology laboratory

GMT Genomic matching technique

HCMV Human cytomegalovirus HCT Haemochromotosis

HERV Human endogenous retrovirus

HES haplospecific electrophoretic signatures

HF Factor H

HFE Haemochromatosis gene

HGE Haplospecific geometric element

HHV-6 Human herpesvirus 6

HIV Human immunodeficiency virus

HLA Human leucocyte antigen

Hosa Homo sapiens (human)

HVS Herpesvirus saimiri

HVSCCPH Herpesvirus saimiri complement control protein homolog

IC Immune complex

IMP Inflammation modulatory protein

Indel Insertion or deletion

kb Kilobase

LD Linkage disequilibrium

- 23 -

LHR Long homologous repeat

LINE Long interspersed nuclear element

MA Membrane attached

MAC Membrane attack complex

Mb Megabase

MCP Membrane cofactor protein

MCPα Membrane cofactor protein alpha

MCPL Membrane cofactor protein like

MG Myasthenia gravis

MHC Major histocompatibility complex

mRNA Messenger ribonucleic acid

Mumu Mus musculus

MV Measles Virus

NCBI National centre for biotechnology information

NHP Non human primate

NS Non-synonomous

nt Nucleotide

Pacy Papio Cynocephalus

PAGE Polyacrylamide gel electrophoresis

Paha Papio hamadryas

Patr Pan troglodytes (chimpanzee)

PCR Polymerase chain reaction

PFB Polymorphic frozen block

PH Population haplotype

Popy Pongo pygmaeus (orangutan)

PV Psoriasis vulgaris

- 24 -

Rano Rattus norvegicus

RCA Regulators of complement activation

RFLP Restriction fragment length polymorphism

RNA Ribonucleic acid

RSA Recurrent spontaneous abortion

S Soluble

SBT Sequence based typing

SCR Short consensus repeat

SINE Short interspersed nuclear element

SIV Simian immunodeficiency virus SLE Systemic lupus erythematosus

SNP Single nucleotide polymorphism

SPICE Smallpox inhibitor of complement enzymes

SS Sjögren’s Syndrome

Tm Primer melting temperature (0C)

VCP Vaccinia virus complement control protein

VV Vaccinia Virus

WGS Whole genome shotgun

- 25 -

GLOSSARY

Allele An alternative form of the gene at a given locus.

Amplicon The product of two primers in a polymerase chain reaction.

Ancestral Haplotype

Highly conserved chromosomal segments carrying specific

combinations of alleles at multiple loci. These are identical in

unrelated individuals indicating their derivation from a

common ancestor. Individual ancestral haplotypes have specific

genomic structures and may carry unique deletions and

duplications.

Centimorgan The unit of measurement for distance and recombinate

frequency on a genetic map

Complement A group of proteins in normal blood serum and plasma that

together form a cascade that results in the destruction of foreign

cells

Complement Control Protein

Genes that regulate and control the activation of complement

and the formation of the complement cascade.

Complotype A combination of alleles of C2, Bf and C4 genes, which are

inherited as a unit.

Electrophoresis A technique that separates charged molecules - such as DNA,

RNA or protein - on the basis of relative migration in an

- 26 -

appropriate matrix (such as agarose gel or polyacrylamide gel)

subjected to an electric field

Epistasis/ Epigenetic

The interaction between loci irrespective of whether linked (see

below).

Gene The DNA segment which encodes a protein product.

Genome The complete genetic material contained within a cell nucleus.

Genomic Matching Technique

Technique that generates a haplospecific electrophoretic

signature by amplifying, with a single primer pair, the genetic

differences at multiple loci.

Genotype The genetic makeup of an individual.

Haplospecific Characteristically specific for a haplotype.

Haplotype Combination of alleles at several linked loci, which are

inherited en bloc from a parent.

Haplotypic Characteristic, but not specific for a haplotype.

Interspersed repetitive DNA sequences

Accounts for > 20% of the human genome, Principal families

include, Alus, L1s, LTRs, MERs, and HERV elements.

L1 Long interspersed nuclear elements (~9kb) that evolved before

the emergence of primates. Although these constitute 15% of

the human genome, most are highly truncated.

- 27 -

Linkage The coexistence of genes inherited together as a result of their

location on the same chromosome. It has been measured by the

percent recombination between loci.

Linkage disequilibrium

Statistical calculation of observed combinations of genetic

markers which occur more, or less frequently in the population

than would be expected from their individual gene frequencies.

It can result from a founder effect, in which there has been

insufficient time to reach equilibrium since one of the markers

was introduced into the population, or from reduced

recombination in the region between the loci.

Locus The specific physical location of a gene on a chromosome

Long Homologous Repeat

A reiterated unit that contains multiple internal domains. In

CR1 the LHR contains at least seven SCRs.

Mastitis An inflammation of the mammary gland (or glands), usually

caused by bacteria.

MHC Region of approximately 4Mb on human chromosome 6p21.3

which includes many immunoregulatory genes.

MHC beta block PFB that contains HLA-A, B and MIC

MHC delta block PFB that contains DQ, DR and DP

Microsatellites Simple, internal repetitive sequence of 1-5bp. Mutations that

vary the number of repetitive elements are more frequent than

- 28 -

in other DNA and hence microsatellites are highly

polymorphic. They are abundantly distributed over the

euchromatic part of the genome.

Multiplex The amplification of multiple unlinked loci in a single PCR

reaction by combining several primer pairs.

Mutation Heritable changes in the genetic material.

Pseudogene A DNA sequence which resembles a gene but which has been

inactivated by mutation so that it cannot produce a functional

product.

Phenotype Expressed characteristic, which is genetically determined.

Phylogeny Classification of organisms designed to reflect the sequence in

which they evolved, and their genetic relationships

Polling The phenotypic absence of horns

Polyacrylamide Gel matrix used for the electrophoretic separation of DNA.

Polymerase Chain Reaction

The exponential amplification of specific genomic elements.

Polymorphism Classically, phenotypic variation occurring with a frequency

>1% in the population and not lost by recombination.

Polymorphic Frozen Blocks

Polymorphic genomic segments faithfully inherited through

multiple generations as a complete unit and not split during

chromosomal rearrangements

- 29 -

Regulators of Complement Activation

Cluster of complement regulatory proteins located in humans at

1q32. Includes HF, C4BP, DAF, CR2, CR1, MCP and their

respective gene copies

Retrosequence Retroelement

Definable nucleic acid sequence inserted and amplified by

reverse transcriptase

Retrovirus An RNA virus that propagates by conversion into duplex DNA

by reverse transcriptase (a RNA-dependent DNA polymerase)

an example is HIV.

RFLP Restriction fragment length polymorphism - differences in the

pattern of DNA fragmentation from two haplotypes after

digestion with the same restriction enzyme and visualisation by

DNA-DNA hybridisation.

Sequence Based Typing

The detection of alleles by DNA sequencing

Short Consensus Repeat

Short reiterated protein domain, approximately 60 amino acids

in length and containing the defining amino acid motif

C…C…C…W…C.

Subfamily Sub classification that furhter defines the ancestral relationship

between SCRs

- 30 -

- 31 -

INTRODUCTION

Preface

The following introduction provides background information and develops the

concepts, which form the basis of this thesis. The data, analyses and conclusions

outlined in the preceding summary are addressed in detail in the following chapters.

Introduction

1. Evolution and Diversity

Of all the mechanisms implicated in evolution and the generation of diversity,

duplication, insertions and deletions (indels) are now recognised to be of major

importance. For example, there is a clear relationship between copy number and

polymorphism when genes within the Major Histocompatability Complex (MHC) are

compared (Dawkins et al. 1999) and the same may be true generally. The role of indels

in generating diversity is less well known but many examples have been demonstrated

(Deininger et al. 2003; Gaudieri et al. 1997a; Hughes and Coffin 2001; Kulski et al.

1997). The thoughts and interpretations presented in this thesis are derived from the

many concepts established during the extensive studies of the Human MHC by this

department and others.

- 32 -

2. The Human Major Histocompatability Complex, Polymorphic

Frozen Blocks and Ancestral Haplotypes

The MHC is the most characterised region of the human genome and is a reservoir of

clinically important genes (Dawkins et al. 1999). Analysis of MHC has revealed

extensive polymorphism occurring within localised clusters of several hundred

kilobases (kb). We refer to these regions as Polymorphic Frozen Blocks (PFBs).

2.1 MHC Polymorphism and PFBs

Previous analysis of the MHC has shown it to be the most polymorphic region of the

entire genome, with approximately 10% nucleotide difference observed at certain

regions (Gaudieri et al. 2000; Guillaudeux et al. 1998; Horton et al. 1998; Satta et al.

1998). This is a significant increase when compared to the 0.08 to 0.2% average

observed in the remainder of the genome (Li and Sadler 1991; Horton et al. 1998; Lai et

al. 1998; Rowen et al. 1996; Satta et al. 1998). Most of this polymorphism is

concentrated within localised regions or blocks, usually several hundred kb long

(Campbell and Trowsdale 1993; Klein and Takahata 1990; Tokunaga et al. 1988; Zhang

et al. 1990). The blocks are apparently frozen as recombination is not seen within them,

hence the reason for the term “PFBs” (Dawkins et al. 1991; Klein et al. 1991; Marshall

et al. 1993). The polymorphism observed within these PFBs is varied and complex.

Examples of the complexity include combinations of gene copy number, indel content

and single nucleotide differences at each of the many tightly linked loci (Campbell and

Trowsdale 1993; Leelayuwat et al. 1994; Tokunaga et al. 1988; Zhang et al. 1990). The

possible number of haplotypes for each PFB is therefore potentially quite large

- 33 -

(multiplication of the alleles from each loci). This group (Dawkins et al. 1983; Degli-

Esposti et al. 1992c) along with others (Awdeh et al. 1983; Yunis et al. 2003) have

shown that this is not the case and that specific haplotypes (combinations of alleles)

occur more frequently than expected within a population, while others are not seen at

all. Interestingly, many groups have now shown that most of the MHC associated

diseases can be explained by a few of these specific haplotypes (Alper 1998; Dawkins

et al. 1999; Dawkins et al. 1983; Degli-Esposti et al. 1992a; Degli-Esposti et al. 1992b;

Yunis et al. 2003).

2.2 MHC Ancestral Haplotypes

Recombination in the MHC is therefore limited to the regions between the PFBs, but

this too is at a significantly decreased level to that observed throughout the rest of the

genome (Dawkins et al. 1991; Klein et al. 1991). The low rate of recombination has

seen many specific combinations or haplotypes of PFBs being conserved through many

generations. These combinations are referred to as Ancestral (AH) (Dawkins et al.

1983; Degli-Esposti et al. 1992c) or Extended Haplotypes (EH) (Awdeh et al. 1983).

Recombination occurring between the PFBs has resulted in shuffling. This has caused

the AHs to split, thereby creating further specific Population Haplotypes (PHs)

(Gaudieri et al. 1997b).

3 Identifying MHC AHs using haplospecific features

As previously mentioned, each MHC AH contains a unique genomic structure

(Dawkins et al. 1989; Tokunaga et al. 1988; Zhang et al. 1990) and sequence (Abraham

- 34 -

et al. 1991; Abraham et al. 1992; Wu et al. 1992). Thus by detecting the allele

combinations at highly conserved, polymorphic loci within each PFB, we can identify

the AH. This department has invented the Genomic Matching Technique (GMT) to do

so.

3.1 The Genomic Matching Technique (GMT)

The GMT is a patented diagnostic technique that was designed and developed within

this department (Dawkins & Abraham, US# 6,383,747). The novelty of the GMT is that

it utilises polymorphic haplospecific elements, present in at least 2 duplicons, to

generate multiple amplicons with a single primer pair. The primers are designed to bind

and amplify within the conserved flanking region of each polymorphic haplospecific

element and generate multiple products. The reaction effectively works as a multiplex

Polymerase Chain Reaction (PCR) by generating multiple amplicons of variable

lengths. The results however are more informative than a standard multiplex; this is

because the amplicon combinations represent alleles of tightly linked loci that have

arisen through duplication of a common ancestral segment and since diverged in line

with the specific coding and non-coding differences within each AH. The differences

between each locus are therefore comparable. In the MHC, the term Haplospecific

Geometric Elements (HGE) was introduced to describe those haplospecific elements

that contained unique geometric patterns of repeat combinations (Abraham et al. 1992).

The AHs are defined through the electrophoretic separation of amplified HGEs.

3.2 Haplospecific Profiles through Electrophoretic Separation of Amplicons

- 35 -

The combination of amplicons produces an electrophoretic profile (Ketheesan et al.

1999; Leelayuwat et al. 1994). The profiles mark haplotypes of coding and non-coding

sequences spanning hundreds of kb (Gaudieri et al. 2000). Segregation of the profiles

through a 3-generation family reveals linkage associations of the individual components

of the profile. The combinations of components that segregate together are referred to as

haplospecific electrophoretic signatures (HES) or block profiles.

3.3 Applications of the Block Profiles and Advantages Over Conventional Sequence

Based Typing (SBT)

It has been shown by this department (Tay et al. 1995a) and others (Witt et al. 2000)

that matching of the MHC beta and delta block GMT profiles significantly increases the

likelihood of successful Bone Marrow Transplantation (BMT) in unrelated individuals.

The reason for this is that as previously mentioned, the profile acts as a marker for the

entire PFB. Therefore, matching profiles indicate that the unrelated individuals share the

same AH for that block (Tay et al. 1995b). The GMT is an easier, more accurate and

cheaper alternative to determine AHs than the SBT diagnostic methods currently used.

With the intention of establishing whether the MHC is representative of the genome

generally, other regions should be studied and compared. To do this I have used the

Regulators of Complement Activation (RCA) gene cluster.

4. The Regulators of Complement Activation (RCA)

- 36 -

Located on the long arm of human chromosome 1 (1q32) is the cluster of genes known

as the Regulators of Complement Activation (RCA) (Heine-Suner et al. 1997; Reid

1986; Rodriguez de Cordoba et al. 1985; Weis et al. 1987). Rodriguez de Cordoba and

colleagues (Rodriguez de Cordoba et al. 1999) have shown that the human RCA gene

cluster, spanning a total of 21.45 cM, contains 61 genes of which 15 are complement

related. The genes of the RCA share many similarities implying that all have arisen

through multiple complex duplication events (Hourcade et al. 1989; Krushkal et al.

2000; McLure et al. 2004a).

4.1 Complement Control Proteins (CCPs)

The RCA genes belong to the CCP family (Reid 1986). The role of CCPs is to prevent

the uncontrolled activation of complement and to assure that damage to autologous cells

is avoided (Krushkal et al. 2000). CCPs regulate complement activation by either (i)

acting as a cofactor for the factor I mediated cleavage of C3b and C4b therefore

inhibiting the binding of Comploment Component 2 (C2) and Properdin Factor (Bf) and

the formation of C3b/C2 and C4b-fB activated complexes or (ii) by accelerating the

decay of those activated complexes that have already formed. The RCA CCPs can be

divided into two groups, the soluble (S) plasma proteins and the membrane-attached

(MA) proteins. The S proteins include C4-Binding Protein (C4BPA and C4BPB) and

Factor H (HF1) while the MA proteins are Membrane Cofactor Protein (MCP),

Complement Receptor 1 (CR1), Complement Receptor 2 (CR2) and Decay Accelerating

Factor (DAF) (Bora et al. 1989; Carroll et al. 1988; Pardo-Manuel et al. 1990; Rey-

Campos et al. 1988). Duplicate copies of these genes have been identified throughout

the cluster but the majority of these are either pseudogenes or genes of unknown

- 37 -

function. (Note: The term CCP is used by some researchers to define what I define as

the SCRs or sushi domains.)

4.2 Short Consensus Repeats (SCRs)

The CCP family is defined by the presence of reiterated protein domains known as

SCRs. SCRs typically contain 56-70 amino acids, including four Cysteines and a

Tryptophan (C…C…C…W…C) (Hourcade et al. 1989; Reid 1986). These are essential

for holding the domain in its rigid triple loop structure (Hourcade et al. 1989;

Schwarzenbacher et al. 1999). The SCRs found in CCPs carry a variety of functions,

including protein binding and cofactor activity in complement regulation (Reviewed by

(Hourcade et al. 1989; Reid and Day 1989). Interestingly, several groups have now

demonstrated that it is the involvement of multiple domains, rather than individual

SCRs that determine these functions (Krushkal et al. 2000; McLure et al. 2005). The

modification or loss of these domains results in a modification to (or loss of) that

particular function.

4.3 SCR combinations of CCP functional domains and their regulatory mechanisms

Complement activation is regulated at several steps to prevent uncontrolled activation

and to ensure that damage to autologous cells is avoided. The table below summarises

the reviews by Kirkitadze (Kirkitadze and Barlow 2001) and Krushkal (Krushkal et al.

2000), which discuss the mechanisms by which individual CCPs regulate complement

activation. The data include the following:

1. Name of the gene (as commonly abbreviated)

2. Physical state – soluble (S) or membrane–attached (MA)

3. The SCR combinations within CCPs that form the functional domains

- 38 -

4. The subfamilies of the SCRs that form the functional domain (McLure et al.

2004a)-Chapter 1

5. The domains regulatory mechanism and/or complement interaction

Table 1. Functional Domains within the Genes of the RCA

RCA Gene

Phys State%

SCRs involved #

Sub-families^

Function Ref-erences*

FH S 1-20 1-4 or 1-5 1-4, 6-10 & 16-20

Competes with factor B for binding to C3b, Cofactor for factor I-catalysed proteolysis of C3b and DAA of C3bBb Cofactor and DAA C3b binding

1-3

C4BP S 1-8 1-3

Competes with C2 for binding to C4b, Cofactor for factor I-catalysed proteolysis of C4b and DAA of C4bBb C4b binding

4-8

DAF MA 1-4 2 &3 2-4

aaje je aje

DAA of the C3 & C5 convertases Classical pathway convertase regulation Alternative pathway convertase regulation

9-17

CR2 MA 1- 15 or 1-16 1-2

Receptor for C3d, interface between innate and adaptive immunity, iC3b/C3dg binding

18-23

CR1 MA 1-30 (F- allele) 1-3 8-10 & 15-18

(ajefbkd)7ch aje aje & aje

Binds C4a & C4b, DAA of classical and alternative pathways convertases & acts as a cofactor for the factor I mediated proteolysis of iC3b/C4b C4b binding, weak C3b binding & DAA of classical and alternative pathways convertases High C3b and low C4b affinity and acts as a cofactor for the factor I mediated proteolysis of iC3b/C4b

24-26

MCP MA 1-4 1 & 2-4 3 & 4 2 + 3&4

aje f/g a & jef/g ef/g j + e&f/g

Cofactor activity for factor I-catalysed proteolysis of C3b & C4b molecules C4b binding and cofactor activity C3b binding C3b Co-factor activity

27-31

Footnotes

* References

1. (Gordon et al. 1995); 2. (Kuhn and Zipfel 1996); 3. (Sharma and Pangburn 1996); 4. (Scharfstein et al. 1978); 5.

(Dahlback et al. 1983); 6. (Gigli et al. 1979); 7. (Blom et al. 2000); 8. (Blom et al. 1999); 9. (Nicholson-Weller et al.

1981); 10. (Nicholson-Weller et al. 1982); 11. (Caras et al. 1987); 12. (Medof et al. 1987); 13. (Medof et al. 1984);

14. (Coyne et al. 1992); 15. (Brodbeck et al. 1996); 16. (Brodbeck et al. 2000); 17. (Kuttner-Kondo et al. 1996); 18.

- 39 -

(Moore et al. 1987); 19. (Matsumoto et al. 1991); 20. (Changelian and Fearon 1986); 21. (Nagar et al. 1998); 22.

(Lowell et al. 1989); 23. (Molina et al. 1995); 24. (Klickstein et al. 1988); 25. (Krych et al. 1991); 26. (Krych-

Goldberg et al. 1999); 27. (Lublin et al. 1988); 28. (Adams et al. 1991); 29. (Iwata et al. 1995); 30. (Liszewski et al.

1991); 31 (Liszewski et al. 2000).

%Physical State

S = Soluble plasma protein MA = Membrane attached protein

# SCRs Involved

SCRs in bold are the critical units that are involved with the specific function. Each SCR is numbered according to its

relative position in the gene

^ Subfamilies Involved

The respective subfamily classification of the functional SCRs (McLure et al 2004a). Note the ajef pattern

4.4 Evolution of the CCPs and SCRs

The CCP family has been conserved from invertebrates to provide regulation of

complement and self-nonself discrimination. The CCPs have evolved in parallel with

the complement cascade and can be regarded as the major agents of regulation. During

vertebrate evolution the family has expanded such that there are numerous copies

clustered throughout the vertebrate and indeed human genome. Functions have diverged

and now include viral receptors (Kotwal and Moss 1988; Miller et al. 1997) regulation

of adaptive immunity (Wei et al. 2001) and maintenance of foetomaternal tolerance

(Bell 2000; Xu et al. 2000).

The SCR domains appear to have an ancient origin that predates their involvement in

CCPs. Examples of these have been identified within insects (Drosphila) (Hoshino et al.

1993), nematodes (Caenorhabtidis elegans) (Consortium 1998), viruses (Spiller et al.

2003) and marine sponges (Blumbach et al. 1998; Pahler et al. 1998).

- 40 -

4.5 Polymorphic Frozen Blocks within the Regulators of Complement Activation

4.5.1 Frozen Blocks

Analysis of the RCA cluster has revealed two unlinked genomic blocks, each containing

their own unique set of tightly linked genes (Campbell 1988; Carroll et al. 1988; Heine-

Suner et al. 1997; Heine-Suner et al. 1998; Hourcade et al. 1990; Rey-Campos et al.

1987; Rey-Campos et al. 1988; Rodriguez de Cordoba and Rubinstein 1987). The first

block is ~900 kb-long DNA segment containing the genes 5’- C4BPB-C4BPA-

C4BPAL1-C4BPAL2-DAF-CR2-CR1-MCPL-CR1L-MCP -3’ while the second is 650

kb-long and contains 5’-HF1-FHR1-FHR2-FHR3-FHR4-F13B- 3’ (Pardo-Manuel et al.

1990; Rey-Campos et al. 1990; Rodriguez de Cordoba et al. 1999).

4.5.2 RCA Polymorphism

Several groups have identified polymorphism within the RCA cluster. The majority of

these are coding Single Nucleotide Polymorphisms (SNPs) (Birmingham et al. 2003;

Moulds et al. 2004; Xiang et al. 1999) but examples of structural (Moulds et al. 1996;

Smith et al. 2002; Wong 1990), gene and domain copy (Dykman et al. 1985) number

polymorphisms have also been described. There are numerous SNPs (approximately 1

per 100bp) in keeping with the conclusion that there is extensive polymorphism within

the region. This suggests that, like the MHC, the RCA is split into well-defined PFBs,

each containing conserved AHs of allele combinations. The following table summarises

some of the SNPs identified within the RCA genes (taken from NCBI SNP database and

references above). For this purpose, only non-synonomous (NS) are shown since the

- 41 -

ultimate purpose is to determine the difference at the protein level. The data include the

following:

1. Name of the gene (as commonly abbreviated)

2. The PFB where the gene is located. Either RCA alpha (α) or RCA beta (β)

3. The contig, mRNA and protein sequences to which each position refers.

4. The SCR where the polymorphism occurs

5. The resulting change to the mRNA and translated protein

Table 2. Single Nucleotide Polymorphisms within the genes of the RCA

RCA Gene

PFB contig mRNA protein SCR Nuc change Protein change

FH β NT_004487 NM_000186 NP_000177 G-257-A V-62-I

C-1277-T H-402-Y

G-2412-T R-780-I

G-2742-T S-890-I

G-2881-T E-936-D

A-3063-C N-997-T

G-3092-T V-1007-L

G-3101-A A-1010-T

G-3251-C V-1060-L

C-3500-G Q-1143-E

C-3645-T S-1191-L

T-3663-C V-1197-A

C4BPA α NT_021877 NM_000715 NP_000706 C-204-G P-4-A

C-373-T A-60-V

T-1093-C I-300-T

DAF α NT_021877 NM_000574 NP_000565 C-1247-T S-334-F

CR2 α NT_021877 NM_001877 NP_001868

CR1 α NT_021877 NM_000573 NP_000564 C-424-T R-105-C

T-455-C V-115-A

A-1360-G T445A

T-2078-C I-684-T

G-3093-T Q-981-H

A-3650-G H-1208-R

- 42 -

C-4334-T T-1408-M

A-4730-G N-1540-S

A-4879-G K-1590-E

A-4912-G R-1601-G

A-4939-T T-1610S

A-4954-G I-1615-V

G-5575-C D-1850-H

C-5591-G P-1827-R

C-5654-T T-1876-I

MCP α NT_021877 NM_172353 NP_758863 G-952A D-266-N

Included in chapter 4 (Fig7) is an alignment of all the Rodent Crry and Primate CR1

and CR1L SCRs. Each of these SCRs has been grouped into subfamilies using their

conserved residues and amino acid motifs. (McLure et al. 2004a; McLure et al. 2005).

The human CR1 SNPs listed in the table above have been annotated on this alignment.

The SNPs that are likely to have a significant effect are those that occur in conserved

residues within each subfamily. Haplotypes of these critical SNPs would therefore be

informative in associating phenotypic variation.

4.6 RCA disease associations and pathogen interactions

4.6.1 Complement related disease

There have been many conditions implicated with the genes of the RCA. These are

generally multi-factorial and involve a number of linked and unlinked genes. The

complement genes on human chromosome 6 play a pivotal role in the development of

these diseases. As previously mentioned, the haplotypic variations in gene expression

have been linked with the development of many autoimmune conditions. The

regulatory effect of the CCPs can provide a protective mechanism for the development

- 43 -

of these conditions and is a candidate region for explaining the incomplete penetrance

of the complotypes (Alper et al. 1983). The mechanisms by which the CCPs regulate

complement have already been discussed; the inability of any of these to function

efficiently may result in Autoimmune Disease (AD). Examples of these include

Systemic Lupus Erythemetosus (SLE), Sjogren’s Syndrome (SS), Recurrent

Spontaneous Abortion (RSA), Haemolytic Uraemic Syndrome (HUS) and Age-related

Macular Degeneration (AMD).

With respect to SLE and CR1, there has been a long debate over whether the observed

decrease in CR1 expression on erythrocytes of individuals with SLE is an acquired or

genetic trait (Dawkins et al. 1983; Walport et al. 1985). Walport and colleagues have

suggested that the decreased number of erythrocyte-bound CR1 (e-CR1) molecules is a

direct result of an increased number of circulating immune complexes (IC) and

therefore an acquired phenotype. Wilson and colleagues on the other hand have

provided evidence favouring the genetic hypothesis and demonstrated an association

between SNPs and decreased e-CR1 expression (Herrera et al. 1998; Xiang et al. 1999).

4.6.2 Pathogen Interactions

Many pathogens have devised efficient mechanisms that are designed to evade the

hosts’ immune system. These strategies include direct inactivation of complement either

by encoding complement regulatory proteins or by capturing membrane regulatory

proteins from the host and by using membrane complement receptors to gain cellular

entry (Bernet et al. 2003). The following tables summarise the findings from a number

of recent reviews on RCA genes and their pathogen interactions (Bernet et al. 2003;

Favoreel et al. 2003; Lindahl et al. 2000).

- 44 -

Table 3. Microorganisms that acquire RCA proteins or use them for

cellular entry

RCA Gene

Micro-organism

Ligand/ protein

Ligand/protein Interaction SCRs &

Ref*

S. pyogenes Some M Proteins

Bacteria-bound C4BP inhinits C3 convertase activity ?

1 & 2 1-7

N. gonorrhoeae Porin Serum resistance of strains ? ? 8

C4BP

B. pertussis FHA? FHA may bind C4BP directly or stimulates its binding to another bacterial surface ?

? 9

S. pyogenes Some M proteins

Hypervariable regions bind to FH and FHL-1 7 4, 10-14

N. gonorrhoeae LOS Bind to factor H and exploit the complement

inhibitory function 16-20 15

&16 Porin ? S. pneumoniae ? May contribute to phagocytosis resistance

through FH binding ? 17

FH

HIV-1 gp41, gp 120

FH may bind to the envelope proteins? ? 18-22

Vaccinia VCP Incorporation of cellular complement regulators 23 HCMV ? Incorporation of cellular complement regulators 24 HTLV-1 ? Incorporation of cellular complement regulators 25 HIV-1 ? Incorporation of cellular complement regulators 20-22 SIV ? Incorporation of cellular complement regulators 26 E. coli Dr-like

antigens Bind via surface proteins present either in fimbria or in an afimbrail sheath

2&3, or 3

27-31

X adhesin 3 or 4 Echovirus 7 Capsid Binds to DAF which facilitates the intereaction of

a second effector receptor/molecule ? 2,3 &4

32-34

DAF

Coxsackievirus Capsid Binds to DAF which facilitates the intereaction of a second effector receptor/molecule ?

1 or 2 32,34, 56,57

CR2 EBV Gp350/220

Accelerates decay of AP C3-convertase. Factor I cofactor for C3b, iC3b, C4b & iC4b

1 & 2 35-42

P. falciparum PfEMP1 Expressed on the surface of infected erythrocytes, CR1 from uninfected erythrocytes binds and forms rosettes

25? 43

CR1

HIV C3 Bound C3 fragments on surface of HIV interact with complement receptors

44-46

MV Haemagglutinin

Uses MCP as a receptor to initiate infection 1 & 2 47-50

S. pyogenes M6

Protein MCP acts as a keratinocyte receptor ? ? 51-52

N. gonorrhoeae Pili Surface pili promote binding to MCP expressing

cells ? 53

MCP

- 45 -

N. meningitidis Pili Surface pili promote binding to MCP expressing cells

? 53

H. pylori BabA

protein ? ? 54

HHV-6 ? Uses MCP as a receptor to initiate infection 1? 55 Vaccinia VCP Incorporation of cellular complement regulators 23 HCMV ? Incorporation of cellular complement regulators 24

SIV ? Incorporation of cellular complement regulators 26 Footnotes

* References

1. (Accardo et al. 1996); 2. (Thern et al. 1995); 3. (Thern et al. 1998); 4. (Johnsson et al. 1996); 5.

(Johnsson et al. 1998); 6. (Liszewski et al. 1996); 7. (Mikata et al. 1998); 8. (Ram et al. 1999); 9.

(Berggard et al. 1997); 10. (Horstmann et al. 1988); 11. (Sharma and Pangburn 1997), 1997; 12.

(Kotarsky et al. 1998); 13. (Blackmore et al. 1998); 14. (Hellwage et al. 1997); 15. (Ram et al. 1998b);

16. (Ram et al. 1998a); 17. (Neeleman et al. 1999); 18. (Stoiber et al. 1995); 19. (Stoiber et al. 1997); 20.

(Marschang et al. 1995); 21. (Stoiber et al. 1996); 22. (Schmitz et al. 1995); 23. (Vanderplasschen et al.

1998); 24. (Cooper 1998); 25. (Spear et al. 1995); 26. (Montefiori et al. 1994); 27. (Nowicki et al. 1993);

28. (Pham et al. 1995); 29. (Jouve et al. 1997); 30. (Peiffer et al. 1998); 31. (Sargiacomo et al. 1993); 32.

(Evans and Almond 1998); 33. (Clarkson et al. 1995); 34. (Shafren et al. 1998); 35. (Mold et al. 1988);

36. (Ahearn and Rosengard 1998); 37. (Moore et al. 1989); 38. (Molina et al. 1991); 39. (Molina et al.

1995); 40. (Fingeroth et al. 1984); 41. (Nemerow et al. 1987); 42. (Tanner et al. 1987); 43. (Rowe et al.

1997); 44. (Robinson et al. 1988); 45. (Stoiber et al. 2001); 46. (Spear et al. 2001); 47. (Naniche et al.

1993); 48. (Dorig et al. 1993); 49. (Manchester et al. 1995); 50. (Casasnovas et al. 1999); 51. (Okada et

al. 1995); 52. (Berkower et al. 1999); 53. (Kallstrom et al. 1997); 54. (Lindahl et al. 2000); 55. (Santoro et

al. 1999). 56. (Bergelson et al. 1995), 57. (Shafren et al. 1997).

As mentioned previously, some viruses have evolved to encode RCA homologous

genes within their own genome. These observations have been reviewed by Bernet

(2003) and Favoreel (2003) and are summarised in the table below.

- 46 -

Table 4. Viruses that encode CCPs homologous to the RCA genes.

Virus Family

Virus Viral Protein

Key Feature Refs*

Vaccinia VCP Binds C3b and C4b. Accelerates decay of CP and AP C3-convertases Factor I cofactor for C3b and C4b

1-3

Cowpox IMP Modulates in-vivo complement-mediated

inflammatory responses 4

Pox-viridae

Variola SPICE Inhibits human complement 5 Herpes-viridae

HVS HVSCCPH Blocks C3b deposition 6 &7

Footnotes

CP –Classical Pathway, AP- Alternative Pathway, VCP- Vaccinia Control Protein, HVSCCPH – Herpesvirus

complement control protein homologue, IMP- Inflamation Modulatory Protein, SPICE – Small Pox Inhibitor of

Complement Enzymes

*References

1. (Kotwal et al. 1990), 2. (McKenzie et al. 1992), 3. (Sahu et al. 1998) 4. (Miller et al. 1997), 5.

(Rosengard et al. 2002), 6. (Albrecht and Fleckenstein 1992), 7. (Fodor et al. 1995)

5. Major Discoveries

5.1 Evolution of the SCRs and CCPs

In chapter 1 to 3 we show that RCA genes have evolved through a series of processes

involving duplication and divergence of individual SCRs and more particularly, sets of

SCR domains. It is also clear that individual SCRs and particularly sets of SCRs have

become specialized in terms of position, proximity, and undoubtedly, function. Thus,

for example, the subfamilies ajef, bkdg/g-like and ch (Chapters 1-3) occur on different

proteins but in the same relative position. Duplications, deletions, and other processes of

divergence have contributed to this process of specialisation or selection.

- 47 -

5.2 Diversity of duplication – Monomers, Tetramers, Octamers and Segments

5.2.1 SCR Subfamilies – The monomers

Phylogenetic studies have revealed that, with rare exceptions, all SCRs can be classified

into only 11 subfamilies designated a, b, c, d, e, f, g, h, i, j & k. Having demonstrated

that there are specific subfamilies of SCRs, it becomes clear that there must have been

many diverse units of duplication and deletion.

5.2.2 Subfamily relationships –Dimers, Tetramers and Octomers

Analysis of the SCR repertoires from each gene has revealed many conserved sets of

subfamily combinations. The sets we have identified consist of two (c & h), four (ajef or

bkdg) or eight (ajefbkdg) SCRs. The Fearon (Klickstein et al. 1988) and Atkinson

groups (Hourcade et al. 2000; Krych et al. 1994) have demonstrated that it is the sets,

rather than the individual SCRs, that form the functional domains within each gene.

Their analyses revealed that within human CR1, SCRs 1-3, 8-10 and 15-17 (the sets we

define as aje) are the components that form the C3b and C4b binding domains. We have

shown through our classification of SCRs, that the combination of subfamilies is critical

for recognition and binding. The aje pattern is consistent with all SCR combinations

that form binding domains in all human and non-human CCPs (Chapter 1). This

suggests the conservation of a critical subunit throughout the species. Evolution has

resulted in additional domains through duplication of these critical sets (Chapter 3).

- 48 -

5.2.3 Segmental Duplications

The 340kb genomic region containing Hosa CR1, MCPL, CR1L and MCP is compared

against itself in Chapter 3 (Fig 2a) and demonstrates the complexity of duplication

within the region. We have demonstrated the segmental duplication of the CR1/MCP

ancestral genes, which resulted in two segments, segment A (CR1 and MCPL) and

segment B (CR1L and MCP). Annotation of the sequence with the location of segments,

genes, Long Homologous Repeats (LHRs) and indels demonstrates that post separation

duplications and deletions of LHRs have created the expansion of segment A (165kb)

and the contraction of segment B (110kb).

5.3 Degeneration

Within the RCA we have revealed several examples of SCR degeneration. This

degeneracy ranges from individual SCRs up to complete LHRs.

5.3.1 Genomic analysis reveals five highly conserved, apparently untranscribed SCRs

of CR1L (Chapter 1)

We first identified SCR degeneracy through genomic analysis of the human CR1L gene

(Chapter 1). Previous studies by Birmingham and colleagues had described seven SCRs

within the gene. This analysis also suggested that these were not expressed in humans

(Logar et al. 2004). The Birmingham group has described the expression of CR1L in

non-human primates and demonstrated its function as the non-human primate immune

adherance molecule (Birmingham and Hebert 2001; Chen et al. 2000).

- 49 -

The genomic analysis of CR1L presented in chapter 1 clearly identifies 12 SCRs in

CR1L (we have since found there to be 13 – see below). Subfamily classification of the

additional SCRs was possible, as in each the defining motifs remained relatively

conserved. The analysis clearly showed that the SCRs 8-12 were from the efbkd

subfamilies respectively. Detailed examination of the additional SCRs revealed a

number of nonsense mutations, thereby confirming degeneracy and the unlikely

expression in humans. This may vary between individuals and degeneracy may not

always be the case.

5.3.2 Genomic analysis reveals a duplication of eight rather than seven SCRs in

primate CR1 and CR1L: evidence for an additional set shared between CR1 and

CR2. (Chapter 2)

Chapter 2 reports the discovery of previously unrecognised short consensus repeats

(SCRs) within human and chimpanzee CR1 and CR1L. Analysis of available genomic,

protein and expression databases suggests that these are actually genomic remnants of

the g subfamily SCRs, which occur in other CCPs (McLure et al. 2004a). Comparison

with the nucleotide motifs of the 11 defined subfamilies of SCRs justifies the

designation g-like because of the close similarity to the g subfamily found in CR2 and

MCP. To date, we have identified five such SCRs in human and chimpanzee CR1, one

in human and chimpanzee CR1L, but none in either rat or mouse Crry in keeping with

the number of internal duplications of the long homologous repeat (LHR) found in CR1

and CR1L. At the genomic level, the ancestral LHR must have contained eight SCRs

rather than seven as previously thought. Since g-like SCRs are found immediately

downstream of d SCRs, we suggest that there must have been a functional dg set which

has been retained by CR2 and MCP but which is degenerate in CR1 and CR1L.

- 50 -

Interestingly, dg is also present in the CR2 component of murine CR1 (MCR1). The

degeneration of the g SCR must have occurred prior to the formation of primate CR1L

and prior to the duplication events, which resulted in primate CR1. In this context, the

apparent conservation of g-like SCRs may be surprising and may suggest the existence of

mechanisms unrelated to protein coding.

5.4 Human CR1: A model for CCP evolution

Genomic and protein analyses suggest that Primate CR1 and CR1L may have evolved

from a common hypothetical ancestor, CR1 alpha (CR1 α) (Chapter 3). We show that

duplication and deletion, both small and large, appear to be the major contributing

factors in the divergence of the two genes. We postulate duplication events involving

“a, j, e, f, b, k, d, g-like” of CR1 α which have resulted in three copies. This has been

presented as a triplication although there may have been two independent duplication

events. Either way, we envisage three copies prior to the segmental duplication of

PreCR1/PreCR1L (CR1β apparently including MCPα). This model resulted in the

formation of 4 genes, Pre-CR1, MCP, Pre-CR1L and MCPL. Since the formation of

Pre-CR1 and Pre-CR1L, indels of retroviral and genomic sequence have caused each to

diverge. In CR1L, deletion of thirteen Hosa CR1 SCRs 21, 21-22, 22, 26, 27, 28, 28-29,

29, 30, 31, 32, 36 & 37 has occurred through three independent events. In CR1,

insertion of Hosa CR1 SCRs 5 to 18 has occurred through a triplication of “bkdg-like

ajef”(Hosa CR1 SCRs 19 to 25). As with CR1α, it is unclear whether the replication

occurred as two separate duplications. However, it is clear that the region has been

highly conserved throughout CR1 and CR1L evolution. The indels that occurred

throughout the evolution of these genes have resulted in 42 SCRs in Hosa CR1

[“(ajefbkdg-like)5 ch”] and 13 in Hosa CR1L [“a(jefbk)2dg-like”].

- 51 -

5.5 Divergence – RCA Polymorphism

5.5.1 Single Nucleotide Polymorphisms

Prior to the commencement and throughout the course of my studies, a considerable

amount of effort has been directed at identifying polymorphism within the RCA region.

These studies have nearly always targeted SNPs and many are now known throughout

the region. With respect to CR1, the effects of non synonomous coding SNPs have been

studied extensively (Birmingham et al. 2003; Moulds et al. 2004; Xiang et al. 1999).

These studies have attempted to relate polymorphisms of a single base and ultimately an

amino acid, with the observed changes to the amount of eCR1 and / or the efficiency of

these to bind C3b/C4b (Birmingham et al. 2003). A reliable diagnostic marker that

could accurately predict either of these would have major implications in disease

prediction. Several studies have shown strong association between individual SNPs and

the amount of CR1 expression but these associations are only found in specific ethnic

groups; analysis of the same SNP within different ethnic groups shows little or no

significance (Herrera et al. 1998; Xiang et al. 1999).

5.5.2 Conserved subfamily motifs define the critical SNPs of CR1

In Chapters 1 and 3, we identified the critical residues and motifs that define each SCR

subfamily by displaying their conservation through rodent and primate evolution

(McLure et al. 2004a; McLure et al. 2005). Using the SNPs described by Moulds

(Moulds et al. 2004) and Birmingham (Birmingham et al. 2003) as an example, and

determining their location within each SCR, we can predict the likely impact that each

- 52 -

will have based on whether they occur within a highly conserved residue. The results of

this are presented in Chapter 4 – Fig7.

5.5.3 SNP Haplotypes

This limited success in defining clinically relevant polymorphism is likely to be a

function of the region`s complexity (McLure et al. 2004a; McLure et al. 2004b; McLure

et al. 2005) and suggests that there are many factors within the region that influence

CR1 phenotypes. Defining haplotypes of the SNPs and relating these to phenotypes

should be more informative than associating the individual SNPs alone.

5.5.4 Genomic Matching Technique haplotypes

With this in mind and because of the proven ability of the GMT to identify complex

haplotypic differences within large genomic regions (Gaudieri et al, 2001), we designed

an extension to the technique to identify haplotypes of the RCA alpha block (CR1,

MCPL and CR1, a region spanning 150kb). These haplotypes mark specific

combinations of the many simple and complex polymorphisms (SNPs, duplications and

indels) within the region, as well as the SNP haplotypes that were previously reported

(as demonstrated in Chapter 4 – Fig7). Through this analysis, we identified extensive

polymorphism with at least 20 distinct haplotypes defined so far. These haplotypes will

undoubtedly contain undescribed ancestral polymorphisms (duplications, indels etc) that

will relate to susceptibility and / or protection to disease. These polymorphisms should

be far more informative than SNPs in marking functional variation between individuals.

- 53 -

The limit of the RCA alpha block remains unclear although earlier analysis using

microsatellite markers has demonstrated that the region between CR1 and DAF is also

free from recombination (Heine-Suner et al. 1997; Rodriguez de Cordoba et al. 1999). If

this is correct, it implies that the GMT method is defining haplospecific profiles for a

genomic region spanning well over 0.5Mb and containing the coding and non coding

polymorphisms of at least 5 genes (DAF, CR2, CR1, MCPL & CR1) and possibly more

(MCP and CD34).

Further studies will be needed to define the extent of this block but regardless of the

eventual size, the GMT provides a simple, efficient and highly informative way to

characterise ancestral haplotypes of the RCA. These ancestral haplotypes will without

doubt solve many of the issues previously encountered in understanding epigenetic

interaction of RCA and MHC genes and their association with disease.

5.5.4.1 Sequencing results

The amplified elements of CR1 and CR1L have been sequenced and the data submitted

to Genbank. Analysis of these sequences shows a complex pattern of repeat

combinations in addition to the complex CR1L defining region (Chapter 4- Fig 6). From

our experience of the HGEs used in the MHC, we would suggest that these are highly

informative markers for defining RCA AHs.

6. Other Observations

In addition to the RCA GMT extension presented in chapter 4, I have also investigated

the applicability of the GMT in defining PFBs within other species. The idea is that

AHs can produce a signature for identifying complex phenotypic traits.

- 54 -

6.1 DLA DQ and DR typing in the Canine.

The work presented in Chapter 5 reports an alternative method for the identification DQ

and DR alleles within the canine MHC (Dog Leukocyte Antigen - DLA). The test

utilises the GMT to amplify polymorphic elements within each copy of the duplicated

DLA DQ genes, DQ α and DQ β.

The results of this were iniatially used to determine parentage within a family of 18

Blue Heeler purebreds. This revealed extensive polymorphism and the results were

more discriminatory than the routine DLA SBT (as described in

http://www.ebi.ac.uk/ipd/mhc/dla/align/html) and microsatellite profiling methods

currently used (DeNise et al. 2004; Francisco et al. 1996).

Segregation of the profiles reveals that each haplotype is faithfully transmitted through

multiple generations and therefore each will undoubtedly have relevance to the

numerous DLA implicated canine diseases (Garlepp et al. 1984; Hedrick et al. 2003;

Ollier et al. 2001; Wagner et al. 1996).

6.2 Other Projects

The following projects have not been reported in this thesis, but preliminary data has

been obtained in relation to GMT diagnostics of the following gene clusters and their

association with particular traits.

1. Keratin genes

a. Polling/Horns

b. Fine wool in sheep

c. Hereditary hair loss in human

- 55 -

2. Beta Defensins

a. Mastitis in cattle

b. Bacterial resistance of fish in intensive breeding environments

(Aquaculture)

3. Apolipoproteins (APO) (Dr Peter Keating is the chief investigator on this

project, I have been assisting him with bionformatics, genomic analysis,

primer design and the segregation of profiles)

a. Alzheimers

b. Vascular Disease

- 56 -

- 57 -

CHAPTERS

- 58 -

- 59 -

PRELUDE TO CHAPTER 1

CONSERVED MOTIFS DEFINE SCR SUBFAMILES

Chapter 1 consists of a paper published in The Journal of Molecular Evolution. The

paper describes the genes and proteins within the region known as the Regulators of

Complement Activation (RCA), a reservoir of clinically important, complement

regulatory genes known as CCPs.

The study analysed the genomic and amino acid sequences of CCPs from a number of

species, including primates (Human – Homo sapiens, Chimpanzee - Pan troglodytes &

Hamadryas baboon - Papio Hamadryas) and rodents (Norway rat - Rattus norvegicus &

House mouse - Mus musculus). This analysis revealed extensive duplication ranging

from segmental duplications of >100 kb and containing multiple genes to 200

nucleotides (nt) and containing only single domains.

To define relationships between each of the genes and their domains, all SCRs were

extracted and added to a SCR database. This allowed the individual sequences to be

analysed and compared without regard to their presence within a particular CCP. The

analysis revealed further conserved residues, other than the SCR defining

C…C…C…W…C motif. The additional conserved residues are specific to SCR

subgroups, or “SCR subfamilies” as we refer to them. Phylogenetic studies suggest that

there are 11 of these subgroups or subfamilies and that all SCRs can be classed as

belonging to only 1 of these. Each subfamily has been labelled alphabetically from “a”

to “k”.

- 60 -

This strategy allowed us to view the functional units of each CCP, according to which

ancestor it originated from. Analysis of the genes shows that similar combinations or

sets of subfamilies are conserved between numerous CCPs, for example “ajef” “bkd”

and “ch”. This suggests that the specific combinations are forming functional domains.

Changes in non-conserved residues within subfamilies has created the variation so that

each gene has evolved to have a unique function.

I am grateful to (i) Professor Roger Dawkins for his ideas, interpretations, comments

and assistance in the compilation of this study, (ii) Dr Silvana Gaudieri for sequence

alignments, synonomous and non-synonomous comparisons and phylogenetic analyses,

(iii) Dr Joseph Williamson for sequence alignments, identifying conserved motifs and

contributions to the text, (iv) Mr Richard Davies for assisting in the compilation of SCR

sequences, (v) Dr Jemma Berry for her assistance with the sequence alignments and

contributions to the text, (vi) Dr Natalie Jacobsen and Miss Rebecca Laird for their

helpful comments and contributions

- 61 -

CHAPTER 1

AMINO ACID PATTERNS WITHIN SHORT CONSENSUS

REPEATS DEFINE CONSERVED DUPLICONS SHARED BY

GENES OF THE RCA COMPLEX

The work described in this chapter has been published in :





- 62 -

The following papers could not be included in this digital thesis for copyright reasons. Please refer to the physical copy of the thesis, held in the University Library.

- 63 -

- 79 -


ANCESTRAL LHRs CONTAINED EIGHT SCRs

Chapter 2 reports the discovery of a novel SCR subfamily within CR1 and CR1-like.

Previous analysis by us (Chapter 1) and others, has reported that CR1 is composed of

multiple copies of a seven SCR, LHR. The work presented in chapter 2 identifies an

additional, apparently redundant SCR within each LHR and suggests that the ancestral

LHR contained eight, not seven SCRs.

We performed several analyses, in order to demonstrate that the sequences identified,

were in fact additional SCRs. These analyses included (i) relationship to neighbouring

SCRs, (ii) comparison to subfamily sets identified in other CCPs and (iii) sequence

conservation between other defined SCR subfamilies.

Relationship to neighbouring SCRs

The location of the novel SCRs was shown to be between the “d” and “a” subfamilies

of each LHR. Closer analysis revealed the novel SCR to be within 30 nt 3’ of the “d”

subfamily and suggests the “d” and the novel SCR are likely to have formed a

functional set.

Comparison to subfamily sets identified in other CCPs.

In order to prove the association with the “d” subfamily, I analysed the subfamily sets

identified in the other CCPs. In CR2 and mCR1, the “d” and “g” subfamilies occur as a

set, in fact both are within the same exon, which suggests the novel SCRs are likely to

have been part of the “g” subfamily.

- 80 -

Sequence conservation between other defined SCR subfamilies

Using the nucleotide sequence to define subfamilies, as opposed to the protein sequence

in chapter 1, I compared the conserved nucleotides of the suspected SCR against the

known subfamilies. The results of this were not convincing but did suggest a close

association with the “f” and “g” subfamilies.

In order to prove the theory that the novel SCRs are in fact “g” we analysed the d&g

encoding exons from CR2 against the “d” & novel SCR sequence from CR1 using

dotter (Sonnhammer et al). This confirms our classification as “g”, but we refer to these

additional SCRs as “g–like” because there is no evidence to suggest that these are

translated.


and assistance in the compilation of this work (ii) Dr Joseph Williamson for his

assistance in constructing the alignments and suggestions for the presentation of

figures, (iii) Dr Brent Stewart and Dr Peter Keating for their helpful comments in

presentation of the figures and additions to the text.

- 81 -

CHAPTER 2

GENOMIC ANALYSIS REVEALS A DUPLICATION OF EIGHT

RATHER THAN SEVEN SHORT CONSENSUS REPEATS IN

PRIMATE CR1 AND CR1L: EVIDENCE FOR AN ADDITIONAL

SET SHARED BETWEEN CR1 AND CR2

The work described in this chapter has been published in:



CR1L: Evidence for an additional set shared between CR1 and CR2." Immunogenetics

56(9): 631-638.

- 82 -


- 91 -


CR1 EVOLUTION

The work presented in Chapter 3 focusses on the region containing the CR1/MCP

segments and more specifically the CR1 and CR1L genes. The analyses presented in this

chapter combines our previous findings presented in Chapters 1 and 2, with our more

recent genomic analyses of rodents and non-human primates.

The aim of this study was to demonstrate that indels and imperfect duplication have

been the driving forces in the evolution of the RCA gene cluster.

Using rodent Crry and primate CR1 and CR1L as our model, we demonstrate how a

critical unit (subfamily combination ajef) is maintained throughout all species. Gene

complexity has accumulated during evolution through (i) the addition of extra SCRs, (ii)

the duplication of critical sets, (iii) the deletion of individual and sets of SCRs and (iv)

the insertion of retroviral sequence. These have resulted in the differences currently

observed.

Figure 4 represents a model for the evolution of the human CR1 and CR1L genes. This

summarises our observations from the current paper, as well as those from Chapters 1

and 2.


and assistance in the compilation of this study (ii) Dr Joseph Williamson, Dr Brent

- 92 -

Stewart, Dr Peter Keating, Mr John Millman and Dr Louise Smyth for their helpful

discussions for the presentation of the figures and for their contributions to the text.

- 93 -

CHAPTER 3

INDELS AND IMPERFECT DUPLICATION HAVE DRIVEN THE

EVOLUTION OF HUMAN CR1 AND CR1-LIKE FROM THEIR

PRECURSOR CR1 ALPHA. IMPORTANCE OF FUNCTIONAL

SETS.

The work described in this chapter has published in:


imperfect duplication have driven the evolution of human CR1 and CR1-like from their

precursor CR1 alpha: Importance of functional sets." Hum Immunol 66(3): 258-273.

- 94 -


- 111 -


RCA POLYMORPHISM

The following chapter reports the discovery of extensive RCA polymorphism. The

study utilised previous genomic analysis, presented in chapters 1 to 3, to identify

complex polymorphic elements within each of the duplicons. Using the GMT, these

products have been amplified and separated by the Polyacrylamide Gel Electrophoresis

(PAGE). The amplicons represent alleles of duplicated loci. Segregation of the

haplospecific patterns through 3 generations supports the previous findings by others

that the region between CR1 and CR1L is part of the same genomic block.

We foresee this example of the GMT will assist in defining the RCA haplotypes that

exhibit susceptibility and resistance to disease. This paper for the first time shows a

relationship between the genes of the Human RCA and RSA.

The results presented here, relate to the application of the GMT in the RCA, but are

presented not just as a paper describing haplotypes of the RCA region but also as a

strategy for identifying genomic polymorphism, AHs and PFBs in any region, from

within any genome.

Post submission addition to Chapter 4

Statistical analyses of the data in Table 2 have been ongoing. In this instance we have

used a contingency table analysis to compare the data and interpreted the differences

observed using odds ratios. The odds ratios were then estimated simultaneously by

logistic regression performed using WinBugs (V 1.4.1 http://www.mrc-

bsu.cam.ac.uk/bugs/winbugs/contents.shtml). WinBugs uses Bayesian MCMC methods

to estimate empirical 95% credible intervals (CI), which are less biased for small

sample sizes. The latest results, confirm that observed differences in haplotype

- 112 -

frequencies between different ethnic groups and disease and controls such as Recurrent

Spontaneous Abortion (RSA) are significant.

A comparison between Indians and Caucasians revealed the frequencies of haplotypes

1-3, 6-7, 9 and 11 were all significantly decreased within the Indian group (RSA

samples pooled). This perhaps is not surprising as the Ancestral haplotype list was

derived on a frequency basis from predominantly Caucasian samples.

The following manuscript reveals associations between the CR1.02 and CR1.08

Ancestral Haplotypes and Recurrent Spontaneous Abortion (RSA). Statistical analyses

of these haplotypes in RSA controls (RSA-C) and patients (RSA-P) confirm that

CR1.02 AH is significantly decreased within the RSA-P group with an odds ratio of

0.08 (range 0.01, 0.47). The increase in CR1.08 AH, which appears to be significant

when compared to other groups, does not appear significant using this analysis. This is

most likely due to very low power of this analysis to detect significance of low

frequency haplotypes.


and assistance in the compilation of this study, (ii) Dr Joseph Williamson for primer 11

and 12 assay, haplotype assignment, statistical analysis and contributions to the text,

(iii) Dr Louise Smyth for the donation of three generation families, (iv) Professor

Suraksha Agrawal for clinical samples and contributions to the text, (v) Mrs Susan

Lester for clinical samples, statistical analyses and contributions to the text, (v) Mr

John Millman for statistical analysis and (vi) Dr Peter Keating and Dr Brent Stewart

for their suggestions and contributions to the figures and text and (vii) Mr Ryan

Southall, Mr Oscar Kolai and Dr Peter Kesners for the laboratory testing of samples.

The contributions of visitors to the CYO quarterly meetings to this manuscript must be

acknowledged. To Professor Stephen Oppenheimer, Professor Michael Chorney and

Professor WenJie Zhang, thankyou for your questions, comments, discussions and

contributions.

- 113 -

CHAPTER 4

EXTENSIVE GENOMIC POLYMORPHISM OF THE CR1

REGION: RCA ANCESTRAL HAPLOTYPES, FUNCTION AND

DISEASE

The work described in this chapter has been submitted for publication:



region: RCA ancestral haplotypes, function and disease". Immunogenetics

- 114 -

McLure et al Page 1

Extensive genomic polymorphism of the CR1 region: RCA

ancestral haplotypes, function and disease.

Craig A McLure1,2, Joseph F Williamson

1,2, Louise A Smyth

1,2, Suraksha Agrawal

3

, Susan Lester2,4, John A Millman

2,5,Peter J Keating

2, Brent J Stewart

1,2& Roger

L Dawkins1,2,6

1Centre for Molecular Immunology and Instrumentation, University of Western Australia,

Nedlands, Western Australia 6907

2C.Y. O’Connor ERADE Village, PO Box 5100, Canning Vale, Western Australia 6155

3Department of Medical Genetics, Sanjay Gandhi Institute of Medical Sciences, Lucknow India

226014

4Arthritis Research Laboratory, Hanson Institute, Frome Road Adelaide, South Australia 5000

5TAFEWA Swan Campus, Hayman Road, Bentley, Western Australia 6102

Manuscript number 0408 of the Centre for Molecular Immunology and Instrumentation of the

University of Western Australia and the C Y O’Connor ERADE Village.

Sequences submitted to Genbank: Accession No’s DQ007054-DQ007076

6Correspondence should be addressed to RLD:

Professor Roger Dawkins

CY O’Connor ERADE Village

PO Box 5100

Canning Vale South

Western Australia 6155

Facsimile: +618 9397 1559

Email: [email protected]

McLure et al Page 2

Using a combination of genomic markers we show that there are more

than 20 distinct Ancestral Haplotypes (AH)1 of Complement Control

Proteins (CCPs) at 1q32. This extensive polymorphism is important

because CCPs are involved in the Regulation of Complement Activation

(RCA) whilst also serving as viral receptors 2.

To screen for haplotypes, we have developed the Genomic Matching

Technique (GMT) based on the pragmatic observation that extreme

nucleotide polymorphism is packaged with duplicated sequences.

Within the Major Histocompatibility Complex (MHC) at 6p21.3, these

regions or quanta are well characterised and are designated

Polymorphic Frozen Blocks (PFB). At each PFB, there are many

alternative sequences (haplotypes) which have become frozen in that

they are inherited faithfully from very remote ancestors. Such AH are

critical in transplantation and disease 1.

We have compared RCA haplotypes in diverse diseases and report that

the frequencies differ in conditions such Recurrent Spontaneous Abortion

(RSA) and Psoriasis Vulgaris (PV)

The many and diverse duplications of CCPs have been described

elsewhere 3-5. Several categories of duplicons were evaluated using

GMT. For example, as shown in Fig. 1, there is an extensive segmental

McLure et al Page 3

duplication involving Complement Receptor 1 (CR1) and Membrane

Cofactor Protein (MCP). With primers P5+6 designed to amplify at

duplicated sites separated by hundreds of kilobases, we observed

multiple diverse products in a screening panel of 60 human subjects

selected to include the major ethnic groups and some relevant diseases.

As shown in Fig. 2, there are 1, 2 or 3 products in the range around 300bp

and 0, 1, 2 or 3 products in the range around 350 bp. Each of the 11

subjects has a unique composite profile. As shown in Fig. 3, these are

highly reproducible with only minor differences under different conditions

of amplification.

We then studied 3 generation families in order to determine whether

combinations of products define transmissible haplotypes. The families

had already undergone MHC typing which was consistent with stated

parentage. In all cases, the RCA haplotypes were unequivocal and

faithfully transmitted. For example, as shown in Fig. 4, each product can

be numbered according to length such that I 1 in family 1 has the 4,5

and 16 profile which resolves through segregation analysis into two

haplotypes (a=4 with null and b=5 with 16) and therefore the genotype

4,0;5,16. Note also that in II 2 (ac), the intensity of product 4 is increased

in keeping with the genotype 4,0;4,14 and homozygosity of 4. Similarly, in

Family 2, I1 (ab) is homozygous for 5.

McLure et al Page 4

In spite of some homozygosity, there is extreme polymorphism as

illustrated by the fact that there are 11 different profiles and genotypes in

the 12 subjects. In each family there are 3 unrelated individuals

(ab,cd,ef). In these 6 subjects there are 9 different haplotypes. In the

case of the 4,0 and 5,0 haplotypes the frequencies were 2/12 and 3/12

respectively suggesting that these may be relatively common and

functionally important ancestral haplotypes. We therefore reviewed the

profiles of the panel of 60 subjects and found that most haplotypes

could be assigned using the iterative strategies described in the

methods.

Confirmation of these assignments was obtained by amplifying other

duplicated sequences with primers 11 and 12 shown in Fig. 1 and by

determining the presence or absence of the BstN1 (G3093T) cutting site 6

on different haplotypes (Table 1). These results demonstrated that the

haplotypes contain haplospecific features at multiple sites. For example

02 contains 4,0 with P5+6, and 1, 13 with P11 +12 and is G3093 whereas

08 is P5+6=6,13 and P11+12=5,11 and is G3093T.

We then tested a separate panel of 322 subjects. The frequencies of

haplotypes in this dataset are as expected from the 2 smaller panels and

are shown in Table 1 which also proposes designations for the more

common ancestral haplotypes.

McLure et al Page 5

To characterise the haplotypes in more detail we sequenced

representative P5+6 products. Based on the available genomic

sequences, we expected that the products of less than 331 bp would be

from CR1 and those above 331 would be from CR1-like (see Fig. 2). We

therefore established operational criteria for assignment using the

patterns shown in Fig. 6. All sequences were as expected.

As shown in Table 1 and Fig 1, some haplotypes fail to generate a CR1-

like product when amplified with P5+6. Since P11+12 yield 2 products per

haplotype we conclude that there is a further polymorphism, probably

an indel, which negates amplification with P5+6 on the CR1-like null

haplotypes. Of further interest, the data suggest that some haplotypes

contain more than 2 duplicons. In fact, on longer gels there are

additional products which have not been shown here.

CCPs are found in clusters around the genome including the MHC where

they are within the early complement components C2 and Bf. The major

cluster at 1q32, designated the RCA complex, contains critical genes

such as MCP, CR1 and CR2 and has many important functions including

viral receptors. CR1 is a receptor for C4 which is itself a highly

polymorphic component of the MHC gamma PFB. It is not surprising that

CR1 polymorphism has been sought for many decades especially in

relation to the possibility that deficient or defective CR1 might be

expected to be associated with poor control of C4 activation and

McLure et al Page 6

therefore disease. Although most results have been disappointing and

controversial there is now evidence that some point mutations or single

nucleotide polymorphisms, such as that revealed by BstN1, may be

important in function and diseases such as in malaria and Systemic Lupus

Erythematosus (SLE) 6,7. These studies illustrate the need for haplotyping

as a means of identifying linked polymorphisms including those of

functional significance.

In the case of CR1-like, some interesting possibilities have been raised by

the finding that there can be an expressed and functional product in

humans as well as Non Human Primates 8. Our demonstration of

extensive polymorphism in both CR1 and CR1-like suggests that there

may be quantitative differences in function and susceptibility to disease.

Meaningful clinical studies using the haplotypes described here are now

possible.

In Table 2 we show the frequencies in the panel of 322 arranged by

clinical subset. The distribution of CR1-01 is similar in all groups but

CR1-02 is rare in patients with RSA and frequent in those with Psoriasis

Vulgaris(PV) (Fig 6). The reverse is seen with CR1-04 and - 08. Indeed

when haplotypes are compared in terms of RSA-P v PV the ratios vary

tenfold. Note also that more than 50% of haplotypes are yet to be

defined in RSA-P whereas the corresponding figure in PV is 10-19%.

McLure et al Page 7

These results provide the first evidence for a role of the RCA complex in

RSA. This finding is entirely consistent with the important role of RCA

products in the outcome of pregnancy in mice. 9,10

The present study provides another example of the utility of the GMT

approach. This simple procedure has demonstrated linked

polymorphisms including at least one of functional significance 6. Short of

sequencing and somehow assembling hundreds of kilobases in at least

30 subjects, we know of no other approach which could reveal more

than 20 different haplotypes with such extensive polymorphism. The

rationale for the assay is that sequence polymorphism is concentrated in

some regions or quanta, which, in our experience, are also rich in

duplications. It remains to be determined which particular category of

duplicon is most useful but, in the meanwhile, we recommend the use of

larger segments with major indels and therefore differences in length

when the 2 or more copies are compared. Such features apply to the

MHC as well as to the current study. It is important to emphasise that the

relationship between polymorphism and duplication is complex 5 and

unrelated to whether one copy is a pseudogene.

Insertions and deletions (indels) are also associated with concentrations

of polymorphism 11. These indels are often complex and degenerate

suggesting a mechanism for divergence between the different

duplicons. As described in Fig. 1, the sequence amplified includes an L1

McLure et al Page 8

(L1M5 or L1P4) which must have anteceded the duplication but which is

different when the 2 copies are compared. There are also differences in

the 5’ sequence but most of the variations in length are due to the very

complex TC rich region which we refer to as a Polymorphic or

Haplospecific Geometric Element (HGE). This contrasts with a

microsatellite in that there are diverse units of different lengths and yet

the sequences have a geometric pattern (Fig. 6). Other features we

associate with such HGEs are stability, complementary sequences,

uniqueness within the genome and extreme polymorphism. A study using

microsatellites in the vicinity of CR1 revealed little polymorphism but did

suggest that there is limited recombination as predicted by the PFB

hypothesis .12

PFBs are remarkable since, although they contain extreme

polymorphism, duplicons and indels, they behave as though they

become frozen after which they appear to be resistant to recombination

and mutation. In terms of calculations of linkage disequilibrium, higher

values are found within, rather than between PFB, but cannot be

expected when haplotypes share common alleles in different

combinations.

The alternative sequences within a PFB (ancestral haplotypes) are

inherited faithfully over many generations. In the MHC, ancestral

haplotypes which are now found in tens of millions of the population

McLure et al Page 9

have proven, when sampled, to be identical at the sequence level. We

expect that the same will be true of CCP region and that these

conserved polymorphisms will be critical in explaining differences in

function and disease (see Fig.7). Included in the possibilities are

inflammatory diseases such as RSA, SLE and SS and differences in

susceptibility to viruses, such as measles, which exploit CCPs, such as

MCP, as receptors. 2.

Methods

To investigate polymorphism within the RCA region we needed an approach

which could interrogate extensive sequences so as to reveal the presence of

haplotypes. The GMT approach is designed to show sequence differences

between the maternal and paternal chromosomes by generating a sequence-

specific profile for each. For example, in the MHC, we have shown that a

particular amplification product may mark a sequence of 200Kb 1,13. Within this

sequence there are many expressed genes, each with a haplotypic allele.

There are also multiple noncoding differences at least some of which appear to

be important in regulation.

Thus, the GMT gives a simple signature for the entire haplotype of the PFB and is

therefore the best approach to matching for bone marrow grafting 14 and to

the identification of disease associations 1.

The GMT procedure used on this occasion involved the following steps:

1. Identification of duplicons.

The genomic region containing CR1, MCP-like, CR1-like and MCP at

1q32, was taken from the NCBI database

McLure et al Page 10

(http://www.ncbi.nlm.nih.gov/) (position 1124945–1449694 on contig

NT_021877.16 (gi:37539616); accession numbers AL691452.10,

AL137789.11, AL365178.10 and AL035209.1). This sequence was

compared against itself using Dotter 15 to identify evidence of

duplication 3-5.

2. Selection of primer sites present in all duplicons.

Segment A, containing CR1 and MCP-like was compared to Segment B,

containing CR1-like and MCP. Regions within these two segments which

shared a complex geometric element were identified as targets 3. The

geometric element must vary in size between the duplicates (see Figs. 1

& 6) but also contain enough homology either side of the element so as

to enable the design of primers that will bind and amplify within each

segment. The resulting mix of products has the potential to define

extensive haplotypes.

Duplicons at position 1150081-1150372 (CR1) and 1322386-1322768 (CR1-

like) of NT_021877.16 were aligned using Clustalw

(http://www.es.embnet.org/cgi-bin/clustalw.cgi). Using Primer3

(http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi), primers were

designed so that a single primer pair will bind and amplify both

duplicates or even more if, as expected, there are more than two

duplicated segments on some haplotypes.

Primer sequences were compared to the NCBI databases using BLASTN

(http://www.ncbi.nlm.nih.gov/BLAST/) at low stringency. Sequence


identities which matched the primers in both the forward and reverse

directions were identified. The only significant matches for primers in

question were in close proximity and it could therefore be assumed the

primer pair would amplify within a PFB. Analysis of the amplified

elements with matches from the Celera database (NT_086601 position

1267344-1267734) suggests the duplicated elements are polymorphic

between individuals (Fig. 1). The intention is to amplify as many

duplicated sites as possible so long as there is no amplification of

unlinked sequences. In the case of the RCA complex, there is a risk of

interference from unlinked priming because CCPs are widely distributed.

Accordingly, we used a three generation nuclear family to test the

selected primers. If the primers are valid, segregation through

generations should be apparent.

3. Comparison of products within 3 generation families

Families with disputed paternity were avoided. Individuals were

compared as blind pairs. Amplicon peaks were numbered successively.

4. Assignment of haplotypes

Once the profiles of individual subjects were defined and compared, the

data were interpreted within the context of the family structure. For

example, the grandfather is designated ab and the grandmother cd.

Next, the second generation, designated II, is inspected to determine

which part of the parental profiles were transmitted. In this way a,b,c,

and d haplotypes can be deduced. As a test of the validity of these

assignments, the next generation (III) is examined. Haplotypic profiles


from generation I should be retained even when they are associated

with haplotypes not present in the previous two generations.

5. Determination of population frequencies with comparison of functions

and diseases.

Haplotypic profiles verified by family studies were given a number here

referred to as 01,02…99 (see Table 1). These profiles can then be

recognised in other families and in other homozygotes. Having defined

common ancesteral haplotypes, we then examine heterozygotes to

determine if 2 assigned haplotypes are present. Product intensity is also

considered as illustrated in Fig. 4. We use the Hardy Weinberg test as an

indication of the validity of assignments. Population and disease studies

are then justified.

We also generated all theoretically possible haplotypes from the alleles

found in each subject. Those occurring in more than 3 subjects were

considered further. In some cases, the frequencies were similar to those

shown in Table 1 but there were major differences. Some of the

common theoretically possible haplotypes were not observed as

homozygotes and were not assigned.

Amplification and analysis of CR1 and CR1-like Haplospecific Geometric

Elements (HGEs)

Genomic DNA was prepared using the standard salting-out method.

Primer Sequences:

P5+6


CR1MCP5 5ÀAT TCC AAA TTG GCC TGG TTG A 3` and

CR1MCP6 5`CCT TCC CTT TGA GAT GTG GAA CA 3`.

P11+12

CR1MCP11 5` GTC AGC TTG GAT TGC CCT TGG TTC TA

CR1MCP12 5` CCT GGG CAA CAA AGC AAG ACA TTG T

Polymerase Chain Reaction:

PCR reactions were performed in a 96-well Palm Cycler (Corbett Research) in

20µl volumes using 100 ng of template DNA, 1.3 U Taq Polymerase (Fisher

Biotec), 10 pmol of the forward and reverse CR1MCP primers, 200µM of each

dNTP, 2 mM MgCl2 and 1X PCR buffer (Fisher Biotec). The samples were

denatured at 940C for 5 min, followed by 30 cycles each comprising 30 seconds

at 940C, 45 seconds at 580C and 45 seconds at 720C. The last cycle was

followed by an additional extension for 5 minutes at 720C.

Detection of amplicons and haplotypes:

The separation and detection of the allelic variants of CR1 and CR1-like was

done with the Corbett Research GS-3000 automated gel analysis system. One

microlitre of PCR product was mixed with 1 µl of loading buffer containing

Puc19 molecular weight ladder. One microlitre of the PCR sample and loading

buffer mixture was then added to a 32 cm long, 48 well, 4% polyacrylamide,

ultra-thin gel and pulsed for 10 seconds. Excess sample was then flushed and

the gel was run at 2000 V for 180 minutes.


Gel analysis and profile generation.

The gel image was analysed using BioRad Quantity One gel analysis software.

Lanes were defined, amplicons detected and standards assigned. Densimetric

profiles were generated and lanes were aligned using the internal pUC19/Hpa II

(Fisher Biotec) standards.

CR1 and CR1-like Sequencing

Primer Sequences:

CR1 specific primers

CR1-F1 5’AAT TCC AAA TTG GCC TGG TT 3’ and

CR1-R1 5ÀAA CTTT AAC TTT GAG ATG TGG AAC A 3’

CR1-like specific primers

CR1MCP5 5ÀAT TCC AAA TTG GCC TGG TTG A 3` and

CR1MCP6 5`CCT TCC CTT TGA GAT GTG GAA CA 3`.

Band purification and sequencing

PCR products were analysed using a 2% agarose gel. Individual bands were cut

from the gel and purified using Amersham Biosciences GFX PCR Gel Band

Purification Kit. The purified products were amplified as above and sequenced.

BstN1 digestion


Polymorphism at nucleotide 3093 was detected using PCR amplification

and BstN1 digestion. This was performed using primers and methods

detailed by Birmingham6. PCR conditions were as above, except the

annealing step was at 60°C for 45 seconds. Sequence analysis suggest

that the primers amplify the site telomeric of CR1 j1 (repeated in CR1 as

shown in Fig. 1) but not CR1-like because of differences in the primer

sites.

ACKNOWLEDGMENTS

We are grateful to Dr D Sayer and Royal Perth Hospital for the

sequencing of the products, Dr Peter Kesners for advice and Ms Wendy

Ford for administration. The samples designated RSA-C and RSA-P are

from the Sanjay Gandhi institute of Medical Sciences (SA) Those

designated ARL-C, SLE-P and SS are from the Arthritis Research

Laboratory, Hanson Institute (SL) with acknowledgements to Dr Maureen

Rischmueller of Rheumatology, The Queen Elizabeth Hospital, Adelaide .

The HCT and PV samples were described previously 16. Supported by

Australian Research Council, C Y O’Connor Village Foundation and

Genetic Technologies Ltd., Fitzroy, Victoria 3065, Australia.

CONFLICTS

As stated in the Form.


REFERENCES

1. Dawkins, R. et al. Genomics of the major histocompatibility complex:

haplotypes, duplication, retroviruses and disease. Immunological

Reviews 167, 275-304 (1999).

2. Dhiman, N., Jacobson, R. & Poland, G. Measles virus receptors: SLAM

and CD46. Reviews in Medical Virology 14, 217-229 (2004).

3. McLure, C. et al. Amino acid patterns within short consensus repeats

define conserved duplicons shared by genes of the RCA complex.

Journal of Molecular Evolution 59, 143-157 (2004).

4. McLure, C., Williamson, J., Stewart, B., Keating, P. & Dawkins, R. Genomic

analysis reveals a duplication of eight rather than seven SCRs in Primate

CR1 and CR1L: Evidence for an additional set shared between CR1 and

CR2. Immunogenetics 56, 631-638 (2004).

5. McLure, C., Williamson, J., Stewart, B., Keating, P. & Dawkins, R. Indels

and imperfect duplication have driven the evolution of human CR1 and

CR1-like from their precursor CR1 alpha: Importance of functional sets.

Hum Immunol 66, 258-273 (2005).

6. Birmingham, D.J. et al. A CR1 polymorphism associated with constitutive

erythrocyte CR1 levels affects binding to C4b but not C3b. Immunology

108, 531-538 (2003).

7. Moulds, J.M. et al. Molecular identification of Knops blood group

polymorphisms found in long homologous region D of complement

receptor 1. Blood 97, 2879-2885 (2001).

8. Logar, C.M., Chen, W., Schmitt, H., Yu, C.Y. & Birmingham, D.J. A human

CR1-like transcript containing sequence for a binding protein for iC4 is

expressed in hematopoietic and fetal lymphoid tissue. Molecular

Immunology 40, 831-40 (2004).


9. Xu, C. et al. A Critical Role for Murine Complement Regulator Crry in

Fetomaternal Tolerance. Science 287, 498-501 (2000).

10. Bell, E. Murine embryonic survival depends on regulation of complement.

Immunology Today 21, 109 (2000).

11. Longman-Jacobsen, N., Williamson, J.F., Dawkins, R.L. & Gaudieri, S. In

Polymorphic Genomic Regions Indels Cluster with Nucleotide

Polymorphism: Quantum Genomics. Gene 312, 257-261 (2003).

12. Heine-Suner, D. et al. A high-resolution map of the regulator of the

complement activation gene cluster on 1q32 that integrates new genes

and markers. Immunogenetics 45, 422-427 (1997).

13. Gaudieri, S., Longman-Jacobsen, N., Tay, G.K. & Dawkins, R.L. Sequence

Analysis of the MHC Class I Region Reveals the Basis of the Genomic

Matching Technique. Human Immunology 62, 279-285 (2001).

14. Witt, C. et al. Unrelated Donors Selected Prospectively by Block-

matching Have Superior Bone Marrow Transplant Outcome. Human

Immunology 61, 85-91 (2000).

15. Sonnhammer, E. & Durbin, R. A dot-matrix program with dynamic

threshold control suited for genomic DNA and protein sequence analysis.

Gene 167, GC1-10 (1995).

16. Korendowych, E. et al. Haplotypes associated with psoriasis, psoriatic

arthritis and haemochromatosis. in IHWG Press (in press, Seattle, 2002).

17. Hourcade, D., Holers, V.M. & Atkinson, J.P. The regulators of complement

activation (RCA) gene cluster. Advances in Immunology 45, 381-416

(1989).

18. Xiang, L., Rundles, J.R., Hamilton, D.R. & Wilson, J.G. Quantitative alleles

of CR1: coding sequence analysis and comparison of haplotypes in two

ethnic groups. J Immunol 163, 4939-45 (1999)


.Figure Legends

Figure 1. Multiple binding and amplification by primer pairs. Schematic

representation of the genomic region on 1q32 showing the duplicated

segments (purple and blue bars) containing the CR1 and MCP genes. The red

and green lines indicate the positions of the forward (CR1MCP 5) and reverse

primers (CR1MCP 6) designated P5+6. The amplified sequences of CR1 (purple)

and CR1-like (blue), including Celera, have been aligned to show conserved

regions flanking a polymorphic geometric element containing multiple complex

components which distinguish CR1 and CR1-like sequences. Black shading and

white text indicates conserved sequence. Numbers above and below the

alignment represent nucleotide positions of CR1-like (Celera - NT_086601) and

CR1 (NCBI – NT_021877.16) respectively. Also shown are locations of primers P

11+12 and BstN1 cutting sites (see Table 1). Conserved nucleotides at CR1-like

positions 289-391 are part of a L1 element.

Figure 2. Genomic polymorphism within the CR1/MCP duplicons. GMT P5+6

profiles following polyacrylamide gel separation were overlayed using internal

molecular weight markers of 242, 331 and 404bp (solid vertical lines) .

Amplicons differ between individuals (broken vertical lines). Bands have been

assigned numbers from the smallest (1) to the largest (19). Some such as 8 are

rare in Caucasians


Figure 3. Reproducibility of the GMT profiles. GMT P5+6 profiles using different

PCR conditions demonstrate the reproducibility of the method. The internal

markers are as in Fig. 2.

Figure 4. Segregation of ancestral haplotypes. GMT P5+6 profiles from 3-

generation families confirm unequivocal segregation of haplotypes. In each

case the profile overlay has been restricted to 2 generations. Individual profiles

are coloured as shown in the family tree and the laboratory specimen codes.

The number assigned to each band is derived from Fig 2.

Figure 5. CR1.02 and CR1.08 haplotype frequencies differ in different clinical

groups.

RCA-C Recurrent Spontaneous Abortion control group; RCA-P - Recurrent

Spontaneous Abortion; HCT - Haemochromatosis; PV - Psoriasiss Vulgaris; ARL-C

– Adelaide Research Laboratory control group; SLE-P - Systemic Lupus

Erythematosus; SS - Sjögren's Syndrome; AH 02 = Ancestral Haplotype 02 -

P5+6=4,0;P11+12=1,13;BstN1-G is rare in RSA but common in PV whereas AH 08 -

Ancestral Haplotype 08 - P5+6=6,13;P11+12=5,11;BstN1-T shows the opposite.

Although less dramatic, the binomial probability mass function (EXCEL) shows a

decrease in 02 (p=0007) and an increase in 08 (p=002) when RSA-S is compared

to RSA-C.


Figure 6. Sequencing reveals the complexity of the haplospecific element and

differences between CR1 and CR1-like. Sequence alignment identifies

potential indels and polymorphic elements. The TC rich region is highly

polymorphic in keeping with other haplospecific elements. Black shading and

white text indicates consensus sequence on either side of the indel

polymorphic region. The differences between CR1-like and CR1 are (i) G at 101,

105, 109, 113, 126 and 130 (*); (ii) length differences between 102 and 281bp;

(iii) other indels. For the purposes of classifying the sequences of products we

used (i) with or without the remainder. Numbers above and below the

alignment represent nucleotide position of CR1-like (Celera - NT_086601) and

CR1 (NCBI - NT _021877.16) respectively. Note “Y” indicates nucleotide C/T.

Figure 7. Polymorphisms within SCR subfamilies

CCPs such as CR1, CR1-like and Crry contain Short Consensus Repeats 17 which

we have classified into subfamilies as a, b, c etc.3-5 Each CCP has its particular

order such as (ajefbkd)5 ch in the case of CR15 but the subfamilies are

remarkably conserved as indicated by the degree of shading. Some of the

known SNPs 6,7,18 have been mapped to the subfamilies since those changing

conserved residues are likely to have profound functional effects. SNPs within

a, j or e are likely to alter ligand binding.6 The BstN1 site is within j.

^ Translated from the mRNA sequence but absent in respective protein

sequence.

Note Hosa is Homo sapien, Mumu is Mus musculus, Rano is Rattus norvegicus,

Patr is Pan troglodytes, Paha is Papio hamadryas and Pacy is Papio

Cynocephalus.


Table 1. RCA haplotypes in an ethnically diverse DNA panel. The P5+6

haplotypes identified in the segregation studies and homozygotes were used to

deduce the haplotypes of additional unrelated individuals. A similar approach

was taken with P11+12 and the combination of P5+6 and P11+12 used to assign

the Ancestral Haplotype number. No deviation from Hardy-Weinberg

equilibrium was observed confirming that heterozygotes can be assigned. Only

the 15 most common are shown here. These account for approximately 70% of

the population studied. After assignment of these, BstN1 typing revealed that

each had either G or T at the cutting site on CR1. At least 15 rarer haplotypes

were identified but at a frequency of less than 1%. Some of these may be

ethnic specific. Some haplotypes also differ in minor bands not illustrated here.

Table 1

Ancestral GMT typing BstN1 Frequency

Haplotype P5+6 P11+12 typing n %

01 5,0 1,13 G 156-165 24-25

02 4,0 1,13 G 80-83 12-13

03 5,16 1,15 G 75-77 12

04 5,13 1,11 G 18-24 3-4

05 6,0 4,13 T 24-29 4

06 5,14 1,15 G 18 3

07 5,17 1,15 G 16 2

08 6,13 5,11 T 11-16 2

09 5,15 1,15 G 15 2

10 6,0 1,13 T 12-13 2

11 6,9 4,17 G 7-9 1

12 4,0 1,12 G 8 1

13 5,0 1,19 G 6-8 1

14 5,0 1,18 G 7-8 1

15 4,14 1,11 G 8 1

Sub-Total 461-497 71-77

Other 108-152 17-23

Total 569-649 88-100


Table 2. Percentage frequencies of ancestral haplotypes in different clinical

groups. Abbreviations as in Fig. 5. The n value refers to the number of

chromosomes and adds to 644. Because of some ambiguities, ranges of

frequency are shown in some instances and the total number of possible

haplotypes is 682. The percent frequencies are similar in the two control groups

and in HCT, SLE and SS but some haplotypes are strikingly different when RSA-P

and PV are compared.

Table 2

Diseasegroup

RSA-C RSA-P HCT PV ARL-C SLE-P SS

Number of chromosomes in sample

Ancestral n=74 n=92 n=48 n=132 n=84 n=58 n=156

Haplotype Haplotype Frequencies (%)

01 15 17-18 25 23-25 22-24 21-24 32

02 12 2-3 10 20 9-10 13-15 13

03 11 6-7 17 7 11-12 8 18

04 3 3-5 2 2-3 3 3 3-4

05 8 2 6 4-7 2-3 3 2

06 2 1 3 5 6

07 6 3 3 2 3

08 1 6-9 2 3 1 2-3 1

09 1 2 4 2 5 1

10 1-3 2 2 4 1 1

11 2 1-2 2 2 1

12 4 1 3 1

13 3 1 2 1-2

14 1 2-3 2 3 1

15 3 1 1 1 2

Other 42-43 51-59 17 10-19 29-34 26-32 15-17

Number of possible haplotypes

n=76 n=102 n=48 n=142 n=92 n=62 n=160

BstN

1 R

FLP locatio

ns

Po

lym

orp

hic

Geo

metr

ic E

lem

en

t

5' C

on

served

Reg

ion

1

1 0

2 0

2 5

2 6

2 9

3 0

3 1

4 0

4 1

5 0

6 0

7 0

8 0

8 1

8 2

9 0

9 5

CR1-like (NT_086601)

AATTCCAAATTGGCCTGGTTGACACTGTACAAAACCACCAGATAATTATAATTTTATTTAACTCTTTGTCTTCTTTTCTTT----CCTTCCCTCCTTCC

CR1-like (NT_021877.16)AATTCCAAATTGGCCTGGTTGACACTGTACAAAACCACCAGATAATTATAATTTTATTTAACTCTTTGTCTTCTTTTCTTT----CCTTCCCTCCTTCC

CR1 (NT_021877.16)

AATTCCAAATTGGCCTGGTTGACATGGTGCCAAACCACCAAATAATTATAATTTTATTTAACTCTTTGTCTTCTTTTCTTTCTTTCCTTCCCTCCCTCC

11 0

2 0

2 5

2 6

2 9

3 0

3 1

4 0

4 1

5 0

6 0

7 0

8 0

8 2

8 3

8 4

8 5

9 0

9 9

9 6

9 8

1 0 0

1 1 0

1 2 0

1 3 0

1 4 0

1 5 0

1 6 0

1 7 0

1 8 0

1 9 0

1 9 4


CTTCTGCCTGCCTGCTTGCCTTCCTTCTTTGCTTGCTTCCTTCCTTCCTCCCTCCCTCCATCCCTCCCTTCCTCCCTCCCTCCCTTCCTTCCTTCCTTC

CR1-like (NT_021877.16)CTTCTGCCTGCCTGCTTGCCTTCCTTCTTTGCTTGCTTCCTTCCTTTCTCCCTCCCTTCCTCCCTCCTTTCCTTCCTTCCTCCCTCCCTCCCTCCCTTC

CR1 (NT_021877.16)

CTCCT-----------------------------------------------------------------------TTCCTCCCTCCCTCCCTCCCTCC

1 0 0

1 0 2

1 0 4

1 0 5

1 1 0

1 2 0

1 2 7

Po

lym

orp

hic

Geo

metr

ic E

lem

en

t3

' C

on

served

Reg

ion

1 9 5

2 0 0

2 1 0

2 2 0

2 3 0

2 4 0

2 5 0

2 6 0

2 7 0

2 8 0

2 9 0

2 9 3


CTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCCTCCTTCCCTCCTTCCCTCCTTCCCTCCTTCCCTCCTTCCCTCCTTTCCTTCTCCTTATTTT

CR1-like (NT_021877.16)CTCCCTCCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCCTCCTTCCCTCCTTCCCT--------CCTTTCCTTCTCCTTATTTT

CR1 (NT_021877.16)

CTCCCTCCCTTCCTTCCTTCCTTCCTTCTTTCCTTCCTTCCTTCCTTCCTTCCCT-------------------------CTTTCCTT------ATTTT

1 2 8

1 3 0

1 4 0

1 5 0

1 6 0

1 7 0

1 8 0

1 8 2

1 8 3

1 9 0

1 9 1

1 9 5

2 9 4

3 0 0

3 1 0

3 1 1

3 1 2

3 2 0

3 3 0

3 4 0

3 5 0

3 6 0

3 7 0

3 8 0

3 8 6

3 8 7

3 9 0

3 9 1


CTTTCTTCTTTACCACAC-GGCTAGGACCACCAGTATAACATTGAACATTGGTAGCAATAGATGTCATCCTTGTCTTGTTCCACATCTCAAAGGGAAGG

CR1-like (NT_021877.16)CTTTCTTCTTTACCACAC-GGCTAGGACCACCAGTATAACATTGAACATTGGTAGCAATAGATGTCATCCTTGTCTTGTTCCACATCTCAAAGGGAAGG

CR1 (NT_021877.16)

CTTTCTTCTTTACCACGCTGGCTAGGACCACCAGTATAACATTGAACATTGGTAGCAATAGATGTCATCCTTGTCTTGTTCCACATCTCAAAGTTAAAG

1 9 6

2 0 0

2 1 0

2 1 2

2 1 4

2 2 0

2 3 0

2 4 0

2 5 0

2 6 0

2 7 0

2 8 0

2 8 9

2 9 0

2 9 3

2 9 4

3' C

on

served

Reg

ion

a

10

0 k

b3

00

kb

20

0 k

b

CR

1M

CP

LC

R1L

MC

P

Segm

entA

Segm

ent B

CR

2C

D34

40

0 k

b5

00

kb

Figu

re 1

- M

ultip

le b

indi

ng a

nd a

mpl

ifica

tion

by p

rim

er p

airs

CR

1MC

P11

&C

R1M

CP

12

CR1MCP6

CR1MCP5

CR

1MC

P11

&C

R1M

CP

12

CR

1MC

P5

& C

R1M

CP

6C

R1M

CP

5&

CR

1MC

P6

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0

1 4 0 R 8 8 / 1 4 0 6 2

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0

1 4 0 C 0 4 / 5 4 9 K

0

5 0

1 0 0

1 5 0

2 0 0

2 5 0 R 8 6 / 1 2 2 9 3

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0

1 4 0 R 8 / 5 2 5 1 9

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0

1 4 0 U 9 8 / 4 2 3 9 K

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0 C 0 4 / 5 5 9 C

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0 C 0 4 / 15 6 F

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0

1 4 0 C 0 4 / 1 5 7 M

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0 C 0 4 / 5 6 7 G

0

5 0

1 0 0

1 5 0

2 0 0 R 9 2 / 2 2 8 4 3 W

0

2 0

4 0

6 0

8 0

1 0 0 C 9 7 / 10 3 9 V

0 1 20 39 58 77 96 115

134

153

172

191

210

229

248

267

286

305

324

343

362

381

400

419

438

457

476

495

514

533

552

571

404bp

191817161514131211109

331bp

87654321

242bp

Run Duration

Ban

d In

tens

ity

Figure 2. Genomic polymorphism within the CR1/MCP duplicons

R88/14062

C04/549K

R86/12293

R88/52519

U98/4239K

C04/559C

C04/156F

C04/157M

C04/567G

R92/22843W

C97/1039V

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0

1 4 0

1 6 0C 0 4 / 15 6 F " L R "

Ban

dIn

tens

ity

C04/156F

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0C 0 4 / 15 6 F " L M "

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0C 0 4 / 15 6 F " K Y "

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0C 0 4 / 15 6 F " L P "

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0

1 4 0C 0 4 / 15 6 F " L Q "

0 1 16 31 46 61 76 91 106

121

136

151

166

181

196

211

226

241

256

271

286

301

316

331

346

361

376

391

406

421

436

451

466

481

496

511

526

541

PCR Annealingtemp = 56oC





Run Duration

Ban

dIn

tens

ity

Run Duration

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0

1 4 0C 0 4 / 15 7 M " L R "

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0C 0 4 / 1 5 7 M " K Y "

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0C 0 4 / 15 7 M " L P "

0

2 0

4 0

6 0

8 0

1 0 0

1 2 0

1 4 0

1 6 0C 0 4 / 15 7 M " L Q "

0 1 16 31 46 61 76 91 106

121

136

151

166

181

196

211

226

241

256

271

286

301

316

331

346

361

376

391

406

421

436

451

466

481

496

511

526

541





C04/157M

Figure 3 – Reproducibility of the GMT profiles

020406080100

120

140 0

20

40

60

80

100

120

140

I 1 C04/0162X

5I 1a C04/0163D

51617

II 1 C04/0175J

516

II 1a C04/0176Q

56

20

III 1 C04/0174C

516

20

III 2 C04/0159A

56

III 3 C04/0177X

56

Obs

erve

dS

egre

gati

on

242bp

331bp

Ded

uced

Gen

otyp

es

404bp

BandIntensity BandIntensity

489bp

501bp

5

6

1617

16

5

20

IIIIII

1a1

41

21a

3

1

IIIIII

1a1

41

21a

3

1

ab

= 5, 0; 5, 0

cd

= 5,16; 5,17

ac = 5, 0; 5,16

ef

= 5,20; 6, 0

ce

= 5,16; 5,20

af

= 5, 0; 6, 0

af

= 5, 0; 6, 0

4

I

1a

1

41

21a

3

1

IIIII

4

I

1a

1

41

21a

3

1

IIIII

020406080100

120

140 020406080100

120

140

I 1

C04/0157M

45

16

I 1a

C04/0156F

46

914

II 2

C04/0172P

414

II 3

C04/0164K

56

916

II 3a

C04/0220C

45

III 1

C04/0165R

56

9III 2

C04/0166Y

46

9

BandIntensity BandIntensity

Obs

erve

dSe

greg

atio

nD

educ

edG

enot

ypes

16

9

645

242bp

331bp

404bp

489bp

501bp

I

IIIII

1

12

3

12

33a

211a

2

I

IIIII

1

12

3

12

33a

211a

2

4

56

91416

I

IIIII

1a

1

12

33a

12

1aI

IIIII

1a

1

12

33a

12

1a1

a1

12

33a

12

1a

ab= 4, 0; 5,16

cd= 4,14; 6, 9

ac = 4, 0; 4,14

bd= 5,16; 6, 9

ef= 4, 0; 5, 0

fd= 5, 0; 6, 9

ed = 4, 0; 6, 9

Family1

Family2

Figure4-Segregationofancestralhaplotypes

RSA-C RSA-P HCT PV ARL-C SLE-P SS Total

Clinical Status

0

10

20

2

4

AH

02

(%

Fre

qu

en

cy)

AH

08

(%

Fre

qu

en

cy)

6

Figure 5. CR1.02 and CR1.08 haplotype frequencies differ in different clinical groups.

8

5' Conserved R

egio

nPoly

morphic

Geom

etric

Ele

ment

3' Conserved R

egio

n

2 5

2 6

2 9

3 1

4 1

5 2

8 1

9 0

9 7

9 8*

**

*

1 4 1

1 5 0

1 5 1

1 5 2

1 5 3

1 5 5

1 5 7

1 6 5

1 6 6

1 7 3

1 7 7

1 7 8

2 0 5

2 0 7

2 2 6

2 7 3

2 7 4

2 7 8

2 7 9

2 8 4

2 8 9

3 1 0

3 2 7

3 8 6

3 8 7

3 9 0

CR1-like

(N

T086601)

CT

AA

GT

T-

--

-C

CT

TC

CC

TT

CT

G(

CC

TG

)2

CT

TG

(C

CT

T)2

CT

TT

(G

CT

T)2

(C

CT

T)2

-C

CT

CA

CT

(C

CT

C)2

C(

CC

TT

)7

C(

CC

TT

CC

CT

)6

CT

CC

TT

CT

AA

-T

GG

G

CR1L_09001

(D

Q007064)

CT

AA

GA

T-

--

-C

CT

TC

CC

TT

CT

G(

CC

TG

)2

CT

TG

(C

CT

T)2

CT

TT

(G

CT

T)2

(C

CT

T)2

-C

CT

CA

CT

(C

CT

C)2

C(

CC

TT

)1

C(

CC

TT

CC

CT

)5

CT

CC

TT

CT

AA

-C

GG

G

CR1L_09501

(D

Q007065)

CT

AA

GA

T-

--

-C

CT

TC

CC

TT

CT

G(

CC

TG

)2

CT

TG

(C

CT

T)2

CT

TT

(G

CT

T)2

(C

CT

T)2

-C

CT

CA

CT

(C

CT

C)2

C(

CC

TT

)2

C(

CC

TT

CC

CT

)5

CT

CC

TT

CT

AA

-C

GG

G

CR1L_09501

(D

Q007066)

CT

AA

GA

T-

--

-C

CT

TC

CC

TT

CT

G(

CC

TG

)2

CT

TG

(C

CT

T)2

CT

TT

(G

CT

T)2

(C

CT

T)2

-C

CT

CA

CT

(C

CT

C)2

C(

CC

TT

)2

C(

CC

TT

CC

CT

)5

CT

CC

TT

CT

AA

-C

GG

G

CR1L_09501

(D

Q007067)

CT

AA

GA

T-

--

-C

CT

TC

CC

TT

CT

G(

CC

TG

)2

CT

TG

(C

CT

T)2

CT

TT

(G

CT

T)2

(C

CT

T)2

-C

CT

CA

CT

(C

CT

C)2

C(

CC

TT

)2

C(

CC

TT

CC

CT

)5

CT

CC

TT

CT

AA

-C

GG

G

CR1L_10001

(D

Q007068)

CT

AA

GT

T-

--

-C

CT

TC

CC

TT

CT

G(

CC

TG

)2

CT

TG

(C

CT

T)2

CT

TT

(G

CT

T)2

(C

CT

T)2

-C

CT

CA

CT

(C

CT

C)2

C(

CC

TT

)3

C(

CC

TT

CC

CT

)5

CT

CC

TT

CT

AA

-T

GG

G

CR1L_15001

(D

Q007069)

CT

AA

GT

T-

--

-C

CT

TC

CC

TT

CT

G(

CC

TG

)2

CT

TG

(C

CT

T)2

CT

TT

(G

CT

T)2

(C

CT

T)2

-C

CT

CA

CT

(C

CT

C)2

C(

CC

TT

)6

C(

CC

TT

CC

CT

)6

CT

CC

TT

CT

AA

-T

GG

G

CR1L_13001

(D

Q007070)

CT

AA

GT

T-

--

-C

CT

TC

CC

TT

CT

G(

CC

TG

)2

CT

TG

(C

CT

T)2

CT

TT

(G

CT

T)2

(C

CT

T)2

-C

CT

CA

CT

(C

CT

C)2

C(

CC

TT

)6

C(

CC

TT

CC

CT

)5

CT

CC

TT

CT

AA

-T

GG

G

CR1L_13001

(D

Q007071)

CT

AA

GT

T-

--

-C

CT

TC

CC

TT

CT

G(

CC

TG

)2

CT

TG

(C

CT

T)2

CT

TT

(G

CT

T)2

(C

CT

T)2

-C

CT

CA

CT

(C

CT

C)2

C(

CC

TT

)6

C(

CC

TT

CC

CT

)5

CT

CC

TT

CT

AA

-T

GG

G

CR1L_17001

(D

Q007072)

CT

AA

GT

T-

--

-C

CT

TC

CC

TT

CT

G(

CC

TG

)2

CT

TG

(C

CT

T)2

CT

TT

(G

CT

T)2

(C

CT

T)2

-C

CT

CA

CT

(C

CT

C)2

C(

CC

TT

)8

C(

CC

TT

CC

CT

)6

CT

CC

TT

CT

AA

-T

GG

G

CR1L_11001

(D

Q007073)

CT

AA

GT

T-

--

-C

CT

TC

CC

TT

CT

G(

CC

TG

)2

CT

TG

(C

CT

T)2

CT

TT

(G

CT

T)2

(C

CT

T)2

-C

CT

CA

CT

(C

CT

C)2

C(

CC

TT

)6

C(

CC

TT

CC

CT

)4

CT

CC

TT

CT

AA

-T

GG

G

CR1L_14001

(D

Q007074)

CT

AA

GT

T-

--

-C

CT

TC

CC

TT

CT

G(

CC

TG

)2

CT

TG

(C

CT

T)2

CT

TT

(G

CT

T)2

(C

CT

T)2

-C

CT

CA

CT

(C

CT

C)2

C(

CC

TT

)7

C(

CC

TT

CC

CT

)5

CT

CC

TT

CT

AA

-T

GG

G

CR1L_14001

(D

Q007075)

CT

AA

GT

T-

--

-C

CT

TC

CC

TT

CT

G(

CC

TG

)2

CT

TG

(C

CT

T)2

CT

TT

(G

CT

T)2

(C

CT

T)2

-C

CT

CA

CT

(C

CT

C)2

C(

CC

TT

)7

C(

CC

TT

CC

CT

)5

CT

CC

TT

CT

AA

-T

GG

G

CR1L_14001

(D

Q007076)

CT

AA

GT

T-

--

-C

CT

TC

CC

TT

CT

G(

CC

TG

)2

CT

TG

(C

CT

T)2

CT

TT

(G

CT

T)2

(C

CT

T)2

-C

CT

CA

CT

(C

CT

C)2

C(

CC

TT

)7

C(

CC

TT

CC

CT

)5

CT

CC

TT

CT

AA

-T

GG

G

CR1_05001

(D

Q007054)

TG

GC

AT

TC

TT

T-

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

-C

--

--

TT

C(

CC

TC

)5

C(

CC

TT

)5

T(

CC

TT

CC

CT

)1

-T

--

--

--

AG

TT

TT

A

CR1_05001

(D

Q007055)

TG

GC

AT

TC

TT

T-

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

-C

--

--

TT

C(

CC

TC

)5

C(

CC

TT

)5

T(

CC

TT

CC

CT

)1

-T

--

--

--

AG

TT

TT

A

CR1_05001

(D

Q007056)

TG

GC

AT

TC

TT

T-

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

-C

--

--

TT

C(

CC

TC

)5

Y(

CC

TT

)5

T(

CC

TT

CC

CT

)1

-T

--

--

--

AG

TT

TT

A

CR1_05001

(D

Q007057)

TG

GC

AT

TC

TT

T-

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

-C

--

--

TT

C(

CC

TC

)5

Y(

CC

TT

)5

T(

CC

TT

CC

CT

)1

-T

--

--

--

AG

TT

TT

A

CR1_04001

(D

Q007058)

TG

GC

AT

TC

TT

T-

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

-C

--

--

TT

C(

CC

TC

)4

C(

CC

TT

)5

T(

CC

TT

CC

CT

)1

-T

--

--

--

AG

TT

TT

A

CR1_04001

(D

Q007059)

TG

GC

AT

TC

TT

T-

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

-C

--

--

TT

C(

CC

TC

)4

C(

CC

TT

)5

T(

CC

TT

CC

CT

)1

-T

--

--

--

AG

TT

TT

A

CR1_06001

(D

Q007060)

TG

GC

AT

TC

TT

T-

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

-C

--

--

TT

C(

CC

TC

)4

C(

CC

TT

)7

C(

CC

TT

CC

CT

)1

-T

--

--

--

AG

TT

TT

A

CR1_07001

(D

Q007061)

TG

GC

AT

TC

TT

T-

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

-C

--

--

TT

C(

CC

TC

)4

C(

CC

TT

)8

C(

CC

TT

CC

CT

)1

-T

--

--

--

AG

TT

TT

A

CR1_03001

(D

Q007062)

TG

GC

AT

TC

TT

T-

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

-C

--

--

TT

C(

CC

TC

)3

C(

CC

TT

)5

T(

CC

TT

CC

CT

)1

-T

--

--

--

AG

TT

TT

A

CR1_04002

(D

Q007063)

TG

GC

AT

TC

TT

T-

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

-C

--

--

TT

T(

CC

TC

)4

C(

CC

TT

)5

T(

CC

TT

CC

CT

)1

-T

--

--

--

AG

TT

TT

A

CR1

(N

T_021877.1

6)

TG

GC

AT

TC

TT

T-

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

-C

--

--

TT

C(

CC

TC

)4

C(

CC

TT

)5

T(

CC

TT

CC

CT

)1

-T

--

--

--

AG

TT

TT

A

2 5

2 6

2 9

3 1

4 1

5 2

8 1

8 2

8 3

8 4

8 5

9 4

1 0 4

1 0 6

1 1 4

1 1 5

1 3 0

1 3 4

1 3 5

1 5 4

1 5 6

1 7 5

1 8 2

1 8 6

1 9 1

2 1 2

2 1 4

2 3 0

2 8 9

2 9 0

2 9 3

CR1-like D

efinin

g R

egio

nPoly

morphic

Ele

ments

Fig

ure

6.

Se

qu

en

cin

g r

eve

als

th

e c

om

ple

xity o

f th

e h

ap

losp

ec

ific

ele

me

nt

an

d d

iffe

ren

ce

s b

etw

ee

n CR1

an

d CR1-like

.

§ No residues

a C x x P x x x x x A x x x x x x x x x x F P x G T x L x Y E C x P x Y x x x x F S I x C x x x x x W x x x x D x C 57

b C Q P P P x x L H x E x x x x x x x x F x x G x E V x Y x C x P x Y D L R G x x x x x C x P Q G D W x P x x P x C 57

Hosa_CR1_5 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S M R C T P Q G D W S P A A P T C E V K S



Patr_CR1_5 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S L R C T P Q G D W S P A T P T C E V K S

Patr_CR1_14 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S L R C T P Q G D W S P A A P T C E V K S

Paha_CR1_5 C Q P P P D V L H G E R T Q R D K D I F Q T G Q E V F Y I C E P G Y D L R G A A S L R C T P Q G D W S P A A P R C E V K S

Paha_CR1_12 C Q P P P D V L H G E R T Q R D K D I F Q P G Q E V F Y I C E P G Y D L R G A A S L R C T P Q G D W S P A A P R C E V K S

Hosa_CR1-like_5 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G S T Y L H C T P Q G D W S P A A P R C

Patr_CR1-like_5 C Q P P P D V L H G E R T Q R D K D N F S P G E E V Y Y S C E P G Y D L R G S T Y L H C T P Q G D W S P E A P R C

Hosa_CR1_26 C Q P P P E I L H G E H T P S H Q D N F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R C A V K S

Patr_CR1_21 C Q P P P E I L H G E H T P S H Q D N F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R C A V K S

Patr_CR1_28 C Q P P P E I L H G E H T P S H Q D N F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R C T V K S

Paha_CR1_26 C Q P P P E I L H G E H T P S H Q D K F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P I C T V K S

Pacy_CR1-like_5 C Q P P P E I L H G E H T P S H Q D F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W N P E A P I C

Paha_CR1_19 C Q P P P E I L H G E H T P S H Q D K F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R C A V K S

Hosa_CR1_33 C Q P P P E I L H G E H T L S H Q D N F S P G Q E V F Y S C E P S Y D L R G A A S L H C T P Q G D W S P E A P R C T V K S

Patr CR1-like 10 C Q P P P E I L H G E H T L S H Q D N F S P G Q D V F Y S C E P G Y D L R G A A S L H C T P Q G D W T P E A P R C

Hosa_CR1-like_10 C Q P P P E I L H G E H T L S H Q D N F L P G Q E V F Y S C E P S Y D L R G A A S L H C M P Q G D W T P E A P R C

c C P x P P K I Q N G H x I G G H V S L Y L P G M T I x Y I C D P G Y L L V G K G x I F C T D Q G I W S Q L D H Y C 57

Hosa_CR1_36 C P D P P K I Q N G H Y I G G H V S L Y L P G M T I S Y I C D P G Y L L V G K G F I F C T D Q G I W S Q L D H Y C K E V N

Patr_CR1_31 C P H P P K I Q N G H D I G G H V S L Y L P G M T I S Y I C D P G Y L L V G K G F I F C T D Q G I W S Q L D H Y C K E V N

Paha_CR1_29 C P H P P K I Q N G H Y I G G H V S L Y L P G M T I G Y I C D P G Y L L V G K G I I F C T D Q G I W S Q L D H Y C K E V N

d C P x P P x I x N G R H x G x x x x x x P x G K x x x Y x C D P H x D R G x x x x L I G E S x I R x T S x x x G N G V W S S x A P R C 67

Patr_CR1_8 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T T F D L I G E S T I R C T S D P Q G N G V W S S P A P R C G I L G H



Hosa_CR1_7 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T S F D L I G E S T I R C T S D P Q G N G V W S S P A P R C G I L G H

Hosa_CR1_21 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T S F D L I G E S T I R C T S D P Q G N G V W S S P A P R C G I L G H

Hosa_CR1_14 C P S P P V I P N G R H T G K P L E V F P F G K T V N Y T C D P H P D R G T S F D L I G E S T I R C T S D P Q G N G V W S S P A P R C G I L G H

Paha_CR1_7 C P S P P V I P N G R H T G K P L E V F P F G K A V T Y T C D P H P D R G M T F D L I G E S T I R C T S D P Q G N G V W S S P A P R C G I L G H

Paha_CR1_14 C P S P P V I P N G R H T G K P L E V F P F G K A V T Y T C D P H P D R G M T F D L I G E S T I R C T S D P Q G N G V W S S R A P R C G I L G H

Hosa_CR1_28 C P N P P A I L N G R H T G T P S G D I P Y G K E I S Y T C D P H P D R G M T F N L I G E S T I R C T S D P H G N G V W S S P A P R C E L S V R A G H

Patr_CR1_23 C P N P P A I L N G R H T G T P F G D I P Y G K E I S Y T C D P H P D R G M T F N L I G E S T I R C T S D P H G N G V W S S P A P R C E L P V H A G H

Hosa_CR1_35 C P N P P A I L N G R H T G T P F G D I P Y G K E I S Y A C D T H P D R G M T F N L I G E S S I R C T S D R Q G N G V W S S P A P R C E L S V P A A

Patr_CR1_30 C P N P P A I L N G R H T G T P F G D I P Y G K E I S Y A C D T H P D R G M T F N L I G E S S I R C T S D P Q G N G V W S S P A P R C E L S V P A A

Hosa CR1-like 12 C P N P P A I L N G R H T G T P P G D I P Y G K E V S Y T C D P H P D R G M T F N L I G E S T I R R T S E P H G N G V W S S P A P R C

Patr CR1-like 12 C P N P P A I L N G R H T G T P L G D I P Y G K E V S Y T C D P H P D R G M T F N L I G E S T I R C T S D P H G N G V W S S P A P R C

Paha_CR1_21 C P N P P A I L N G R H T G A L L G D I P Y G K E I S Y T C D P H R D R G M T F N L I G E S T I R C T S D L Q G N G V W S S P A P R C E L S V R A G H

Paha_CR1_28 C P N P P A I L N G R H T G T P L G D I P Y G K E V S Y T C D P H P D R G M T F N L I G E S T I R C T S D L Q G N G V W S S P A P R C E L S V P A A

Pacy_CR1-like_7 C P N P P A I L N G R H I G A P L G D I P Y G K E V S Y I C D P H P D R G M T V N L I G E S T I R C T S D P Q G N G V W S S P A P R C

e C x x P P x I x N G D F x S x x R x x F x x x x V V T Y x C x x x x x x x x x F x L V G E x S x x C T S x x x x x G x W S x P x P x C 67

Hosa_CR1_10 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q C I I P N K

Hosa_CR1_17 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q C I I P N K

Hosa_CR1_3 C G L P P T I T N G D F I S T N R E N F H Y G S V V T Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q C I I P N K

Patr_CR1_3 C G L P P T I T N G D F I S T N R E N F H Y G S V V T Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q C I I P N K

Hosa_CR1_24 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N L G S R G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q C I I P N K

Patr_CR1_12 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N P G S R G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q C I I P N K

Patr_CR1_19 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N L G S R G R K V F E L V G E P S I Y C T S N D D Q V G I W A P Q C I I P N K

Paha_CR1_10 C G L P P P I A N G D F I S T N R E Y F H Y G S V V T Y R C N L G S G R K K L F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q C I I P N K

Pacy_CR1-like_3 C G L P P T I A N G D F I S T S R E Y F P Y G S V V T Y R C N L G S G R K K L F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q C

Paha_CR1_17 C G L P P P I A N G D F I S T N R E Y F H Y G S V V T Y R C N L G S G R K K L F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q C

Hosa_CR1-like_3 C G L P P T I A N G D F T S I S R E Y F H Y G S V V T Y H C N L G S R G K K V F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q C

Patr_CR1-like_3 C G L P P T I A N G D F T S I S R E Y F H Y A S V V T Y H C N L G S G G K K V F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q C

Paha_CR1_3 C G L P P T I D N G D F F S A N K E Y F H Y G S V V T Y R C N L G S G G R K L F E L V G E P S I Y C T S N E D Q V G I W S G P A P Q C I I P N K

Hosa_CR1-like_8 C G L P P N I T N G Y F I S T D R E Y F H Y G S V V T Y H C N L G S R G R K V F E L V G E P S I Y C T S K D D Q V G V W S G P V P Q C

Patr_CR1-like_8 C G L P P N I T N G Y F I S T D R E Y F H Y G S V V T Y R C N L G S R G R K V F E L V G E P S I Y C T S K G D Q V G V W Q C

Rano_Crry_3 C E I P P S I P N G D F F S P N R E D F H Y G M V V T Y Q C N T D A R G K K L F N L V G E P S I H C T S I D G Q V G V W S G P P P Q C I E L N K

Mumu_Crry_3 C E I P P G I P N G D F F S S T R E D F H Y G M V V T Y R C N T D A R G K A L F N L V G E P S L Y C T S N D G E I G V W S G P P P Q C I E L N K

Hosa_CR1_31 C E P P P T I S N G D F Y S N N R T S F H N G T V V T Y Q C H T G P D G E Q L F E L V G E R S I Y C T S K D D Q V G V W S S P P P R C I S T N K

Patr_CR1_26 C E P P P T I S N G D F Y S N N R A S F H N G T V V T Y Q C H T G P D G E Q L F E L V G E R S I Y C T S K D D Q V G V W S S P P P R C I S T N K

Paha_CR1_24 C K P P P T I S N G D F Y S N N R T S F H S G T V V T Y Q C H T G P D G E Q L F E L V G E R S I Y C T S K D D Q V G A W S S P P P R C I S T N K

f C x x P x V x x x x x x x x N x S x F S L x x x V x F R C x x G F x M x G x x x V x C x x x x x W x P x L P x C 56

Hosa_CR1_32 C T A P E V E N A I R V P G N R S F F S L T E I V R F R C Q P G F V M V G S H T V Q C Q T N G R W G P K L P H C S R V

Patr_CR1_27 C T A P E V E N A I R V P G N R S F F S L T E I V R F R C Q P G F V M V G S H T V Q C Q T N G R W G P K L P H C S R V

Paha_CR1_25 C T A P E V K N G I R V P G N R S F F S L N E I V R F R C Q P G F V M V G S H T V Q C Q T N N R W G P K L P H C S R V

Rano_Crry_4 C T P P H V E N A V I V S K N K S L F S L R D M V E F R C Q D G F M M K G D S S V Y C R S L N R W E P Q L P S C F K V K S

Mumu_Crry_4 C T P P P Y V E N A V M L S E N R S L F S L R D I V E F R C H P G F I M K G A S S V H C Q S L N K W E P E L P S C F K G V I

Hosa_CR1_4 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R R V K C Q A L N K W E P E L P S C S R V




Patr_CR1_13 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F A M K G P R R V K C Q A L N K W E P E L P S C S R V

Patr_CR1_4 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P P R V K C Q A L N K W E P E L P S C S R V

Patr_CR1_20 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P H R V K C Q A L N K W E P E L P S C S R V

Patr_CR1-like_9 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C L P G F V M K R P P P R V Q C Q A L N K W E T E L P S C

Hosa_CR1-like_9 C T P P N V E G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P H R V Q C Q A L N K W E T E L P S C

Pacy_CR1-like_4 C M P P N V E N G V L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R H V Q C Q A L N K W E P E L P S C

Patr_CR1-like_4 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R H V H C Q A L N K W E P E L P S C

Paha_CR1_11 C M P P N V E N G I L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R R V Q C Q A L N K W E P E L P S C S R V

Paha_CR1_18 C M P P N V E N G I L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R R V Q C Q A L N K W E P E L P S C S R V

Paha_CR1_4 C T P P N V E N G I L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R R V Q C Q A L N K W E P E L P S C S R V

Hosa_CR1-like_4 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F G M K G P S H V K C Q A L N K W E P E L P S C

g-like x x x P H I x N G F R I x x x x P x x F x x x x x x x x x x x x x x x x x x x x x x x x x x

h C x x P x x M x G x x K x L x M K K x Y x Y G x x V x L x C E D G Y x L E G S x x S Q C Q x D x x W x P x L x x C 57

j C x x P x x P x N G x V H x x x x x x x G S x x x Y x C x x G x R L x G x x x x x C x x x x x x x x W x x x x P x C 58

Pacy_CR1-like_2 C R N P K D P V N G M V H V I K D I Q F G S Q I N Y S C N K G Y R L I G S S S A T C I I S G N T V I W D N E T P I C

^ Paha_CR1_2 C R N P R D P V N G M V H V I K D I Q F G S Q I N Y S C T E G H R L I G S S S A T C I I S G N T V I W D N E T P I C E K I S

Patr_CR1-like_2 C R N P P D P V N G M V H V I K D I Q F G S Q I K Y S C T K G Y R L I G S S S A T C I I S G N T V I W D N K T P V C

Hosa_CR1-like_2 C R N P P D P V N G M A H V I K D I Q F G S Q I K Y S C P K G Y R L I G S S S A T C I I S G N T V I W D N K T P V C

Patr_CR1_2 C R N P P D P V N G M V H V I K D I Q F G S Q I K Y S C T K G Y R L I G S S S A T C I I S G D T V I W D N E T P I C D R I P

Hosa_CR1_2 C R N P P D P V N G M V H V I K G I Q F G S Q I K Y S C T K G Y R L I G S S S A T C I I S G D T V I W D N E T P I C D R I P

Rano_Crry_2 C E T P L D P Q N G I V H V N T D I R F G S S I T Y T C N E G Y R L I G S S S A M C I I S D Q S V A W D A E A P I C E S I P

Mumu_Crry_2 C K T P S D P E N G L V H V H T G I Q F G S R I N Y T C N Q G Y R L I G S S S A V C V I T D Q S V D W D T E A P I C E W I P

Hosa_CR1_9 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N A A H W S T K P P I C Q R I P

Hosa_CR1_16 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N A A H W S T K P P I C Q R I P

Patr_CR1_11 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N A A H W S T K P P I C Q R I P

Patr_CR1_18 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N S A H W S T K P P I C Q R I P

Hosa_CR1_23 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N T A H W S T K P P I C Q R I P

Paha_CR1_16 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I I S G N T A H W S T K P P I C Q R I P

Paha_CR1_9 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C V T S G N T A H W S T K P P I C Q R I P

Hosa_CR1-like_7 C E T P P V P V N G M V H V I T D I H V G S R I N Y S C T T G H R L I G H S S A E C I L S G N T A H W S M K P P I C

Patr_CR1-like_7 C E T P P V P V N G M V H V I T D I H V G S R I N Y S C I T G H R L I G H S S A E C I L S G N T A H W S M K P P I C

Hosa_CR1_30 C G P P P E P F N G M V H I N T D T Q F G S T V N Y S C N E G F R L I G S P S T T C L V S G N N V T W D K K A P I C E I I S

Patr_CR1_25 C G P P P E P F N G M V H I N T D T Q F G S T V N Y S C N E G F R L I G S P S T T C L V S G N N V T W D K K A P I C E I I S

Paha_CR1_23 C G T P P E P F N G M V H I N T D T Q F G S T V N Y S C N E G F R L I G S P S T T C L V S G N N V T W D K E A P I C E I I S

k C x x x x G x L x x G x V x x P x x L Q L G A K V x F V C x x G x x L K G x x x S x C V L x G x x x x W N x S V P V C 59

Figure 7. Polymorphism within SCR submfamilies

A3650G

H1208R

G5575C

D1850H

A4041C

SILENTC5507G

P1827R

A4828G

R1601G

T4855A

S1610T

A4870G

I1615V

G3093T

Q981H

C5654T

T1876I

T455C

V115A

A1360G

T445A

T2078C

I684T

A4795G

K1590E

- 115 -

- 145 -


GMT APPLICATIONS IN THE CANINE

The following chapter extends the application of the GMT to the canine genome by

utilising the duplication of DQ alpha and beta genes in the Dog Leukocyte Antigen

(DLA).

To do this, I used a similar approach as that described in chapter 4, by firstly identifying

the duplication, examining the duplicates for polymorphic loci and designing primers

that would amplify within each duplicon.

Initial results revealed extensive polymorphism within a family of 15 Blue Heelers.

Segregation of the profiles was faithful and in line with the results obtained through

conventional typing methods. As we would have predicted, the GMT results are in fact

more discriminatory than the current SBT and microsatellite methods used.

The discrimination by the GMT, in addition to its reduced cost, makes it a more feasible

alternative than those methods currently employed to determine MHC alleles and

parentage.


and assistance in the compilation of this study (ii) Dr Peter Kesners for the compilation

of data and figures, (iii) Ms Susan Lester for the DLA DQ and DR SBT of the Blue

Heeler family (iv) Dr Claire Amadou for annotation of the DLA class II genes and the

MHC class II analyses, (v) Dr Brent Stewart for the collection of specimens, (vi) Dr

- 146 -

Dean Male and Genetic Technologies Ltd for the Microsattelite typing of the Blue

Heeler Family and for providing other canine sspecimens, (vii) Dr Joseph Williamson

for his comments and suggestion to the text. Mr Ryan Southall and Mr Oscar Kalai for

for the laboratory testing of samples.

- 147 -

CHAPTER 5

HAPLOTYPING OF THE CANINE MHC WITHOUT THE NEED

FOR DLA TYPING

The work described in this chapter is in preparation for publication:

McLure, C., P. Kesners, S. Lester, D.Male, C. Amadou, J. Dawkins, B. Stewart, J.

Williamson and R. Dawkins. (In Press). "Haplotyping of the Canine MHC without the

need for DLA typing". Intl J. Immunogenetics

- 148 -

- 149 -

Haplotyping of the Canine MHC without the need for DLA

typing

Craig A McLure1,2, Peter W Kesners1,2, Susan Lester2,3, Dean Male4, Claire

Amadou2, John R Dawkins2, Brent J Stewart1,2, Joseph F Williamson1,2 & Roger L

Dawkins1,2,6

1Faculty of Medicine and Dentistry, University of Western Australia, Nedlands, Western

Australia 6907


3Arthritis Research Laboratory, Hanson Institute, Frome Road Adelaide, South Australia 5000

4 Genetic Technologies Ltd, 66 Hanover St, Fitzroy, Victoria 3065

Manuscript number 0504 of the C Y O’Connor ERADE Village.




PO Box 5100

Canning Vale South


Facsimile: +618 9397 1559


- 150 -

Abstract

The Genomic Matching Technique has proven useful in MHC haplotyping in man. We

have adopted a similar approach in Australian Cattle Dogs and report that genotyping

can be achieved with a single assay.

Keywords

Genotyping, Haplotypes, MHC, Dog.

Introduction

Recently, there has been widespread demand for genotyping of dogs. The purposes can

be classified into three major categories:

1. PROOF OF IDENTITY AND PARENTAGE

Identification through DNA profiling has become necessary for purebred dogs to be

registered with the American Kennel Clubs (DeNise et al. 2004) and is already

established as the gold standard in other species. Electronic methods such as

microchips do not, in themselves, provide identity, parentage or genetic background.

Microchip identification has been subject to abuse.

2. BREED CHARACTERISATION AND EVOLUTION

Many dog breeds are being characterised with the intention of defining DNA based

criteria. There is increasing interest in the evolution of breeds and in addressing the

paradox whereby genetically distinct breeds have evolved very recently from a

- 151 -

common ancestral pool.(Hedrick et al. 2003; Kennedy et al. 2002a) As in other

species, the first target is to be able to confirm or deny outcrossing but the ultimate

hope is to identify the genes which are responsible for the characteristics of each

breed whilst allowing selection for desirable traits.

3. ELIMINATION OF DISEASE AND IDENTIFICATION OF GENES IN

CANINE MODELS OF HUMAN DISEASE

Although, as expected with inbreeding, there are many recessive monogenic

diseases, it is now appreciated that there are many others which are polygenic and

therefore difficult to address using existing methods. It is known that dogs have

similar genomic architecture to man and develop many diseases which closely

resemble their human counterparts suggesting that the genetics and the

pathophysiology may be similar.(Debenham et al. 2005; Ollier et al. 2001; Wagner

2003) In some instances, such as myasthenia gravis, the diseases appear to be the

same (Garlepp et al. 1984). Identification of disease susceptibility genes in either

species would benefit both.

Existing methods have shortcomings with respect to one or more of these purposes.

1. DNA PROFILING

Although microsatellites have proven useful in terms of identity checking,

evolutionary studies and disease linkage, they are of limited value in distinguishing

between members of a highly inbreed group. Further, some of the selected

microsatellites are relatively uninformative whether due to instability or limited

- 152 -

polymorphism. Improvements can be obtained by testing more sites and by

selecting more stable and more complex sequences (Williamson et al. 2003)but

advantages in terms of identification come at cost in terms of breed characterisation

and other applications. Even with high volumes and multiplexing, the capital cost

can be high.

2. MONOGENIC TESTING

Although useful in relation to the detection of known mutations, such as those

responsible for blindness, (Acland et al. 1998; Kijas et al. 2003) these tests have

limited utility in other respects. As the number of mutation-specific tests increases,

so the battery of tests required becomes impractical.

3. GENOTYPING OF POLYMORPHIC LOCI

Molecular typing of the DR and DQ genes is now well established (Kennedy et al.

2002b) and serves as an example of the power of typing polymorphic loci. Based

on the experience in man, this approach will be useful in all respects, including

disease association, simply because of the extraordinary degree of stable

polymorphism. (Sayer et al. 2001) However, the cost of sequence based typing is

significant and, as other loci are added, the problem compounds.

With the above purposes and shortcomings in mind, we have evaluated an approach,

which has proven useful in other species.(Gaudieri et al. 2001; Martinez et al. 1994) At

issue was whether it would be possible to apply a single cost effective approach to

contribute to all major issues requiring solutions.

- 153 -

The principle of the assay is to target regions of the genome with maximal information

content. We have found that the genome is actually quite uneven in the distribution of

critical polymorphic regions. Polymorphic frozen blocks are rich in nucleotide diversity,

indels, duplications and disease genes and can be located using appropriate

bioinformatic tools(Dawkins et al. 1999).

Methods

The 3 generation family

The test panel consisted of 21 Blue heelers (Australian Cattle Dogs) including, 1

grandmother designated “cd”, 2 parents designated “ac” and “ef” and 15 puppies from 2

matings designated “ae”, “af”, “ce” or “cf”.

DLA Sequence Based Typing (SBT)

DLA DRB1, DQA1, DQB1 typing was performed by sequence based typing using 14th

IHWC DLA Workshop protocols. Allele nomenclature and sequence alignments.

(http://www.ebi.ac.uk/ipd/mhc/dla/align/html)

Microsatellite Profiling

Microsatellite profiling was undertaken using sequences as described by Francisco

(Francisco et al. 1996) and Halverson (Halverson et al. 1995)

GMT Approach

The GENOMIC MATCHING TECHNIQUE is based on generating haplotype markers

with a single primer pair which amplifies duplicated sites (Figure 1). A single test

identifies maternal and paternal haplotypes of sequences of up to several hundred

- 154 -

kilobases. Within this sequence are multiple linked polymorphisms, both coding and

non coding, indels and duplications. Thus, differences in copy number and regulation

can be detected and, in this way, there is more information than with the alternative

tests. Importantly, the cost is less rather than more. The DLA GMT method was

designed using the following steps:

1. Identification of duplicons.

The genomic region containing DLA DQA1 and DQB1 , was taken from the

NCBI database (http://www.ncbi.nlm.nih.gov/) (positions DQA1, GeneID:

474861, pos 133484 to 168500 and DQB1, GeneID: 474862 pos 185720C to

222182 on contig NW_139872.1 (gi: 54126008). This sequence was compared

against itself using Dotter (Sonnhammer and Durbin 1995) to identify evidence

of duplication.

2. Selection of primer sites present in all duplicons.

Segment A, containing DQA1 was compared to Segment B, containing DQB1.

Regions within these two segments which shared a complex geometric element

were identified as targets. The geometric element must vary in size between the

duplicates but also contain enough homology either side of the element so as to

enable the design of primers that will bind and amplify within each segment.

The resulting mix of products has the potential to define extensive haplotypes.

Duplicons at position 143791-144189 (DQA1) and 210163-210376 (DQB1) of

NW_139872.1 were aligned using Clustalw (http://www.es.embnet.org/cgi-

bin/clustalw.cgi). Using Primer3 (http://frodo.wi.mit.edu/cgi-

bin/primer3/primer3_www.cgi), primers were designed so that a single primer

- 155 -

pair will bind and amplify both duplicates or even more if, as expected, there are

more than two duplicated segments on some haplotypes.

Primer sequences were compared to the NCBI databases using BLASTN

(http://www.ncbi.nlm.nih.gov/BLAST/) at low stringency. Sequence identities

which matched the primers in both the forward and reverse directions were

identified. The only significant matches for primers in question were in close

proximity and it could therefore be assumed the primer pair would amplify

within a PFB. The intention is to amplify as many duplicated sites as possible

so long as there is no amplification of unlinked sequences. Linkage of amplified

products is tested by segregation through a three generation nuclear family. If

the primers are valid, segregation through generations should be apparent.

3. Amplification and analysis of DLA DQ alpha and DLA DQ beta

Haplospecific Geometric Elements (HGEs)

Genomic DNA was prepared using the standard salting-out method.

Primer Sequences:

Cafa class II

F1 5` AAA TAG CCT GGC TTT CTT TAC A 3` and

R1 5’ CAA CCA ACA ATT TCT GGG ACA 3`

F2 5` TCT GGC ATA TAG AAA GCA CTC TG 3` and

R2 5` CCT CCC TTC CCA CCT AAT GT 3`

F3 5` ATT TGC TCA AGG TCC ATC CA 3` and

R3 5` TAT GGA AAC CAC CAA AGT GC 3`

- 156 -

Polymerase Chain Reaction:

PCR reactions were performed in a 96-well Palm Cycler (Corbett Research) in

20µl volumes using 100 ng of template DNA, 1.3 U Taq Polymerase (Fisher

Biotec), 10 pmol of the forward and reverse Cafa class II primers, 200µM of

each dNTP, 2 mM MgCl2 and 1X PCR buffer (Fisher Biotec). The samples were

denatured at 940C for 5 min, followed by 30 cycles each comprising 30 seconds

at 940C, 45 seconds at 590C and 45 seconds at 720C. The last cycle was followed

by an additional extension for 5 minutes at 720C.

Detection of amplicons and haplotypes:

The separation and detection of the allelic variants of DQ alpha and DQ beta

was done with the Corbett Research GS-3000 automated gel analysis system.

One microlitre of PCR product was mixed with 1 µl of loading buffer containing

pUC19 molecular weight ladder. One microlitre of the PCR sample and loading

buffer mixture was then added to a 32 cm long, 48 well, 4% polyacrylamide,

ultra-thin gel and pulsed for 10 seconds. Excess sample was then flushed and the

gel was run at 2000 V for 180 minutes.

Gel analysis and profile generation.

The gel image was analysed using BioRad Quantity One gel analysis software.

Lanes were defined, amplicons detected and standards assigned. Densimetric

- 157 -

profiles were generated and lanes were aligned using the internal pUC19/Hpa II

(Fisher Biotec) standards.

Results

In the first instance we chose to compare the GMT of the delta block of the MHC with

molecular typing of DR and DQ. The results are shown in Figure 2.

Individuals are indicated by name and generation number. Thus Caddy’s daughter,

Petal, was mated twice with Plugger and had 7 and then 8 puppies. By convention I 1a

is cd, and II 1a is ef. After amplification with primer pair 1+2, each family member

gives 2 polymorphic products and these segregate as the maternal and paternal

haplotypes. Each animal can be assigned a genotype such as cf in III 1 and III 3 and ae

in III 2 and III 6.

When the family members were typed by SBT at the DR and DQ loci, the conclusions

were the same with the exception that the GMT results avoided ambiguities in allele

calling due to heterozygosity. Surprisingly, given the experience in humans, we are

able to correlate GMT products to alleles as well as haplotypes. For example, at least

within this family, we obtain surrogate DQB1 typing without the need for SBT. For

example P2, 4 and 5 mark DQB1 00301, 00501 and 02002 respectively. P9 and 8 split

DQB 00101 suggesting that GMT is not only simpler but also more informative.

When additional siblings were tested the conclusions were the same. When unrelated

Blue heelers were compared, additional products were seen but these also correlated

with DQB1 typing. Thus Ned had P5 and DQB1 2002, as expected, whereas the P3

- 158 -

product marks DQB1 02301 and P7, as with P8 and 9, marks DQB1 00101. Kinky

appeared to be homozygous by molecular typing but with GMT there was a second

higher molecular weight product which is yet to be characterized.

When the results were considered in terms of haplotypes, a and f are identical at

DRB1(00201), DQA1(00901) and DQB1(00101) but GMT indicates that there is a

specific and consistent difference at the sequence level. Note that a and f were present

in 2 generations and occurred separately or together in 15 subjects and can therefore be

assumed to be stable ancestral haplotypes. Further breeds will be examined to

determine the distribution of such haplotypes.

When microsatellite DNA profiling was compared with GMT, the conclusions were the

same in terms of parentage but more sites had to amplified and, as yet, there is no way

of haplotyping the MHC.

Conclusions

We conclude that GMT is a cost-effective alternative to SBT and microsatellite

profiling at least within the MHC. One simple assay produced unambiguous

genotyping of a three generation family. Each haplotype gave a unique product.

Surprisingly, these products also identified the DQB1 alleles unequivocally suggesting

that the polymorphic elements are remarkably specific at least within the Blue heeler

breed. Furthermore, GMT is more polymorphic than DQB1 in that the DRB1 00201,

DQA1 0901, DQB1 00101 haplotype by molecular typing actually splits into 2 ancestral

haplotypes. For the purpose of associating functions or diseases with MHC haplotypes,

GMT appears preferable.

- 159 -

The present study also demonstrates proof of principle with respect to the strategy of

identifying PFB and then duplicons which can be used to expand polymorphism over

those which could be demonstrated with a single amplicon. Undoubtedly, this

expansion is due to the differences in length and sequence content of the element,

differences in priming efficiency and potential interactions between the products.

It is now appropriate to apply the GMT strategy to the genotyping of other genomic

regions known to be highly polymorphic. The next region to be evaluated will be class

I within the MHC so that megabase (rather than kilobase) haplotypes can be identified

as in man. We will then address the RCA region which has already been haplotyped

successfully in man (McLure et al. Submitted). Similarly, we will use other gene

clusters known to encode disease susceptibility. In this way, a single GMT assay will

be able to contribute to the identification of individuals, breeds and diseases.

The same approach can be used to discover other polymorphic genomic regions. We

use bioinformatic tools to identify duplications and then PFB throughout the genome.

We expect that most of the important polymorphism will be contained within perhaps

10 regions each consisting of 2 or 3 blocks of several hundred kilobases. Thus as little

as 1% of the genome will provide a relatively high yield for all of our purposes.

In parallel with targeting blocks, we will take account of existing information on the

likely locations of disease genes with the intention of developing GMT assays which

will assist in the evaluation of monogenic as well as polygenic diseases.

- 160 -

References

Acland, G. M., Ray, K., Mellersh, C. S., Gu, W., Langston, A. A., Rine, J., Ostrander,

E. A., and Aguirre, G. D.: Linkage analysis and comparative mapping of canine

progressive rod-cone degeneration (prcd) establishes potential locus homology

with retinitis pigmentosa (RP17) in humans. Proc Natl Acad Sci U S A 95:

3048-53, 1998

Dawkins, R., Leelayuwat, C., Gaudieri, S., Tay, G., Hui, J., Cattley, S., Martinez, P.,

and Kulski, J.: Genomics of the major histocompatibility complex: haplotypes,

duplication, retroviruses and disease. Immunological Reviews 167: 275-304,

1999

Debenham, S. L., Hart, E. A., Ashurst, J. L., Howe, K. L., Quail, M. A., Ollier, W. E.,

and Binns, M. M.: Genomic sequence of the class II region of the canine MHC:

comparison with the MHC of other mammalian species. Genomics 85: 48-59,

2005

DeNise, S., Johnston, E., Halverson, J., Marshall, K., Rosenfeld, D., McKenna, S.,

Sharp, T., and Edwards, J.: Power of exclusion for parentage verification and

probability of match for identity in American Kennel Club breeds using 17

canine microsatellite markers. Anim Genet 35: 14-7, 2004

Francisco, L. V., Langston, A. A., Mellersh, C. S., Neal, C. L., and Ostrander, E. A.: A

class of highly polymorphic tetranucleotide repeats for canine genetic mapping.

Mamm Genome 7: 359-62, 1996

Garlepp, M. J., Kay, P. H., Farrow, B. R., and Dawkins, R. L.: Autoimmunity in

spontaneous myasthenia gravis in dogs. Clinical Immunology and

Immunopathology 31: 301 - 306, 1984

- 161 -

Gaudieri, S., Longman-Jacobsen, N., Tay, G. K., and Dawkins, R. L.: Sequence

Analysis of the MHC Class I Region Reveals the Basis of the Genomic

Matching Technique. Human Immunology 62: 279-285, 2001

Halverson, J., Dvorak, J., and Stevenson, T.: Microsatellite sequences for canine

genotyping., USA, 1995

Hedrick, P. W., Lee, R. N., and Buchanan, C.: Canine parvovirus enteritis, canine

distemper, and major histocompatibility complex genetic variation in Mexican

wolves. J Wildl Dis 39: 909-13, 2003

Kennedy, L. J., Barnes, A., Happ, G. M., Quinnell, R. J., Bennett, D., Angles, J. M.,

Day, M. J., Carmichael, N., Innes, J. F., Isherwood, D., Carter, S. D., Thomson,

W., and Ollier, W. E.: Extensive interbreed, but minimal intrabreed, variation of

DLA class II alleles and haplotypes in dogs. Tissue Antigens 59: 294-304, 2002a

Kennedy, L. J., Barnes, A., Happ, G. M., Quinnell, R. J., Courtenay, O., Carter, S. D.,

Ollier, W. E., and Thomson, W.: Evidence for extensive DLA polymorphism in

different dog populations. Tissue Antigens 60: 43-52, 2002b

Kijas, J. W., Miller, B. J., Pearce-Kelling, S. E., Aguirre, G. D., and Acland, G. M.:

Canine models of ocular disease: outcross breedings define a dominant disorder

present in the English mastiff and bull mastiff dog breeds. J Hered 94: 27-30,

2003

Martinez, O. P., Witt, C. S., Tay, G., Christiansen, F. T., and Dawkins, R. L.:

Immunogenetic analysis of successful and rejected bone marrow grafts within

one family. European Journal of Immunogenetics 21: 365-372, 1994

McLure, C., Williamson, J., Smyth, L., Agrawal, S., Lester, S., Millman, J., Keating, P.,

Stewart, B., and Dawkins, R.: Extensive genomic and functional polymorphism

of Complement Control Proteins. Submitted

- 162 -

Ollier, W. E., Kennedy, L. J., Thomson, W., Barnes, A. N., Bell, S. C., Bennett, D.,

Angles, J. M., Innes, J. F., and Carter, S. D.: Dog MHC alleles containing the

human RA shared epitope confer susceptibility to canine rheumatoid arthritis.

Immunogenetics 53: 669-73, 2001

Sayer, D., Whidborne, R., Brestovac, B., Trimboli, F., Witt, C., and Christiansen, F.:

HLA-DRB1 DNA sequencing based typing: an approach suitable for high

throughput typing including unrelated bone marrow registry donors. Tissue

Antigens 57: 46-54, 2001

Sonnhammer, E. and Durbin, R.: A dot-matrix program with dynamic threshold control

suited for genomic DNA and protein sequence analysis. Gene 167: GC1-10,

1995

Wagner, J. L.: Molecular organization of the canine major histocompatibility complex.

J Hered 94: 23-6, 2003

Williamson, J. F., Gaudieri, S., Longman-Jacobsen, N., and Dawkins, R. L.: The use

and abuse of microsatellites markers. In J. A. Hanson and B. Dupont (eds.),

HLA 2002 Immunobiology of the Human MHC, Seattle. IHWG Press, in press.

- 163 -

Figure legends

Figure 1. Differences between two ancestral haplotypes in the Human MHC.

Primers amplify polymorphic and duplicated sequences resulting in block specific PCR

profiles.

The polymorphic element varies in sequence structure and length. Different haplotyes

carry different numbers of copies of the polymorphic sequences.

Figure 2. MHC Genotyping Report.

Genotype analysis of 21 Blue Heeler dogs using GMT and a comparison to DLA alleles

assigned by conventional SBT. Figure 1a reports the results of GMT typing and DLA

DR, DQA and DQB of the 3-generation family. 3 unrelated individuals have also been

included. 1b shows the family tree of the grand parents, parents and offspring that have

resulted from two separate matings. 1c is a summary of the deduced DLA haplotypes.

Three unrelated Blue Heelers (Ned, Theo, Kinky) are included.

COMMENT

1. The Cafa_classII 1&2 primers amplify within DLA DQ alpha 1 and DQ beta 1

(NW_139872, positions 143791-144189 and 210163-210376 respectively).

- 164 -

- 167 -


GMT APPLICATIONS IN LIVESTOCK

The following chapter describes an area of interest I have had since the commencement

of my studies. The exciting results obtained through the study of the RCA genes have

resulted in limited time to devote to the livestock projects. I have however compiled a

DNA collection of over 250 specimens. These include several complete four generation

families from Simmentals, Dexters, Angus, Friesian and assorted crosses. All the

specimens collected have detailed phenotypic data, including whether they are

horned/polled, their temperament, coat colour and pedigree. This information has been

compiled in a database that was created specifically for this project by Dr Brent Stewart.

Screen shots of this software are included in the following manuscript along with a

detailed family tree of all Professor Dawkins cattle, from the last 20 years.

I have used the polling project as an example of the application of the GMT in

livestock. I have however, preliminary data for several other projects, including mastitis

and fine wool in sheep.

I am grateful to (i) Professor Roger Dawkins for his instruction and guidance in

working with cattle, collecting specimens and in the compilation of this manuscript, (ii)

Mr John Dawkins for assistance in the collection of specimens, (iii) Dr Brent Stewart

for the may hours spent creating “Beef Breeder” a database capable of handling the

large volume of phenotypic, specimen and genetic data that has been generated to date,

(iv) Mr Ryan Southall for assistance with DNA extractions and Dr Yang Da from the

- 168 -

University of Minnesota for kindly producing the complex family tree with his pedigree

software “Pedigraph”.

- 169 -

CHAPTER 6

IDENTIFICATION OF TRAITS AND FUNCTION IN LIVESTOCK

BY GENOMIC MATCHING: GENETIC DETERMINATION OF

HOMOZYGOUS AND HETEROZYGOUS POLLED CATTLE

The work described in this chapter is part of an Australian Research Council

(ARC) funded project and is in preparation for submission:

McLure, C., J. Dawkins, B. Stewart, and R. Dawkins. (In preparation). " Identification

of traits and function in livestock by genomic matching: Genetically determining


- 170 -

- 171 -

Identification of traits and function in livestock by genomic

matching: Genetically determining homozygous and

heterozygous polled cattle.

Craig A McLure1,2, John R Dawkins2, Brent J Stewart1,2 & Roger L Dawkins1,2,3

1Faculty of Medicine and Dentistry, University of Western Australia, Nedlands, Western

Australia 6907


Manuscript number 0000 of the C Y O’Connor ERADE Village.




PO Box 5100

Canning Vale South


Facsimile: +618 9397 1559


- 172 -

Abstract

A major aim is to apply our in-house patented DNA typing procedure (Genomic

Matching Technique, GMT) to commercially important problems in the livestock

industry. We (Gaudieri et al. 2001; Tay et al. 1995) and others (Witt et al. 2000) have

shown that the GMT method is the most cost effective way to identify donors for human

bone marrow transplantation. It does this because a single test can distinguish between

extensive sequences (up to 1 million bases), which contain the relevant genes. We refer

to each specific polymorphic sequence with its component alleles as a haplotype.

Introduction

One advantage of the method is that it is possible to type for traits and functions

encoded within a haplotype before the nature and function of all component genes are

known. Another advantage is that such explanatory studies become possible after the

relevant haplotypes are defined. However, it is worth emphasising that after 10 years

and huge effort in many laboratories, we still do not know precisely how the benefit in

transplantation is mediated and for this reason we prefer the GMT approach to more

classic alternatives which assume that functions can be deduced from sequence and

some simple in vitro reductionist experiments. Undoubtedly, there is far greater

complexity than some admit. Identifying the whole haplotype sequence is a critical first

step.

The GMT method was developed when we realised that functionally important regions

of the genome are characterised by historic duplications of stretches of DNA sequence.

Thus a clinically or commercially significant haplotype is a complex sequence with

many imperfect but specific iterations. To exploit this feature, we used the Polymerase

Chain Reaction (PCR) to amplify successive duplicons collectively. Because of the

- 173 -

haplospecific differences are effectively multiplied, the readout is a robust signature of

the haplotype. Because only a single test is required, the cost is a fraction of the

alternatives. GMT is now the gold standard for bone marrow matching in South East

Asia.

More recently we have demonstrated the applicability of the GMT outside the human

MHC (McLure et al. Submitted-a; McLure et al. Submitted-b). This suggests the GMT

will be just as informative in identifying genomic polymorphism and AHs in the bovine

genome. We have selected polling in cattle as a model.

The Problem

Polling is sometimes said to be a simple monogenic trait (Georges et al. 1993) but we

consider this misleading. It is true that polling (P) is dominant over horning (H). Thus in

general the genotypes PP and PH will be polled and HH will be horned. However it is

now clear that there must be interacting genes for head shape, scurring (loose horns) and

polling. Of note also is that there are different patterns of inheritance in different breeds

and we have observed that there are distinct degrees of horning. Some cattle designated

polled as calves develop small horns later in life. Some cattle need repeated dehorning.

Accordingly we postulate that there are at least several linked genes, which together

constitute a haplotype that controls several related functions, including rate of growth,

attachment and shape.

It follows that the genetics of horning may be ideal for GMT and that other attempts

may have failed because the complexity was underestimated. On the other hand

horning is not too complex in that at least most of the genes must be close together and

within a haplotype.

- 174 -

Methods

DNA Extraction

DNA was extracted from Acid Citrate Dextrose (ACD) treated whole blood by the

standard salting out protocol.

Pedigree analysis of 920 cattle

Figure 1 shows the pedigree of 920 cattle from Melaleuca Stud and was generated by

the pedigree analysis software, Pedigraph (Garbe and Da 2004).The records that were

used to form this complex family tree have been maintained by Professor Roger

Dawkins and Mr John Dawkins and date back over 20 years. As shown in Figure1, the

DNA collected includes many families with at least 4 generations. Many of the cattle

also have several offspring.

Beef breeder database

The beef breeder database is a data management tool that was developed specifically for

this project. The program incorporates the common stud management tools such as

animal parentage, administered therapeutics and phenotype as well as many tools for

laboratory sample management and genetic testing data. Various screenshots of this

database are shown in Figure 2.

The Genomic Matching Technique Approach

This will be done by using the limited published (Brenneman et al. 1996; Georges et al.

1993; Harlizius et al. 1997) and proprietary data on mapping of polling and then

applying the synteny strategy. We know the equivalent regions in other species

- 175 -

including man because for some years we have been pursuing comparative genomics

with the production of maps which show that vertebrates have the same basic genomic

structure albeit shuffled into patchworks which are species specific. Since we have

detailed sequence data on at least several examples of well studied species, we have

already designed primers which can be expected to amplify the relevant region of cattle.

Once candidate regions are identified, the following steps are taked:

1. Identify genomic duplication in candidate regions,

2. Examine duplications for conserved regions and polymorphic geometric elements

3. Design primers that amplify at multiple locations within a block

4. Test primers on a selection of individuals and examine amplicons for polymorphism

5. Segregate profiles to confirm primers are binding at linked loci.

6. Define Ancestral Haplotypes and associatiate with implicated phenotypes

Discussion

Irrespective of its interest scientifically, horn growth is emerging as a major issue in the

cattle industry. Firstly, horning is dangerous to workers and is therefore important in

terms of litigation and industrial relations. Secondly horned cattle injure each other and

inflict substantial bruising when transported. For these reasons, it is almost mandatory

to dehorn but there are several problems. Dehorning at birth disguises the phenotype so

that the distinction between polled and horned and degrees of horning is not apparent to

a breeder. This is one reason why horning genes remain so prevalent. More

importantly, dehorning later in life, when the phenotype is recognisable, is painful and

about to judged unacceptable unless performed under prohibitively expensive surgical

conditions.

- 176 -

We conclude that any simple and robust test for the preferred haplotypes encoding

minimal horn growth without deleterious associations will be valuable to the beef

industry. A test which is simple to collect and cheap to perform will be commercially

viable. Thus, we will use some of the DNA collected for other purposes such as ID,

pathogen tracing etc and aspire to a cost to the farmer of only $20 per head.

Acknowledgements

The authors would like to thank (i) Dr Yang Da for kindly generating the full pedigree

of the herd using his software Pedigraph (garbe et al, 2004), (ii) The CY O’Connor

ERADE Village Foundation, The Australian Research Council and Genetic

Technologies for their generous support.

- 177 -

References

Brenneman, R. A., S. K. Davis, J. O. Sanders, B. M. Burns, T. C. Wheeler, J. W. Turner

and J. F. Taylor (1996). "The polled locus maps to BTA1 in a Bos indicus x Bos

taurus cross." J Hered 87(2): 156-61.

Garbe, J. R. and Y. Da (2004). "Pedigraph user manual version 2.0 trail version."

Department of Animal Science, University of Minnesota.

Gaudieri, S., N. Longman-Jacobsen, G. K. Tay and R. L. Dawkins (2001). "Sequence

analysis of the MHC class I region reveals the basis of the genomic matching

technique." Hum Immunol 62(3): 279-85.

Georges, M., R. Drinkwater, T. King, A. Mishra, S. S. Moore, D. Nielsen, L. S.

Sargeant, A. Sorensen, M. R. Steele, X. Zhao and et al. (1993). "Microsatellite

mapping of a gene affecting horn development in Bos taurus." Nat Genet 4(2):

206-10.

Harlizius, B., I. Tammen, K. Eichler, A. Eggen and D. J. Hetzel (1997). "New markers

on bovine chromosome 1 are closely linked to the polled gene in Simmental and

Pinzgauer cattle." Mamm Genome 8(4): 255-7.

McLure, C., P. Kesners, S. Lester, D. Male, C. Amadou, J. Dawkins, B. Stewart, J.

Williamson and R. Dawkins (Submitted-a). "Haplotyping of the canine MHC

without the need for DLA typing."


Stewart and R. Dawkins (Submitted-b). "Extensive genomic and functional

polymorphism of Complement Control Proteins."

Tay, G. K., C. S. Witt, F. T. Christiansen, D. Charron, D. Baker, R. Herrmann, L. K.

Smith, D. Diepeveen, S. Mallal, J. McCluskey and et al. (1995). "Matching for

MHC haplotypes results in improved survival following unrelated bone marrow

transplantation." Bone Marrow Transplant 15(3): 381-5.

- 178 -

Witt, C., D. Sayer, F. Trimboli, M. Saw, R. Herrmann, P. Cannell, D. Baker and F.

Christiansen (2000). "Unrelated donors selected prospectively by block-

matching have superior bone marrow transplant outcome." Hum Immunol 61(2):

85-91.

- 179 -

Figure Legends

Figure 1. Pedigree of 920 cattle.

The pedigree above shows the controlled interbreeding within a herd over the last 20

years. Names are assigned to those cattle introduced to the family, Numbers are

assigned to cattle that were born on the property, such that the first two numbers

represent the year and the last two represent the number in that year. DNA and serum

has been collected from all the individual shaded grey. The cattle shaded green have not

been collected as yet. The DNA collection covers at least 4 generations with multiple

offspring in each. These samples will be invaluable with the future genetic analysis of

phenotypic traits.

Figure 2. Beef Breeder database for phenotypic and genotypic data management.

Screen shots of the many layers to the Beef Breeder database. a) Main Page, b) Data

entry and analysis options, 1c) Search cattle based on any category, d) Individual cattle

details, e) 4 generation family trees identifying parents, grandparents and great

grandparents, f) Progeny Table, f) Entry of updated data , h) Laboratory data

management.

- 180 -

- 183 -

CONCLUSIONS AND FUTURE PLANS

- 184 -

- 185 -

CONCLUSIONS AND FUTURE PLANS

Future Plans

The Regulators of Complement

As can be imagined, there are many studies currently planned to utilise this extensive

genomic polymorphism of the RCA alpha block. Currently our focus is on determining

how far the alpha block extends, but we expect this is likely to be over 0.9 Mb and

containing the DAF, CR2, CR1, MCPL, CR1 and MCP (Rodriguez de Cordoba). The

further the block extends the more informative the haplotypes will become. It will be

extremely interesting if as we predict AHs vary not only in the number and location of

indels and SNPs but also in gene copy number (complete genes or internal domains).

While clinical studies were beyond the scope of this project, we have commenced

several pilot studies that are investigating the involvement of the RCA AHs in a number

of autoimmune diseases. Theses include Recurrent Spontaneous Abortion (RSA),

Sjogren’s Syndrome (SS) and Systemic Lupus Erythematosus (SLE) but we plan to

include many more diseases and population groups. The results of these studies will no

doubt create valuable insight into the mechanisms defining multifactorial disease.

As many of the CCPs act as viral receptors, the pathogenicity of and resistance to

viruses such as Measles (MV), Epstein Barr (EBV) and Human Herpes (HHV), is likely

to be encoded within the individual RCA AHs. The identificiation of resistant AHs may

lead to the development of novel vaccines and therapies. We hope to begin these studies

very shortly.

- 186 -

Applications of the GMT to other genomes

Chapters 4 and 5 provide the evidence to suggest that the GMT has applications, not

only within the human MHC, but the human and non-human genomes in general.

Canines

The canine parentage project has demonstrated proof-of-concept. It is now our aim to

utilise the GMT signatures of the dog to define Canine MHC AHs (Dog Lymphocyte

Antigen – DLA). These will be highly informative in identifying disease susceptible and

resistant dogs and breeds. As the dog shares many of the MHC related diseases found in

humans, this is also expected to reveal many disease mechanisms that have previously

been missed or overlooked in humans.

Livestock

The many livestock projects appear promising, especially with the ever-increasing

amount of genomic sequence being made available and I look forward to continuing this

work.

Conclusion

In conclusion this thesis provides a new look at the function of duplication and

polymorphism within the human RCA. Analysis of the CR1 and CR1L genes

demonstrates the importance of duplication, indels and degeneracy in defining the SCR

repertoires of individual genes and their alleles. Internal duplications of functional

subunits have created genomic expansion while transposable elements and degeneracy

have created divergence. All these add to the overall complexity. Using this knowledge,

I have developed a functional assay that is able to characterise AHs defining this

- 187 -

divergence. Eventual sequencing of each entire Ancestral Haplotype will be needed in

order to define the individual events specific to each.

- 188 -

- 189 -

APPENDICES

- 190 -

- 191 -

APPENDIX 1

NCBI sequence submission for CR1 and CR1L

HGEs

- 192 -

- 193 -

LOCUS C05/522D 298 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1_05001 (CR1MCP5&6). ACCESSION DQ007054 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 298) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 298) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..298 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..195 repeat_region 107..138 /rpt_unit="cctc" repeat_region 139..178 /rpt_unit="cctt" repeat_region 179..186 /rpt_unit="ccttccct" primer_bind complement(276..298) BASE COUNT 50 a 105 c 25 g 118 t ORIGIN 1 aattccaaat tggcctggtt gacatggtgc caaaccacca aataattata attttattta 61 actctttgtc ttcttttctt tctttccttc cctccctccc tcctttcctc cctccctccc 121 tccctccctc cctccctccc ttccttcctt ccttccttct ttccttcctt ccttccttcc 181 ttccctcttt ccttattttc tttcttcttt accacgctgg ctaggaccac cagtataaca 241 ttgaacattg gtagcaatag atgtcatcct tgtcttgttc cacatctcaa agttaaag //

- 194 -

LOCUS C05/524R 298 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1_05001 (CR1MCP5&6). ACCESSION DQ007055 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 298) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 298) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..298 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..195 repeat_region 107..138 /rpt_unit="cctc" repeat_region 139..178 /rpt_unit="cctt" repeat_region 179..186 /rpt_unit="ccttccct" primer_bind complement(276..298) BASE COUNT 50 a 105 c 25 g 118 t ORIGIN 1 aattccaaat tggcctggtt gacatggtgc caaaccacca aataattata attttattta 61 actctttgtc ttcttttctt tctttccttc cctccctccc tcctttcctc cctccctccc 121 tccctccctc cctccctccc ttccttcctt ccttccttct ttccttcctt ccttccttcc 181 ttccctcttt ccttattttc tttcttcttt accacgctgg ctaggaccac cagtataaca 241 ttgaacattg gtagcaatag atgtcatcct tgtcttgttc cacatctcaa agttaaag //

- 195 -

LOCUS C05/531P 298 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1_05001 (CR1MCP5&6). ACCESSION DQ007056 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 298) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 298) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..298 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..195 repeat_region 107..134 /rpt_unit="cctc" repeat_region 135..178 /rpt_unit="cctt" repeat_region 179..186 /rpt_unit="ccttccct" primer_bind complement(276..298) BASE COUNT 50 a 104 c 25 g 118 t 1 others ORIGIN 1 aattccaaat tggcctggtt gacatggtgc caaaccacca aataattata attttattta 61 actctttgtc ttcttttctt tctttccttc cctccctccc tcctttcctc cctccctccc 121 tccctccctc cctccctycc ttccttcctt ccttccttct ttccttcctt ccttccttcc 181 ttccctcttt ccttattttc tttcttcttt accacgctgg ctaggaccac cagtataaca 241 ttgaacattg gtagcaatag atgtcatcct tgtcttgttc cacatctcaa agttaaag //

- 196 -

LOCUS C05/528S 298 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1_05001 (CR1MCP5&6). ACCESSION DQ007057 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 298) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 298) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..298 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..195 repeat_region 107..134 /rpt_unit="cctc" repeat_region 135..178 /rpt_unit="cctt" repeat_region 179..186 /rpt_unit="ccttccct" primer_bind complement(276..298) BASE COUNT 50 a 104 c 25 g 118 t 1 others ORIGIN 1 aattccaaat tggcctggtt gacatggtgc caaaccacca aataattata attttattta 61 actctttgtc ttcttttctt tctttccttc cctccctccc tcctttcctc cctccctccc 121 tccctccctc cctccctycc ttccttcctt ccttccttct ttccttcctt ccttccttcc 181 ttccctcttt ccttattttc tttcttcttt accacgctgg ctaggaccac cagtataaca 241 ttgaacattg gtagcaatag atgtcatcct tgtcttgttc cacatctcaa agttaaag //

- 197 -

LOCUS C05/523K-1 294 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1_04001 (CR1MCP5&6). ACCESSION DQ007058 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 294) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 294) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..294 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..191 repeat_region 107..134 /rpt_unit="cctc" repeat_region 135..174 /rpt_unit="cctt" repeat_region 175..182 /rpt_unit="ccttccct" primer_bind complement(272..294) BASE COUNT 50 a 102 c 25 g 117 t ORIGIN 1 aattccaaat tggcctggtt gacatggtgc caaaccacca aataattata attttattta 61 actctttgtc ttcttttctt tctttccttc cctccctccc tcctttcctc cctccctccc 121 tccctccctc cctcccttcc ttccttcctt ccttctttcc ttccttcctt ccttccttcc 181 ctctttcctt attttctttc ttctttacca cgctggctag gaccaccagt ataacattga 241 acattggtag caatagatgt catccttgtc ttgttccaca tctcaaagtt aaag //

- 198 -

LOCUS C05/519G 294 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1_04001 (CR1MCP5&6). ACCESSION DQ007059 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 294) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 294) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..294 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..191 repeat_region 107..134 /rpt_unit="cctc" repeat_region 135..174 /rpt_unit="cctt" repeat_region 175..182 /rpt_unit="ccttccct" primer_bind complement(272..294) BASE COUNT 50 a 102 c 25 g 117 t ORIGIN 1 aattccaaat tggcctggtt gacatggtgc caaaccacca aataattata attttattta 61 actctttgtc ttcttttctt tctttccttc cctccctccc tcctttcctc cctccctccc 121 tccctccctc cctcccttcc ttccttcctt ccttctttcc ttccttcctt ccttccttcc 181 ctctttcctt attttctttc ttctttacca cgctggctag gaccaccagt ataacattga 241 acattggtag caatagatgt catccttgtc ttgttccaca tctcaaagtt aaag

- 199 -

LOCUS C05/525Y 302 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1_06001 (CR1MCP5&6). ACCESSION DQ007060 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 302) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 302) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..302 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..199 repeat_region 107..134 /rpt_unit="cctc" repeat_region 135..182 /rpt_unit="cctt" repeat_region 183..190 /rpt_unit="ccttccct" primer_bind complement(280..302) BASE COUNT 50 a 107 c 25 g 120 t ORIGIN 1 aattccaaat tggcctggtt gacatggtgc caaaccacca aataattata attttattta 61 actctttgtc ttcttttctt tctttccttc cctccctccc tcctttcctc cctccctccc 121 tccctccctc cctcccttcc ttccttcctt ccttccttcc ttccttcctt ccttccttcc 181 ttccttccct ctttccttat tttctttctt ctttaccacg ctggctagga ccaccagtat 241 aacattgaac attggtagca atagatgtca tccttgtctt gttccacatc tcaaagttaa 301 ag

- 200 -

LOCUS C05/527L 306 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1_07001 (CR1MCP5&6). ACCESSION DQ007061 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 306) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 306) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..306 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..203 repeat_region 107..135 /rpt_unit="cctc" repeat_region 135..186 /rpt_unit="cctt" repeat_region 187..194 /rpt_unit="ccttccct" primer_bind complement(284..306) BASE COUNT 50 a 109 c 25 g 122 t ORIGIN 1 aattccaaat tggcctggtt gacatggtgc caaaccacca aataattata attttattta 61 actctttgtc ttcttttctt tctttccttc cctccctccc tcctttcctc cctccctccc 121 tccctccctc cctcccttcc ttccttcctt ccttccttcc ttccttcctt ccttccttcc 181 ttccttcctt ccctctttcc ttattttctt tcttctttac cacgctggct aggaccacca 241 gtataacatt gaacattggt agcaatagat gtcatccttg tcttgttcca catctcaaag 301 ttaaag //

- 201 -

LOCUS C05/517T 290 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1_03001 (CR1MCP5&6). ACCESSION DQ007062 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 290) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 290) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..290 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..187 repeat_region 107..130 /rpt_unit="cctc" repeat_region 131..170 /rpt_unit="cctt" repeat_region 171..178 /rpt_unit="ccttccct" primer_bind complement(268..290) BASE COUNT 50 a 99 c 25 g 116 t ORIGIN 1 aattccaaat tggcctggtt gacatggtgc caaaccacca aataattata attttattta 61 actctttgtc ttcttttctt tctttccttc cctccctccc tcctttcctc cctccctccc 121 tccctccctc ccttccttcc ttccttcctt ctttccttcc ttccttcctt ccttccctct 181 ttccttattt tctttcttct ttaccacgct ggctaggacc accagtataa cattgaacat 241 tggtagcaat agatgtcatc cttgtcttgt tccacatctc aaagttaaag //

- 202 -

LOCUS C05/523K-2 294 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1_04002 (CR1MCP5&6). ACCESSION DQ007063 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 294) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 294) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..294 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..191 repeat_region 107..134 /rpt_unit="cctc" repeat_region 135..174 /rpt_unit="cctt" repeat_region 175..182 /rpt_unit="ccttccct" primer_bind complement(272..294) BASE COUNT 50 a 101 c 25 g 118 t ORIGIN 1 aattccaaat tggcctggtt gacatggtgc caaaccacca aataattata attttattta 61 actctttgtc ttcttttctt tctttccttc cctccctccc tcctttcctc ccttcctccc 121 tccctccctc cctcccttcc ttccttcctt ccttctttcc ttccttcctt ccttccttcc 181 ctctttcctt attttctttc ttctttacca cgctggctag gaccaccagt ataacattga 241 acattggtag caatagatgt catccttgtc ttgttccaca tctcaaagtt aaag //

- 203 -

LOCUS C05/450E 359 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1L_09001 (CR1MCP5&6). ACCESSION DQ007064 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 359) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 359) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..359 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..257 repeat_region 166..177 /rpt_unit="cctc" repeat_region 178..201 /rpt_unit="cctt" repeat_region 202..241 /rpt_unit="ccttccct" primer_bind complement(337..359) BASE COUNT 53 a 137 c 32 g 137 t ORIGIN 1 aattccaaat tggcctggtt gacactgtac aaaaccacca gataattata aatttattta 61 actctttgtc ttcttttctt tccttccctc cttcccttct gcctgcctgc ttgccttcct 121 tctttgcttg cttccttcct tcctccctcc ctccatccct cccttcctcc ctccctccct 181 tccttccttc cttccttcct tccttccctc cttccctcct tccctccttc cctccttccc 241 tcctttcctt ctccttattt tctttcttct ttaccacacg gctaggacca ccagtacaac 301 attgaacatt ggtagcaata gatgtcatcc ttgtcttgtt ccacatctca aagggaagg //

- 204 -

LOCUS C05/452S 363 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1L_09501 (CR1MCP5&6). ACCESSION DQ007065 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 363) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 363) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..363 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..261 repeat_region 166..177 /rpt_unit="cctc" repeat_region 178..205 /rpt_unit="cctt" repeat_region 206..245 /rpt_unit="ccttccct" primer_bind complement(341..363) BASE COUNT 53 a 139 c 32 g 139 t ORIGIN 1 aattccaaat tggcctggtt gacactgtac aaaaccacca gataattata aatttattta 61 actctttgtc ttcttttctt tccttccctc cttcccttct gcctgcctgc ttgccttcct 121 tctttgcttg cttccttcct tcctccctcc ctccatccct cccttcctcc ctccctccct 181 tccttccttc cttccttcct tccttccttc cctccttccc tccttccctc cttccctcct 241 tccctccttt ccttctcctt attttctttc ttctttacca cacggctagg accaccagta 301 caacattgaa cattggtagc aatagatgtc atccttgtct tgttccacat ctcaaaggga 361 agg //

- 205 -

LOCUS C05/448P 363 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1L_09501 (CR1MCP5&6). ACCESSION DQ007066 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 363) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 363) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..363 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..261 repeat_region 166..177 /rpt_unit="cctc" repeat_region 178..205 /rpt_unit="cctt" repeat_region 206..245 /rpt_unit="ccttccct" primer_bind complement(341..363) BASE COUNT 53 a 139 c 32 g 139 t ORIGIN 1 aattccaaat tggcctggtt gacactgtac aaaaccacca gataattata aatttattta 61 actctttgtc ttcttttctt tccttccctc cttcccttct gcctgcctgc ttgccttcct 121 tctttgcttg cttccttcct tcctccctcc ctccatccct cccttcctcc ctccctccct 181 tccttccttc cttccttcct tccttccttc cctccttccc tccttccctc cttccctcct 241 tccctccttt ccttctcctt attttctttc ttctttacca cacggctagg accaccagta 301 caacattgaa cattggtagc aatagatgtc atccttgtct tgttccacat ctcaaaggga 361 agg //

- 206 -

LOCUS C05/449W 363 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1L_09501 (CR1MCP5&6). ACCESSION DQ007067 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 363) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 363) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..363 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..261 repeat_region 166..177 /rpt_unit="cctc" repeat_region 178..205 /rpt_unit="cctt" repeat_region 206..245 /rpt_unit="ccttccct" primer_bind complement(341..363) BASE COUNT 53 a 139 c 32 g 139 t ORIGIN 1 aattccaaat tggcctggtt gacactgtac aaaaccacca gataattata aatttattta 61 actctttgtc ttcttttctt tccttccctc cttcccttct gcctgcctgc ttgccttcct 121 tctttgcttg cttccttcct tcctccctcc ctccatccct cccttcctcc ctccctccct 181 tccttccttc cttccttcct tccttccttc cctccttccc tccttccctc cttccctcct 241 tccctccttt ccttctcctt attttctttc ttctttacca cacggctagg accaccagta 301 caacattgaa cattggtagc aatagatgtc atccttgtct tgttccacat ctcaaaggga 361 agg //

- 207 -

LOCUS C05/454F 367 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1L_10001 (CR1MCP5&6). ACCESSION DQ007068 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 367) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 367) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..367 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..265 repeat_region 166..177 /rpt_unit="cctc" repeat_region 178..209 /rpt_unit="cctt" repeat_region 210..249 /rpt_unit="ccttccct" primer_bind complement(345..367) BASE COUNT 52 a 140 c 32 g 143 t ORIGIN 1 aattccaaat tggcctggtt gacactgtac aaaaccacca gataattata attttattta 61 actctttgtc ttcttttctt tccttccctc cttcccttct gcctgcctgc ttgccttcct 121 tctttgcttg cttccttcct tcctccctcc ctccatccct cccttcctcc ctccctccct 181 tccttccttc cttccttcct tccttccttc cttccctcct tccctccttc cctccttccc 241 tccttccctc ctttccttct ccttattttc tttcttcttt accacacggc taggaccacc 301 agtataacat tgaacattgg tagcaataga tgtcatcctt gtcttgttcc acatctcaaa 361 gggaagg //

- 208 -

LOCUS C05/453Z 387 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1L_15001 (CR1MCP5&6). ACCESSION DQ007069 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 387) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 387) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..387 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..285 repeat_region 166..177 /rpt_unit="cctc" repeat_region 178..221 /rpt_unit="cctt" repeat_region 222..269 /rpt_unit="ccttccct" primer_bind complement(365..387) BASE COUNT 52 a 151 c 32 g 152 t ORIGIN 1 aattccaaat tggcctggtt gacactgtac aaaaccacca gataattata attttattta 61 actctttgtc ttcttttctt tccttccctc cttcccttct gcctgcctgc ttgccttcct 121 tctttgcttg cttccttcct tcctccctcc ctccatccct cccttcctcc ctccctccct 181 tccttccttc cttccttcct tccttccttc cttccttcct tccttccctc cttccctcct 241 tccctccttc cctccttccc tccttccctc ctttccttct ccttattttc tttcttcttt 301 accacacggc taggaccacc agtataacat tgaacattgg tagcaataga tgtcatcctt 361 gtcttgttcc acatctcaaa gggaagg //

- 209 -

LOCUS C05/456T 379 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1L_13001 (CR1MCP5&6). ACCESSION DQ007070 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 379) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 379) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..379 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..277 repeat_region 166..177 /rpt_unit="cctc" repeat_region 178..221 /rpt_unit="cctt" repeat_region 222..261 /rpt_unit="ccttccct" primer_bind complement(352..379) BASE COUNT 52 a 146 c 32 g 149 t ORIGIN 1 aattccaaat tggcctggtt gacactgtac aaaaccacca gataattata attttattta 61 actctttgtc ttcttttctt tccttccctc cttcccttct gcctgcctgc ttgccttcct 121 tctttgcttg cttccttcct tcctccctcc ctccatccct cccttcctcc ctccctccct 181 tccttccttc cttccttcct tccttccttc cttccttcct tccttccctc cttccctcct 241 tccctccttc cctccttccc tcctttcctt ctccttattt tctttcttct ttaccacacg 301 gctaggacca ccagtataac attgaacatt ggtagcaata gatgtcatcc ttgtcttgtt 361 ccacatctca aagggaagg //

- 210 -

LOCUS C05/443G 379 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1L_13001 (CR1MCP5&6). ACCESSION DQ007071 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 379) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 379) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..379 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..277 repeat_region 166..177 /rpt_unit="cctc" repeat_region 178..221 /rpt_unit="cctt" repeat_region 222..261 /rpt_unit="ccttccct" primer_bind complement(357..379) BASE COUNT 52 a 146 c 32 g 149 t ORIGIN 1 aattccaaat tggcctggtt gacactgtac aaaaccacca gataattata attttattta 61 actctttgtc ttcttttctt tccttccctc cttcccttct gcctgcctgc ttgccttcct 121 tctttgcttg cttccttcct tcctccctcc ctccatccct cccttcctcc ctccctccct 181 tccttccttc cttccttcct tccttccttc cttccttcct tccttccctc cttccctcct 241 tccctccttc cctccttccc tcctttcctt ctccttattt tctttcttct ttaccacacg 301 gctaggacca ccagtataac attgaacatt ggtagcaata gatgtcatcc ttgtcttgtt 361 ccacatctca aagggaagg //

- 211 -

LOCUS C05/445U 395 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1L_17001 (CR1MCP5&6). ACCESSION DQ007072 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 395) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 395) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..395 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..293 repeat_region 166..177 /rpt_unit="cctc" repeat_region 178..229 /rpt_unit="cctt" repeat_region 230..277 /rpt_unit="ccttccct" primer_bind complement(373..395) BASE COUNT 52 a 155 c 32 g 156 t ORIGIN 1 aattccaaat tggcctggtt gacactgtac aaaaccacca gataattata attttattta 61 actctttgtc ttcttttctt tccttccctc cttcccttct gcctgcctgc ttgccttcct 121 tctttgcttg cttccttcct tcctccctcc ctccatccct cccttcctcc ctccctccct 181 tccttccttc cttccttcct tccttccttc cttccttcct tccttccttc cttccctcct 241 tccctccttc cctccttccc tccttccctc cttccctcct ttccttctcc ttattttctt 301 tcttctttac cacacggcta ggaccaccag tataacattg aacattggta gcaatagatg 361 tcatccttgt cttgttccac atctcaaagg gaagg //

- 212 -

LOCUS C05/457A 371 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1L_11001 (CR1MCP5&6). ACCESSION DQ007073 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 371) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 371) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..371 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..269 repeat_region 166..177 /rpt_unit="cctc" repeat_region 178..221 /rpt_unit="cctt" repeat_region 222..253 /rpt_unit="ccttccct" primer_bind complement(349..371) BASE COUNT 52 a 141 c 32 g 146 t ORIGIN 1 aattccaaat tggcctggtt gacactgtac aaaaccacca gataattata attttattta 61 actctttgtc ttcttttctt tccttccctc cttcccttct gcctgcctgc ttgccttcct 121 tctttgcttg cttccttcct tcctccctcc ctccatccct cccttcctcc ctccctccct 181 tccttccttc cttccttcct tccttccttc cttccttcct tccttccctc cttccctcct 241 tccctccttc cctcctttcc ttctccttat tttctttctt ctttaccaca cggctaggac 301 caccagtata acattgaaca ttggtagcaa tagatgtcat ccttgtcttg ttccacatct 361 caaagggaag g //

- 213 -

LOCUS C05/455M 383 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1L_14001 (CR1MCP5&6). ACCESSION DQ007074 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 383) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 383) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..383 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..281 repeat_region 166..177 /rpt_unit="cctc" repeat_region 178..225 /rpt_unit="cctt" repeat_region 226..265 /rpt_unit="ccttccct" primer_bind complement(361..383) BASE COUNT 52 a 148 c 32 g 151 t ORIGIN 1 aattccaaat tggcctggtt gacactgtac aaaaccacca gataattata attttattta 61 actctttgtc ttcttttctt tccttccctc cttcccttct gcctgcctgc ttgccttcct 121 tctttgcttg cttccttcct tcctccctcc ctccatccct cccttcctcc ctccctccct 181 tccttccttc cttccttcct tccttccttc cttccttcct tccttccttc cctccttccc 241 tccttccctc cttccctcct tccctccttt ccttctcctt attttctttc ttctttacca 301 cacggctagg accaccagta taacattgaa cattggtagc aatagatgtc atccttgtct 361 tgttccacat ctcaaaggga agg //

- 214 -

LOCUS C05/459N 383 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1L_14001 (CR1MCP5&6). ACCESSION DQ007075 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 383) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 383) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..383 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..281 repeat_region 166..177 /rpt_unit="cctc" repeat_region 178..225 /rpt_unit="cctt" repeat_region 226..265 /rpt_unit="ccttccct" primer_bind complement(361..383) BASE COUNT 52 a 148 c 32 g 151 t ORIGIN 1 aattccaaat tggcctggtt gacactgtac aaaaccacca gataattata attttattta 61 actctttgtc ttcttttctt tccttccctc cttcccttct gcctgcctgc ttgccttcct 121 tctttgcttg cttccttcct tcctccctcc ctccatccct cccttcctcc ctccctccct 181 tccttccttc cttccttcct tccttccttc cttccttcct tccttccttc cctccttccc 241 tccttccctc cttccctcct tccctccttt ccttctcctt attttctttc ttctttacca 301 cacggctagg accaccagta taacattgaa cattggtagc aatagatgtc atccttgtct 361 tgttccacat ctcaaaggga agg //

- 215 -

LOCUS C05/446B 383 bp DNA linear PRI 13-APR-2005 DEFINITION Human RCA CR1L_14001 (CR1MCP5&6). ACCESSION DQ007076 VERSION KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 383) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Extensive Genomic Polymorphism of the CR1 Region: RCA Ancestral Haplotypes, Function and Disease JOURNAL Unpublished REFERENCE 2 (bases 1 to 383) AUTHORS McLure,C.A., Williamson,J.F., Smyth,L.A., Agrawal,S., Lester,S., Millman,J., Keating,P.J., Stewart,B.J. and Dawkins,R.L. TITLE Direct Submission JOURNAL Submitted (13-APR-2005) C Y O'Connor ERADE Village, PO Box 5100, Canning Vale, WA 6155, Australia FEATURES Location/Qualifiers source 1..383 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" primer_bind 1..22 satellite 68..281 repeat_region 166..177 /rpt_unit="cctc" repeat_region 178..225 /rpt_unit="cctt" repeat_region 226..265 /rpt_unit="ccttccct" primer_bind complement(361..383) BASE COUNT 52 a 148 c 32 g 151 t ORIGIN 1 aattccaaat tggcctggtt gacactgtac aaaaccacca gataattata attttattta 61 actctttgtc ttcttttctt tccttccctc cttcccttct gcctgcctgc ttgccttcct 121 tctttgcttg cttccttcct tcctccctcc ctccatccct cccttcctcc ctccctccct 181 tccttccttc cttccttcct tccttccttc cttccttcct tccttccttc cctccttccc 241 tccttccctc cttccctcct tccctccttt ccttctcctt attttctttc ttctttacca 301 cacggctagg accaccagta taacattgaa cattggtagc aatagatgtc atccttgtct 361 tgttccacat ctcaaaggga agg //

- 216 -

- 217 -

APPENDIX 2

ENLARGED FIGURES AND TABLES

- 218 -

- 219 -

CHAPTER 1 – MS0014





FIGURES AND TABLES

- 220 -

Figure 1: Characteristic amino acid patterns of eleven SCR groupsGroup† Protein No Residues§

a C x x x x x x x x A x x x x x x x x x x F x x G T x x x Y x C x P x Y x x x x F x I x C x x x x x W x x x x x x C 57 Hosa CR1-1 C N A P E W L P F A R P T N L T D E F E F P V G T Y L N Y E C R P G Y S G R P F S I I C L K N S V W T G A K D R C

Patr CR1-1 C N A P E W L P F A R P T N L T D E F E F P I G T Y L N Y E C R P G Y Y G R P F S I I C L K N S V W T G A K D R C

Hosa CR1-22 C K T P E Q F P F A S P T I P I N D F E F P I G T S L N Y E C R P G Y F G K M F S I S C L E N L V W S S V E D N C

Patr CR1-22 C K T P E Q F P F A S P T I P I N D F E F P V G T S L N Y E C R P G Y F G K M F S I S C L E N L V W S S V E D N C

Paha CR1-21 C K T P E Q F P F A S P T I P I N D F E F P V G T S L N Y E C H P G Y F G R M F S I S C L E N L V W S S V E D N C

Hosa CR1-8 C Q A P D H F L F A K L K T Q T N A S D F P I G T S L K Y E C R P E Y Y G R P F S I T C L D N L V W S S P K D V C

Patr CR1-8 C Q A P D H F L F A K L K T Q T N A S D F P I G T S L K Y K C R P E Y Y G R P F S I T C L D N L V W S S P K D V C

Paha CR1-7 C K A P D H F L F A K L K T Q T N A S D F P I G T S L K Y E C R P E Y Y G R P F S I T C L D N L E W S S P K D V C

Hosa CR1-15 C Q A P D H F L F A K L K T Q T N A S D F P V G T S L K Y E C R P E Y Y G R P F S I T C L D N L V W S S P K D V C

Patr CR1-15 C Q A P D H F L F A K L K T Q T N A S D F P I G T S L K Y E C R P E Y Y G R P F S I T C L D N L V W S S P K D V C

Paha CR1-14 C K A P D H F L F A K L K T Q T N A S D F P I G T S L K Y E C R P E Y Y G K P F S I T C L D N L V W S S P K D V C

Mumu Crry-1 C P A P S Q L P S A K P I N L T D E S M F P I G T Y L L Y E C L P G Y I K R Q F S I T C K Q D S T W T S A E D K C

Rano Crry-1 C P A P P L F P Y A K P I N P T D E S T F P V G T S L K Y E C R P G Y I K R Q F S I T C E V N S V W T S P Q D V C

Mumu CR1-1 C K L L P K Y S F A K P S I V S D K S E F A I G T T W E Y K C R P G Y F R K S F I I T C L E T S K W S D A Q Q F C

Hosa DAF-1 C G L P P D V P N A Q P A L E G R T S F P E D T V I T Y K C E E S F V K I P G E K D S V T C L K G S Q W S D I E E F C

Hosa DAF-2 C E V P T R L N S A S L K Q P Y I T Q N Y F P V G T V V E Y E C R P G Y R R E P S L S P K L T C L Q N L K W S T A V E F C

Hosa MCP-1 C E E P P T F E A M E L I G K P K P Y Y E I G E R V D Y K C K K G Y F Y I P P L A T H T I C D R N H T W L P V S D D A C

Hosa CR2-7 C Q A P P N I L N G Q K E D R H M V R F D P G T S I K Y S C N P G Y V L V G E E S I Q C T S E V W T P P V P Q C

Hosa C2-1 C P Q N V N I S G G T F T L S H G W A P G S L L T Y S C P Q G L Y P S P A S R L C - - - - - - - - - - - - -

Hosa Bf-1 C S L E G V E I K G G S F R L L Q E G Q A L E Y V C P S G F Y P Y P V Q T R T C R S T G S W S T L K - - -

b C x P P x x x L H x x x x x x x x x x F x x G Q x V x Y x C x P x Y x L x G x x x x x C T x x G x W S x x x P x C 57Hosa CR1-5 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S M R C T P Q G D W S P A A P T CPatr CR1-5 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S L R C T P Q G D W S P A T P T C

Paha CR1-4 C Q P P P D V L H G E R T Q R D K D I F Q T G Q E V F Y I C E P G Y D L R G A A S L R C T P Q G D W S P A A P R C

Hosa CR1-12 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S M R C T P Q G D W S P A A P T CPatr CR1-12 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S L R C T P Q G D W S P A A P T C

Paha CR1-11 C Q P P P D V L H G E R T Q R D K D I F Q P G Q E V F Y I C E P G Y D L R G A A S L R C T P Q G D W S P A A P R C

Hosa CR1-19 C Q P P P E I L H G E H T P S H Q D N F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R CPatr CR1-19 C Q P P P E I L H G E H T P S H Q D N F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R CPaha CR1-18 C Q P P P E I L H G E H T P S H Q D K F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R CHosa CR1-26 C Q P P P E I L H G E H T L S H Q D N F S P G Q E V F Y S C E P S Y D L R G A A S L H C T P Q G D W S P E A P R C

Patr CR1-26 C Q P P P E I L H G E H T P S H Q D N F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R C

Paha CR1-25 C Q P P P E I L H G E H T P S H Q D K F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P I C

Mumu CR1-5 C L P P Q N I L H G D Y N K K D E F F S V G Q K V S Y T C N P G Y T L I G T N L V E C T S L G T W S N T V P T C

Hosa CR2-11 C Q P P P G L H H G H H T G G N T V F F V S G M T V D Y T C D P G Y L L V G N K S I H C M P S G N W S P S A P R C

Hosa CR2-3 C P A L P M I H N G H H T S E N V G S I A P G L S V T Y S C E S G Y L L V G E K I I N C L S S G K W S A V P P T C

Hosa C2-3 C P N P G I S L G A V R T G F R F G H G D K V R Y R C S S N L V L T G S S E R E C Q G N G V W S G T E P I CHosa Bf-3 C S N P G I P I G T R K V G S Q Y R L E D S V T Y H C S R G L T L R G S Q R R T C Q E G G S W S G T E P S C

c C P H P P K I Q N G H x I G G H V S L Y L P G M T I x Y x C D P G Y L L V G K G x I F C T D Q G I W S Q L D H Y C 57

Hosa CR1-29 C P H P P K I Q N G H Y I G G H V S L Y L P G M T I S Y T C D P G Y L L V G K G F I F C T D Q G I W S Q L D H Y CPatr CR1-29 C P H P P K I Q N G H D I G G H V S L Y L P G M T I S Y I C D P G Y L L V G K G F I F C T D Q G I W S Q L D H Y CPaha CR1-28 C P H P P K I Q N G H Y I G G H V S L Y L P G M T I G Y I C D P G Y L L V G K G I I F C T D Q G I W S Q L D H Y CHosa CR2-15 C P P P P K T P N G N H T G G N I A R F S P G M S I L Y S C D Q G Y L L V G E A L L L C T H E G T W S Q P A P H C

d C P x P P x I x N G R H T G x x x x x x P x G K x x x Y x C D x H x D R G x x F x L I G E S x I R C T S D x x G N G V W S S x A P R C 67Hosa CR1-7 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T S F D L I G E S T I R C T S D P Q G N G V W S S P A P R CPatr CR1-7 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T T F D L I G E S T I R C T S D P Q G N G V W S S P A P R C

Paha CR1-6 C P S P P V I P N G R H T G K P L E V F P F G K A V T Y T C D P H P D R G M T F D L I G E S T I R C T S D P Q G N G V W S S P A P R C

Hosa CR1-14 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T S F D L I G E S T I R C T S D P Q G N G V W S S P A P R CPatr CR1-14 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T Y F D L I G E S T I R C T S D P Q G N G V W S S P A P R C

Paha CR1-13 C P S P P V I P N G R H T G K P L E V F P F G K A V T Y T C D P H P D R G M T F D L I G E S T I R C T S D P Q G N G V W S S R A P R C

Hosa CR1-21 C P N P P A I L N G R H T G T P S G D I P Y G K E I S Y T C D P H P D R G M T F N L I G E S T I R C T S D P H G N G V W S S P A P R CPatr CR1-21 C P N P P A I L N G R H T G T P F G D I P Y G K E I S Y T C D P H P D R G M T F N L I G E S T I R C T S D P H G N G V W S S P A P R CPaha CR1-20 C P N P P A I L N G R H T G A L L G D I P Y G K E I S Y T C D P H R D R G M T F N L I G E S T I R C T S D L Q G N G V W S S P A P R CHosa CR1-28 C P N P P A I L N G R H T G T P F G D I P Y G K E I S Y A C D T H P D R G M T F N L I G E S S I R C T S D P Q G N G V W S S P A P R CPatr CR1-28 C P N P P A I L N G R H T G T P F G D I P Y G K E I S Y A C D T H P D R G M T F N L I G E S S I R C T S D P Q G N G V W S S P A P R CPaha CR1-27 C P N P P A I L N G R H T G T P L G D I P Y G K E V S Y T C D P H P D R G M T F N L I G E S T I R C T S D L Q G N G V W S S P A P R C

Hosa CR2-5 C P S P P P I L N G R H I G N S L A N V S Y G S I V T Y T C D P D P E E G V N F I L I G E S T L R C T V D S Q K T G T W S G P A P R C

Hosa CR2-9 C P P P P V I Y N G A H T G S S L E D F P Y G T T V T Y T C N P G P E R G V E F S L I G E S T I R C T S N D Q E R G T W S G P A P L C

Hosa CR2-13 C H P P P V I V N G K H T G M M A E N F L Y G N E V S Y E C D Q G F Y L L G E K K L Q C R S D S K G H G S W S G P S P Q C

Hosa MCP-3 C T P P P K I K N G K H T F S E V E V F E Y L D A V T Y S C D P A P G P D P F S L I G E S T I Y C G D N S V W S R A A P E C

e C x x P P x I x N G D F x S x x x x x F x x G x V V x Y x C x x x x x x x x x F x L V G E x S x x C T S x x x x x G x W x x P x P x C 67Hosa CR1-3 C G L P P T I T N G D F I S T N R E N F H Y G S V V V Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q CPatr CR1-3 C G L P P T I T N G D F I S T N R E N F H Y G S V V T Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q C

Paha CR1-2 C G L P P T I D N G D F F S A N K E Y F H Y G S V V T Y R C N L G S G G R K L F E L V G E P S I Y C T S N E D Q V G I W S G P A P Q C

Hosa CR1-10 C G L P P T I A N G D F I S T N R E N F H Y G S V V V Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q CPatr CR1-10 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N P G S R G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q CPaha CR1-9 C G L P P P I A N G D F I S T N R E Y F H Y G S V V T Y R C N L G S G R K K L F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q CHosa CR1-17 C G L P P T I A N G D F I S T N R E N F H Y G S V V V Y R C N L G S R G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q CPatr CR1-17 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N L G S R G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q CPaha CR1-16 C G L P P P I A N G D F I S T N R E Y F H Y G S V V T Y R C N L G S G R K K L F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q C

Hosa CR1-24 C E P P P T I S N G D F Y S N N R T S F H N G T V V V Y Q C H T G P D G E Q L F E L V G E R S I Y C T S K D D Q V G V W S S P P P R CPatr CR1-24 C E P P P T I S N G D F Y S N N R A S F H N G T V V T Y Q C H T G P D G E Q L F E L V G E R S I Y C T S K D D Q V G V W S S P P P R CPaha CR1-23 C K P P P T I S N G D F Y S N N R T S F H S G T V V T Y Q C H T G P D G E Q L F E L V G E R S I Y C T S K D D Q V G A W S S P P P R C

Mumu Crry-3 C E I P P G I P N G D F F S S T R E D F H Y G M V V V Y R C N T D A R G K A L F N L V G E P S L Y C T S N D G E I G V W S G P P P Q C

Rano Crry-3 C E I P P S I P N G D F F S P N R E D F H Y G M V V V Y Q C N T D A R G K K L F N L V G E P S I H C T S I D G Q V G V W S G P P P Q CMumu CR1-3 C E S P P A I S N G D F Y S S S R D S F F Y G M V V T Y Y C H T G K N R E K L F D L V G E K S I Y C T S K D N Q V G I W N S P P P Q C

Hosa DAF-4 C P A P P Q I D N G I I Q G E R D H Y G Y R Q S V T Y A C N K G F T M I G E H S I Y C T V N N D E G E W S G P P P E C

f C x x P x x x N x x x x x x x x x x F x L x x x x x F x C x x G F x M x G x x x x x C x x x x x W x P x L P x C 56Hosa CR1-4 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R R V K C Q A L N K W E P E L P S CPatr CR1-4 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P P R V K C Q A L N K W E P E L P S CPaha CR1-3 C T P P N V E N G I L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R R V Q C Q A L N K W E P E L P S CHosa CR1-11 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R R V K C Q A L N K W E P E L P S CPatr CR1-11 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F A M K G P R R V K C Q A L N K W E P E L P S CPaha CR1-10 C M P P N V E N G I L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R R V Q C Q A L N K W E P E L P S CHosa CR1-18 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R R V K C Q A L N K W E P E L P S CPatr CR1-18 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P H R V K C Q A L N K W E P E L P S CPaha CR1-17 C M P P N V E N G I L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R R V Q C Q A L N K W E P E L P S C

Hosa CR1-25 C T A P E V E N A I R V P G N R S F F S L T E I I R F R C Q P G F V M V G S H T V Q C Q T N G R W G P K L P H CPatr CR1-25 C T A P E V E N A I R V P G N R S F F S L T E I V R F R C Q P G F V M V G S H T V Q C Q T N G R W G P K L P H C

Paha CR1-24 C T A P E V K N G I R V P G N R S F F S L N E I V R F R C Q P G F V M V G S H T V Q C Q T N N R W G P K L P H C

Mumu Crry-4 C T P P P Y V E N A V M L S E N R S L F S L R D I V E F R C H P G F I M K G A S S V H C Q S L N K W E P E L P S C

Rano Crry-4 C T P P H V E N A V I V S K N K S L F S L R D M V E F R C Q D G F M M K G D S S V Y C R S L N R W E P Q L P S C

Mumu CR1-4 C P M P E I E N G L V E S G F K H S F F L N D T V I F K C K S G F T M K G S R I A W C Q P N S K W S P P L P T C

Hosa CR2-2 C P E P I V P G G Y K I R G S T P Y R H G D S V T F A C K T N F S M N G N K S V W C Q A N N M W G P T R L P T C

Hosa CR2-14 C P N P E V K H G Y K L N K T H S A Y S H N D I V Y V D C N P G F I M N G S R V I R C H T D N T W V P G V P T C

Figure 1: Characteristic amino acid patterns of eleven SCR groups (Cont)

g C x H x x I x x G x x x S G x x x x Y x Y N D T V x F x C x x G F T L K G S x Q I R C x A x x T W x P x x P V C 56Hosa CR2-6 C P H P Q I L R G R M V S G Q K D R Y T Y N D T V I F A C M F G F T L K G S K Q I R C N A Q G T W E P S A P V CHosa CR2-10 C S H V H I A N G Y K I S G K E A P Y F Y N D T V T F K C Y S G F T L K G S S Q I R C K A D N T W D P E I P V CHosa MCP-4 C R F P V V E N G K Q I S G F G K K F Y Y K A T V M F E C D K G F Y L D G S D T I V C D S N S T W D P P V P K C

h C x x P x x M x G x x K x L x M K K x Y x Y G x x V x L x C E D G Y x L E G S x x S Q C Q x D x x W x P x L x x C 57Hosa CR1-30 C S F P L F M N G I S K E L E M K K V Y H Y G D Y V T L K C E D G Y T L E G S P W S Q C Q A D D R W D P P L A K CPatr CR1-30 C S F P L F M N G I S K E L E M K K V Y H Y G D Y V T L K C E D G Y T L E G S P W S Q C Q A D D R W D P P L A K CPaha CR1-29 C S F P Q F M N G I S K E L E M K K V Y H Y G D Y V T L E C E D G Y A L E G S P W S Q C Q A D D R W D P P L A I C

Mumu CRry-5 C R L P Q E M S G F Q K G L G M K K E Y Y Y G E N V T L E C E D G Y T L E G S S Q S Q C Q S D G S W N P L L A K C

Rano Crry-6 C K L P Q D M S G F Q K G L Q M K K D Y Y Y G D N V A L E C E D G Y T L E G S S Q S Q C Q S D A S W D P P L P K CRano Crry-7 C K L P Q D M S G F Q K G L Q M K K D Y Y Y G D N V A L E C E D G Y T L E G S S Q S Q C Q S D A S W D P P L P K C

Hosa CR2-16 C S S P A D M D G I Q K G L E P R K M Y Q Y G A V V T L E C E D G Y M L E G S P Q S Q C Q S D H Q W N P P L A V C

Hosa C2-2 C P A P V S F E N G I Y T P R L G S Y P V G G N V S F E C E D G F I L R G S P V R Q C R P N G M W D G E T A V C

Hosa Bf-2 C P R P H D F E N G E Y W P R S P Y Y N V S D E I S F H C Y D G Y T L R G S A N R T C Q V N G R W S G Q T A I C

i C x x x R Q x L x x x x x x x x x x x V N x x C x x G Y x x x G x x Y Q x C Q x x x x W F x x I x L C 51Hosa CR2-8 C E A T G R Q L L T K P Q H Q F V R P D V N S S C G E G Y K L S G S V Y Q E C Q G T I P W F M E I R L CHosa CR2-12 C Q H V R Q S L Q E L P A G S R V E L V N T S C Q D G Y Q L T G H A Y Q M C Q D A E N G I W F K K I P L C

j C x x P x x P x x G x V H x x x x x x x G S x x x Y x C x x G x R L I G x x S x x C x x x x x x x x W x x x x P x C 58Hosa CR1-2 C R N P P D P V N G M V H V I K G I Q F G S Q I K Y S C T K G Y R L I G S S S A T C I I S G D T V I W D N E T P I C

Patr CR1-2 C R N P P D P V N G M V H V I K D I Q F G S Q I K Y S C T K G Y R L I G S S S A T C I I S G D T V I W D N E T P I C

Paha CR1-1 M V H V I K D I Q F G S Q I N Y S C T E G H R L I G S S S A T C I I S G N T V I W D N E T P I C

Hosa CR1-9 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N A A H W S T K P P I CPatr CR1-9 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N A A H W S T K P P I C

Paha CR1-8 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C V T S G N T A H W S T K P P I C

Hosa CR1-16 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N T A H W S T K P P I C

Patr CR1-16 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N S A H W S T K P P I C

Paha CR1-15 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I I S G N T A H W S T K P P I C

Hosa CR1-23 C G P P P E P F N G M V H I N T D T Q F G S T V N Y S C N E G F R L I G S P S T T C L V S G N N V T W D K K A P I CPatr CR1-23 C G P P P E P F N G M V H I N T D T Q F G S T V N Y S C N E G F R L I G S P S T T C L V S G N N V T W D K K A P I CPaha CR1-22 C G T P P E P F - N G M V H I N T D T Q F G S T V N Y S C N E G F R L I G S P S T T C L V S G N N V T W D K E A P I C

Mumu CRry-2 C K T P S D P E N G L V H V H T G I Q F G S R I N Y T C N Q G Y R L I G S S S A V C V I T D Q S V D W D T E A P I C

Rano Crry-2 C E T P L D P Q N G I V H V N T D I R F G S S I T Y T C N E G Y R L I G S S S A M C I I S D Q S V A W D A E A P I C

Mumu CR1-2 C M N P Q E P L H G S V H I N T G I E F G S T I T Y S C N Q G Y R L I G D S S A T C I V S D N T V M W D N D M P L C

Hosa DAF-3 C P N P G E I R N G Q I D V P G G I L F G A T I S F S C N T G Y K L F G S T S S F C L I S G S S V Q W S D P L P E C

Hosa CR2-1 C G S P P P I L N G R I S Y Y S T P I A V G T V I R Y S C S G T F R L I G E K S L L C I T K D K V D G T W D K P A P K C

k C x x x x x x L x x G x V x x P x x L Q L G A x V x F V C x x G x x L K G x S x S x C V L x G x x x x W N x S V P V C 59Hosa CR1-6 C D D F M G Q L L N G R V L F P V N L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V CPatr CR1-6 C D D F M G Q L L N G R V L F P V N L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V CPaha CR1-5 C D D S L G Q L P N G R V L F P R S L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V CHosa CR1-13 C D D F M G Q L L N G R V L F P V N L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V CPatr CR1-13 C D G F M G Q L L N G R V L F P V N L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V CPaha CR1-12 C D D S L G Q L P N G R V L F P R S L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V C

Hosa CR1-20 C D D F L G Q L P H G R V L F P L N L Q L G A K V S F V C D E G F R L K G S S V S H C V L V G M R S L W N N S V P V CPatr CR1-20 C D D F L G Q L P H G R V L F P L N L Q L G A K V S F V C D E G F R L K G S S V S H C V L V G M R S L W N N S V P V CPaha CR1-19 C D D F L G Q L H H G R V L V P F N L Q L G A K V S F V C D E G F R L K G S S V S H C V L V G M R S L W N N S V P V C

Hosa CR1-27 C D D F L G Q L P H G R V L L P L N L Q L G A K V S F V C D E G F R L K G R S A S H C V L A G M K A L W N S S V P V CPatr CR1-27 C D D F L G Q L P H G R V L F P L N L Q L G A K V S F V C D E G F R L K G R S A S H C V L A G M K A L W N S S V P V CPaha CR1-26 C D E F L G Q L P H G R V L S P L N L Q L G A K V S F V C D E G F R L K G R S A S H C V L A G M K A L W N S S V P V C

Rano Crry-5 C G A F L G E L P N G H V F V P Q N L Q L G A K V T F V C N T G Y Q L K G N S S S H C V L D G V E S I W N S S V P V CMumu CR1-6 C D A I P N H L L H G R V F L P P N L Q L G A E V S F V C D L G

Hosa CR2-4 C K S L G R F P N G K V K E P P I L R V G V T A N F F C D E G Y R L Q G P P S S R C V I A G Q G V A W T K M P V C

Hosa MCP-2 C P Y I R D P L N G Q A V P A N G T Y E F G Y Q M H F I C N E G Y Y L I G E E I L Y C E L K G S V A I W S G K P P I C

Consensus* C x x P P x I x N G x I x x x x x x x F G D x I x Y x C x x G x x x x x x F x x x G x x x I x C x x x A x W x x x x P x C 61SCR Patterns L A L Y E L F Y L G

V S V V V S* The consensus SCR sequence derived by reference 11.† The proteins used to define the groups are Mumu and Rano Crry, Hosa, Patr, Paha CR1 and the 'ajefbk' portion of Mumu CR1. The residues essential for defining any of the groups were only assigned when all group members had a single residue at a specific position and are shown as black boxes. Positions where multiple residues were present were designated with an (x). Of these, grey boxes indicate amino acids shared by multiple members of the group. Boxed amino acids indicate the same amino acid in the CR1 and Crry protein(s) and Hosa CR2, MCP, DAF, C2 and/or Bf. § Number of residues for group based only on CR1 and Crry proteins. Note Hosa is Homo sapien, Mumu is Mus musculus, Rano is Rattus norvegicus, Patr is Pan troglodytes and Paha is Papio hamadryas

- 223 -




CR1L: Evidence for an additional set shared between CR1 and CR2." Immunogenetics

56(9): 631-638.

FIGURES AND TABLES

- 224 -

5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80

a) Hosa_CR1_7-8 T G C T C A T T T C C C C A C A T C C C A A A T G G G T T C A G A A T A T C T A A C C C A G G C C C T C C A T A T T T C C G T A A T T A C A A T G T G G T A T THosa_CR1_14-15 T G C T C A T T T C C C C A C A T C C C A A A T G G G T T C A G A A T A T C T A A C C C A G G C C C T C C A T A T T T C C G T A A T T A C A A T G T G G T A T TPatr_CR1_7-8 T G C T C A T T T C C C C A C A T C C C A A A T G G G T T C A G A A T A T C T A A C C C A G G C C C T C C A T A T T T C C A T A A T T A C A A T G T G G T A T TPatr_CR1_8-9 T G C T C A T T T C C C C A C A T C C C A A A T G G G T T C A G A A T A T C T A A C C C A G G C C C T C C A T A T T T C C A T A A T T A C A A T G T G G T A T TPatr_CR1_16-17 T G C T C A T T T C C C C A C A T C C C T A A T G G G T T C A G A A T A T C T A A C C C A G C C C C T C C A T A T T T C C A T A A T T A C A G T G T A G T A T THosa_CR1_21-22 T G C T C A T T T C C C C A C A T C C C T A A T G G G T T C A G A A T A T C T A A C C C A G C C C C T C C A T A T T T C C A T A A T T A C A G T G T A G T A T TPatr_CR1L_12+ T A T C C G C T T C C A C A T A T C C T A A A T G G G T T C A G A A T A T G T A G G T G A G A A C C T C C A T A T T T C T A T A G T - - G A C A G T C A T T T THosa_CR1L_12+ T A T C C G C T T C C A C A T A T C C T A A A T G G G T T C A G A A T A T G T A G G T G A G A A C C T T C A T A T T T C T A T A G T - - G A C A G T C A T T T THosa_CR1_35-36 T A C C T G C T T C C A C A T A T C C T A A A T G G G T T C A G A A T A T C T A G G T A A G A A C C T C C A T A T T T C T A T A G T - - G A C A G T C A T T T TPatr_CR1_30-31 T A C C T G C T T C C A C A T A T C C T A A A T G G G T T C A G A A T A T C T A G G T A A G A A C C T C C A T A T T T C T A T A G T - - G A C A G T C G T T T TPatr_CR1_23-24 T A T C C G C T T C C A C A T A T C C T A A A T G G G T T C A G A A T A T G T G G A C C C A A - C C C T C A T G T T T C T G T A A T A A G A C T A T G G T A T AHosa_CR1_28-29 T A T C C A C T T C C A C A T A T C C T A A A T G G G T T C A G A A T A T G T G G A C C C A A T C C C T C A T G T T T C T G T A A T A A G A C T A T G G T A T T

95 100 105 110 115 120 125 130 135 140 145 150 155 160Hosa_CR1_7-8 T A T T T - - - - - - G T G C A T T T G C - - - - - - - - - - - - - - - C A C A A T G G A A T G C C A A A C C A A T G A T A G A T G G T T C T A A G G T A G G THosa_CR1_14-15 T A T T T - - - - - - G T G C A T T T G C - - - - - - - - - - - - - - - C A C A A T G G A A T G C C A A A C C A A T G A T A G A T G G T T C T A A G G T A G G TPatr_CR1_7-8 T A T T T - - - - - - G T G C A T T T G C - - - - - - - - - - - - - - - C A C A A T G G A A T G C C A A A C C A A T G A T A G A T G G T T C T A A G G T A G G TPatr_CR1_8-9 T A T T T - - - - - - G T G C A T T T G C - - - - - - - - - - - - - - - C A C A A T G G A A T G C C A A A C C A A T G A T A G A T G G T T C T A A G G T A G G TPatr_CR1_16-17 T A T T T A T A T G T G T G C A T T T G C - - - - - - - - - - - - - - - C A C A A T G G A A T G C C A A A C C A A T G A T A A A T G G T T C T A A G G T A G G THosa_CR1_21-22 T A T T T G T A T G T A T G C A T T T G C - - - - - - - - - - - - - - - C A C A A T G G A A T G C C A A A C C A A T G A T A G A T G G T T C T A A G G T A G G TPatr_CR1L_12+ T G C T T G T G A A A A T G G C T T T G C T G T A A C T G T C A G A G A C A G A A C T A C C T C C C A A G T G A A T G A C A A A C G G G T T C T A G A T A G G CHosa_CR1L_12+ T G C T T G T G A A A A T G G C T T T G C T G T A A C T G T C A G A G A C A G A A C T A C C T C C C A A G T G A A T G A C A A A T G G G T T C T A G A T A G G CHosa_CR1_35-36 T G C T T G T G A A A A T G G C T T T G C T G T A A C T G T C A G A G A C A G A A C T A C C T C C C A A G T G A A T G A C A A A C G G G T T A T A G A T A G G CPatr_CR1_30-31 T G C T T G T G A A A A T G G C T T T G C T G T A A C T G T C A G A G A C A G A A C T C C C T C C C A A G T G A A T G A C A A A T G G G T T C T A G A T A G G CPatr_CR1_23-24 T G T T T G T G A G C T T A A C T T T G T C A T A A G T G T A A A T G T C A A A A T T A C A T A C C A T A G C T A A A A C A G A T G G G T T T C A G C A G C G CHosa_CR1_28-29 T G T T T G T G A G C T T A A C T T T G T C A T A A G T G T A A A T G T C A A A A T T A C A T A C C A T A G C T A A A A C A G A T G G G T T T C A G C A G C G C

165 170Hosa_CR1_7-8 - C A A C A C A T A AHosa_CR1_14-15 - C A A C A C A T A APatr_CR1_7-8 - C A A C A C A T A APatr_CR1_8-9 - C A A C A C A T A APatr_CR1_16-17 G C A A C A C A T A AHosa_CR1_21-22 - C A A C A C A T A APatr_CR1L_12+ A C A - - - - C T G THosa_CR1L_12+ A C A - - - - C T G THosa_CR1_35-36 A C G - - - - C T G TPatr_CR1_30-31 A C G - - - - C T G TPatr_CR1_23-24 - C A A G G T A T G THosa_CR1_28-29 - C A A G G T A T G T

5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80

b) Hosa_CR1_CR7 T G T C C A A G T C C T C C A G T T A T T C C T A A T G G G A G A C A C A C A G G A A A A C C T C T G G A A G T C T T T C C C T T T G G G A A A A C A G T A A AHosa_CR1_CR14 T G T C C A A G T C C T C C A G T T A T T C C T A A T G G G A G A C A C A C A G G A A A A C C T C T G G A A G T C T T T C C C T T T G G G A A A A C A G T A A AHosa_CR1_CR21 T G T C C A A G T C C T C C A G T T A T T C C T A A T G G G A G A C A C A C A G G A A A A C C T C T G G A A G T C T T T C C C T T T G G A A A A G C A G T A A APatr_CR1_CR16 T G T C C A A G T C C T C C A G T T A T T C C T A A C G G G A G A C A C A C A G G A A A A C C T C T G G A A G T C T T T C C C T T T G G A A A A G C A G T A A APatr_CR1_CR7 T G T C C A A G T C C T C C A G T T A T T C C T A A T G G G A G A C A C A C A G G A A A A C C T C T G G A A G T C T T T C C C T T T G G A A A A G C A G T A A APatr_CR1_CR8 T G T C C A A G T C C T C C A G T T A T T C C T A A T G G G A G A C A C A C A G G A A A A C C T C T G G A A G T C T T T C C C T T T G G A A A A G C A G T A A APaha_CR1_CR7 T G T C C A A G T C C T C C A G T T A T T C C T A A T G G G A G A C A C A C A G G A A A A C C T C T G G A A G T C T T T C C C T T T G G A A A A G C T G T G A CPaha_CR1_CR14 T G T C C A A G T C C T C C A G T T A T T C C T A A T G G G A G A C A C A C A G G A A A A C C T C T G G A A G T C T T T C C C T T T G G A A A A G C T G T G A CHosa_CR1_CR28 T G T C C A A A T C C T C C A G C T A T C C T T A A T G G G A G A C A C A C A G G A A C T C C C T C T G G A G A T A T T C C C T A T G G A A A A G A A A T A T CPatr_CR1_CR23 T G T C C A A A T C C T C C A G C T A T C C T T A A T G G G A G A C A C A C A G G A A C T C C C T T T G G A G A T A T T C C C T A T G G A A A A G A A A T A T CHosa_CR1_CR35 T G T C C A A A T C C T C C A G C T A T C C T T A A T G G G A G A C A C A C A G G A A C T C C C T T T G G A G A T A T T C C C T A T G G A A A A G A A A T A T CPatr_CR1_CR30 T G T C C A A A T C C T C C A G C T A T C C T T A A T G G G A G A C A C A C A G G A A C T C C C T T T G G A G A T A T T C C C T A T G G A A A A G A A A T A T CPatr_CR1L_CR12 T G T C C A A A T C C T C C A G C T A T C C T T A A T G G G A G A C A C A C A G G A A C T C C C C T T G G A G A T A T T C C C T A T G G A A A A G A A G T A T CHosa_CR1L_CR12 T G T C C A A A T C C T C C A G C T A T C C T T A A T G G G A G A C A C A C A G G A A C T C C C C T T G G A G A T A T T C C C T A T G G A A A A G A A G T A T CPaha_CR1_CR21 T G T C C A A A T C C T C C A G C T A T C C T T A A T G G G A G A C A C A C A G G A G C T C T C C T T G G A G A T A T T C C C T A T G G A A A A G A A A T A T CPacy_CR1L_CR7 T G C C C A A A T C C T C C A G C T A T C C T T A A T G G G A G A C A C A T A G G A G C T C C C C T T G G A G A T A T T C C C T A T G G A A A A G A A G T A T CPaha_CR1_CR28 T G C C C A A A T C C T C C A G C T A T C C T T A A T G G G A G A C A C A C C G G A A C T C C C C T T G G A G A T A T T C C C T A T G G A A A A G A A G T A T C

95 100 105 110 115 120 125 130 135 140 145 150 155 160

Hosa_CR1_CR7 T T A C A C A T G C G A C C C C C A C C C A G A C A G A G G G A C G A G C T T C G A C C T C A T T G G A G A G A G C A C C A T C C G C T G C A C A A G T G A C CHosa_CR1_CR14 T T A C A C A T G C G A C C C C C A C C C A G A C A G A G G G A C G A G C T T C G A C C T C A T T G G A G A G A G C A C C A T C C G C T G C A C A A G T G A C CHosa_CR1_CR21 T T A C A C A T G C G A C C C C C A C C C A G A C A G A G G G A C G A G C T T C G A C C T C A T T G G A G A G A G C A C C A T C C G C T G C A C A A G T G A C CPatr_CR1_CR16 T T A C A C A T G C G A C C C C C A C C C A G A C A G A G G G A C G A C C T T C G A C C T C A T T G G A G A G A G C A C C A T C C G C T G C A C A A G T G A C CPatr_CR1_CR7 T T A C A C A T G C G A C C C C C A C C C A G A C A G A G G G A C G A C C T T C G A C C T C A T T G G A G A G A G C A C C A T C C G C T G C A C A A G T G A C CPatr_CR1_CR8 T T A C A C A T G C G A C C C C C A C C C A G A C A G A G G G A C G A C C T T C G A C C T C A T T G G A G A G A G C A C C A T C C G C T G C A C A A G T G A C CPaha_CR1_CR7 T T A C A C A T G T G A C C C C C A C C C A G A C A G A G G G A T G A C C T T C G A C C T C A T T G G G G A G A G C A C C A T C C G C T G C A C A A G T G A C CPaha_CR1_CR14 T T A C A C A T G T G A C C C C C A C C C A G A C A G A G G G A T G A C C T T C G A C C T C A T T G G G G A G A G C A C C A T C C G C T G C A C A A G T G A C CHosa_CR1_CR28 T T A C A C A T G T G A C C C C C A C C C A G A C A G A G G G A T G A C C T T C A A C C T C A T T G G G G A G A G C A C C A T C C G C T G C A C A A G T G A C CPatr_CR1_CR23 T T A C A C A T G T G A C C C C C A C C C A G A C A G A G G G A T G A C C T T C A A C C T C A T T G G G G A G A G C A C C A T C C G C T G C A C A A G T G A C CHosa_CR1_CR35 T T A C G C A T G C G A C A C C C A C C C A G A C A G A G G G A T G A C C T T C A A C C T C A T T G G G G A G A G C T C C A T C C G C T G C A C A A G T G A C CPatr_CR1_CR30 T T A C G C A T G C G A C A C C C A C C C A G A C A G A G G G A T G A C C T T C A A C C T C A T T G G G G A G A G C T C C A T C C G C T G C A C A A G T G A C CPatr_CR1L_CR12 T T A C A C A T G T G A C C C C C A C C C A G A C A G A G G G A T G A C C T T C A A C C T C A T T G G G G A G A G C A C C A T C C G C T G C A C A A G T G A C CHosa_CR1L_CR12 T T A C A C A T G T G A C C C C C A C C C A G A C A G A G G G A T G A C C T T C A A C C T C A T T G G G G A G A G C A C C A T C C G C C G C A C A A G T G A A CPaha_CR1_CR21 T T A C A C A T G T G A C C C C C A C C G A G A C A G A G G G A T G A C C T T C A A C C T C A T T G G G G A G A G C A C C A T C C G C T G C A C A A G T G A C CPacy_CR1L_CR7 T T A C A T A T G C G A C C C C C A C C C A G A C A G A G G G A T G A C C G T C A A C C T C A T T G G G G A G A G C A C C A T C C G C T G C A C A A G T G A C CPaha_CR1_CR28 T T A C A C A T G C G A C C C C C A C C C A G A C A G A G G G A T G A C C T T C A A C C T C A T T G G G G A G A G C A C C A T C C G C T G C A C A A G T G A C C

165 170 175 180 185 190 195 200Hosa_CR1_CR7 C T C A A G G G A A T G G G G T T T G G A G C A G C C C T G C C C C T C G C T G THosa_CR1_CR14 C T C A A G G G A A T G G G G T T T G G A G C A G C C C T G C C C C T C G C T G THosa_CR1_CR21 C T C A A G G G A A T G G G G T T T G G A G C A G C C C T G C C C C T C G C T G TPatr_CR1_CR16 C T C A A G G G A A T G G G G T T T G G A G C A G C C C T G C C C C T C G C T G TPatr_CR1_CR7 C T C A A G G G A A T G G G G T T T G G A G C A G C C C T G C C C C T C G C T G TPatr_CR1_CR8 C T C A A G G G A A T G G G G T T T G G A G C A G C C C T G C C C C T C G C T G TPaha_CR1_CR7 C T C A A G G G A A T G G G G T T T G G A G C A G C C C T G C C C C T C G C T G TPaha_CR1_CR14 C T C A A G G G A A T G G G G T T T G G A G C A G C C G G G C C C C T C G C T G THosa_CR1_CR28 C T C A T G G G A A T G G G G T T T G G A G C A G C C C T G C C C C T C G C T G TPatr_CR1_CR23 C T C A T G G G A A T G G G G T T T G G A G C A G C C C T G C C C C T C G C T G THosa_CR1_CR35 C T C A A G G G A A T G G G G T T T G G A G C A G C C C T G C C C C T C G C T G TPatr_CR1_CR30 C T C A A G G G A A T G G G G T T T G G A G C A G C C C T G C C C C T C G C T G TPatr_CR1L_CR12 C T C A T G G G A A T G G G G T T T G G A G C A G C C C T G C C C C T C G C T G THosa_CR1L_CR12 C T C A T G G G A A T G G G G T T T G G A G C A G C C C T G C C C C T C G C T G TPaha_CR1_CR21 T T C A A G G G A A T G G G G T T T G G A G C A G C C C C G C C C C T C G C T G TPacy_CR1L_CR7 C T C A A G G G A A T G G G G T T T G G A G C A G C C C C G C C C C T C G C T G TPaha_CR1_CR28 T T C A A G G G A A T G G G G T T T G G A G C A G C C C C G C C C C T C G C T G T

85 90

85 90

Figure 1 – Relationship of additional SCRsFigure 1a shows the alignment of the nucleotide sequences of the twelve additionalnovel SCRs. Note blocks of conservation confirming that all are closely related. However, the conservation is much less than found within expressed subfamilies such as "d“ shown in Fig 1b. Conserved nucleotides have been shaded black with white text. Partially conserved nucleotides have been shaded grey.

- 252 -

- 227 -



imperfect duplication have driven the evolution of human CR1 and CR1-like from their

precursor CR1 alpha: Importance of functional sets." Hum Immunol 66(3): 258-273.

FIGURES AND TABLES

- 228 -

Figure 1a. Sets of SCR subfamilies reveal relationships between Complement Control proteins. (i) Phylogenetic analysis of the amino acid sequence of Hosa CR1 and CR1L reveals that 55 SCRs form 10 distinct subfamilies (a = red, j = orange, e = yellow, f = green, b = dark blue, k = purple, d = mauve, g = grey, c = light blue and h = aqua.). Note the six degenerate g-likeSCRs are not shown in the phylogenies. (ii) After adding Mumu and Rano Crry, Patr and Pacy CR1L and Patr and Paha CR1, the same subfamilies are apparent, indicating conservation of amino acid motifs. (iii) Organisation and use of subfamilies. The colours from (i) and (ii) have been retained. White indicates a gap to permit the recognition of patterns. Black dots indicate SCR presence is unknown (no genomic sequence). Coloured boxes with white stripes indicate truncated or degenerate SCRs grouped on remaining sequence. The numbers apply to Hosa CR1. Degenerate SCRs are designated 7-8, 14-15 etc, thus not affecting the existing numbering. The inner circles show Mumu Crry “ajefh” and Rano Crry “ajefkhh”. The next three circles (CR1L) show the addition and deletion of SCRs resulting in Hosa, Patr and Pacy CR1L being “ajefbkjefbkdg-like”, “ajefbkjefbkdg-like” and “ajef…bkd” respectively. The outer three circles (CR1) reflect the use of the “ch”, “ajef” and “bkdg-like” sets (with some deletions). Imperfect internal duplication of octamers is apparent at several locations such as 8 to 14.

hf cbj dea k

Rano Crry

Mumu Crry

Pacy CR1L

Patr CR1L

Hosa CR1L

Paha CR1

Patr CR1

Hosa CR1

(i) Human(ii) Human, primate and Rodent

(iii)

Hos

aC

R1

10H

osa

CR

1 3

Hos

aC

R1

17

Hosa CR1 2

4

Hosa CR1L 3Hosa CR1L 8Hosa CR1 31

Hosa CR1 7Hosa CR1 21Hosa CR1 14

Hosa CR1L 12

Hosa CR1 28

Hosa

CR

1 35

Hosa CR1 36

Hosa CR1 33

Hosa CR1L 10

Hosa

CR

1 26

Hosa

CR

1L 5H

osaC

R1 12

Hosa

CR

1 5

HosaCR1 19

Hos

aC

R1

1H

osa

CR

1L 1

Hos

aC

R1

29

Hos

aC

R1

8

HosaCR1 15

Hosa CR1 22

Hos

aC

R1

16H

osa

CR1

23

Hosa CR1 9

Hosa CR1L 7

Hosa CR1L 2Hosa CR1 2Hosa CR1 30

Hosa CR1 27Hosa CR1L 11

Hosa CR1 34

HosaCR1L 6

Hosa

CR

1 20

Hosa

CR

1 6H

osaC

R1 13

Hosa

CR

1 37

HosaCR1 32

HosaCR1L 4

Hosa

CR

1L 9

Hosa

CR

1 18H

osaC

R1 4

HosaCR1 11

HosaCR1 25

0.5

Pah

a C

R1

10P

aha

CR

1 17

Hos

aC

R1

24P

acy

CR

1 L 3

Pah

a C

R1

3H

osa

CR

1L 3

Pat

rC

R1L

3

Hos

aC

R1L

8

Hos

aC

R1

10

Hos

aC

R1

17

Hosa

CR1 3

Patr CR1

3

PatrCR1 12

Rano Crry3

Mumu Crry3

Patr CR1 26

Hosa CR1 31

Paha CR1 24

Hosa

CR1 7

Hosa CR1 2

1

Patr CR1 7

Patr CR1 16

Patr CR1 8Hosa CR1 14

Paha CR1 7Paha CR1 14Patr CR1L 12Paha CR1 28Pacy CR1L 7

Paha CR1 21

Hosa CR1L 12

Hosa CR1 28

Patr CR1 23

Hosa CR1 35

Patr CR1 30

Hosa CR1 36

Patr CR1 31

Paha CR1 29Hosa CR1 19Patr CR1 5Hosa CR1 12

Hosa CR1 5

Patr CR1 14Paha CR1 12

Paha CR1 5

HosaCR1L 5

Patr CR1L 5Hosa

CR1 26

Patr CR

1 21

Patr

CR

1 28

Paha C

R1 19

Paha C

R1 26

Hos a

CR

1 3 3P

acyC

R1L 5

Patr

CR

1L 10

Hosa

CR

1L 10

HosaCR1 20

PatrCR1 6

Hosa

CR1 13

Hos

aC

R1

6

Pat

rC

R1

15

Hos

aC

R1L

6

Pat

rC

R1L

6H

osa

CR

1 27

Pat

rC

R1

22P

aha

CR

1 6

Pah

a C

R1

13

Pah

a C

R1

20

Paha

CR

1 27

Hosa

CR1 34

Hosa CR1L

11

Patr CR1L 11

Pacy CR1L 6

Patr CR1 29

Rano Crry5

Hos

aC

R1

37P

atr C

R1

32

Paha

CR

1 30

Mum

uC

rry5

Rano

Crry6

Rano Crry7

Ran

oC

rry

4

Mum

uCrry

4H

osa

CR

1 32

Patr C

R1 27

Paha C

R1 25

Hosa

CR1L 4

Patr

CR1L 4

Paha C

R1 11

Paha C

R1 18

Pacy CR1L 4

Paha CR1 4

Patr CR1 4Hosa CR1 4Hosa CR1 11Hosa CR1 18Hosa CR1 25

Patr CR1 13

Patr CR1 20

Patr CR1L 9

Hosa

CR

1L 9

Patr CR1 25Paha CR1 23Hosa CR1 30

Pacy CR1L 2Paha CR1 2

Patr CR1 2Patr CR1L 2Hosa CR1L 2

Hosa CR1 2

Rano Crry 2

Mumu Crry 2

Hosa CR1L 7

Patr CR1L 7

Paha CR1 9

Paha CR

1 16

Hosa

CR

1 9

Hosa

CR

1 16P

atrC

R1 11

Patr

CR

1 18H

osaC

R1 23

HosaCR1 29

Patr CR

1 24

Paha C

R1 22

Hosa

CR

1 22

Patr C

R1 17

Hosa

CR

1 15

Hosa

CR

1 8P

aha CR

1 8P

aha CR

1 15R

anoC

rry1M

umu

Crry

1H

osaC

R1 1

Patr

CR

1 1P

aha CR

1 1

PacyC

R1L 1

HosaCR

1L 1

PatrCR1L 1

0.5

g

KbMCPCR1

LMCPLCR1

j e f b ka d ga j e f b k d g c h

50 100 150

50

100

150

20

40

60

20

40

Human(i) Chimpanzee

(ii)

Norway rat

(iii)

House mouse

MCP

Crrya j e f k

h h

MCP

CR1L

MCP

LCR

1

j e f b

a j e f b k d g

c h

d g a

MCP

Crrya j e f

h

MCP

CR1Lj e f b k

a

d g

a j e f b k d g

Figure 2b. Domain and segmental duplications within primate CR1 explain the genomic expansion of CR1and CR1L not seen in the rodent.Comparative analysis of the genomic region containing HosaCR1, MCPL, CR1L and MCP with syntenic regions in (i) Patr, (ii) Mumuand (iii) Rano using dotter (Sonhammerand Durbin, 1995). Comparative dot-plots reveal high sequence similarity between Hosa and Patr. There are notable exceptions, for example the missing LHR in CR1, the extra SCRs(dg-like) between the 1st and 2nd octamers and the additional MCPduplicon. Loss of sequence similarity between rodent and Hosa is due to the absence of both internal duplication of octamers within primate CR1 and segmental duplication of the primate genes CR1and MCP. Sequences have been Repeat Masked (http://repeatmasker.org/cgi-bin/WEBRepeatMasker) and masked elements removed from the annotated sequence. Note that missing Patr CR1Ldata has been found in WGS sequence. These follow the ensembl sequence, are separated by horizontal lines and have been annotated accordingly. f

Figure 3a: Analysis of genomic sequence of CR1L against CR1. Coloured lines running through the plot indicate positions of individual SCRs such that a = red, j = orange, e = yellow, f = green, b = dark blue, k = purple, d = mauve, g = grey, c = light blue and h = aqua. Filled regions show non coding sequence between split exons (j & k). For the purpose of discussion we assume that the CR1L was the progenitor of CR1 which arose through further piecemeal duplication of components within CR1L. For example the region of CR1Lcommencing at b1 has duplicated en bloc and there has been further diversification, especially in non coding regions between j2(i) and j2(ii). The deletion of the segment including d1, g-like1 & a2 is indicated by a vertical gap between k (ii) and j (i) (Revised Figure 4a. from [6]).

Figure 4. Phylogenetic and genomic analyses define a model for the evolution of Hosa CR1 and CR1L. The evolutionary model has been constructed through analyses of phylogenetic trees comparing SCR peptides of CR1 related genes and the comparisons of the genomic sequence from the two genes. We hypothesise that these genes have resulted from multiple duplication and indel events. First, we believe the ancestral sequence (CR1 a) contained 1 copy of each SCR subfamily “a, j, e, f, b, k, d, g -like, c & h”. Second, the domain containing “a, j, e, f, b, k, d & g-like” was then duplicated twice, which we refer to as a “triplication”; this resulted in CR1 b, containing three copies of the domain “ajefbkdg-like” as well as 1 copy of the “c” and “h” SCRs. Third, segmental duplication of the entire gene, CR1b, formed two copies of the gene (pre-CR1 and pre-CR1L). Last, triplication of the domain “b, k, d, g-like, a, j, e & f” in pre-CR1 created further genomic expansion while deletions (“d, g-like & a”, “b, k, d, g-like, a, j, e & f” and “c & h”) in pre-CR1L caused genomic contraction. The resultant genes CR1 and CR1L contain 42 and 13 SCRs respectively (including degenerate g-like).

TABLE 1. SCR alignments from nine SCR groups found in Crry, CR1 and CR1L. § No residues

a C x x P x x x x x A x x x x x x x x x x F P x G T x L x Y E C x P x Y x x x x F S I x C x x x x x W x x x x D x C 57Hosa_CR1_1 C N A P E W L P F A R P T N L T D E F E F P I G T Y L N Y E C R P G Y S G R P F S I I C L K N S V W T G A K D R CPatr_CR1_1 C N A P E W L P F A R P T N L T D E F E F P I G T Y L N Y E C R P G Y Y G R P F S I I C L K N S V W T G A K D R C

^ Paha_CR1_1 C N A P E Q L P F A R P T E L I D E P E F S I G T H L K Y E C R P G Y Y G R P F S I I C L K N S V W T S A K D K CHosa_CR1L_1 C N V P E W L P F A R P T N L T D D F E F P I G T Y L N Y E C R P G Y S G R P F S I I C L K N S V W T S A K D K CPatr_CR1L_1 C N V P E W L P F A R P T N L T D E F E F P I G T Y L N Y E C R P G Y Y G R P F S I I C L K N S V W T S A E D K CPacy_CR1L_1 C N A P E Q L P F A R P T N L T D A S E F P V G T Y L K Y E C L P G Y H G K P F S I I C L K N S V W T S A K D K CRano_Crry_1 C P A P P L F P Y A K P I N P T D E S T F P V G T S L K Y E C R P G Y I K R Q F S I T C E V N S V W T S P Q D V CMumu_Crry_1 C P A P S Q L P S A K P I N L T D E S M F P I G T Y L L Y E C L P G Y I K R Q F S I T C K Q D S T W T S A E D K CHosa_CR1_8 C Q A P D H F L F A K L K T Q T N A S D F P I G T S L K Y E C R P E Y Y G R P F S I T C L D N L V W S S P K D V CHosa_CR1_15 C Q A P D H F L F A K L K T Q T N A S D F P I G T S L K Y E C R P E Y Y G R P F S I T C L D N L V W S S P K D V CHosa_CR1_22 C Q A P D H F L F A K L K T Q T N A S D F P I G T S L K Y E C R P E Y Y G R P F S I T C L D N L V W S S P K D V CPatr_CR1_17 C Q A P D H F L F A K L K T Q T N A S D F P I G T S L K Y E C R P E Y Y G R P F S I T C L D N L V W S S P K D V CPaha_CR1_8 C K A P D H F L F A K L K T Q T N A S D F P I G T S L K Y E C R P E Y Y G R P F S I T C L D N L E W S S P K D V CPaha_CR1_15 C K A P D H F L F A K L K T Q T N A S D F P I G T S L K Y E C R P E Y Y G K P F S I T C L D N L V W S S P K D V CPatr_CR1_9 C Q A P D H F L F A K L K T Q S F A I G T S L K Y K C R P E Y Y G R P F S I T C L D N L V W S S P K D V CPatr_CR1_10 C Q A P D H F L F A K L K T Q S F A I G T S L K Y K C R P E Y Y G R P F S I T C L D N L V W S S P K D V CHosa_CR1_29 C K T P E Q F P F A S P T I P I N D F E F P V G T S L N Y E C R P G Y F G K M F S I S C L E N L V W S S V E D N CPatr_CR1_24 C K T P E Q F P F A S P T I P I N D F E F P V G T S L N Y E C R P G Y F G K M F S I S C L E N L V W S S V E D N CPaha_CR1_22 C K T P E Q F P F A S P T I P I N D F E F P V G T S L N Y E C H P G Y F G R M F S I S C L E N L V W S S V E D N C

b C Q P P P x x L H x E x x x x x x x x F x x G x E V x Y x C x P x x x L R G x x x x x C x P Q G x x x P x x P x C 57Hosa_CR1_5 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S M R C T P Q G D W S P A A P T CHosa_CR1_12 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S M R C T P Q G D W S P A A P T CHosa_CR1_19 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S M R C T P Q G D W S P A A P T CPatr_CR1_5 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S L R C T P Q G D W S P A T P T CPaha_CR1_5 C Q P P P D V L H G E R T Q R D K D I F Q T G Q E V F Y I C E P G Y D L R G A A S L R C T P Q G D W S P A A P R CPaha_CR1_12 C Q P P P D V L H G E R T Q R D K D I F Q P G Q E V F Y I C E P G Y D L R G A A S L R C T P Q G D W S P A A P R CHosa_CR1L_5 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G S T Y L H C T P Q G D W S P A A P R CPatr_CR1L_5 C Q P P P D V L H G E R T Q R D K D N F S P G E E V Y Y S C E P G Y D L R G S T Y L H C T P Q G D W S P E A P R CHosa_CR1_26 C Q P P P E I L H G E H T P S H Q D N F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R CPatr_CR1_21 C Q P P P E I L H G E H T P S H Q D N F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R CPatr_CR1_28 C Q P P P E I L H G E H T P S H Q D N F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R CPaha_CR1_26 C Q P P P E I L H G E H T P S H Q D K F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P I CPacy_CR1L_5 C Q P P P E I L H G E H T P S H Q D F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W N P E A P I CPaha_CR1_19 C Q P P P E I L H G E H T P S H Q D K F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R CHosa_CR1_33 C Q P P P E I L H G E H T L S H Q D N F S P G Q E V F Y S C E P S Y D L R G A A S L H C T P Q G D W S P E A P R CPatr_CR1L_10 C Q P P P E I L H G E H T L S H Q D N F S P G Q D V F Y S C E P G Y D L R G A A S L H C T P Q G D W T P E A P R CHosa_CR1L_10 C Q P P P E I L H G E H T L S H Q D N F L P G Q E V F Y S C E P S Y D L R G A A S L H C M P Q G D W T P E A P R CPatr_CR1_14 C Q P P P D V L H A E A Y P K G Q G Q L F T R G R E V F Y S C X P A T N L R G A A S L R C T P Q G R L E P L Q P P Q C

c C P x P P K I Q N G H x I G G H V S L Y L P G M T I x Y I C D P G Y L L V G K G x I F C T D Q G I W S Q L D H Y C 57Hosa_CR1_36 C P D P P K I Q N G H Y I G G H V S L Y L P G M T I S Y I C D P G Y L L V G K G F I F C T D Q G I W S Q L D H Y CPatr_CR1_31 C P H P P K I Q N G H D I G G H V S L Y L P G M T I S Y I C D P G Y L L V G K G F I F C T D Q G I W S Q L D H Y CPaha_CR1_29 C P H P P K I Q N G H Y I G G H V S L Y L P G M T I G Y I C D P G Y L L V G K G I I F C T D Q G I W S Q L D H Y C

d C P x P P x I x N G R H x G x x x x x x P x G K x x x Y x C D P H x D R G x x x x L I G E S x I R x T S x x x G N G V W S S x A P R C 67Patr_CR1_8 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T T F D L I G E S T I R C T S D P Q G N G V W S S P A P R CPatr_CR1_16 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T T F D L I G E S T I R C T S D P Q G N G V W S S P A P R CPatr_CR1_7 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T T F D L I G E S T I R C T S D P Q G N G V W S S P A P R CHosa_CR1_7 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T S F D L I G E S T I R C T S D P Q G N G V W S S P A P R CHosa_CR1_21 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T S F D L I G E S T I R C T S D P Q G N G V W S S P A P R CHosa_CR1_14 C P S P P V I P N G R H T G K P L E V F P F G K T V N Y T C D P H P D R G T S F D L I G E S T I R C T S D P Q G N G V W S S P A P R CPaha_CR1_7 C P S P P V I P N G R H T G K P L E V F P F G K A V T Y T C D P H P D R G M T F D L I G E S T I R C T S D P Q G N G V W S S P A P R CPaha_CR1_14 C P S P P V I P N G R H T G K P L E V F P F G K A V T Y T C D P H P D R G M T F D L I G E S T I R C T S D P Q G N G V W S S R A P R CHosa_CR1_28 C P N P P A I L N G R H T G T P S G D I P Y G K E I S Y T C D P H P D R G M T F N L I G E S T I R C T S D P H G N G V W S S P A P R CPatr_CR1_23 C P N P P A I L N G R H T G T P F G D I P Y G K E I S Y T C D P H P D R G M T F N L I G E S T I R C T S D P H G N G V W S S P A P R CHosa_CR1_35 C P N P P A I L N G R H T G T P F G D I P Y G K E I S Y A C D T H P D R G M T F N L I G E S S I R C T S D R Q G N G V W S S P A P R CPatr_CR1_30 C P N P P A I L N G R H T G T P F G D I P Y G K E I S Y A C D T H P D R G M T F N L I G E S S I R C T S D P Q G N G V W S S P A P R CHosa_CR1L_12 C P N P P A I L N G R H T G T P P G D I P Y G K E V S Y T C D P H P D R G M T F N L I G E S T I R R T S E P H G N G V W S S P A P R CPatr_CR1L_12 C P N P P A I L N G R H T G T P L G D I P Y G K E V S Y T C D P H P D R G M T F N L I G E S T I R C T S D P H G N G V W S S P A P R CPaha_CR1_21 C P N P P A I L N G R H T G A L L G D I P Y G K E I S Y T C D P H R D R G M T F N L I G E S T I R C T S D L Q G N G V W S S P A P R CPaha_CR1_28 C P N P P A I L N G R H T G T P L G D I P Y G K E V S Y T C D P H P D R G M T F N L I G E S T I R C T S D L Q G N G V W S S P A P R CPacy_CR1L_7 C P N P P A I L N G R H I G A P L G D I P Y G K E V S Y I C D P H P D R G M T V N L I G E S T I R C T S D P Q G N G V W S S P A P R C

e C x x P P x I x N G D F x S x x R x x F x x x x V V T Y x C x x x x x x x x x F x L V G E x S x x C T S x x x x x G x W S x P x P x C 67Hosa_CR1_10 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q CHosa_CR1_17 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q CHosa_CR1_3 C G L P P T I T N G D F I S T N R E N F H Y G S V V T Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q CPatr_CR1_3 C G L P P T I T N G D F I S T N R E N F H Y G S V V T Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q CHosa_CR1_24 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N L G S R G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q CPatr_CR1_12 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N P G S R G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q CPatr_CR1_19 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N L G S R G R K V F E L V G E P S I Y C T S N D D Q V G I W A P Q CPaha_CR1_10 C G L P P P I A N G D F I S T N R E Y F H Y G S V V T Y R C N L G S G R K K L F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q CPacy_CR1L_3 C G L P P T I A N G D F I S T S R E Y F P Y G S V V T Y R C N L G S G R K K L F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q CPaha_CR1_17 C G L P P P I A N G D F I S T N R E Y F H Y G S V V T Y R C N L G S G R K K L F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q CHosa_CR1L_3 C G L P P T I A N G D F T S I S R E Y F H Y G S V V T Y H C N L G S R G K K V F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q CPatr_CR1L_3 C G L P P T I A N G D F T S I S R E Y F H Y A S V V T Y H C N L G S G G K K V F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q CPaha_CR1_3 C G L P P T I D N G D F F S A N K E Y F H Y G S V V T Y R C N L G S G G R K L F E L V G E P S I Y C T S N E D Q V G I W S G P A P Q CHosa_CR1L_8 C G L P P N I T N G Y F I S T D R E Y F H Y G S V V T Y H C N L G S R G R K V F E L V G E P S I Y C T S K D D Q V G V W S G P V P Q CPatr_CR1L_8 C G L P P N I T N G Y F I S T D R E Y F H Y G S V V T Y R C N L G S R G R K V F E L V G E P S I Y C T S K G D Q V G V W Q CRano_Crry_3 C E I P P S I P N G D F F S P N R E D F H Y G M V V T Y Q C N T D A R G K K L F N L V G E P S I H C T S I D G Q V G V W S G P P P Q CMumu_Crry_3 C E I P P G I P N G D F F S S T R E D F H Y G M V V T Y R C N T D A R G K A L F N L V G E P S L Y C T S N D G E I G V W S G P P P Q CHosa_CR1_31 C E P P P T I S N G D F Y S N N R T S F H N G T V V T Y Q C H T G P D G E Q L F E L V G E R S I Y C T S K D D Q V G V W S S P P P R CPatr_CR1_26 C E P P P T I S N G D F Y S N N R A S F H N G T V V T Y Q C H T G P D G E Q L F E L V G E R S I Y C T S K D D Q V G V W S S P P P R CPaha_CR1_24 C K P P P T I S N G D F Y S N N R T S F H S G T V V T Y Q C H T G P D G E Q L F E L V G E R S I Y C T S K D D Q V G A W S S P P P R C

f C x x P x V x x x x x x x x N x S x F S L x x x V x F R C x x G F x M x G x x x V x C x x x x x W x P x L P x C 56Hosa_CR1_32 C T A P E V E N A I R V P G N R S F F S L T E I V R F R C Q P G F V M V G S H T V Q C Q T N G R W G P K L P H CPatr_CR1_27 C T A P E V E N A I R V P G N R S F F S L T E I V R F R C Q P G F V M V G S H T V Q C Q T N G R W G P K L P H CPaha_CR1_25 C T A P E V K N G I R V P G N R S F F S L N E I V R F R C Q P G F V M V G S H T V Q C Q T N N R W G P K L P H CRano_Crry_4 C T P P H V E N A V I V S K N K S L F S L R D M V E F R C Q D G F M M K G D S S V Y C R S L N R W E P Q L P S CMumu_Crry_4 C T P P P Y V E N A V M L S E N R S L F S L R D I V E F R C H P G F I M K G A S S V H C Q S L N K W E P E L P S CHosa_CR1_4 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R R V K C Q A L N K W E P E L P S CHosa_CR1_11 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R R V K C Q A L N K W E P E L P S CHosa_CR1_18 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R R V K C Q A L N K W E P E L P S CHosa_CR1_25 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R R V K C Q A L N K W E P E L P S CPatr_CR1_13 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F A M K G P R R V K C Q A L N K W E P E L P S CPatr_CR1_4 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P P R V K C Q A L N K W E P E L P S CPatr_CR1_20 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P H R V K C Q A L N K W E P E L P S CPatr_CR1L_9 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C L P G F V M K R P P P R V Q C Q A L N K W E T E L P S CHosa_CR1L_9 C T P P N V E G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P H R V Q C Q A L N K W E T E L P S CPacy_CR1L_4 C M P P N V E N G V L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R H V Q C Q A L N K W E P E L P S CPatr_CR1L_4 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R H V H C Q A L N K W E P E L P S CPaha_CR1_11 C M P P N V E N G I L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R R V Q C Q A L N K W E P E L P S CPaha_CR1_18 C M P P N V E N G I L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R R V Q C Q A L N K W E P E L P S CPaha_CR1_4 C T P P N V E N G I L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R R V Q C Q A L N K W E P E L P S CHosa_CR1L_4 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F G M K G P S H V K C Q A L N K W E P E L P S C

g-like x x x P H I x N G F R I x x x x P x x F x x x x x x x x x x x x x x x x x x x x x x x x x xPatr_CR1_7-8s C S F P H I P N G F R I S N P G P P Y F H N Y N V V F I C A F A T M E C Q T N D R WHosa_CR1_7-8s C S F P H I P N G F R I S N P G P P Y F R N Y N V V F I C A F A T M E C Q T N D R WPatr_CR1_8-9s C S F P H I P N G F R I S N P G P P Y F H N Y N V V F I C A F A T M E C Q T N D R WHosa_CR1_14-15s C S F P H I P N G F R I S N P G P P Y F R N Y N V V F I C A F A T M E C Q T N D R WPatr_CR1_16-17s C S F P H I P N G F R I S N P A P P Y F H N Y S V V F I Y M C A F A T M E C Q T N D K WHosa_CR1_21-22s C S F P H I P N G F R I S N P A P P Y F H N Y S V V F I C M Y A F A T M E C Q T N D K WPatr_CR1_23-24s P H I L N G F R I C G P N P S C F C N K T M V Y V CHosa_CR1_28-29s P H I L N G F R I C G P N P S C F C N K T M V F V C

Patr_CR1_30-31s P H I L N G F R I S R * E P P Y F Y S D R F C L * K W L C C N C QHosa_CR1_35-36s P H I L N G F R I S R * E P P Y F Y SPatr_CR1L_12+s P H I L N G F R I C R * E P P Y F Y S D H F C L * K W L C C N C QHosa_CR1L_12+s P H I L N G F R I C R * E P S Y F Y S

TABLE 1. SCR alignments from nine SCR groups found in Crry, CR1 and CR1L (Cont)

h C x x P x x M x G x x K x L x M K K x Y x Y G x x V x L x C E D G Y x L E G S x x S Q C Q x D x x W x P x L x x C 57Hosa_CR1_37 C S F P L F M N G I S K E L E M K K V Y H Y G D Y V T L K C E D G Y T L E G S P W S Q C Q A D D R W D P P L A K CPatr_CR1_32 C S F P L F M N G I S K E L E M K K V Y H Y G D Y V T L K C E D G Y T L E G S P W S Q C Q A D D R W D P P L A K CPaha_CR1_30 C S F P Q F M N G I S K E L E M K K V Y H Y G D Y V T L E C E D G Y A L E G S P W S Q C Q A D D R W D P P L A I CRano_Crry_6 C K L P Q D M S G F Q K G L Q M K K D Y Y Y G D N V A L E C E D G Y T L E G S S Q S Q C Q S D A S W D P P L P K CRano_Crry_7 C K L P Q D M S G F Q K G L Q M K K D Y Y Y G D N V A L E C E D G Y T L E G S S Q S Q C Q S D A S W D P P L P K CMumu_Crry_5 C R L P Q E M S G F Q K G L G M K K E Y Y Y G E N V T L E C E D G Y T L E G S S Q S Q C Q S D G S W N P L L A K C

j C x x P x x P x N G x V H x x x x x x x G S x x x Y x C x x G x R L x G x x x x x C x x x x x x x x W x x x x P x C 58Pacy_CR1L_2 C R N P K D P V N G M V H V I K D I Q F G S Q I N Y S C N K G Y R L I G S S S A T C I I S G N T V I W D N E T P I C

^ Paha_CR1_2 C R N P R D P V N G M V H V I K D I Q F G S Q I N Y S C T E G H R L I G S S S A T C I I S G N T V I W D N E T P I CPatr_CR1L_2 C R N P P D P V N G M V H V I K D I Q F G S Q I K Y S C T K G Y R L I G S S S A T C I I S G N T V I W D N K T P V CHosa_CR1L_2 C R N P P D P V N G M A H V I K D I Q F G S Q I K Y S C P K G Y R L I G S S S A T C I I S G N T V I W D N K T P V CPatr_CR1_2 C R N P P D P V N G M V H V I K D I Q F G S Q I K Y S C T K G Y R L I G S S S A T C I I S G D T V I W D N E T P I CHosa_CR1_2 C R N P P D P V N G M V H V I K G I Q F G S Q I K Y S C T K G Y R L I G S S S A T C I I S G D T V I W D N E T P I CRano_Crry_2 C E T P L D P Q N G I V H V N T D I R F G S S I T Y T C N E G Y R L I G S S S A M C I I S D Q S V A W D A E A P I CMumu_Crry_2 C K T P S D P E N G L V H V H T G I Q F G S R I N Y T C N Q G Y R L I G S S S A V C V I T D Q S V D W D T E A P I CHosa_CR1_9 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N A A H W S T K P P I CHosa_CR1_16 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N A A H W S T K P P I CPatr_CR1_11 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N A A H W S T K P P I CPatr_CR1_18 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N S A H W S T K P P I CHosa_CR1_23 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N T A H W S T K P P I CPaha_CR1_16 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I I S G N T A H W S T K P P I CPaha_CR1_9 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C V T S G N T A H W S T K P P I CHosa_CR1L_7 C E T P P V P V N G M V H V I T D I H V G S R I N Y S C T T G H R L I G H S S A E C I L S G N T A H W S M K P P I CPatr_CR1L_7 C E T P P V P V N G M V H V I T D I H V G S R I N Y S C I T G H R L I G H S S A E C I L S G N T A H W S M K P P I CHosa_CR1_30 C G P P P E P F N G M V H I N T D T Q F G S T V N Y S C N E G F R L I G S P S T T C L V S G N N V T W D K K A P I CPatr_CR1_25 C G P P P E P F N G M V H I N T D T Q F G S T V N Y S C N E G F R L I G S P S T T C L V S G N N V T W D K K A P I CPaha_CR1_23 C G T P P E P F N G M V H I N T D T Q F G S T V N Y S C N E G F R L I G S P S T T C L V S G N N V T W D K E A P I C

k C x x x x G x L x x G x V x x P x x L Q L G A K V x F V C x x G x x L K G x x x S x C V L x G x x x x W N x S V P V C 59Hosa_CR1L_6 C D D F L G Q L P N G H V L F P L N L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V CPatr_CR1L_6 C D D F L G Q L P N G R V L F P L N L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V CHosa_CR1_6 C D D F M G Q L L N G R V L F P V N L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V CHosa_CR1_13 C D D F M G Q L L N G R V L F P V N L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V CHosa_CR1_20 C D D F M G Q L L N G R V L F P V N L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V CPatr_CR1_6 C D D F M G Q L L N G R V L F P V N L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V CPatr_CR1_15 C D G F M G Q L L N G R V L F P V N L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V CPaha_CR1_6 C D D S L G Q L P N G R V L F P R S L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V CPaha_CR1_13 C D D S L G Q L P N G R V L F P R S L Q L G A K V D F V C D E G F Q L K G S S A S Y C V L A G M E S L W N S S V P V CHosa_CR1_27 C D D F L G Q L P H G R V L F P L N L Q L G A K V S F V C D E G F R L K G S S V S H C V L V G M R S L W N N S V P V CPatr_CR1_22 C D D F L G Q L P H G H V L F P L N L Q L G A K V S F V C D E G F R L K G S S V S H C V L V G M R S L W N N S V P V CPaha_CR1_20 C D D F L G Q L H H G R V L V P F N L Q L G A K V S F V C D E G F R L K G S S V S H C V L V G M R S L W N N S V P V CHosa_CR1L_11 C D D F L G Q L P H G R V L F P L N L Q L G A K V S F V C D E G F L K G R S A S H C V L A G M K A L W N S S V P V CPatr_CR1L_11 C D D F L G Q L P H G R V L F P L N L Q L G A K V S F V C D E G F R L K G R S A S H C V L A G M K A L W N S S V P V CPacy_CR1L_6 C D D F L G Q L P H G R V L F P L N L Q L G A K V S F V C D E G F R L K G R F A S H C V L A G M K A L W N S S V P V CPatr_CR1_29 C D D F L G Q L P H G R V L F P L N L Q L G A K V S F V C D E G F R L K G R S A S H C V L A G M K A L W N S S V P V CHosa_CR1_34 C D D F L G Q L P H G R V L L P L N L Q L G A K V S F V C D E G F R L K G R S A S H C V L A G M K A L W N S S V P V CPaha_CR1_27 C D E F L G Q L P H G R V L S P L N L Q L G A K V S F V C D E G F R L K G R S A S H C V L A G M K A L W N S S V P V CRano_Crry_5 C G A F L G E L P N G H V F V P Q N L Q L G A K V T F V C N T G Y Q L K G N S S S H C V L D G V E S I W N S S V P V C

* Consensus C x x P P x I x N G x I x x x x x x x F G D x I x Y x C x x G x x x x x x F x x x G x x x I x C x x x A x W x x x x P x C 61SCR Patterns L A Y E L F Y L G

V S V V S

TABLE 1. SCR alignments from nine SCR groups found in Crry, CR1 and CR1L (Cont).* The consensus SCR sequence derived by [11].† The proteins used to define the groups are Mumu and Rano Crry, Hosa, Patr, Paha CR1 and Hosa, Patr, Pacy CR1L. The residues essential for defining any of the subfamilies were only assigned when all group members had a single residue at a specific position and are shown as black boxes. Positions where multiple residues were present were designated with an (x). Of these, grey boxes indicate amino acids shared by multiple members of the group. Boxed sequences indicate partial or incomplete SCRs found within the genomic sequences. These generally involve frameshift mutations. When this is the case, the amino acid disrupted has been shade black and does not contain a residue. Sequence downstream is continued in the correct reading frame, thus ignoring the frameshift. These have been assigned to a SCR group based on their sequence present. Partial translations from the recently discovered g-like subfamily have been included but due to nucleotide degeneracy, limited sequence has been translated [9]. Partial, incomplete and degenerate SCRs were not included in phylogenetic analysis shown in Fig. 1a(ii) and Fig. 1b. § Number of residues for each subfamily. ^ Translated from the mRNA sequence but absent in respective protein sequence. Note Hosa is Homo sapien, Mumu is Mus musculus, Rano is Rattus norvegicus, Patr is Pan troglodytes, Paha is Papio hamadryas and Pacy is Papio Cynocephalus.

- 252 -

- 241 -




region: RCA ancestral haplotypes, function and disease" Immunogenetics

FIGURES AND TABLES

- 242 -

BstN1 RFLP locations

Polymorphic Geometric Element

5' Conserved Region

110

20

25

26

29

30

31

40

41

50

60

70

80

81

82

90

95

CR1-like (NT_086601) A A T T C C A A A T T G G C C T G G T T G A C A C T G T A C A A A A C C A C C A G A T A A T T A T A A T T T T A T T T A A C T C T T T G T C T T C T T T T C T T T - - - - C C T T C C C T C C T T C CCR1-like (NT_021877.16) A A T T C C A A A T T G G C C T G G T T G A C A C T G T A C A A A A C C A C C A G A T A A T T A T A A T T T T A T T T A A C T C T T T G T C T T C T T T T C T T T - - - - C C T T C C C T C C T T C CCR1 (NT_021877.16) A A T T C C A A A T T G G C C T G G T T G A C A T G G T G C C A A A C C A C C A A A T A A T T A T A A T T T T A T T T A A C T C T T T G T C T T C T T T T C T T T C T T T C C T T C C C T C C C T C C

1 10

20

25

26

29

30

31

40

41

50

60

70

80

82

83

84

85

90

99

96

98

100

110

120

130

140

150

160

170

180

190

194

CR1-like (NT_086601) C T T C T G C C T G C C T G C T T G C C T T C C T T C T T T G C T T G C T T C C T T C C T T C C T C C C T C C C T C C A T C C C T C C C T T C C T C C C T C C C T C C C T T C C T T C C T T C C T T CCR1-like (NT_021877.16) C T T C T G C C T G C C T G C T T G C C T T C C T T C T T T G C T T G C T T C C T T C C T T T C T C C C T C C C T T C C T C C C T C C T T T C C T T C C T T C C T C C C T C C C T C C C T C C C T T CCR1 (NT_021877.16) C T C C T - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - T T C C T C C C T C C C T C C C T C C C T C C

100

102

104

105

110

120

127

Polymorphic Geometric Element 3' Conserved Region

195

200

210

220

230

240

250

260

270

280

290

293

CR1-like (NT_086601) C T T C C T T C C T T C C T T C C T T C C T T C C T T C C T T C C T T C C C T C C T T C C C T C C T T C C C T C C T T C C C T C C T T C C C T C C T T C C C T C C T T T C C T T C T C C T T A T T T TCR1-like (NT_021877.16) C T C C C T C C C T T C C T T C C T T C C T T C C T T C C T T C C T T C C T T C C T T C C T T C C T T C C C T C C T T C C C T C C T T C C C T - - - - - - - - C C T T T C C T T C T C C T T A T T T TCR1 (NT_021877.16) C T C C C T C C C T T C C T T C C T T C C T T C C T T C T T T C C T T C C T T C C T T C C T T C C T T C C C T - - - - - - - - - - - - - - - - - - - - - - - - - C T T T C C T T - - - - - - A T T T T

128

130

140

150

160

170

180

182

183

190

191

195

294

300

310

311

312

320

330

340

350

360

370

380

386

387

390

391

CR1-like (NT_086601) C T T T C T T C T T T A C C A C A C - G G C T A G G A C C A C C A G T A T A A C A T T G A A C A T T G G T A G C A A T A G A T G T C A T C C T T G T C T T G T T C C A C A T C T C A A A G G G A A G GCR1-like (NT_021877.16) C T T T C T T C T T T A C C A C A C - G G C T A G G A C C A C C A G T A T A A C A T T G A A C A T T G G T A G C A A T A G A T G T C A T C C T T G T C T T G T T C C A C A T C T C A A A G G G A A G GCR1 (NT_021877.16) C T T T C T T C T T T A C C A C G C T G G C T A G G A C C A C C A G T A T A A C A T T G A A C A T T G G T A G C A A T A G A T G T C A T C C T T G T C T T G T T C C A C A T C T C A A A G T T A A A G

196

200

210

212

214

220

230

240

250

260

270

280

289

290

293

294

3' Conserved Region

a

100 kb 300 kb200 kb

CR1 MCPL CR1L MCP

Segment A Segment B

CR2 CD34

400 kb 500 kb

CR1MCP11 & CR1MCP12

CR1MCP6

CR1MCP5

CR1MCP11 & CR1MCP12

CR1MCP5 & CR1MCP6 CR1MCP5 & CR1MCP6

Figure 1. Multiple binding and amplification by primer pairs. Schematic representation of the genomic region on 1q32 showing the duplicated segments (purple and blue bars) containing the CR1 and MCP genes. The red and green lines indicate the positions of the forward (CR1MCP 5) and reverse primers (CR1MCP 6) designated P5+6. The amplified sequences of CR1 (purple) and CR1-like (blue), including Celera, have been aligned to show conserved regions flanking a polymorphic geometric element containing multiple complex components which distinguish CR1 and CR1-like sequences. Black shading and white text indicates conserved sequence. Numbers above and below the alignment represent nucleotide positions of CR1-like (Celera - NT_086601) and CR1 (NCBI – NT_021877.16) respectively. Also shown are locations of primers P 11+12 and BstN1 cutting sites (see Table 1). Conserved nucleotides at CR1-like positions 289-391 are part of a L1 element.

0

20

40

60

80

100

120

140

0

20

40

60

80

100

120

140

I 1 C04/0162X 5I 1a C04/0163D 5 16 17II 1 C04/0175J 5 16II 1a C04/0176Q 5 6 20III 1 C04/0174C 5 16 20III 2 C04/0159A 5 6III 3 C04/0177X 5 6

Observed Segregation

242bp 331bp

Deduced Genotypes

404bp

Ban

d In

tens

ityB

and

Inte

nsity

489bp 501bp

5

6

1617

16

5

20

III

II

I

1a1

41 2

1a

3

1

III

II

I

1a1

41 2

1a

3

1

ab = 5, 0; 5, 0cd = 5,16; 5,17ac = 5, 0; 5,16ef = 5,20; 6, 0ce = 5,16; 5,20af = 5, 0; 6, 0af = 5, 0; 6, 0

4

I

1a1

41 2

1a

3

1

III

II

4

I

1a1

41 2

1a

3

1

III

II

0

20

40

60

80

100

120

140

0

20

40

60

80

100

120

140

I 1 C04/0157M 45 16I 1a C04/0156F 4 6 9 14II 2 C04/0172P 4 14II 3 C04/0164K 5 6 9 16II 3a C04/0220C 45III 1 C04/0165R 56 9III 2 C04/0166Y 4 6 9

Ban

d In

tens

ityB

and

Inte

nsity

Observed Segregation

Deduced Genotypes

16

9

64

5

242bp 331bp 404bp 489bp 501bp

I

III

II

1

1 2 3

12

3 3a2

1 1a

2

I

III

II

1

1 2 3

12

3 3a2

1 1a

2

4

56

9 1416

I

III

II

1 a1

1 2 3 3a

1 2

1aI

III

II

1 a1

1 2 3 3a

1 2

1a1 a1

1 2 3 3a

1 2

1a

ab = 4, 0; 5,16cd = 4,14; 6, 9ac = 4, 0; 4,14

bd = 5,16; 6, 9ef = 4, 0; 5, 0fd = 5, 0; 6, 9ed = 4, 0; 6, 9

Family 1 Family 2

Figure 4. Segregation of ancestral haplotypes. GMT P5+6 profiles from 3-generation families confirm unequivocal segregation of haplotypes. In each case the profile overlay has been restricted to 2 generations. Individual profiles are coloured as shown in the family tree and the laboratory specimen codes. The number assigned to each band is derived from Fig 2.

5' Conserved Region Polymorphic Geometric Element 3' Conserved Region

25

26

29

31

41

52

81

90

97

98 * * * *

141

150

151

152

153

155

157

165

166

173

177

178

205

207

226

273

274

278

279

284

289

310

327

386

387

390

CR1-like (NT086601) C T A A G T T - - - - C C T T C C C T T C T G ( C C T G )2 C T T G ( C C T T )2 C T T T ( G C T T )2 ( C C T T )2 - C C T C A C T ( C C T C )2 C ( C C T T )7 C ( C C T T C C C T )6 C T C C T T C T A A - T G G G

CR1L_09001 (DQ007064) C T A A G A T - - - - C C T T C C C T T C T G ( C C T G )2 C T T G ( C C T T )2 C T T T ( G C T T )2 ( C C T T )2 - C C T C A C T ( C C T C )2 C ( C C T T )1 C ( C C T T C C C T )5 C T C C T T C T A A - C G G G




CR1L_10001 (DQ007068) C T A A G T T - - - - C C T T C C C T T C T G ( C C T G )2 C T T G ( C C T T )2 C T T T ( G C T T )2 ( C C T T )2 - C C T C A C T ( C C T C )2 C ( C C T T )3 C ( C C T T C C C T )5 C T C C T T C T A A - T G G G









CR1_05001 (DQ007054) T G G C A T T C T T T - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - C - - - - T T C ( C C T C )5 C ( C C T T )5 T ( C C T T C C C T )1 - T - - - - - - A G T T T T A


CR1_05001 (DQ007056) T G G C A T T C T T T - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - C - - - - T T C ( C C T C )5 Y ( C C T T )5 T ( C C T T C C C T )1 - T - - - - - - A G T T T T A

CR1_05001 (DQ007057) T G G C A T T C T T T - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - C - - - - T T C ( C C T C )5 Y ( C C T T )5 T ( C C T T C C C T )1 - T - - - - - - A G T T T T A



CR1_06001 (DQ007060) T G G C A T T C T T T - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - C - - - - T T C ( C C T C )4 C ( C C T T )7 C ( C C T T C C C T )1 - T - - - - - - A G T T T T A

CR1_07001 (DQ007061) T G G C A T T C T T T - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - C - - - - T T C ( C C T C )4 C ( C C T T )8 C ( C C T T C C C T )1 - T - - - - - - A G T T T T A


CR1_04002 (DQ007063) T G G C A T T C T T T - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - C - - - - T T T ( C C T C )4 C ( C C T T )5 T ( C C T T C C C T )1 - T - - - - - - A G T T T T A

CR1 (NT_021877.16) T G G C A T T C T T T - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - C - - - - T T C ( C C T C )4 C ( C C T T )5 T ( C C T T C C C T )1 - T - - - - - - A G T T T T A

25

26

29

31

41

52

81

82

83

84

85

94

104

106

114

115

130

134

135

154

156

175

182

186

191

212

214

230

289

290

293

CR1-like Defining Region Polymorphic Elements

Figure 6. Sequencing reveals the complexity of the haplospecific element and differences between CR1 and CR1-like. Sequence alignment identifies potential indels and polymorphic elements. The TC rich region is highly polymorphic in keeping with other haplospecific elements. Black shading and white text indicates consensus sequence on either side of the indel polymorphic region. The differences between CR1-like and CR1 are (i) G at 101, 105, 109, 113, 126 and 130 (*); (ii) length differences between 102 and 281bp; (iii) other indels. For the purposes of classifying the sequences of products we used (i) with or without the remainder. Numbers above and below the alignment represent nucleotide position of CR1-like (Celera - NT_086601) and CR1 (NCBI - NT _021877.16) respectively. Note “Y” indicates nucleotide C/T.

§ No residues a C x x P x x x x x A x x x x x x x x x x F P x G T x L x Y E C x P x Y x x x x F S I x C x x x x x W x x x x D x C 57

b C Q P P P x x L H x E x x x x x x x x F x x G x E V x Y x C x P x Y D L R G x x x x x C x P Q G D W x P x x P x C 57Hosa_CR1_5 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S M R C T P Q G D W S P A A P T C E V K SHosa_CR1_12 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S M R C T P Q G D W S P A A P T C E V K SHosa_CR1_19 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S M R C T P Q G D W S P A A P T C E V K SPatr_CR1_5 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S L R C T P Q G D W S P A T P T C E V K SPatr_CR1_14 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G A A S L R C T P Q G D W S P A A P T C E V K SPaha_CR1_5 C Q P P P D V L H G E R T Q R D K D I F Q T G Q E V F Y I C E P G Y D L R G A A S L R C T P Q G D W S P A A P R C E V K SPaha_CR1_12 C Q P P P D V L H G E R T Q R D K D I F Q P G Q E V F Y I C E P G Y D L R G A A S L R C T P Q G D W S P A A P R C E V K SHosa_CR1-like_5 C Q P P P D V L H A E R T Q R D K D N F S P G Q E V F Y S C E P G Y D L R G S T Y L H C T P Q G D W S P A A P R CPatr_CR1-like_5 C Q P P P D V L H G E R T Q R D K D N F S P G E E V Y Y S C E P G Y D L R G S T Y L H C T P Q G D W S P E A P R CHosa_CR1_26 C Q P P P E I L H G E H T P S H Q D N F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R C A V K SPatr_CR1_21 C Q P P P E I L H G E H T P S H Q D N F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R C A V K SPatr_CR1_28 C Q P P P E I L H G E H T P S H Q D N F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R C T V K SPaha_CR1_26 C Q P P P E I L H G E H T P S H Q D K F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P I C T V K SPacy_CR1-like_5 C Q P P P E I L H G E H T P S H Q D F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W N P E A P I CPaha_CR1_19 C Q P P P E I L H G E H T P S H Q D K F S P G Q E V F Y S C E P G Y D L R G A A S L H C T P Q G D W S P E A P R C A V K SHosa_CR1_33 C Q P P P E I L H G E H T L S H Q D N F S P G Q E V F Y S C E P S Y D L R G A A S L H C T P Q G D W S P E A P R C T V K SPatr_CR1-like_10C Q P P P E I L H G E H T L S H Q D N F S P G Q D V F Y S C E P G Y D L R G A A S L H C T P Q G D W T P E A P R CHosa_CR1-like_10C Q P P P E I L H G E H T L S H Q D N F L P G Q E V F Y S C E P S Y D L R G A A S L H C M P Q G D W T P E A P R C

c C P x P P K I Q N G H x I G G H V S L Y L P G M T I x Y I C D P G Y L L V G K G x I F C T D Q G I W S Q L D H Y C 57Hosa_CR1_36 C P D P P K I Q N G H Y I G G H V S L Y L P G M T I S Y I C D P G Y L L V G K G F I F C T D Q G I W S Q L D H Y C K E V NPatr_CR1_31 C P H P P K I Q N G H D I G G H V S L Y L P G M T I S Y I C D P G Y L L V G K G F I F C T D Q G I W S Q L D H Y C K E V NPaha_CR1_29 C P H P P K I Q N G H Y I G G H V S L Y L P G M T I G Y I C D P G Y L L V G K G I I F C T D Q G I W S Q L D H Y C K E V N

d C P x P P x I x N G R H x G x x x x x x P x G K x x x Y x C D P H x D R G x x x x L I G E S x I R x T S x x x G N G V W S S x A P R C 67Patr_CR1_8 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T T F D L I G E S T I R C T S D P Q G N G V W S S P A P R C G I L G HPatr_CR1_16 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T T F D L I G E S T I R C T S D P Q G N G V W S S P A P R C G I L G HPatr_CR1_7 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T T F D L I G E S T I R C T S D P Q G N G V W S S P A P R C G I L G HHosa_CR1_7 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T S F D L I G E S T I R C T S D P Q G N G V W S S P A P R C G I L G HHosa_CR1_21 C P S P P V I P N G R H T G K P L E V F P F G K A V N Y T C D P H P D R G T S F D L I G E S T I R C T S D P Q G N G V W S S P A P R C G I L G HHosa_CR1_14 C P S P P V I P N G R H T G K P L E V F P F G K T V N Y T C D P H P D R G T S F D L I G E S T I R C T S D P Q G N G V W S S P A P R C G I L G HPaha_CR1_7 C P S P P V I P N G R H T G K P L E V F P F G K A V T Y T C D P H P D R G M T F D L I G E S T I R C T S D P Q G N G V W S S P A P R C G I L G HPaha_CR1_14 C P S P P V I P N G R H T G K P L E V F P F G K A V T Y T C D P H P D R G M T F D L I G E S T I R C T S D P Q G N G V W S S R A P R C G I L G HHosa_CR1_28 C P N P P A I L N G R H T G T P S G D I P Y G K E I S Y T C D P H P D R G M T F N L I G E S T I R C T S D P H G N G V W S S P A P R C E L S V R A G HPatr_CR1_23 C P N P P A I L N G R H T G T P F G D I P Y G K E I S Y T C D P H P D R G M T F N L I G E S T I R C T S D P H G N G V W S S P A P R C E L P V H A G HHosa_CR1_35 C P N P P A I L N G R H T G T P F G D I P Y G K E I S Y A C D T H P D R G M T F N L I G E S S I R C T S D R Q G N G V W S S P A P R C E L S V P A APatr_CR1_30 C P N P P A I L N G R H T G T P F G D I P Y G K E I S Y A C D T H P D R G M T F N L I G E S S I R C T S D P Q G N G V W S S P A P R C E L S V P A AHosa_CR1-like_12C P N P P A I L N G R H T G T P P G D I P Y G K E V S Y T C D P H P D R G M T F N L I G E S T I R R T S E P H G N G V W S S P A P R CPatr_CR1-like_12C P N P P A I L N G R H T G T P L G D I P Y G K E V S Y T C D P H P D R G M T F N L I G E S T I R C T S D P H G N G V W S S P A P R CPaha_CR1_21 C P N P P A I L N G R H T G A L L G D I P Y G K E I S Y T C D P H R D R G M T F N L I G E S T I R C T S D L Q G N G V W S S P A P R C E L S V R A G HPaha_CR1_28 C P N P P A I L N G R H T G T P L G D I P Y G K E V S Y T C D P H P D R G M T F N L I G E S T I R C T S D L Q G N G V W S S P A P R C E L S V P A APacy_CR1-like_7 C P N P P A I L N G R H I G A P L G D I P Y G K E V S Y I C D P H P D R G M T V N L I G E S T I R C T S D P Q G N G V W S S P A P R C

e C x x P P x I x N G D F x S x x R x x F x x x x V V T Y x C x x x x x x x x x F x L V G E x S x x C T S x x x x x G x W S x P x P x C 67Hosa_CR1_10 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q C I I P N KHosa_CR1_17 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q C I I P N KHosa_CR1_3 C G L P P T I T N G D F I S T N R E N F H Y G S V V T Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q C I I P N KPatr_CR1_3 C G L P P T I T N G D F I S T N R E N F H Y G S V V T Y R C N P G S G G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q C I I P N KHosa_CR1_24 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N L G S R G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q C I I P N KPatr_CR1_12 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N P G S R G R K V F E L V G E P S I Y C T S N D D Q V G I W S G P A P Q C I I P N KPatr_CR1_19 C G L P P T I A N G D F I S T N R E N F H Y G S V V T Y R C N L G S R G R K V F E L V G E P S I Y C T S N D D Q V G I W A P Q C I I P N KPaha_CR1_10 C G L P P P I A N G D F I S T N R E Y F H Y G S V V T Y R C N L G S G R K K L F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q C I I P N KPacy_CR1-like_3 C G L P P T I A N G D F I S T S R E Y F P Y G S V V T Y R C N L G S G R K K L F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q CPaha_CR1_17 C G L P P P I A N G D F I S T N R E Y F H Y G S V V T Y R C N L G S G R K K L F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q CHosa_CR1-like_3 C G L P P T I A N G D F T S I S R E Y F H Y G S V V T Y H C N L G S R G K K V F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q CPatr_CR1-like_3 C G L P P T I A N G D F T S I S R E Y F H Y A S V V T Y H C N L G S G G K K V F E L V G E P S I Y C T S K D D Q V G I W S G P A P Q CPaha_CR1_3 C G L P P T I D N G D F F S A N K E Y F H Y G S V V T Y R C N L G S G G R K L F E L V G E P S I Y C T S N E D Q V G I W S G P A P Q C I I P N KHosa_CR1-like_8 C G L P P N I T N G Y F I S T D R E Y F H Y G S V V T Y H C N L G S R G R K V F E L V G E P S I Y C T S K D D Q V G V W S G P V P Q CPatr_CR1-like_8 C G L P P N I T N G Y F I S T D R E Y F H Y G S V V T Y R C N L G S R G R K V F E L V G E P S I Y C T S K G D Q V G V W Q CRano_Crry_3 C E I P P S I P N G D F F S P N R E D F H Y G M V V T Y Q C N T D A R G K K L F N L V G E P S I H C T S I D G Q V G V W S G P P P Q C I E L N KMumu_Crry_3 C E I P P G I P N G D F F S S T R E D F H Y G M V V T Y R C N T D A R G K A L F N L V G E P S L Y C T S N D G E I G V W S G P P P Q C I E L N KHosa_CR1_31 C E P P P T I S N G D F Y S N N R T S F H N G T V V T Y Q C H T G P D G E Q L F E L V G E R S I Y C T S K D D Q V G V W S S P P P R C I S T N KPatr_CR1_26 C E P P P T I S N G D F Y S N N R A S F H N G T V V T Y Q C H T G P D G E Q L F E L V G E R S I Y C T S K D D Q V G V W S S P P P R C I S T N KPaha_CR1_24 C K P P P T I S N G D F Y S N N R T S F H S G T V V T Y Q C H T G P D G E Q L F E L V G E R S I Y C T S K D D Q V G A W S S P P P R C I S T N K

f C x x P x V x x x x x x x x N x S x F S L x x x V x F R C x x G F x M x G x x x V x C x x x x x W x P x L P x C 56Hosa_CR1_32 C T A P E V E N A I R V P G N R S F F S L T E I V R F R C Q P G F V M V G S H T V Q C Q T N G R W G P K L P H C S R VPatr_CR1_27 C T A P E V E N A I R V P G N R S F F S L T E I V R F R C Q P G F V M V G S H T V Q C Q T N G R W G P K L P H C S R VPaha_CR1_25 C T A P E V K N G I R V P G N R S F F S L N E I V R F R C Q P G F V M V G S H T V Q C Q T N N R W G P K L P H C S R VRano_Crry_4 C T P P H V E N A V I V S K N K S L F S L R D M V E F R C Q D G F M M K G D S S V Y C R S L N R W E P Q L P S C F K V K SMumu_Crry_4 C T P P P Y V E N A V M L S E N R S L F S L R D I V E F R C H P G F I M K G A S S V H C Q S L N K W E P E L P S C F K G V IHosa_CR1_4 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R R V K C Q A L N K W E P E L P S C S R VHosa_CR1_11 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R R V K C Q A L N K W E P E L P S C S R VHosa_CR1_18 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R R V K C Q A L N K W E P E L P S C S R VHosa_CR1_25 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R R V K C Q A L N K W E P E L P S C S R VPatr_CR1_13 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F A M K G P R R V K C Q A L N K W E P E L P S C S R VPatr_CR1_4 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P P R V K C Q A L N K W E P E L P S C S R VPatr_CR1_20 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P H R V K C Q A L N K W E P E L P S C S R VPatr_CR1-like_9 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C L P G F V M K R P P P R V Q C Q A L N K W E T E L P S CHosa_CR1-like_9 C T P P N V E G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P H R V Q C Q A L N K W E T E L P S CPacy_CR1-like_4 C M P P N V E N G V L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R H V Q C Q A L N K W E P E L P S CPatr_CR1-like_4 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F V M K G P R H V H C Q A L N K W E P E L P S CPaha_CR1_11 C M P P N V E N G I L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R R V Q C Q A L N K W E P E L P S C S R VPaha_CR1_18 C M P P N V E N G I L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R R V Q C Q A L N K W E P E L P S C S R VPaha_CR1_4 C T P P N V E N G I L V S V N R S L F S L N E V V E F R C Q P G F V M K G P R R V Q C Q A L N K W E P E L P S C S R VHosa_CR1-like_4 C T P P N V E N G I L V S D N R S L F S L N E V V E F R C Q P G F G M K G P S H V K C Q A L N K W E P E L P S C

g-like x x x P H I x N G F R I x x x x P x x F x x x x x x x x x x x x x x x x x x x x x x x x x x

h C x x P x x M x G x x K x L x M K K x Y x Y G x x V x L x C E D G Y x L E G S x x S Q C Q x D x x W x P x L x x C 57

j C x x P x x P x N G x V H x x x x x x x G S x x x Y x C x x G x R L x G x x x x x C x x x x x x x x W x x x x P x C 58Pacy_CR1-like_2 C R N P K D P V N G M V H V I K D I Q F G S Q I N Y S C N K G Y R L I G S S S A T C I I S G N T V I W D N E T P I C

^ Paha_CR1_2 C R N P R D P V N G M V H V I K D I Q F G S Q I N Y S C T E G H R L I G S S S A T C I I S G N T V I W D N E T P I C E K I SPatr_CR1-like_2 C R N P P D P V N G M V H V I K D I Q F G S Q I K Y S C T K G Y R L I G S S S A T C I I S G N T V I W D N K T P V CHosa_CR1-like_2 C R N P P D P V N G M A H V I K D I Q F G S Q I K Y S C P K G Y R L I G S S S A T C I I S G N T V I W D N K T P V CPatr_CR1_2 C R N P P D P V N G M V H V I K D I Q F G S Q I K Y S C T K G Y R L I G S S S A T C I I S G D T V I W D N E T P I C D R I PHosa_CR1_2 C R N P P D P V N G M V H V I K G I Q F G S Q I K Y S C T K G Y R L I G S S S A T C I I S G D T V I W D N E T P I C D R I PRano_Crry_2 C E T P L D P Q N G I V H V N T D I R F G S S I T Y T C N E G Y R L I G S S S A M C I I S D Q S V A W D A E A P I C E S I PMumu_Crry_2 C K T P S D P E N G L V H V H T G I Q F G S R I N Y T C N Q G Y R L I G S S S A V C V I T D Q S V D W D T E A P I C E W I PHosa_CR1_9 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N A A H W S T K P P I C Q R I PHosa_CR1_16 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N A A H W S T K P P I C Q R I PPatr_CR1_11 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N A A H W S T K P P I C Q R I PPatr_CR1_18 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N S A H W S T K P P I C Q R I PHosa_CR1_23 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I L S G N T A H W S T K P P I C Q R I PPaha_CR1_16 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C I I S G N T A H W S T K P P I C Q R I PPaha_CR1_9 C K T P P D P V N G M V H V I T D I Q V G S R I N Y S C T T G H R L I G H S S A E C V T S G N T A H W S T K P P I C Q R I PHosa_CR1-like_7 C E T P P V P V N G M V H V I T D I H V G S R I N Y S C T T G H R L I G H S S A E C I L S G N T A H W S M K P P I CPatr_CR1-like_7 C E T P P V P V N G M V H V I T D I H V G S R I N Y S C I T G H R L I G H S S A E C I L S G N T A H W S M K P P I CHosa_CR1_30 C G P P P E P F N G M V H I N T D T Q F G S T V N Y S C N E G F R L I G S P S T T C L V S G N N V T W D K K A P I C E I I SPatr_CR1_25 C G P P P E P F N G M V H I N T D T Q F G S T V N Y S C N E G F R L I G S P S T T C L V S G N N V T W D K K A P I C E I I SPaha_CR1_23 C G T P P E P F N G M V H I N T D T Q F G S T V N Y S C N E G F R L I G S P S T T C L V S G N N V T W D K E A P I C E I I S

k C x x x x G x L x x G x V x x P x x L Q L G A K V x F V C x x G x x L K G x x x S x C V L x G x x x x W N x S V P V C 59

A3650GH1208R

G5575CD1850H

A4041CSILENT

C5507GP1827R

A4828GR1601G

T4855AS1610T

A4870GI1615V

G3093TQ981H

C5654TT1876I

T455CV115A

A1360GT445A

T2078CI684T

A4795GK1590E

Figure 7. Polymorphisms within SCR subfamiliesCCPs such as CR1, CR1-like and Crry contain Short Consensus Repeats 17 which we have classified into subfamilies as a, b, c etc.3-5 Each CCP has its particular order such as (ajefbkd)5 ch in the case of CR15 but the subfamilies are remarkably conserved as indicated by the degree of shading. Some of the known SNPs 6,7,18 have been mapped to the subfamilies since those changing conserved residues are likely to have profound functional effects. SNPs within a, j or e are likely to alter ligand binding.6 The BstN1 site is within j.^ Translated from the mRNA sequence but absent in respective protein sequence. Note Hosa is Homo sapien, Mumu is Mus musculus, Rano is Rattus norvegicus, Patr is Pan troglodytes, Paha is Papio hamadryas and Pacy is Papio Cynocephalus.

- 251 -


McLure, C., P. Kesners, S. Lester, D.Male, C. Amadou, J. Dawkins, B. Stewart, J.

Williamson and R. Dawkins. (In Press). "Haplotyping of the Canine MHC

without the need for DLA typing". Intl J. Immunogenetics

FIGURES AND TABLES

- 252 -

Figure 2. MHC Genotyping Report Reporting date: Family ID: CYO1-Peta)Cafa DLA-DQ-F1 + DLA-DQ-R1

Generation Lab No P1 P2 P3 p4

P5 P6 P7 P8 P9 DRB1 DQA1 DQB1a c d e f

I a C04/0000499J c d 5 3 1 3 1 1 1 1 1 01301,01501 00301,0601 00301,00501 II 1 C04/0000470Q a c 3 3 1 1 1 1 1 1 3 00201,01501 00601,00901 00101,00301

C05/0000512L a c 7 4 1 1 1 1 1 1 3

C05/0000534J a c 9 4 1 1 1 1 1 1 3

II 1a C04/0000473K e f 7 1 1 1 3 1 1 3 1 00201,01501 00601,00901 00101,02002C05/0000511E e f 9 1 1 1 6 1 1 3 1

III 1 C04/0000512M c f 5 3 1 1 1 1 1 2 1 00201,01501 00601,00901 00101,00301C04/0000530J c f 9 5 1 1 1 1 1 4 1

III 2 C04/0000513T a e 4 1 1 1 3 1 1 1 3 00201,01501 00601,00901 00101,02002C04/0000531Q a e 9 1 1 1 3 1 1 1 3

III 3 C04/0000514A c f 6 3 1 1 1 1 1 3 1 00201,01501 00601,00901 00101,00301C04/0000532X c f 9 4 1 1 1 1 1 4 1

III 4 C04/0000518B c e 4 3 1 1 3 1 1 1 1 01501 00601 00301,02002C04/0000533D c e 9 4 1 1 6 1 1 1 1

C05/0000535Q c e 9 4 1 1 4 1 1 1 1

III 5 C04/0000516N c e 6 4 1 1 4 1 1 1 1 01501 00601 00301,02002C04/0000534K c e 9 4 1 1 6 1 1 1 1

III 6 C04/0000517U a e 5 1 1 1 2 1 1 1 3 00201,01501 00601,00901 00101,02002C04/0000535R a e 9 1 1 1 5 1 1 1 3

III 7 C04/0000515G a f 4 1 1 1 1 1 1 3 3 00201 00901 00101C04/0000536Y a f 8 1 1 1 1 1 1 3 3

III 8 C05/0000566Z c f 9 5 1 1 1 1 1 4 1 00101,00301III 9 C05/0000567F c f 9 5 1 1 1 1 1 4 1 00101,00301III 10 C05/0000568M a e 9 1 1 1 4 1 1 1 4 00101,02002III 11 C05/0000569T c f 9 5 1 1 1 1 1 4 1 00101,00301III 12 C05/0000570C a f 9 1 1 1 1 1 1 4 4 00101,III 13 C05/0000571J c f 9 5 1 1 1 1 1 4 1 00101,00301III 14 C05/0000572Q a e 9 1 1 1 4 1 1 1 4 00101,02002III 15 C05/0000573X a e 9 1 1 1 4 1 1 1 4 00101,02002

DQB1 allele 3 5 2 1 1

0 0 0 0 0

1 1 0 1 1

2

Name Lab No P1 P2 P3 P4 P5 P6 P7 P8 P9 DRB1 DQA1 DQB1

Ned C04/0000474R 5 1 3 1 3 1 1 1 1 01501 00601 02002, 02301

Theo C04/0000471X 6 1 3 1 1 1 3 1 1 01501 00601, 00901 00101, 02301

Kinky 5 * 01501 00601 02301*1 additional polymorphic fragment.

b) c)Deduced Haplotypes

DRB1 DQA1 DQB1a 00201 00901 00101b NTc 01501 00601 00301d 01301 00301 00501e 01501 00601 02002f 00201 00901 00101

Figure 2. MHC Genotyping Report. Genotype analysis of 21 Blue Heeler dogs using GMT and a comparison to DLA alleles assigned by coventional SBT. Figure 1a reports the results of GMT typing and DLA DR, DQA and DQB of the 3-generation family. 3 unrelated individuals have also been included. 1b shows the family tree of the grand parents, parents and offspring that have resulted from two separate matings. 1c is a summary of the deduced DLA haplotypes. Three unrelated Blue Heelers (Ned, Theo, Kinky) are included.

COMMENT1. The Cafa_classII F1 & R1 primers amplify within DLA DQ alpha 1 and DQ beta 1 (NW_139872, positions 143791-144189 and 210163-210376 respectively).

- 252 -

- 255 -


McLure, C., J. Dawkins, B. Stewart, and R. Dawkins. (In preparation). " Identification

of traits and function in livestock by genomic matching: Genetically determining


FIGURES AND TABLES

- 256 -

F

0003 9706980099190004 9835 9918

00059805 99250006982099310007 000898199915

000997109809 9917001098119908

0011

0135 9716 98349914

001297369831 9906

0013970898029923 00149705 9821 9909 9910

0015 0016 00170018 0019

0020 9702 97039839 9912 00219735 9921

0022

00239838 99270024 9731 9812 9929

0025

0026 0027

0028 98019904

0029 97349825 9924

0030 9829 9928 00319711 9823 9920 0032 0288005000510150 9985 0052 0053 005401550055 00560304 0057 015100580059 0060 0061 0062 9984 0063 006400650173 99920066

0067

006800690070 007100720073 0172 00740170 00750076 0154 00770156 998600780153 0079008000810113 0160 9991 008200830084 008501710086 00870088

0089 02539952

00909967 00910099

97779888 9970

01000101 9982 0102 01030104 99880105 010601070108 0109 0110 02040111 01120114 01150116

0117

01180119 01200121 012201230124 012501260127 0128 0129 99890130 0131 01320133 01340152 0157 0303 01580159

0161

0162 0163 02850164 0286 0287 0165

0166

0167

0168

01690174 0175 0176017701780179 0180 01810182 9979 01830184 0185

0186

0197

0198

019902000201 02020203 020502060207

0208

02090210 0210002101

02102

02110212 021302140215 02160217 021802190220 022102220223 0224

0250

0251

0252

02540255

0256 02570258

0259026002610262 0263 02640265

0266

026702680269 0270 02710272 02730274

0275

0276 027702780279

02800281

02820283

0284

02890290

0291 0292

029302940295 0295a

0296 0297 0298

0299

0300040903010427

0302 0413

03050363 045503060423 03070308

0309 04000310

031 1 0424 0312 0313

03140315

0316

0317

0318

03190422 03200401

0321 0322 03230324 0325

03260327 03280329 0330 033103320333 0334

0335

0336

03370338 0339

03400341 03420343 0344 03450346 03470348

034903500351

0352 03530354

03550356 0357 03580359 0360036103620388 0391 0392 039403640365 0366 0367

03680369

0370

03710372

0373 0374 03750376037703780379 038003810382 0383 03840385 0386 03870389 0390039303950396 0397 0398

04020403

0405

0406

0407 040804100411 0412

0414 04150416 0417 04180419 0420 0421

04250426 0428 0429

0430

04310432

0433

0434

0435

04360437

0438

0439

0440 0441

0442 0443

0444 044504460447 04480449 04500451 0452

0453

04540456 0457

0N 033

1U 058

6X Y

7019

79Y

8102

8117

8223

8276

8278

83038324

8336

8342

84088439

8470

8495

8504 8520

8531

8552 8557

8574

8607

8615 86618676

8679

8681

8703 8710

8717

8718

8755

8766

8767

8769

8828 88538856

8857

8865

8878 8890

8900

8903 89058909

8970 8914 8934 8941 8956

8959

8962 9003

9009

9028

9054

9056 9078

9081

9087 90929112 9127 91369138

9156

9160

9163

9181 9202 9203 92169217

9219

922092219223

9239

9242 92539258 9301

9302

9314 9318 93199320

9326

9327

9335

9336

9339

9349 93539361

93639365 9370 93839398 9402 9403 94049405

9407940994139414

9415

9416

942794309432 9438 9445 9451

9453

9455 95029503 9505

9506

9509

951 19521

9526 95489555

9559

96049608

9612 9729 9613

9615 96169617

9624 97049804

9626

9631

9634 96359636

9639 96419645

9649

965697559876

96699675

97009701 98169902 99039707 9818 9950 9709 9712 98159913

9713

9714 9715 9717971897199826 9827 97209814 990099019721 9722975098839723 98039724 97259726 97279728 973097329733 9737 985198529751 9752

9753 9890

9754 97569857 9969 97579966 975898629759 97609853 99639761 9762

976398759960

97649879 9971 9765 9884

9766 9882

9767 98649973

9768

97699865 99549770 9771

9772 9873

97739866 997297749964

9775 9870 9978

9776 9886979Z9806 9807

9808

9810

9813993098179822

9824

98289974

9830

983299589833 9836 99269837 99329850

9854

9855

9856

98589956

9859

9860 9861 99579863 9867

9868

9869 9871 9872 9874996898779959 9878 988099519881

9885

9887 9889 98919892

9899 9905

9907

9911

9916

9922

99539955 9961

9962

9965 99759976

9977

99809981 998399879990 9993

9994

ADAM

ARNIE

B301

BE70

BE8CALIDJ

D1 14

DexII

Du sty D

Emir

Exc els

Exodus

EXTRA G4 1HMAYER JNT1 Ken

L157

Lad y

Martello

MPF

Mrs

O2 7PANZER

PK09 2PL1 72

Poloni

R?? ?1 R?? ?2 R?? ?3

R?? ?4

RaffDex3

RB???2 RB???3

RedRogue

RedVolt

RNT1

SBL6 3K

SPHERC

SPP

U0 24

U0 36 Usc h

W00 3

W01 6

W03 6 W13 W39

Y0 82

Yarl

YellVolt

Z012Z509Zazou Zodia c

Zulu

0002

0001

KarKarg

0004 9835 9918 001098119908

0028 9801990400560304 00860101 9982 0104 99880109 01200130 01340157 0303

0168

0200 0207 0212 0224

0250

0254

0258

0267 0270 0274

028403000409

03140317

0318

032004010327 0329

03370339

0343 0348

0355035803590373 03780379 03810382039504310448 0450

0N033

1U058

8102 8223

8278

830383248495

8552

8607

8679 8828

8865

89038959

9112 9138930193189339

9349 9361

9370 9383

9612 9729 9624 970498049950 97099728 97569857 9969

9775 9870 9978

9817

9830

9837 99329850

98689981

ADAM

ARNIE

CALIDJ

DustyD

Excels

EXTRAHMAYER PANZER

SPP

U024

U036 Usch

W003

W016Y082 Zazou

Zulu

Figure 1. Pedigree of 920 cattle.The pedigree above shows the controlled interbreeding within a herd over the last 20 years. Names are assigned to those cattle introduced tothe family, Numbers are assigned to cattle that were born on the property, such that the first two numbers represent the year and the last tworepresent the number in that year. DNA and serum has been collected from all the individual shaded grey. The cattle shaded green have not beencollected as yet. The DNA collection covers at least 4 generations with multiple offspring in each. These samples will be invaluable with thefuture genetic analysis of phenotypic traits.

Figure 2. Beef Breeder database for phenotypic and genotypic data management.

Screen shots of the many layers to the Beef Breeder database. a) Main Page, b) Data entry and analysis options, 1c) Search cattle based on any category, d) Individual cattle details, e) 4 generation family trees identifying parents, grand parents and great grand parents, f) Progeny Table, f) Entry of updated data , h) Laboratory data management.

a)

b)

c)

d)

e)

f)

g)

h)

- 261 -

BIBLIOGRAPHY

- 262 -

- 263 -

BIBLIOGRAPHY Abraham, L. J., D. C. Du, K. Zahedi, R. L. Dawkins and A. S. Whitehead (1991). "Haplotypic

polymorphisms of the TNFB gene." Immunogenetics 33(1): 50-3.

Abraham, L. J., C. Leelayuwat, G. Grimsley, M. A. Degli-Esposti, A. Mann, W. J. Zhang, F. T.

Christiansen and R. L. Dawkins (1992). "Sequence differences between HLA-B and TNF

distinguish different MHC ancestral haplotypes." Tissue Antigens 39(3): 117-21.

Accardo, P., P. Sanchez-Corral, O. Criado, E. Garcia and S. Rodriguez de Cordoba (1996). "Binding of

human complement component C4b-binding protein (C4BP) to Streptococcus pyogenes involves

the C4b-binding site." J Immunol 157(11): 4935-9.

Acland, G. M., K. Ray, C. S. Mellersh, W. Gu, A. A. Langston, J. Rine, E. A. Ostrander and G. D.

Aguirre (1998). "Linkage analysis and comparative mapping of canine progressive rod-cone

degeneration (prcd) establishes potential locus homology with retinitis pigmentosa (RP17) in

humans." Proc Natl Acad Sci U S A 95(6): 3048-53.

Adams, E. M., M. C. Brown, M. Nunge, M. Krych and J. P. Atkinson (1991). "Contribution of the

repeating domains of membrane cofactor protein (CD46) of the complement system to ligand

binding and cofactor activity." J Immunol 147(9): 3005-11.

Ahearn, J. M. and A. M. Rosengard (1998). Complement Receptors. The human complement system in

health and disease. J. E. Volanakis and N. M. Frank. New York, Marcel Dekker: 167-202.

Albrecht, J. C. and B. Fleckenstein (1992). "New member of the multigene family of complement control

proteins in herpesvirus saimiri." J Virol 66(6): 3937-40.

Alper, C. A. (1998). "A history of complement genetics." Exp Clin Immunogenet 15(4): 203-12.

Alper, C. A., D. Raum, S. Karp, Z. L. Awdeh and E. J. Yunis (1983). "Serum complement 'supergenes' of

the major histocompatibility complex in man (complotypes)." Vox Sang 45(1): 62-7.

Awdeh, Z. L., D. Raum, E. J. Yunis and C. A. Alper (1983). "Extended HLA/complement allele

haplotypes: evidence for T/t-like complex in man." Proc Natl Acad Sci U S A 80(1): 259-63.

Bailey, J. A., Z. Gu, R. A. Clark, K. Reinert, R. V. Samonte, S. Schwartz, M. D. Adams, E. W. Myers, P.

W. Li and E. E. Eichler (2002). "Recent segmental duplications in the human genome." Science

297(5583): 1003-7.

Bell, E. (2000). "Murine embryonic survival depends on regulation of complement." Immunology Today

21(3): 109.

Bergelson, J. M., J. G. Mohanty, R. L. Crowell, N. F. St John, D. M. Lublin and R. W. Finberg (1995).

"Coxsackievirus B3 adapted to growth in RD cells binds to decay-accelerating factor (CD55)." J

Virol 69(3): 1903-6.

- 264 -

Berggard, K., E. Johnsson, F. R. Mooi and G. Lindahl (1997). "Bordetella pertussis binds the human

complement regulator C4BP: role of filamentous hemagglutinin." Infect Immun 65(9): 3638-43.

Berkower, C., M. Ravins, A. E. Moses and E. Hanski (1999). "Expression of different group A

streptococcal M proteins in an isogenic background demonstrates diversity in adherence to and

invasion of eukaryotic cells." Mol Microbiol 31(5): 1463-75.

Bernet, J., J. Mullick, A. K. Singh and A. Sahu (2003). "Viral mimicry of the complement system." J

Biosci 28(3): 249-64.

Birmingham, D. J., W. Chen, G. Liang, H. C. Schmitt, K. Gavit and H. N. Nagaraja (2003). "A CR1

polymorphism associated with constitutive erythrocyte CR1 levels affects binding to C4b but not

C3b." Immunology 108(4): 531-8.

Birmingham, D. J. and L. A. Hebert (2001). "CR1 and CR1-like: the primate immune adherence

receptors." Immunol Rev 180: 100-11.

Blackmore, T. K., V. A. Fischetti, T. A. Sadlon, H. M. Ward and D. L. Gordon (1998). "M protein of the

group A Streptococcus binds to the seventh short consensus repeat of human complement factor

H." Infect Immun 66(4): 1427-31.

Blom, A. M., J. Webb, B. O. Villoutreix and B. Dahlback (1999). "A cluster of positively charged amino

acids in the C4BP alpha-chain is crucial for C4b binding and factor I cofactor function." J Biol

Chem 274(27): 19237-45.

Blom, A. M., A. F. Zadura, B. O. Villoutreix and B. Dahlback (2000). "Positively charged amino acids at

the interface between alpha-chain CCP1 and CCP2 of C4BP are required for regulation of the

classical C3-convertase." Mol Immunol 37(8): 445-53.

Blumbach, B., Z. Pancer, B. Diehl-Seifert, R. Steffen, J. Munkner, I. Muller and W. E. Muller (1998).

"The putative sponge aggregation receptor. Isolation and characterization of a molecule

composed of scavenger receptor cysteine-rich domains and short consensus repeats." J Cell Sci

111 ( Pt 17): 2635-44.

Bora, N. S., D. M. Lublin, B. V. Kumar, R. D. Hockett, V. M. Holers and J. P. Atkinson (1989).

"Structural gene for human membrane cofactor protein (MCP) of complement maps to within

100 kb of the 3' end of the C3b/C4b receptor gene." J Exp Med 169(2): 597-602.

Brenneman, R. A., S. K. Davis, J. O. Sanders, B. M. Burns, T. C. Wheeler, J. W. Turner and J. F. Taylor

(1996). "The polled locus maps to BTA1 in a Bos indicus x Bos taurus cross." J Hered 87(2):

156-61.

Brodbeck, W. G., L. Kuttner-Kondo, C. Mold and M. E. Medof (2000). "Structure/function studies of

human decay-accelerating factor." Immunology 101(1): 104-11.

Brodbeck, W. G., D. Liu, J. Sperry, C. Mold and M. E. Medof (1996). "Localization of classical and

alternative pathway regulatory activity within the decay-accelerating factor." J Immunol 156(7):

2528-33.

- 265 -

Campbell, R. D. (1988). "The molecular genetics of components of the complement system." Baillieres

Clin Rheumatol 2(3): 547-75.

Campbell, R. D. and J. Trowsdale (1993). "Map of the human MHC." Immunol Today 14(7): 349-52.

Caras, I. W., M. A. Davitz, L. Rhee, G. Weddell, D. W. Martin, Jr. and V. Nussenzweig (1987). "Cloning

of decay-accelerating factor suggests novel use of splicing to generate two proteins." Nature

325(6104): 545-9.

Carroll, M. C., E. M. Alicot, P. J. Katzman, L. B. Klickstein, J. A. Smith and D. T. Fearon (1988).

"Organization of the genes encoding complement receptors type 1 and 2, decay-accelerating

factor, and C4-binding protein in the RCA locus on human chromosome 1." J Exp Med 167(4):

1271-80.

Casasnovas, J. M., M. Larvie and T. Stehle (1999). "Crystal structure of two CD46 domains reveals an

extended measles virus-binding surface." Embo J 18(11): 2911-22.

Changelian, P. S. and D. T. Fearon (1986). "Tissue-specific phosphorylation of complement receptors

CR1 and CR2." J Exp Med 163(1): 101-15.

Chen, W., C. M. Logar, X. P. Shen and D. J. Birmingham (2000). "The chimpanzee and cynomolgus

monkey erythrocyte immune adherence receptors are encoded by CR1-like genes."

Immunogenetics 52(1-2): 46-52.

Clarkson, N. A., R. Kaufman, D. M. Lublin, T. Ward, P. A. Pipkin, P. D. Minor, D. J. Evans and J. W.

Almond (1995). "Characterization of the echovirus 7 receptor: domains of CD55 critical for

virus binding." J Virol 69(9): 5497-501.

Consortium, T. C. e. S. (1998). "Genome sequence of the nematode C. elegans: a platform for

investigating biology." Science 282(5396): 2012-8.

Cooper, N. R. (1998). Complement and Viruses. The human complement system in health and disease. J.

E. Volanakis and N. M. Frank. New York, Marcel Dekker: 393-407.

Coyne, K. E., S. E. Hall, S. Thompson, M. A. Arce, T. Kinoshita, T. Fujita, D. J. Anstee, W. Rosse and

D. M. Lublin (1992). "Mapping of epitopes, glycosylation sites, and complement regulatory

domains in human decay accelerating factor." J Immunol 149(9): 2906-13.

Dahlback, B., C. A. Smith and H. J. Muller-Eberhard (1983). "Visualization of human C4b-binding

protein and its complexes with vitamin K-dependent protein S and complement protein C4b."

Proc Natl Acad Sci U S A 80(11): 3461-5.

Dawkins, R., C. Leelayuwat, S. Gaudieri, G. Tay, J. Hui, S. Cattley, P. Martinez and J. Kulski (1999).

"Genomics of the major histocompatibility complex: haplotypes, duplication, retroviruses and

disease." Immunol Rev 167: 275-304.

- 266 -

Dawkins, R. L., F. T. Christiansen, P. H. Kay, M. Garlepp, J. McCluskey, P. N. Hollingsworth and P. J.

Zilko (1983). "Disease associations with complotypes, supratypes and haplotypes." Immunol

Rev 70: 1-22.

Dawkins, R. L., M. P. Degli-Esposti, L. J. Abraham, W. Zhang and F. T. Christiansen (1991).

Conservation versus polymorphism of the MHC in relation to transplantation, immune response

and autoimmune disease. Molecular Evolution of the Major Histocompatibility Complex. J.

Klein and D. Klein. Heidelberg, Springer-Verlag. 59.

Dawkins, R. L., A. Leaver, P. U. Cameron, E. Martin, P. H. Kay and F. T. Christiansen (1989). "Some

disease-associated ancestral haplotypes carry a polymorphism of TNF." Hum Immunol 26(2):

91-7.

Debenham, S. L., E. A. Hart, J. L. Ashurst, K. L. Howe, M. A. Quail, W. E. Ollier and M. M. Binns

(2005). "Genomic sequence of the class II region of the canine MHC: comparison with the MHC

of other mammalian species." Genomics 85(1): 48-59.

Degli-Esposti, M. A., L. J. Abraham, V. McCann, T. Spies, F. T. Christiansen and R. L. Dawkins

(1992a). "Ancestral haplotypes reveal the role of the central MHC in the immunogenetics of

IDDM." Immunogenetics 36(6): 345-56.

Degli-Esposti, M. A., A. Andreas, F. T. Christiansen, B. Schalke, E. Albert and R. L. Dawkins (1992b).

"An approach to the localization of the susceptibility genes for generalized myasthenia gravis by

mapping recombinant ancestral haplotypes." Immunogenetics 35(6): 355-64.

Degli-Esposti, M. A., A. L. Leaver, F. T. Christiansen, C. S. Witt, L. J. Abraham and R. L. Dawkins

(1992c). "Ancestral haplotypes: conserved population MHC haplotypes." Hum Immunol 34(4):

242-52.

Deininger, P. L., J. V. Moran, M. A. Batzer and H. H. Kazazian, Jr. (2003). "Mobile elements and

mammalian genome evolution." Curr Opin Genet Dev 13(6): 651-8.

DeNise, S., E. Johnston, J. Halverson, K. Marshall, D. Rosenfeld, S. McKenna, T. Sharp and J. Edwards

(2004). "Power of exclusion for parentage verification and probability of match for identity in

American Kennel Club breeds using 17 canine microsatellite markers." Anim Genet 35(1): 14-7.

Dhiman, N., R. M. Jacobson and G. A. Poland (2004). "Measles virus receptors: SLAM and CD46." Rev

Med Virol 14(4): 217-29.

Dorig, R. E., A. Marcil, A. Chopra and C. D. Richardson (1993). "The human CD46 molecule is a

receptor for measles virus (Edmonston strain)." Cell 75(2): 295-305.

Dykman, T. R., J. A. Hatch, M. S. Aqua and J. P. Atkinson (1985). "Polymorphism of the C3b/C4b

receptor (CR1): characterization of a fourth allele." J Immunol 134(3): 1787-9.

Endo, T., K. Ikeo and T. Gojobori (1996). "Large-scale search for genes on which positive selection may

operate." Mol Biol Evol 13(5): 685-90.

- 267 -

Evans, D. J. and J. W. Almond (1998). "Cell receptors for picornaviruses as determinants of cell tropism

and pathogenesis." Trends Microbiol 6(5): 198-202.

Favoreel, H. W., G. R. Van de Walle, H. J. Nauwynck and M. B. Pensaert (2003). "Virus complement

evasion strategies." J Gen Virol 84(Pt 1): 1-15.

Fingeroth, J. D., J. J. Weis, T. F. Tedder, J. L. Strominger, P. A. Biro and D. T. Fearon (1984). "Epstein-

Barr virus receptor of human B lymphocytes is the C3d receptor CR2." Proc Natl Acad Sci U S

A 81(14): 4510-4.

Fodor, W. L., S. A. Rollins, S. Bianco-Caron, R. P. Rother, E. R. Guilmette, W. V. Burton, J. C.

Albrecht, B. Fleckenstein and S. P. Squinto (1995). "The complement control protein homolog

of herpesvirus saimiri regulates serum complement by inhibiting C3 convertase activity." J Virol

69(6): 3889-92.

Francisco, L. V., A. A. Langston, C. S. Mellersh, C. L. Neal and E. A. Ostrander (1996). "A class of

highly polymorphic tetranucleotide repeats for canine genetic mapping." Mamm Genome 7(5):

359-62.

Garbe, J. R. and Y. Da (2004). "Pedigraph user manual version 2.0 trail version." Department of Animal

Science, University of Minnesota.

Garlepp, M. J., P. H. Kay, B. R. Farrow and R. L. Dawkins (1984). "Autoimmunity in spontaneous

myasthenia gravis in dogs." Clinical Immunology and Immunopathology 31(2): 301 - 6.

Gaudieri, S., R. L. Dawkins, K. Habara, J. K. Kulski and T. Gojobori (2000a). Nucleotide diversity within

the human Major Histocompatibility Complex: Function of hitch-hiking effect, duplications,

indels and recombination. The Major Histocompatibility Complex: Evolution, Structure, and

Function. M. Kasahara. Tokyo, Springer-Verlag: 186-200.

Gaudieri, S., R. L. Dawkins, K. Habara, J. K. Kulski and T. Gojobori (2000b). "SNP profile within the

human major histocompatibility complex reveals an extreme and interrupted level of nucleotide

diversity." Genome Res 10(10): 1579-86.

Gaudieri, S., K. M. Giles, J. K. Kulski and R. L. Dawkins (1997a). "Duplication and polymorphism in the

MHC: Alu generated diversity and polymorphism within the PERB11 gene family." Hereditas

127(1-2): 37-46.

Gaudieri, S., J. K. Kulski, L. Balmer, K. M. Giles, H. Inoko and R. L. Dawkins (1997b). "Retroelements

and segmental duplications in the generation of diversity within the MHC." DNA Seq 8(3): 137-

41.

Gaudieri, S., J. K. Kulski, R. L. Dawkins and T. Gojobori (1999a). "Different evolutionary histories in

two subgenomic regions of the major histocompatibility complex." Genome Res 9(6): 541-9.

- 268 -

Gaudieri, S., J. K. Kulski, R. L. Dawkins and T. Gojobori (1999b). "Extensive nucleotide variability

within a 370 kb sequence from the central region of the major histocompatibility complex."

Gene 238(1): 157-61.

Gaudieri, S., C. Leelayuwat, G. K. Tay, D. C. Townend and R. L. Dawkins (1997c). "The major

histocompatability complex (MHC) contains conserved polymorphic genomic sequences that are

shuffled by recombination to form ethnic-specific haplotypes." J Mol Evol 45(1): 17-23.

Gaudieri, S., C. Leelayuwat, D. C. Townend, J. K. Kulski and R. L. Dawkins (1997d). "Genomic

characterization of the region between HLA-B and TNF: implications for the evolution of

multicopy gene families." J Mol Evol 44 Suppl 1: S147-54.

Gaudieri, S., N. Longman-Jacobsen, G. K. Tay and R. L. Dawkins (2001). "Sequence analysis of the

MHC class I region reveals the basis of the genomic matching technique." Hum Immunol 62(3):

279-85.

Georges, M., R. Drinkwater, T. King, A. Mishra, S. S. Moore, D. Nielsen, L. S. Sargeant, A. Sorensen,

M. R. Steele, X. Zhao and et al. (1993). "Microsatellite mapping of a gene affecting horn

development in Bos taurus." Nat Genet 4(2): 206-10.

Gigli, I., T. Fujita and V. Nussenzweig (1979). "Modulation of the classical pathway C3 convertase by

plasma proteins C4 binding protein and C3b inactivator." Proc Natl Acad Sci U S A 76(12):

6596-600.

Gordon, D. L., R. M. Kaufman, T. K. Blackmore, J. Kwong and D. M. Lublin (1995). "Identification of

complement regulatory domains in human factor H." J Immunol 155(1): 348-56.

Guillaudeux, T., M. Janer, G. K. Wong, T. Spies and D. E. Geraghty (1998). "The complete genomic

sequence of 424,015 bp at the centromeric end of the HLA class I region: gene content and

polymorphism." Proc Natl Acad Sci U S A 95(16): 9494-9.

Halverson, J., J. Dvorak and T. Stevenson (1995). Microsatellite sequences for canine genotyping. USA.

Harlizius, B., I. Tammen, K. Eichler, A. Eggen and D. J. Hetzel (1997). "New markers on bovine

chromosome 1 are closely linked to the polled gene in Simmental and Pinzgauer cattle." Mamm

Genome 8(4): 255-7.

Hedrick, P. W., R. N. Lee and C. Buchanan (2003). "Canine parvovirus enteritis, canine distemper, and

major histocompatibility complex genetic variation in Mexican wolves." J Wildl Dis 39(4): 909-

13.

Heine-Suner, D., M. A. Diaz-Guillen, F. P. de Villena, M. Robledo, J. Benitez and S. Rodriguez de

Cordoba (1997). "A high-resolution map of the regulator of the complement activation gene

cluster on 1q32 that integrates new genes and markers." Immunogenetics 45(6): 422-7.

Heine-Suner, D., M. A. Diaz-Guillen, A. J. Lange and S. Rodriguez de Cordoba (1998). "Sequence and

structure of the human 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase heart isoform gene

(PFKFB2)." Eur J Biochem 254(1): 103-10.

- 269 -

Hellwage, J., S. Kuhn and P. F. Zipfel (1997). "The human complement regulatory factor-H-like protein

1, which represents a truncated form of factor H, displays cell-attachment activity." Biochem J

326 ( Pt 2): 321-7.

Herrera, A. H., L. Xiang, S. G. Martin, J. Lewis and J. G. Wilson (1998). "Analysis of complement

receptor type 1 (CR1) expression on erythrocytes and of CR1 allelic markers in Caucasian and

African American populations." Clin Immunol Immunopathol 87(2): 176-83.

Holers, V. M., T. Kinoshita and H. Molina (1992). "The evolution of mouse and human complement C3-

binding proteins: divergence of form but conservation of function." Immunol Today 13(6): 231-

6.

Horstmann, R. D., H. J. Sievertsen, J. Knobloch and V. A. Fischetti (1988). "Antiphagocytic activity of

streptococcal M protein: selective binding of complement control protein factor H." Proc Natl

Acad Sci U S A 85(5): 1657-61.

Horton, R., D. Niblett, S. Milne, S. Palmer, B. Tubby, J. Trowsdale and S. Beck (1998). "Large-scale

sequence comparisons reveal unusually high levels of variation in the HLA-DQB1 locus in the

class II region of the human MHC." J Mol Biol 282(1): 71-97.

Hoshino, M., F. Matsuzaki, Y. Nabeshima and C. Hama (1993). "hikaru genki, a CNS-specific gene

identified by abnormal locomotion in Drosophila, encodes a novel type of protein." Neuron

10(3): 395-407.

Hourcade, D., V. M. Holers and J. P. Atkinson (1989). "The regulators of complement activation (RCA)

gene cluster." Adv Immunol 45: 381-416.

Hourcade, D., M. K. Liszewski, M. Krych-Goldberg and J. P. Atkinson (2000). "Functional domains,

structural variations and pathogen interactions of MCP, DAF and CR1." Immunopharmacology

49(1-2): 103-16.

Hourcade, D., T. W. Post, V. M. Holers, D. M. Lublin and J. P. Atkinson (1990). "Polymorphisms of the

regulators of complement activation gene cluster." Complement Inflamm 7(4-6): 302-14.

Hughes, J. F. and J. M. Coffin (2001). "Evidence for genomic rearrangements mediated by human

endogenous retroviruses during primate evolution." Nat Genet 29(4): 487-9.

Hughes, J. F. and J. M. Coffin (2004). "Human endogenous retrovirus K solo-LTR formation and

insertional polymorphisms: implications for human and viral evolution." Proc Natl Acad Sci U S

A 101(6): 1668-72.

Iwata, K., T. Seya, Y. Yanagi, J. M. Pesando, P. M. Johnson, M. Okabe, S. Ueda, H. Ariga and S.

Nagasawa (1995). "Diversity of sites for measles virus binding and for inactivation of

complement C3b and C4b on membrane cofactor protein CD46." J Biol Chem 270(25): 15148-

52.

- 270 -

Johnsson, E., K. Berggard, H. Kotarsky, J. Hellwage, P. F. Zipfel, U. Sjobring and G. Lindahl (1998).

"Role of the hypervariable region in streptococcal M proteins: binding of a human complement

inhibitor." J Immunol 161(9): 4894-901.

Johnsson, E., A. Thern, B. Dahlback, L. O. Heden, M. Wikstrom and G. Lindahl (1996). "A highly

variable region in members of the streptococcal M protein family binds the human complement

regulator C4BP." J Immunol 157(7): 3021-9.

Jouve, M., M. I. Garcia, P. Courcoux, A. Labigne, P. Gounon and C. Le Bouguenec (1997). "Adhesion to

and invasion of HeLa cells by pathogenic Escherichia coli carrying the afa-3 gene cluster are

mediated by the AfaE and AfaD proteins, respectively." Infect Immun 65(10): 4082-9.

Kalli, K. R. and D. T. Fearon (1994). "Binding of C3b and C4b by the CR1-like site in murine CR1." J

Immunol 152(6): 2899-903.

Kallstrom, H., M. K. Liszewski, J. P. Atkinson and A. B. Jonsson (1997). "Membrane cofactor protein

(MCP or CD46) is a cellular pilus receptor for pathogenic Neisseria." Mol Microbiol 25(4): 639-

47.

Kennedy, L. J., A. Barnes, G. M. Happ, R. J. Quinnell, D. Bennett, J. M. Angles, M. J. Day, N.

Carmichael, J. F. Innes, D. Isherwood, S. D. Carter, W. Thomson and W. E. Ollier (2002a).

"Extensive interbreed, but minimal intrabreed, variation of DLA class II alleles and haplotypes

in dogs." Tissue Antigens 59(3): 294-304.

Kennedy, L. J., A. Barnes, G. M. Happ, R. J. Quinnell, O. Courtenay, S. D. Carter, W. E. Ollier and W.

Thomson (2002b). "Evidence for extensive DLA polymorphism in different dog populations."

Tissue Antigens 60(1): 43-52.

Ketheesan, N., S. Gaudieri, C. S. Witt, G. K. Tay, D. C. Townend, F. T. Christiansen and R. L. Dawkins

(1999). "Reconstruction of the block matching profiles." Hum Immunol 60(2): 171-6.

Kijas, J. W., B. J. Miller, S. E. Pearce-Kelling, G. D. Aguirre and G. M. Acland (2003). "Canine models

of ocular disease: outcross breedings define a dominant disorder present in the English mastiff

and bull mastiff dog breeds." J Hered 94(1): 27-30.

Kirkitadze, M. D. and P. N. Barlow (2001). "Structure and flexibility of the multiple domain proteins that

regulate complement activation." Immunol Rev 180: 146-61.

Kirkitadze, M. D., D. T. Dryden, S. M. Kelly, N. C. Price, X. Wang, M. Krych, J. P. Atkinson and P. N.

Barlow (1999). "Co-operativity between modules within a C3b-binding site of complement

receptor type 1." FEBS Lett 459(1): 133-8.

Klein, J., C. O'hUigin, M. Kasahara, V. Vincek, D. Klein and F. Figueroa (1991). Frozen haplotypes in

Mhc evolution. Molecular Evolution of the Major Histocompatibility Complex. J. Klein and D.

Klein. Berlin, Springer-Verlag: 261-86.

Klein, J. and N. Takahata (1990). "The major histocompatibility complex and the quest for origins."

Immunol Rev 113: 5-25.

- 271 -

Klickstein, L. B., T. J. Bartow, V. Miletic, L. D. Rabson, J. A. Smith and D. T. Fearon (1988).

"Identification of distinct C3b and C4b recognition sites in the human C3b/C4b receptor (CR1,

CD35) by deletion mutagenesis." J Exp Med 168(5): 1699-717.

Kotarsky, H., J. Hellwage, E. Johnsson, C. Skerka, H. G. Svensson, G. Lindahl, U. Sjobring and P. F.

Zipfel (1998). "Identification of a domain in human factor H and factor H-like protein-1 required

for the interaction with streptococcal M proteins." J Immunol 160(7): 3349-54.

Kotwal, G. J., A. W. Hugin and B. Moss (1989). "Mapping and insertional mutagenesis of a vaccinia

virus gene encoding a 13,800-Da secreted protein." Virology 171(2): 579-87.

Kotwal, G. J., S. N. Isaacs, R. McKenzie, M. M. Frank and B. Moss (1990). "Inhibition of the

complement cascade by the major secretory protein of vaccinia virus." Science 250(4982): 827-

30.

Kotwal, G. J. and B. Moss (1988). "Analysis of a large cluster of nonessential genes deleted from a

vaccinia virus terminal transposition mutant." Virology 167(2): 524-37.

Krushkal, J., O. Bat and I. Gigli (2000). "Evolutionary relationships among proteins encoded by the

regulator of complement activation gene cluster." Mol Biol Evol 17(11): 1718-30.

Krych, M., L. Clemenza, D. Howdeshell, R. Hauhart, D. Hourcade and J. P. Atkinson (1994). "Analysis

of the functional domains of complement receptor type 1 (C3b/C4b receptor; CD35) by

substitution mutagenesis." J Biol Chem 269(18): 13273-8.

Krych, M., R. Hauhart and J. P. Atkinson (1998). "Structure-function analysis of the active sites of

complement receptor type 1." J Biol Chem 273(15): 8623-9.

Krych, M., D. Hourcade and J. P. Atkinson (1991). "Sites within the complement C3b/C4b receptor

important for the specificity of ligand binding." Proc Natl Acad Sci U S A 88(10): 4353-7.

Krych-Goldberg, M., R. E. Hauhart, V. B. Subramanian, B. M. Yurcisin, 2nd, D. L. Crimmins, D. E.

Hourcade and J. P. Atkinson (1999). "Decay accelerating activity of complement receptor type 1

(CD35). Two active sites are required for dissociating C5 convertases." J Biol Chem 274(44):

31160-8.

Kuhn, S. and P. F. Zipfel (1996). "Mapping of the domains required for decay acceleration activity of the

human factor H-like protein 1 and factor H." Eur J Immunol 26(10): 2383-7.

Kulski, J. K., S. Gaudieri, M. Bellgard, L. Balmer, K. Giles, H. Inoko and R. L. Dawkins (1997). "The

evolution of MHC diversity by segmental duplication and transposition of retroelements." J Mol

Evol 45(6): 599-609.

Kulski, J. K., S. Gaudieri and R. L. Dawkins (2000). "Using alu J elements as molecular clocks to trace

the evolutionary relationships between duplicated HLA class I genomic segments." J Mol Evol

50(6): 510-9.

- 272 -

Kulski, J. K., S. Gaudieri, H. Inoko and R. L. Dawkins (1999a). "Comparison between two human

endogenous retrovirus (HERV)-rich regions within the major histocompatibility complex." J

Mol Evol 48(6): 675-83.

Kulski, J. K., S. Gaudieri, A. Martin and R. L. Dawkins (1999b). "Coevolution of PERB11 (MIC) and

HLA class I genes with HERV-16 and retroelements by extended genomic duplication." J Mol

Evol 49(1): 84-97.

Kumar, S., K. Tamura, I. B. Jakobsen and M. Nei (2001). "MEGA2: molecular evolutionary genetics

analysis software." Bioinformatics 17(12): 1244-5.

Kuttner-Kondo, L., M. E. Medof, W. Brodbeck and M. Shoham (1996). "Molecular modeling and

mechanism of action of human decay-accelerating factor." Protein Eng 9(12): 1143-9.

Lai, E., J. Riley, I. Purvis and A. Roses (1998). "A 4-Mb high-density single nucleotide polymorphism-

based map around human APOE." Genomics 54(1): 31-8.

Leelayuwat, C., L. J. Abraham, H. Tabarias, F. T. Christiansen and R. L. Dawkins (1992). "Genomic

organization of a polymorphic duplicated region centromeric of HLA-B." Immunogenetics

36(4): 208-12.

Leelayuwat, C., D. C. Townend, M. A. Degli-Esposti, L. J. Abraham and R. L. Dawkins (1994). "A new

polymorphic and multicopy MHC gene family related to nonmammalian class I."


Li, W. H. and L. A. Sadler (1991). "Low nucleotide diversity in man." Genetics 129(2): 513-23.

Lindahl, G., U. Sjobring and E. Johnsson (2000). "Human complement regulators: a major target for

pathogenic microorganisms." Curr Opin Immunol 12(1): 44-51.

Liszewski, M. K., T. C. Farries, D. M. Lublin, I. A. Rooney and J. P. Atkinson (1996). "Control of the

complement system." Adv Immunol 61: 201-83.

Liszewski, M. K., M. Leung, W. Cui, V. B. Subramanian, J. Parkinson, P. N. Barlow, M. Manchester and

J. P. Atkinson (2000). "Dissecting sites important for complement regulatory activity in

membrane cofactor protein (MCP; CD46)." J Biol Chem 275(48): 37692-701.

Liszewski, M. K., T. W. Post and J. P. Atkinson (1991). "Membrane cofactor protein (MCP or CD46):

newest member of the regulators of complement activation gene cluster." Annu Rev Immunol 9:

431-55.

Logar, C. M., W. Chen, H. Schmitt, C. Y. Yu and D. J. Birmingham (2004). "A human CR1-like

transcript containing sequence for a binding protein for iC4 is expressed in hematopoietic and

fetal lymphoid tissue." Mol Immunol 40(11): 831-40.

Longman-Jacobsen, N., J. F. Williamson, R. L. Dawkins and S. Gaudieri (2003). "In polymorphic

genomic regions indels cluster with nucleotide polymorphism: Quantum Genomics." Gene 312:

257-61.

- 273 -

Lowell, C. A., L. B. Klickstein, R. H. Carter, J. A. Mitchell, D. T. Fearon and J. M. Ahearn (1989).

"Mapping of the Epstein-Barr virus and C3dg binding sites to a common domain on complement

receptor type 2." J Exp Med 170(6): 1931-46.

Lublin, D. M., M. K. Liszewski, T. W. Post, M. A. Arce, M. M. Le Beau, M. B. Rebentisch, L. S.

Lemons, T. Seya and J. P. Atkinson (1988). "Molecular cloning and chromosomal localization

of human membrane cofactor protein (MCP). Evidence for inclusion in the multigene family of

complement-regulatory proteins." J Exp Med 168(1): 181-94.

Manchester, M., A. Valsamakis, R. Kaufman, M. K. Liszewski, J. Alvarez, J. P. Atkinson, D. M. Lublin

and M. B. Oldstone (1995). "Measles virus and C3 binding sites are distinct on membrane

cofactor protein (CD46)." Proc Natl Acad Sci U S A 92(6): 2303-7.

Marschang, P., J. Sodroski, R. Wurzner and M. P. Dierich (1995). "Decay-accelerating factor (CD55)

protects human immunodeficiency virus type 1 from inactivation by human complement." Eur J

Immunol 25(1): 285-90.

Marshall, B., C. Leelayuwat, M. A. Degli-Esposti, M. Pinelli, L. J. Abraham and R. L. Dawkins (1993).

"New major histocompatibility complex genes." Hum Immunol 38(1): 24-9.

Martinez, O. P., N. Longman-Jacobsen, R. Davies, E. K. Chung, Y. Yang, S. Gaudieri, R. L. Dawkins

and C. Y. Yu (2001). "Genetics of human complement component C4 and evolution the central

MHC." Front Biosci 6: D904-13.

Martinez, O. P., C. S. Witt, G. Tay, F. T. Christiansen and R. L. Dawkins (1994). "Immunogenetic

analysis of successful and rejected bone marrow grafts within one family." European Journal of


Matsumoto, A. K., J. Kopicky-Burd, R. H. Carter, D. A. Tuveson, T. F. Tedder and D. T. Fearon (1991).

"Intersection of the complement and immune systems: a signal transduction complex of the B

lymphocyte-containing complement receptor type 2 and CD19." J Exp Med 173(1): 55-64.

McKenzie, R., G. J. Kotwal, B. Moss, C. H. Hammer and M. M. Frank (1992). "Regulation of

complement activity by vaccinia virus complement-control protein." J Infect Dis 166(6): 1245-

50.

McLure, C., P. Kesners, S. Lester, D. Male, C. Amadou, J. Dawkins, B. Stewart, J. Williamson and R.

Dawkins (Submitted-a). "Haplotyping of the canine MHC without the need for DLA typing."

McLure, C., J. Williamson, L. Smyth, S. Agrawal, S. Lester, J. Millman, P. Keating, B. Stewart and R.

Dawkins (Submitted-b). "Extensive genomic and functional polymorphism of Complement

Control Proteins."

McLure, C. A., R. L. Dawkins, J. F. Williamson, R. A. Davies, J. Berry, L. J. Natalie, R. Laird and S.

Gaudieri (2004a). "Amino acid patterns within short consensus repeats define conserved

duplicons shared by genes of the RCA complex." J Mol Evol 59(2): 143-57.

- 274 -

McLure, C. A., J. F. Williamson, B. J. Stewart, P. J. Keating and R. L. Dawkins (2004b). "Genomic

analysis reveals a duplication of eight rather than seven short consensus repeats in primate CR1

and CR1L: evidence for an additional set shared between CR1 and CR2." Immunogenetics

56(9): 631-8.

McLure, C. A., J. F. Williamson, B. J. Stewart, P. J. Keating and R. L. Dawkins (2005). "Indels and

imperfect duplication have driven the evolution of human Complement Receptor 1 (CR1) and

CR1-like from their precursor CR1 alpha: Importance of functional sets." Hum Immunol 66(3):

258-73.

Medof, M. E., T. Kinoshita and V. Nussenzweig (1984). "Inhibition of complement activation on the

surface of cells after incorporation of decay-accelerating factor (DAF) into their membranes." J

Exp Med 160(5): 1558-78.

Medof, M. E., D. M. Lublin, V. M. Holers, D. J. Ayers, R. R. Getty, J. F. Leykam, J. P. Atkinson and M.

L. Tykocinski (1987). "Cloning and characterization of cDNAs encoding the complete sequence

of decay-accelerating factor of human complement." Proc Natl Acad Sci U S A 84(7): 2007-11.

Mikata, S., S. Miyagawa, K. Iwata, S. Nagasawa, M. Hatanaka, M. Matsumoto, W. Kamiike, H. Matsuda,

R. Shirakura and T. Seya (1998). "Regulation of complement-mediated swine endothelial cell

lysis by a surface-bound form of human C4b binding protein." Transplantation 65(3): 363-8.

Miller, C. G., S. N. Shchelkunov and G. J. Kotwal (1997). "The cowpox virus-encoded homolog of the

vaccinia virus complement control protein is an inflammation modulatory protein." Virology

229(1): 126-33.

Mold, C., B. M. Bradt, G. R. Nemerow and N. R. Cooper (1988). "Epstein-Barr virus regulates activation

and processing of the third component of complement." J Exp Med 168(3): 949-69.

Molina, H., C. Brenner, S. Jacobi, J. Gorka, J. C. Carel, T. Kinoshita and V. M. Holers (1991). "Analysis

of Epstein-Barr virus-binding sites on complement receptor 2 (CR2/CD21) using human-mouse

chimeras and peptides. At least two distinct sites are necessary for ligand-receptor interaction." J

Biol Chem 266(19): 12173-9.

Molina, H., T. Kinoshita, C. B. Webster and V. M. Holers (1994). "Analysis of C3b/C3d binding sites

and factor I cofactor regions within mouse complement receptors 1 and 2." J Immunol 153(2):

789-95.

Molina, H., S. J. Perkins, J. Guthridge, J. Gorka, T. Kinoshita and V. M. Holers (1995). "Characterization

of a complement receptor 2 (CR2, CD21) ligand binding site for C3. An initial model of ligand

interaction with two linked short consensus repeat modules." J Immunol 154(10): 5426-35.

Montefiori, D. C., R. J. Cornell, J. Y. Zhou, J. T. Zhou, V. M. Hirsch and P. R. Johnson (1994).

"Complement control proteins, CD46, CD55, and CD59, as common surface constituents of

human and simian immunodeficiency viruses and possible targets for vaccine protection."

Virology 205(1): 82-92.

- 275 -

Moore, M. D., N. R. Cooper, B. F. Tack and G. R. Nemerow (1987). "Molecular cloning of the cDNA

encoding the Epstein-Barr virus/C3d receptor (complement receptor type 2) of human B

lymphocytes." Proc Natl Acad Sci U S A 84(24): 9194-8.

Moore, M. D., R. G. DiScipio, N. R. Cooper and G. R. Nemerow (1989). "Hydrodynamic, electron

microscopic, and ligand-binding analysis of the Epstein-Barr virus/C3dg receptor (CR2)." J Biol

Chem 264(34): 20576-82.

Moulds, J. M., J. D. Reveille and F. C. Arnett (1996). "Structural polymorphisms of complement receptor

1 (CR1) in systemic lupus erythematosus (SLE) patients and normal controls of three ethnic

groups." Clin Exp Immunol 105(2): 302-5.

Moulds, J. M., B. J. Thomas, O. Doumbo, D. A. Diallo, K. E. Lyke, C. V. Plowe, J. A. Rowe and D. J.

Birmingham (2004). "Identification of the Kna/Knb polymorphism and a method for Knops

genotyping." Transfusion 44(2): 164-9.

Moulds, J. M., P. A. Zimmerman, O. K. Doumbo, L. Kassambara, I. Sagara, D. A. Diallo, J. P. Atkinson,

M. Krych-Goldberg, R. E. Hauhart, D. E. Hourcade, D. T. McNamara, D. J. Birmingham, J. A.

Rowe, J. J. Moulds and L. H. Miller (2001). "Molecular identification of Knops blood group

polymorphisms found in long homologous region D of complement receptor 1." Blood 97(9):

2879-85.

Nagar, B., R. G. Jones, R. J. Diefenbach, D. E. Isenman and J. M. Rini (1998). "X-ray crystal structure of

C3d: a C3 fragment and ligand for complement receptor 2." Science 280(5367): 1277-81.

Naniche, D., G. Varior-Krishnan, F. Cervoni, T. F. Wild, B. Rossi, C. Rabourdin-Combe and D. Gerlier

(1993). "Human membrane cofactor protein (CD46) acts as a cellular receptor for measles

virus." J Virol 67(10): 6025-32.

Neeleman, C., S. P. Geelen, P. C. Aerts, M. R. Daha, T. E. Mollnes, J. J. Roord, G. Posthuma, H. van

Dijk and A. Fleer (1999). "Resistance to both complement activation and phagocytosis in type 3

pneumococci is mediated by the binding of complement regulatory protein factor H." Infect

Immun 67(9): 4517-24.

Nemerow, G. R., C. Mold, V. K. Schwend, V. Tollefson and N. R. Cooper (1987). "Identification of

gp350 as the viral glycoprotein mediating attachment of Epstein-Barr virus (EBV) to the

EBV/C3d receptor of B cells: sequence homology of gp350 and C3 complement fragment C3d."

J Virol 61(5): 1416-20.

Nicholson-Weller, A., J. Burge and K. F. Austen (1981). "Purification from guinea pig erythrocyte stroma

of a decay-accelerating factor for the classical c3 convertase, C4b,2a." J Immunol 127(5): 2035-

9.

Nicholson-Weller, A., J. Burge, D. T. Fearon, P. F. Weller and K. F. Austen (1982). "Isolation of a

human erythrocyte membrane glycoprotein with decay-accelerating activity for C3 convertases

of the complement system." J Immunol 129(1): 184-9.

- 276 -

Nowicki, B., A. Hart, K. E. Coyne, D. M. Lublin and S. Nowicki (1993). "Short consensus repeat-3

domain of recombinant decay-accelerating factor is recognized by Escherichia coli recombinant

Dr adhesin in a model of a cell-cell interaction." J Exp Med 178(6): 2115-21.

Okada, N., M. K. Liszewski, J. P. Atkinson and M. Caparon (1995). "Membrane cofactor protein (CD46)

is a keratinocyte receptor for the M protein of the group A streptococcus." Proc Natl Acad Sci U

S A 92(7): 2489-93.

Ollier, W. E., L. J. Kennedy, W. Thomson, A. N. Barnes, S. C. Bell, D. Bennett, J. M. Angles, J. F. Innes

and S. D. Carter (2001). "Dog MHC alleles containing the human RA shared epitope confer

susceptibility to canine rheumatoid arthritis." Immunogenetics 53(8): 669-73.

Pahler, S., B. Blumbach, I. Muller and W. E. Muller (1998). "Putative multiadhesive protein from the

marine sponge Geodia cydonium: cloning of the cDNA encoding a fibronectin-, an SRCR-, and

a complement control protein module." J Exp Zool 282(3): 332-43.

Pardo-Manuel, F., J. Rey-Campos, A. Hillarp, B. Dahlback and S. Rodriguez de Cordoba (1990).

"Human genes for the alpha and beta chains of complement C4b-binding protein are closely

linked in a head-to-tail arrangement." Proc Natl Acad Sci U S A 87(12): 4529-32.

Peiffer, I., A. L. Servin and M. F. Bernet-Camard (1998). "Piracy of decay-accelerating factor (CD55)

signal transduction by the diffusely adhering strain Escherichia coli C1845 promotes

cytoskeletal F-actin rearrangements in cultured human intestinal INT407 cells." Infect Immun

66(9): 4036-42.

Pham, T., A. Kaul, A. Hart, P. Goluszko, J. Moulds, S. Nowicki, D. M. Lublin and B. J. Nowicki (1995).

"dra-related X adhesins of gestational pyelonephritis-associated Escherichia coli recognize SCR-

3 and SCR-4 domains of recombinant decay-accelerating factor." Infect Immun 63(5): 1663-8.

Prechl, J. and A. Erdei (2000). "Immunomodulatory functions of murine CR1/2." Immunopharmacology

49(1-2): 117-24.

Ram, S., F. G. Mackinnon, S. Gulati, D. P. McQuillen, U. Vogel, M. Frosch, C. Elkins, H. K.

Guttormsen, L. M. Wetzler, M. Oppermann, M. K. Pangburn and P. A. Rice (1999). "The

contrasting mechanisms of serum resistance of Neisseria gonorrhoeae and group B Neisseria

meningitidis." Mol Immunol 36(13-14): 915-28.

Ram, S., D. P. McQuillen, S. Gulati, C. Elkins, M. K. Pangburn and P. A. Rice (1998a). "Binding of

complement factor H to loop 5 of porin protein 1A: a molecular mechanism of serum resistance

of nonsialylated Neisseria gonorrhoeae." J Exp Med 188(4): 671-80.

Ram, S., A. K. Sharma, S. D. Simpson, S. Gulati, D. P. McQuillen, M. K. Pangburn and P. A. Rice

(1998b). "A novel sialic acid binding site on factor H mediates serum resistance of sialylated

Neisseria gonorrhoeae." J Exp Med 187(5): 743-52.

Reid, K. B. (1986). "Activation and control of the complement system." Essays Biochem 22: 27-68.

- 277 -

Reid, K. B. and A. J. Day (1989). "Structure-function relationships of the complement components."

Immunol Today 10(6): 177-80.

Rey-Campos, J., D. Baeza-Sanz and S. Rodriguez de Cordoba (1990). "Physical linkage of the human

genes coding for complement factor H and coagulation factor XIII B subunit." Genomics 7(4):

644-6.

Rey-Campos, J., P. Rubinstein and S. Rodriguez de Cordoba (1987). "Decay-accelerating factor. Genetic

polymorphism and linkage to the RCA (regulator of complement activation) gene cluster in

humans." J Exp Med 166(1): 246-52.

Rey-Campos, J., P. Rubinstein and S. Rodriguez de Cordoba (1988). "A physical map of the human

regulator of complement activation gene cluster linking the complement genes CR1, CR2, DAF,

and C4BP." J Exp Med 167(2): 664-9.

Robinson, W. E., Jr., D. C. Montefiori and W. M. Mitchell (1988). "Antibody-dependent enhancement of

human immunodeficiency virus type 1 infection." Lancet 1(8589): 790-4.

Rodriguez de Cordoba, S., M. A. Diaz-Guillen and D. Heine-Suner (1999). "An integrated map of the

human regulator of complement activation (RCA) gene cluster on 1q32." Mol Immunol 36(13-

14): 803-8.

Rodriguez de Cordoba, S., D. M. Lublin, P. Rubinstein and J. P. Atkinson (1985). "Human genes for

three complement components that regulate the activation of C3 are tightly linked." J Exp Med

161(5): 1189-95.

Rodriguez de Cordoba, S. and P. Rubinstein (1987). "New alleles of C4-binding protein and factor H and

further linkage data in the regulator of complement activation (RCA) gene cluster in man."


Rosengard, A. M., Y. Liu, Z. Nie and R. Jimenez (2002). "Variola virus immune evasion design:

expression of a highly efficient inhibitor of human complement." Proc Natl Acad Sci U S A

99(13): 8808-13.

Rowe, J. A., J. M. Moulds, C. I. Newbold and L. H. Miller (1997). "P. falciparum rosetting mediated by a

parasite-variant erythrocyte membrane protein and complement-receptor 1." Nature 388(6639):

292-5.

Rowen, L., B. F. Koop and L. Hood (1996). "The complete 685-kilobase DNA sequence of the human

beta T cell receptor locus." Science 272(5269): 1755-62.

Rutherford, K., J. Parkhill, J. Crook, T. Horsnell, P. Rice, M. A. Rajandream and B. Barrell (2000).

"Artemis: sequence visualization and annotation." Bioinformatics 16(10): 944-5.

Sahu, A., S. N. Isaacs, A. M. Soulika and J. D. Lambris (1998). "Interaction of vaccinia virus

complement control protein with human complement proteins: factor I-mediated degradation of

C3b to iC3b1 inactivates the alternative complement pathway." J Immunol 160(11): 5596-604.

- 278 -

Santoro, F., P. E. Kennedy, G. Locatelli, M. S. Malnati, E. A. Berger and P. Lusso (1999). "CD46 is a

cellular receptor for human herpesvirus 6." Cell 99(7): 817-27.

Sargiacomo, M., M. Sudol, Z. Tang and M. P. Lisanti (1993). "Signal transducing molecules and

glycosyl-phosphatidylinositol-linked proteins form a caveolin-rich insoluble complex in MDCK

cells." J Cell Biol 122(4): 789-807.

Satta, Y., Y. J. Li and N. Takahata (1998). "The neutral theory and natural selection in the HLA region."

Front Biosci 3: d459-67.

Sayer, D., R. Whidborne, B. Brestovac, F. Trimboli, C. Witt and F. Christiansen (2001). "HLA-DRB1

DNA sequencing based typing: an approach suitable for high throughput typing including

unrelated bone marrow registry donors." Tissue Antigens 57(1): 46-54.

Scharfstein, J., A. Ferreira, I. Gigli and V. Nussenzweig (1978). "Human C4-binding protein. I. Isolation

and characterization." J Exp Med 148(1): 207-22.

Schmitz, J., J. P. Zimmer, B. Kluxen, S. Aries, M. Bogel, I. Gigli and H. Schmitz (1995). "Antibody-

dependent complement-mediated cytotoxicity in sera from patients with HIV-1 infection is

controlled by CD55 and CD59." J Clin Invest 96(3): 1520-6.

Schwarzenbacher, R., K. Zeth, K. Diederichs, A. Gries, G. M. Kostner, P. Laggner and R. Prassl (1999).

"Crystal structure of human beta2-glycoprotein I: implications for phospholipid binding and the

antiphospholipid syndrome." Embo J 18(22): 6228-39.

Shafren, D. R., D. J. Dorahy, R. A. Ingham, G. F. Burns and R. D. Barry (1997). "Coxsackievirus A21

binds to decay-accelerating factor but requires intercellular adhesion molecule 1 for cell entry." J

Virol 71(6): 4736-43.

Shafren, D. R., D. J. Dorahy, R. F. Thorne, T. Kinoshita, R. D. Barry and G. F. Burns (1998). "Antibody

binding to individual short consensus repeats of decay-accelerating factor enhances enterovirus

cell attachment and infectivity." J Immunol 160(5): 2318-23.

Sharma, A. K. and M. K. Pangburn (1996). "Identification of three physically and functionally distinct

binding sites for C3b in human complement factor H by deletion mutagenesis." Proc Natl Acad

Sci U S A 93(20): 10996-1001.

Sharma, A. K. and M. K. Pangburn (1997). "Localization by site-directed mutagenesis of the site in

human complement factor H that binds to Streptococcus pyogenes M protein." Infect Immun

65(2): 484-7.

Smith, B. O., R. L. Mallin, M. Krych-Goldberg, X. Wang, R. E. Hauhart, K. Bromek, D. Uhrin, J. P.

Atkinson and P. N. Barlow (2002). "Structure of the C3b binding site of CR1 (CD35), the

immune adherence receptor." Cell 108(6): 769-80.

Sonnhammer, E. L. and R. Durbin (1995). "A dot-matrix program with dynamic threshold control suited

for genomic DNA and protein sequence analysis." Gene 167(1-2): GC1-10.

- 279 -

Spear, G. T., M. Hart, G. G. Olinger, F. B. Hashemi and M. Saifuddin (2001). "The role of the

complement system in virus infections." Curr Top Microbiol Immunol 260: 229-45.

Spear, G. T., N. S. Lurain, C. J. Parker, M. Ghassemi, G. H. Payne and M. Saifuddin (1995). "Host cell-

derived complement control proteins CD55 and CD59 are incorporated into the virions of two

unrelated enveloped viruses. Human T cell leukemia/lymphoma virus type I (HTLV-I) and

human cytomegalovirus (HCMV)." J Immunol 155(9): 4376-81.

Spiller, O. B., M. Robinson, E. O'Donnell, S. Milligan, B. P. Morgan, A. J. Davison and D. J. Blackbourn

(2003). "Complement regulation by Kaposi's sarcoma-associated herpesvirus ORF4 protein." J

Virol 77(1): 592-9.

Stoiber, H., A. Clivio and M. P. Dierich (1997). "Role of complement in HIV infection." Annu Rev

Immunol 15: 649-74.

Stoiber, H., L. Kacani, C. Speth, R. Wurzner and M. P. Dierich (2001). "The supportive role of

complement in HIV pathogenesis." Immunol Rev 180: 168-76.

Stoiber, H., C. Pinter, A. G. Siccardi, A. Clivio and M. P. Dierich (1996). "Efficient destruction of human

immunodeficiency virus in human serum by inhibiting the protective action of complement

factor H and decay accelerating factor (DAF, CD55)." J Exp Med 183(1): 307-10.

Stoiber, H., R. Schneider, J. Janatova and M. P. Dierich (1995). "Human complement proteins C3b, C4b,

factor H and properdin react with specific sites in gp120 and gp41, the envelope proteins of

HIV-1." Immunobiology 193(1): 98-113.

Szakonyi, G., J. M. Guthridge, D. Li, K. Young, V. M. Holers and X. S. Chen (2001). "Structure of

complement receptor 2 in complex with its C3d ligand." Science 292(5522): 1725-8.

Tanner, J., J. Weis, D. Fearon, Y. Whang and E. Kieff (1987). "Epstein-Barr virus gp350/220 binding to

the B lymphocyte C3d receptor mediates adsorption, capping, and endocytosis." Cell 50(2): 203-

13.

Tay, G. K., C. S. Witt, F. T. Christiansen, D. Charron, D. Baker, R. Herrmann, L. K. Smith, D.

Diepeveen, S. Mallal, J. McCluskey and et al. (1995a). "Matching for MHC haplotypes results in

improved survival following unrelated bone marrow transplantation." Bone Marrow Transplant

15(3): 381-5.

Tay, G. K., C. S. Witt, F. T. Christiansen, J. M. Corbett and R. L. Dawkins (1995b). "The identification

of MHC identical siblings without HLA typing." Exp Hematol 23(14): 1655-60.

Thern, A., L. Stenberg, B. Dahlback and G. Lindahl (1995). "Ig-binding surface proteins of Streptococcus

pyogenes also bind human C4b-binding protein (C4BP), a regulatory component of the

complement system." J Immunol 154(1): 375-86.

Thern, A., M. Wastfelt and G. Lindahl (1998). "Expression of two different antiphagocytic M proteins by

Streptococcus pyogenes of the OF+ lineage." J Immunol 160(2): 860-9.

- 280 -

Tokunaga, K., G. Saueracker, P. H. Kay, F. T. Christiansen, R. Anand and R. L. Dawkins (1988).

"Extensive deletions and insertions in different MHC supratypes detected by pusled field gel

electrophoresis." J Exp Med 168(3): 933-40.

Uhrinova, S., F. Lin, G. Ball, K. Bromek, D. Uhrin, M. E. Medof and P. N. Barlow (2003). "Solution

structure of a functionally active fragment of decay-accelerating factor." Proc Natl Acad Sci U S

A 100(8): 4718-23.

Vanderplasschen, A., E. Mathew, M. Hollinshead, R. B. Sim and G. L. Smith (1998). "Extracellular

enveloped vaccinia virus is resistant to complement because of incorporation of host

complement control proteins into its envelope." Proc Natl Acad Sci U S A 95(13): 7544-9.

Wagner, J. L. (2003). "Molecular organization of the canine major histocompatibility complex." J Hered

94(1): 23-6.

Wagner, J. L., R. C. Burnett, S. A. DeRose, L. V. Francisco, R. Storb and E. A. Ostrander (1996).

"Histocompatibility testing of dog families with highly polymorphic microsatellite markers."

Transplantation 62(6): 876-7.

Walport, M. J., G. D. Ross, C. Mackworth-Young, J. V. Watson, N. Hogg and P. J. Lachmann (1985).

"Family studies of erythrocyte complement receptor type 1 levels: reduced levels in patients with

SLE are acquired, not inherited." Clin Exp Immunol 59(3): 547-54.

Wei, X., M. Orchardson, J. A. Gracie, B. P. Leung, B. Gao, H. Guan, W. Niedbala, G. K. Paterson, I. B.

McInnes and F. Y. Liew (2001). "The Sushi domain of soluble IL-15 receptor alpha is essential

for binding IL-15 and inhibiting inflammatory and allogenic responses in vitro and in vivo." J

Immunol 167(1): 277-82.

Weis, J. H., C. C. Morton, G. A. Bruns, J. J. Weis, L. B. Klickstein, W. W. Wong and D. T. Fearon

(1987). "A complement receptor locus: genes encoding C3b/C4b receptor and C3d/Epstein-Barr

virus receptor map to 1q32." J Immunol 138(1): 312-5.

Williamson, J. F., S. Gaudieri, N. Longman-Jacobsen and R. L. Dawkins (2003). The use and abuse of

microsatellites markers. HLA 2002 Immunobiology of the Human MHC, Seattle, IHWG Press,

in press.

Witt, C., D. Sayer, F. Trimboli, M. Saw, R. Herrmann, P. Cannell, D. Baker and F. Christiansen (2000).

"Unrelated donors selected prospectively by block-matching have superior bone marrow

transplant outcome." Hum Immunol 61(2): 85-91.

Wong, W. W. (1990). "Structural and functional correlation of the human complement receptor type 1." J

Invest Dermatol 94(6 Suppl): 64S-7S.

Wu, X., W. J. Zhang, C. S. Witt, L. J. Abraham, F. T. Christiansen and R. L. Dawkins (1992).

"Haplospecific polymorphism between HLA B and tumor necrosis factor." Hum Immunol 33(2):

89-97.

- 281 -

Xiang, L., J. R. Rundles, D. R. Hamilton and J. G. Wilson (1999). "Quantitative alleles of CR1: coding

sequence analysis and comparison of haplotypes in two ethnic groups." J Immunol 163(9): 4939-

45.

Xu, C., D. Mao, V. M. Holers, B. Palanca, A. M. Cheng and H. Molina (2000). "A critical role for murine

complement regulator crry in fetomaternal tolerance." Science 287(5452): 498-501.

Yunis, E. J., Z. Awdeh, D. Raum and C. A. Alper (1983). "The MHC in human bone marrow

allotransplantation." Clin Haematol 12(3): 641-80.

Yunis, E. J., C. E. Larsen, M. Fernandez-Vina, Z. L. Awdeh, T. Romero, J. A. Hansen and C. A. Alper

(2003). "Inheritable variable sizes of DNA stretches in the human MHC: conserved extended

haplotypes and their fragments or blocks." Tissue Antigens 62(1): 1-20.

Zhang, W. J., M. A. Degli-Esposti, T. J. Cobain, P. U. Cameron, F. T. Christiansen and R. L. Dawkins

(1990). "Differences in gene copy number carried by different MHC ancestral haplotypes.

Quantitation after physical separation of haplotypes by pulsed field gel electrophoresis." J Exp

Med 171(6): 2101-14.

- 282 -

- 283 -

EXAMINERS REPORTS

- 284 -

- 285 -

Examiner 1: Professor Sir Peter Lachmann Report for the University of Western Australia on the thesis "Duplication and Polymorphism with particular reference to Regulators of Complement Activation" submitted for the degree of Doctor of Philosophy by Craig Anthony McLure Mr McLure comes to his work on the RCA locus from a background of MHC genetics. He is well versed in this subject and particularly in the approaches pioneered by Roger Dawkins and his colleagues. In this thesis he describes the application of this same approach to the locus on chromosome Clq coding for the so-called "regulators of complement activation" (RCA). This is an intriguing idea even though there maybe significant differences between these two loci. The long held theory for explaining the maintenance of "extended haplotypes" within the MHC is that there may be selective advantage in holding together on a single haplotype alleles at MHC Class 1 loci and MHC Class 2 loci whose combined presence is advantageous for resistance to particular pathogens. There is, to the best of my knowledge, no evidence of this kind for the RCA locus. I am not aware of, nor does Mr. McLure quote, any studies which suggest that combining particular alleles on different molecules of the RCA cluster carries any selective advantage. For this reason one would not be surprised if the evolution of these two loci had followed rather different paths. In his Introduction, he first discusses the mechanisms by which genes and gene loci evolve describing the particular importance of duplications and of insertions and deletions (indels in the local terminology) basing this on work on the MHC. He also defines the blocks of genes in which recombination seems to be suppressed which are locally called "polymorphic frozen blocks". This part of the review focuses quite largely on the work for which the Dawkins group are well known and is well done. I do have one reservation which I think it would be interesting to raise with the candidate. In another complement locus, the one that codes for C6 and C7 and, at a greater distance, C9 - components that also gene duplicates - there is strong evidence from the mapping of intron/exon boundaries in these genes that, at any rate in "recent" evolution, the progression has been from larger molecules to smaller molecules, i.e. that the build-up of the large molecule is an early event and that the smaller molecules are derived from it by duplication and trimming rather than by being built up from a smaller precursor. However such evolutionary models are all, to some extent, speculative; and the arguments raised by Mr McLure are quite plausible. The RCA proteins are made up of linear sequences of a particular protein domain which is usually called the "short consensus repeat" (or SCR). As Mr McLure notes, this is of ancient origin and can be found even in invertebrates that have no functioning complement system. It is also found in man in a number of complement proteins that are not regulators of complement activation. Thus there are SCRs in the sequentially acting, duplicated proteins Clr and Cls and in the sequentially acting, duplicated proteins C6 and C7; as well as in the duplicated proteins C2 and Factor B which are homologues in the classical and alternative

- 286 -

complement activation pathways. These SCRs are given little attention and only those in C2 and Factor B are even mentioned. Linear oligomers of SCRs - four or more - are characteristic of the proteins of the RCA locus. The background review of complement and of the complement control proteins and their functions show some lack of depth. Most of the discussion is based on reviews rather than on the original papers, something which I think is not wholly desirable in a PhD thesis. The NMR studies of the structure of CCPs (carried out, for example, by Campbell and his group in Oxford) which give some explanation why it is groups of SCRs rather than any individual SCR that carry function are not mentioned In Table 5 there are some errors of fact. It is stated that C4bp competes with Factor B for binding to C4b. Factor B does not bind to C4b - it is C2 that binds to C4b in the classical pathway. Mr McLure may not appreciate that CR2 is not a complement control protein at all, having neither co-factor activity for Factor I nor "Decay Accelerating" activity. Its role is as a complement receptor on B cells which is involved in cell triggering. Again, he says that it binds C4dg. I don't believe that C4dg is a described fragment, and it is C3dg that is intended on Figure 5. On the same table, he does not appreciate that CR1 is also a co-factor, and indeed the sole co-factor, for the Factor I mediated proteolysis of iC3b to C3dg, and that this is a very important function of CR1. It would also be worth pointing out that the function of CR1 is rather different in primates where it is present on erythrocytes and plays a major role in carrying immune complexes round the body, than in other mammals where CR1 is not found on red cells. It may be found on platelets as in rabbits, or it may be found on neither platelets nor red cells, as is the case in mice. Although mice do have CR1 and DAF and MCP, the major CCP is the molecule Crry, which is not seen in primates. On page 39 he comments on diverse functions of CCPs. One is their role as viral receptors, which is usually independent of the presence of complement. There can be few cell surface molecules that some virus does not use as a receptor! In other cases, however, HIV being an example, it is C3 fragments fixed on the virus that bind CR2 on B cells or follicular dendritic cells and lead to their infection. Maintaining feto-maternal "tolerance" depends on the prevention complement mediated damage in the placenta. The double "knock-out" of C3 as well as of Crry is normally fertile. It is only the animals that have a functioning complement system but lack Crry that lose their fetuses. The section on the RCA disease associations is really rather inadequate. The evidence that genetic polymorphism in CR1 is associated with lupus is weak. CR1 number polymorphism (detected by the associated DNA pattern) does not appear to be associated with disease nor does its size polymorphism. The substantial decrease in CR1 number on the red cells of patients with immune complex diseases is certainly acquired, and this is no longer a controversy. The decrease is seen not only in diseases like lupus but, very markedly, in cold autoantibody haemolytic anaemia where there is extensive complement fixation on the surface of red cells. There are more interesting associations which are not discussed. These largely concern Factor H where deficiency or mutations (often of the C-terminal part of the molecule) are associated with familial haemolytic uraemic syndrome (HUS). Similar associations occur with mutations in MCP and in factor I itself, suggesting

- 287 -

that failure of control of the alternative complement pathway does play a real part in the genesis of familial HUS. Much more recently, (and probably too late for comment in this thesis), are the observations that there is a strong associations between a common polymorphism in Factor H and macular degeneration. Finally, in this section Mr McLure reviews the role of CCPs in microbial virulence and cites a long list of observations. Viruses and bacteria use CCPs quite differently. Bacteria fix soluble mammalian CCPs, (Factor H or C4 binding protein) from the plasma and bind them to "receptors" on their surfaces thereby achieving protection from complement attack. Viruses do not do this. They either incorporate host CCPs during budding, (this is a property largely of retroviruses but it is also seen in one form of budding vaccinia); or - in the large DNA viruses such as pox viruses and herpes viruses - frequently encode their own CCPs. Sometimes these are based on the SCR domain, (Variola, vaccinia, Herpes virus saimiri, HHV 8) and probably represent gene capture from the host. On the other hand herpes simplex virus makes a CCP that is not based on the SCR although it has rather similar functional properties. This probably represents convergent evolution. The Chapters describing the work done. The first chapter is devoted to classifying the SCRs found in the RCA locus into families on the basis of sequence analysis and is presented as a paper in the Journal of Molecular Evolution. They were able to define eleven sub-families of SCR and to show that these occur in defined blocks in the different proteins. This is a valuable contribution and also helps to clarify the organisation of the membrane bound RCA proteins. Mr. McLure has produced a dendrogram suggesting how the different SCR sub-families are inter-related in CR1, the largest of the RCA proteins. The paper also describes comparisons of RCA proteins in different species on the basis of the SCR sub-families which shows conservation in primates and that mouse Crry seems to be the true homologue of human CR1 rather than the molecule known as mouse CR1. This accords with their relative functional importance in the two species. The second chapter is presented in the form of a paper in Immunogenetics, in which the authors demonstrate that the long homologous repeat in CR1 is made out of eight rather than seven SCRs in the gene. This also is a satisfying conclusion in that the oligomer sequence in the smaller RCA proteins is made up of four SCRs. The CR1 pattern is also found in the so-called CR1-like molecule and in chimpanzee CR1. The eighth SCR, which they describe as g-like, (i.e. like the g sub-family), is generally not expressed, although the reason for this is not immediately apparent. The third chapter, which is presented as a paper in Human Immunology, concerns the evolution of human CR1 and the CR1-like gene which they regard as both being derived from a precursor, which they call CRlalpha. They show that in human CR1 and CR1-like genes, and the corresponding syntenic genes in chimpanzees, baboons, rats and mice, the order of the sub-families of SCR are maintained. The results of these elaborate sequence analyses are complex and the authors point out that it is difficult to define the unit of duplication on account of changes due to degeneracy, deletions and imperfect duplication. In the fourth chapter, Mr. McLure goes on to study polymorphisms in the RCA locus (particularly in CR1) with the intention of defining ancestral haplotypes within the RCA

- 288 -

locus. This has been done using the "genomic matching technique" (GMT) which they have developed for the MHC and which is based on the observation that high levels of polymorphism are "packaged" within duplicated sequences and that these packages are stable and inherited over long periods of time. This paper contains experimental work looking, by PCR, at a panel of human subjects varying in ethnic group and in disease status. Some twenty ancestral haplotypes have been identified including fifteen which comprising about three-quarters of those in the population., Some data is presented to suggest that haplotype frequencies differ from normal in a group of patients with recurrent spontaneous abortion or with psoriasis. These findings are preliminary and difficult to evaluate partly because of the lack of detail about how the groups are defined and how well they are matched to the controls and partly because of a lack of statistical evaluation. It is likely that these are hypothesis-generating findings rather than ones that allow the hypothesis to be tested. The final chapters are on a rather different topic, which is the application of the GMT technique to dogs in Chapter 5, and to cattle in Chapter 6. They are both concerned with the MHC rather than the RCA locus and are both quite brief. The principal conclusion of these studies is that the GMT technique is an effective alternative to more conventional methods to detect polymorphisms and identify haplotypes in highly polymorphic regions. Their future plans are to exploit their new data on the polymorphism of the a-block of the regulators of complement activation, i.e. the portion that contains the cell-bound activators to see whether they can detect important associations with auto-immune diseases. It is not quite clear to me why they are particularly interested in auto-immune diseases rather than looking at different infections in this connection; since it seems more likely that infection is the driver of such polymorphisms, as, indeed, it is in the MHC. However it is not self-evident that the induction of auto-immunity will form the negative aspect of this as it is does in the MHC. They also propose to try to find CCPs that have lost their capacity to act as receptors for individual viruses such as measles in the case of MCP, or Epstein-Barr virus in the case of CR2. I will watch the progress of these studies with great interest and if they succeed in showing a significant clinical utility for these polymorphisms, this will be a great advance. In summary, this is essentially a study of genomes using, in large part, published sequence data to identify family relationships within a particular genetic locus that codes essentially for a single protein domain in multiple duplications and to use techniques that have been used in the MHC for studying evolution and polymorphism at this locus. The work has been productive and has added significantly to knowledge of how the RCA is organised and may have evolved. There are also some leads that may point to clinical utility with a limited amount of experimental work, largely based on PCR, looking at the distribution of polymorphisms in different disease groups - work which is still at a preliminary stage. I would have preferred to discuss the issues that I have raised in this report with him face to face; and, because this is not possible, I have perhaps been rather more critical at certain points, particularly concerning the Introduction, than I would normally be where there is a viva. I think that the Introduction needs amending to correct some errors that have been pointed out.

- 289 -

Subject to this being done, I am happy to recommend that Mr. McLure be awarded the degree of Ph.D. Peter Lachmann

- 290 -

Examiner 2: Professor Edmond Yunis Thesis: "Duplication and polymorphism with particular reference to regulators of complement activation" By Craig Anthony McLure Thesis for degree of Doctor of Philosophy University of Western Australia. Comments:

The cluster of genes known as the Regulators of Complement Activation is located in chromosome 1 (1q32). This region contains several genes related to the complement system. The RCA genes are phylogenetically related with the complement control proteins (CCP) family, that prevent the activation of complement. The CCP family has been conserved in invertebrates and apparently have evolved in parallel with the complement family located in the major histocompatibility complex region. Complement activation is regulated by several mechanisms mediated by different RCA genes (FH, C4BP, DAP, CR2, CR1, MCP) and different SCRs and sub-families. Previous studies have reported the existence of DNA conserved or frozen blocks in this region, each block containing a specific set of linked genes. Also in this region several studies have identified SNPs in coding and non coding sequences of RCA cluster. Several studies have described a potential relevance of the RCA genes in the pathogenesis of autoimmune and infectious diseases. This doctoral thesis represents an important approach to analyze the structure of ancestral haplotypes using extensive genomic analysis methods to define the mechanisms involved in the evolution of RCA cluster.

The aims of this study were 1) the characterization of the relationship between the genes that code for the complement control-proteins (CCPs) and domains of the regulators of complement activation (RCA), 2) Analysis of the duplicated elements in the RCA region, 3) analysis of divergence in duplicated genes, 4) applicability of the Genomic Matching Technique (GMT) to asses the presence of conserved haplotypes, 4) evaluate the potential relevance of RCA conserved haplotypes with CCP implicated diseases, 6) applicability of the analysis of GMT in other species. In this study, the author demonstrates that duplication and divergence of particular sets of SCRs have contribute with the evolution of RCA cluster. It is important to mention that the published studies derived from this thesis shows that all SCRs can be classified in 11 subfamilies (a-k), in this context, events of duplication and deletion have contributed to the specialization or selection of SCRs sequences. Primate complement receptor 1 (CR1) and its. ligand (CR1L) contain a duplication of eight rather than seven SCRs, these differences can be explained by duplications, retroviral insertions and deletions. On the other hand, the GMT was used to identify polymorphisms in the RCA. With this method at least 20 conserved haplotypes for the RCA alpha block, were detected. Interestingly, the distribution of some haplotypes such as CR1.02 and CRX.08 differ in Psoriasis VuIgaris and Recurrent Spontaneous Abortion. Finally this analysis can be used in the detection of conserved haplotypes in other species genome.

This is a very good thesis and contributes significantly in the knowledge of this

field and the approach is innovative for mapping regions in the RCA cluster that could be relevant in the pathogenesis of autoimmune diseases and could help to understand the role of genome evolution in the regulation of immune system mechanisms. The

- 291 -

author of this thesis (Craig Anthony McLure) is a very well qualified to conduct this research projects and the proposed research. I strongly recommend that Craig Anthony McLure receive the PhD degree by the University of Western Australia with Honors.

Professor Edmond J Yunis

- 292 -

Examiner 3: Dr Daniel J Birmingham Thesis Report Thesis Title: Duplication and Polymorphism with Particular Reference to Regulators of Complement Activation Ph.D. Candidate: Craig A. McLure Reference number: 0179071 Examiner: Daniel J. Birmingham, Ph.D. Evaluation: The thesis entitled "Duplication and Polymorphism with Particular Reference to Regulators of Complement Activation" details the research performed by Craig A. McLure in fulfillment of the degree of Doctor of Philosophy. The following is an evaluation of this thesis. The overall goal of this thesis is to identify, annotate, and detect genomic duplication and polymorphism within large genomic regions. For this purpose, Mr. McLure selected the genomic region known as the regulators of complement activation (RCA) gene cluster. The RCA gene cluster covers over 2 Mb of sequence and encompasses over 60 genes or gene-like regions, 15 of which are closely related binding proteins for fragments of the third and fourth components of complement (C3 and C4). Mr. McLure also introduces brief preliminary analyses of canine and cattle DNA. The organization of this thesis is by chapter (six total), with each chapter addressing a separate aim of the thesis. An Introduction and a Conclusion/Future Directions section are also included. This report will comment on each section before providing a summary evaluation. Introduction In general, this is a well-written introduction to the thesis in which Mr. McLure provides a competent overview of the terms and approaches that he utilizes in the remaining sections. This includes explanations of polymorphic frozen blocks (PFB), ancestral/extended haplotypes (AH), and the genomic matching technique (GMT). This section also introduces the RCA cluster, and provides a good overview of the general structure of the RCA proteins, of the short consensus repeats (SCRs), and of the evolution and divergence of RCA proteins. Of note is the use of the term CCP, which is defined in the thesis (subheading 4.1) as a "complement control protein", ie. an RCA protein. However, most if not all other investigators use the term CCP as a synonym for SCR (eg. Biochemistry, 30:2847, 1991; Immunological Reviews, 180:112, 2001). Thus, using the term CCP to refer to an RCA protein can be confusing when considering other published work. It is suggested that this difference be noted to minimize confusion. One area possibly lacking sufficient attention is the presentation of the functions of the RCA proteins. The RCA proteins are characterized in this section as complement regulators that function either through acceleration of convertase decay or through cofactor function, and some important differences in ligand specificity among the RCA proteins are listed (Table, p 38). However, there is no consideration of the apparent redundancy in function among these proteins, or of their unique physiological roles. Other important non-complement regulatory functions, such as immunomodulation

- 293 -

(CR2, likely DAF) and immune complex clearance (CR1), are not mentioned. This reviewer realizes that RCA function is not the subject of the thesis, and emphasizing function in the Introduction might detract from the focus of the thesis. Nevertheless, when comparing RCA genes across species (eg. mouse Crry vs. human CR1), it is helpful to have an understanding of the physiological roles played by these various RCA proteins. Minor comments include: 1. The tables in Introduction should be numbered. 2. In stating the complement regulatory role of RCA proteins (p 36), point (i)

should read "acting as a cofactor for the factor I-mediated cleavage of C3b..." 3. Table on page 38:

a) For DAF function - it's unclear what convertase "activation" is. If intended "inactivation", how is this different from DAA?

b) For CR2 function - CR2 does not bind C4d (g?). Chapter 1 This chapter is a reprint of the paper published by Mr. McLure and his colleagues in 2004 in J Mol Evol (impact factor 3.1). The focus of this chapter is an analysis of RCA genomic and amino acid sequences of different species. Each SCR was analyzed and classified into 11 different SCR subfamilies (a to k). Thus, for each analyzed RCA, SCRs could be classified as one of these 11 types. This appears to provide information about the evolutionary route taken by each RCA gene, the relevant orthologs across species (eg. Crry and CR1), and the SCRs important for RCA protein function (eg. aje). One note of interest should be mentioned. While most SCRs are encoded by single exons, a number of them are encoded by "split exons" (two exons/SCR) or by "fused exons" (one exon/2 SCRs). Though not discussed by Mr. McLure, assessing these types of SCRs across genes and species would seem to be particularly informative. For instance, are the "e/f' SCRs, which are fused exons in primate CR1 (SCRs 3/4, 10/11, etc), also fused in Crry? In RCA genes containing only the "e" (DAF) or "f' (CR2) SCR, is there evidence of remnants of the other SCR? Chapter 2 Chapter 2 is a reprint describing the research, published by Mr. McLure and colleagues (R.L. Dawkins as the corresponding author) in 2004 in Immunogenetics (impact factor 2.7). The work presented by Mr. McLure in this chapter describes the discovery of genomic sequence for another previously unrecognized SCR in primate CR1 and CR1L. This SCR is closest in homology to the "g" family of SCRs that are expressed in CR2 and MCP. It is not expressed in CR1/CR1L, and has thus been designated as "g-like". The existence of the "g-like" SCR suggests that the ancestral repeating series of SCRs in CR1 (the long homologous repeat) was 8 SCRs rather than 7 SCRs. Two cormments/questions become evident to this reviewer. First, the position of the "g-like" SCR is quite proximal to SCR "d" (< 30 nucleotides away), suggesting that at one time these represented fused exons. The "g-like" SCR also demonstrates homology to the "f' SCR, which is encoded by a fused exon in CR1 (eg. SCR 4). Is it known if the dig exons are fused in MCP or CR2? Second, it is concluded that "d+g-like" SCRs likely represent a functional set, based on its widespread existence. This reasoning does not appear convincing. Can this be supported by postulating what functions would have

- 294 -

been exhibited by the "d+g-like" SCRs, based for instance on similarities to other SCRs? Chapter 3 This chapter represents the most recent of the three publications that have resulted from this thesis (R.L. Dawkins corresponding author). It was published earlier this year (2005) in Human Immunology (impact factor 2.6). Chapter 3 describes the genomic analysis of CR1 and CR1L, and some minimal analysis of the proximal MCP regions, aimed at understanding the evolution of this region. This analysis has revealed that a critical set of SCRs (the "ajef' combination) is maintained within CR1/CR1L/Crry across species. In addition, this analysis has led to a plausible paradigm explaining the evolution of both CR1 and CR1L from a primordial unit (CR1a). This section appears to be a logical extension of the studies described in Chapters 1 and 2, and as such is a relevant and important contribution to the thesis. One question that remains unaddressed is what were the evolutionary forces and biological advantages that drove the expansion of CR1 and the divergence of CR1L. Although a definitive answer is likely not achievable, especially with the current lack of knowledge of human CR1L function, this portion of the thesis would be strengthened through educated theories. Similarly, it would be interesting to postulate why CR1/CR1L/Crry have undergone substantial indel/duplication across species, while MCP remains highly conserved. Chapter 4 The aim of the work presented in this chapter was to use the GMT to identify haplotypes that define CR1/CR1L polymorphisms. Using this technique, numerous haplotypes (ancestral) were identified based on indel differences. These haplotypes were verified as transmissible, and were determined in a population (n = 322) composed of normal controls and patients with recurrent spontaneous abortion, hemochromatosis, psoriasis vulgaris, systemic lupus erythematosus, and Sjogren's syndrome. Certain haplotypes appeared to be disproportionately represented in some of the disease states, suggesting that these regions are linked to disease susceptibility. Perhaps more important, these studies show the potential power of the GMT in determine the role of any given polymorphic region in disease susceptibility. The research described in Chapter 4, which has been submitted for publication, is based in part on the knowledge that this RCA region behaves as a polymorphic frozen block, and builds on the understanding of the specific repetitive nature of this region. As such, this work utilizes the findings of Chapters 1-3 to devise a practical approach to understanding the role of RCA genetic diversity in disease. This culmination of Mr. McLure's research efforts represents a form of translational research, and is one of the stronger aspects of the thesis. This research also represents perhaps the most complex portion of the thesis. Some sections appear to require more detailed description or additional information to clarify some of the results and fully appreciate the applicability of the GMT. For instance: 1. In presenting the data of Fig 2 (manuscript p. 3), it wasn't clear that the two sets of potential products resulting from the GMT amplification also discriminated between CR1 (Fig 2; peaks 1-8) and CR1L (peaks 9-19). Although this is stated later (p. 5), it would facilitate the reader's understanding to point this out when first discussing these peaks.

- 295 -

2. It wasn't clear why some of the CR1L haplotypes, resulting from an observed single band, were determined to be null values as opposed to homozygotes (as is mentioned for some of the CR1 haplotypes). If this is an issue of relative band intensity, this should be directly stated, and the basis for determining this should be described (eg. how were intensities standardized). 3. The frequency ranges shown in Table 1 need explained (eg. 156-165 for the 01 AH). Do these ranges reflect that some samples were undeterminable? 4. Though Fig 3 suggests that GMT is highly reproducible under different amplification conditions, the limitations or disadvantages of the GMT were not discussed. For example, what is the maximum amplicon size for which robust amplification can be expected, and how could this affect the interpretations of GMT profiles. 5. It is mentioned in the Fig 2 legend that some of the amplicons are race-specific, as would be expected. It would be informative to show these differences, or indicate the race-specific haplotypes, in the 322 subjects tested. 6. Was a statistical analysis performed on data shown in Table 2 and Fig 5 (incorrectly referred to as "Fig 6" on p. 6)? Is race accounted for as a potential confounder in the apparent differences? 7. It is mentioned on p. 5 that "defective or deficient CR1 might be expected to be associated with poor control of C4 activation and therefore disease". This requires further explanation, as CR1 has not been shown to control C4 activation, but rather controls activation of C3, C5, and beyond through DAA and cofactor functions. Chapter 5 and 6 Both of these chapters explore the commercial use of GMT in other species. As such, they can be viewed as pilot studies for future research, though manuscripts for both are cited as "in preparation". Chapter 5 deals with the use of GMT in an Australian canine population (Blue Heelers). Specifically, using the dog leukocyte antigen region as the target for the GMT primers, specific heritable GMT haplotypes were found, they identified DQ alleles, and they appeared more diverse than the DQ haplotypes. This work represents, in the words of Mr. McLure, a proof of principle that the GMT approach is feasible across species for measuring genetic variability in targeted regions. Chapter 6 is basically a proposal to use GMT to genetically characterize cattle haplotypes associated with polling or horning. The preliminary data include the identification of 920 cattle, covering 4 or more generations, all with various phenotypes. DNA has been isolated from many of these (an N of 250 is stated in the Prelude). Current efforts are focusing on identifying the appropriate genomic region in which to devise the GMT primers. Summary Evaluation The thesis entitled "Duplication and Polymorphism with Particular Reference to Regulators of Complement Activation" is a well organized, logical, and extensive analysis of the RCA gene cluster as a model of genomic divergence and duplication, and as a proving ground for the use of GMT. The first three chapters of this thesis have resulted in three publications in reputable journals, and as such have undergone the rigors of peer-review, which is the gold standard for judging the scientific quality of research. The fourth chapter builds on these accomplishments to fully characterize the genetic diversity of the CR1/CR1L

- 296 -

region within the RCA gene cluster. The results reveal the practical aspects of this research, and implicate associations between genetic variability of this RCA region and certain diseases. This aspect of the thesis will likely result in a fourth publication. This reviewer has presented suggestions and questions for each of the sections. For the three sections that are composed of reprints (Chapters 1-3), it is not necessary to address the suggestions/questions, as these studies have already undergone peer-review. Alternatively, they can be addressed in the Prelude of these chapters at the discretion of Mr. McLure's advisor. For the other sections, it is anticipated that these suggestions/questions will receive some attention, though again at the discretion of the advisor. In conclusion, the thesis entitled "Duplication and Polymorphism with Particular Reference to Regulators of Complement Activation" exceeds typical expectations for a doctoral dissertation, and represents an important and original contribution in this area of science. As such, this reviewer judges the thesis as passed, subject to minor revision. Daniel J Birmingham

- 297 -

RESPONSE TO EXAMINERS REPORTS

- 298 -

- 299 -

Response to examiners reports Response to questions by Reviewer 1 (PJ Lachmann) Question 1. “In Table 5 (Introduction table 1) there are some errors of fact. It is stated that C4bp competes with Factor B for binding to C4b. Factor B does not bind to C4b - it is C2 that binds to C4b in the classical pathway.”

I have changed “Factor B” to “C2” to correct this Question 2. “Again, he says that it binds C4dg. I don't believe that C4dg is a described fragment, and it is C3dg that is intended on Figure 5.”

This has been corrected to “C3dg” Question 3. “On the same table, he does not appreciate that CR1 is also a co-factor, and indeed the sole co-factor, for the Factor I mediated proteolysis of iC3b to C3dg, and that this is a very important function of CR1.”

The table reads “cofactor for the factor I mediated proteolysis of C3b/C4b”. This statement has been amended and now reads “cofactor for the factor I mediated proteolysis of iC3b/C4b”

Question 4. “It would also be worth pointing out that the function of CR1 is rather different in primates where it is present on erythrocytes and plays a major role in carrying immune complexes around the body, than in other mammals where CR1 is not found on red cells. It may be found on platelets as in rabbits, or it may be found on neither platelets nor red cells, as is the case in mice. Although mice do have CR1 and DAF and MCP, the major CCP is the molecule Crry, which is not seen in primates.”

From the work presented in chapters 1 and 3, we show evidence that Crry (which is expressed on the surface of rodent RBCs) is in fact the ortholog of Human CR1/CR1L. The accumulation of SCRs and LHRs has occurred as a process of evolution. Ideally the nomenclature in different mammals should be based on evolutionary analysis.

- 300 -

Question 5. “The section on the RCA disease associations is really rather inadequate. The evidence that genetic polymorphism in CR1 is associated with lupus is weak. CR1 number polymorphism (detected by the associated DNA pattern) does not appear to be associated with disease nor does its size polymorphism. The substantial decrease in CR1 number on the red cells of patients with immune complex diseases is certainly acquired, and this is no longer a controversy. The decrease is seen not only in diseases like lupus but, very markedly, in cold autoantibody haemolytic anaemia where there is extensive complement fixation on the surface of red cells.”

We believe the association of CR1 with Lupus will be revealed through the genomic polymorphisms that we define in chapter 4, rather than the RFLP and SNP polymorphisms. If correct, the controversy may continue.

Question 6. “There are more interesting associations which are not discussed. These largely concern Factor H where deficiency or mutations (often of the C-terminal part of the molecule) are associated with familial haemolytic uraemic syndrome (HUS). Similar associations occur with mutations in MCP and in factor I itself, suggesting that failure of control of the alternative complement pathway does play a real part in the genesis of familial HUS. Much more recently, (and probably too late for comment in this thesis), are the observations that there is a strong associations between a common polymorphism in Factor H and macular degeneration.”

The initial focus was on CR1 and MCP but we have recently extended the GMT to define haplotypes within the RCA PFB containing Factor H and its duplicates. Using the data from this analysis, we shall complete studies of the HF related diseases/disorders. I have updated the disease table to include HUS and Age-related Macular Degeneration (AMD).

Question 7. “Finally, in this section Mr McLure reviews the role of CCPs in microbial virulence and cites a long list of observations. Viruses and bacteria use CCPs quite differently. Bacteria fix soluble mammalian CCPs (Factor H or C4 binding protein) from the plasma and bind them to "receptors" on their surfaces thereby achieving protection from complement attack. Viruses do not do this.”

It is not stated that viruses do bind soluble CCPs. Rather I report that FH may bind to the envelope proteins of HIV-1. This possibility is supported by a number of references.

- 301 -

Question 8. “These findings are preliminary and difficult to evaluate partly because of the lack of detail about how the groups are defined and how well they are matched to the controls and partly because of a lack of statistical evaluation.”

The samples were provided by Professor Agrawal and have been described in a previous publication by the Agrawal group. It has been subsequently noted that the relevant reference in the manuscript was missing and this has since been rectified. Statistical analyses of the data in table 2 have been ongoing. The latest results are included as an amendment in the prelude to chapter 4. The point to emphasise is that I have discovered new haplotypes and need to test many disease groups as they come to hand. I acknowledge the valuable contributions of Ms Lester and Dr Agrawal.

Question 9. “It is likely that these are hypothesis-generating findings rather than ones that allow the hypothesis to be tested.”

A number of pre-defined hypotheses were made prior to commencement of this study. Obvious targets were Recurrent Spontaneos Abortion, Lupus and Sjogren’s disease and their CCP interactions. Due to the inherent difficulties in defining control groups for autoimmune conditions, multiple disease groups were tested, including those where an association was not expected. The initial strategy was to compare and contrast multiple disease groups.

Response to questions by Reviewer 2 (EJ Yunis) Reviewer 2 had no questions or amendments Response to questions by Reviewer 3 (DJ Birmingham) Question 1 “Of note is the use of the term CCP, which is defined in the thesis (subheading 4.1) as a "complement control protein", ie. an RCA protein. However, most if not all other investigators use the term CCP as a synonym for SCR (eg. Biochemistry, 30:2847, 1991; Immunological Reviews, 180:112, 2001). Thus, using the term CCP to refer to an RCA protein can be confusing when considering other published work. It is suggested that this difference be noted to minimize confusion.”

A brief note has been included directly following section 4.1 to address this suggestion

Question 2. “The tables in Introduction should be numbered.”

Table numbers have been included

- 302 -

Question 3. “In stating the complement regulatory role of RCA proteins (p 36), point (i) should read "acting as a cofactor for the factor I-mediated cleavage of C3b..."

This has been corrected

Question 4. “For DAF function - it's unclear what convertase "activation" is. If intended "inactivation", how is this different from DAA?”

The word “activation” has been replaced with “regulation”. Question 5. “For CR2 function - CR2 does not bind C4d (g?).”

See reviewer 1, question 2. Question 6. “One note of interest should be mentioned. While most SCRs are encoded by single exons, a number of them are encoded by "split exons" (two exons/SCR) or by "fused exons" (one exon/2 SCRs). Though not discussed by Mr. McLure, assessing these types of SCRs across genes and species would seem to be particularly informative. For instance, are the "e/f' SCRs, which are fused exons in primate CR1 (SCRs 3/4, 10/11, etc), also fused in Crry?”

The observation of and comparison between the “split” and “fused” exons was a critical factor in defining the subfamilies. Therefore the observation of “j/k” and “ef/dg” has been observed throughout each species analysed.

Question 7. “In RCA genes containing only the "e" (DAF) or " f ' (CR2) SCR, is there evidence of remnants of the other SCR?”

Since publication of the manuscript presented in chapter 1, our knowledge of this region has increased significantly. The observation of common ancestors between the SCR subfamilies was mentioned in chapter 1. This stated that the a,j,e,f,b,k,d,g subfamilies had likely arisen through the duplication of a/b, j/k, e/d and f/g ancestors. This point is discussed further in the subsequent chapters. In relation to CR2, the patterns (ajef/bkdg) fall out by classifying each SCR as the ancestral subfamily listed above (a/b. j/k, e/d, f/g)

Question 8. “First, the position of the "g-like" SCR is quite proximal to SCR "d" (< 30 nucleotides away), suggesting that at one time these represented fused exons. The "g-like" SCR also demonstrates homology to the " f ' SCR, which is encoded by a fused exon in CR1 (eg. SCR 4). Is it known if the d/g exons are fused in MCP or CR2?”

The d/g exons, like the e/f exons (see above) do indeed form fused exons

- 303 -

Question 9. “Second, it is concluded that "d+g-like" SCRs likely represent a functional set, based on its widespread existence. This reasoning does not appear convincing. Can this be supported by postulating what functions would have been exhibited by the "d+g-like" SCRs, based for instance on similarities to other SCRs?”

It is suggested that the “d/g” fused exon is likely to represent a functional set for two reasons: (i) it is conserved throughout multiple genes and species; and (ii) the evolutionary relationship to the “e/f” SCRs, which have been proven to be important in ligand recognition and binding.

Question 10. “It wasn't clear why some of the CR1L haplotypes, resulting from an observed single band, were determined to be null values as opposed to homozygotes (as is mentioned for some of the CR1 haplotypes). If this is an issue of relative band intensity, this should be directly stated, and the basis for determining this should be described (eg. how were intensities standardized).”

The haplotypes for those individuals with a single CR1L product were classified by either family analysis and segregation or in the situations where we could not make a definitive call from the intensity of the amplified products, both possible haplotypes were included in the analysis. This is why ranges are presented..

Question 11. “The frequency ranges shown in Table 1 need explained (eg. 156-165 for the 01 AH). Do these ranges reflect that some samples were undeterminable?”

See above. Question 12 & 13. “It is mentioned in the Fig 2 legend that some of the amplicons are race-specific, as would be expected. It would be informative to show these differences, or indicate the race-specific haplotypes, in the 322 subjects tested. Was a statistical analysis performed on data shown in Table 2 and Fig 5 (incorrectly referred to as "Fig 6" on p. 6)? Is race accounted for as a potential confounder in the apparent differences?”

See Reviewer 1, Question 8

I would also like to bring to the attention of the reader, that since submission of the thesis, the manuscript presented in chapter 5, which describes the Genomic Matching Technique within the canine MHC has been accepted for publication in the International Journal of Immunogenetics, and its status changed from “submitted” to “In Press”. In addition to this, the manuscript presented in chapter 4 has been reviewed, revised and resubmitted to Immunogenetics and it is expected that this will be accepted shortly. The status of this manuscript may therefore change from “submitted” to “In Press”.

- 304 -

Documents

DUPLICATION AND POLYMORPHISM WITH PARTICULAR REFERENCE … · DUPLICATION AND POLYMORPHISM WITH PARTICULAR REFERENCE TO REGULATORS OF COMPLEMENT ACTIVATION By Craig Anthony McLure