Embed Size (px)
Citation preview
1 A quantitative molecular assay based on the gene sxtA to identify saxitoxin-producing 1
harmful algal blooms in marine waters 2
3
4
Shauna A. Murray1, 2*, Maria Wiese1, 2, Anke Stüken3, Steve Brett4, Ralf Kellmann5, Gustaaf 5
Hallegraeff6, Brett A. Neilan2. 6
7
8 1Sydney Institute of Marine Sciences, Chowder Bay Rd, Mosman, NSW 2088, Australia 9
10 2School of Biotechnology and Biomolecular Sciences and Evolution and Ecology Research 11
Centre , University of New South Wales, Sydney, NSW 2052, Australia 12
13 3Microbial Evolution Research Group, Department of Biology, University of Oslo, 0316 14
Oslo, Norway 15
16 4Microalgal Services, 308 Tucker Rd, Ormond Victoria 3204 Australia 17
18 5 Hormone Laboratory, Haukeland University Hospital, 5021 Bergen, Norway 19
20 6 Institute for Marine and Antarctic Studies, University of Tasmania, Private Bag 55, Hobart, 21
Tas. 7001, Australia 22
23
24
25
Running title: Detecting saxitoxin-producing dinoflagellates 26
27
Keywords: Alexandrium, harmful algal bloom, saxitoxin, monitoring, sxtA, qPCR 28 29
Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.05308-11 AEM Accepts, published online ahead of print on 12 August 2011
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
2 Abstract 30
31
The recent identification of genes involved in the production of the potent neurotoxin and 32
keystone metabolite, saxitoxin (STX), in marine eukaryotic phytoplankton, has allowed us for 33
the first time to develop molecular genetic methods to investigate the chemical ecology of 34
harmful algal blooms in situ. We present a novel method for detecting and quantifying the 35
potential for STX production in marine environmental samples. Our assay detects a domain 36
of the gene sxtA that encodes a unique enzyme putatively involved in the sxt pathway in 37
marine dinoflagellates, sxtA4. A product of the correct size was recovered from nine strains 38
of four species of STX-producing Alexandrium and Gymnodinium catenatum, and was not 39
detected in the non STX-producing Alexandrium species, other dinoflagellate cultures or in 40
an environmental sample that did not contain known STX-producing species. However, sxtA4 41
was also detected in the non STX-producing strain of Alexandrium tamarense, Tasmanian 42
ribotype. We investigated copy number of sxtA4 in three strains of Alexandrium catenella, 43
and found it to be relatively constant amongst strains. Using our novel method, we detected 44
and quantified sxtA4 in three environmental blooms of Alexandrium catenella that led to STX 45
uptake in oysters. We conclude that this method shows promise as an accurate, fast and cost 46
effective means of quantifying the potential for STX production in marine samples, and will 47
be useful for biological oceanographic research and harmful algal bloom monitoring. 48
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
3 Introduction 49
Harmful Algal Blooms (HABs) are caused by the production of toxic secondary metabolites 50
by species of phytoplankton. The in situ detection of genes involved in HABs could lead to a 51
new level of understanding of their community impacts. Blooms of Alexandrium species, 52
Pyrodinium bahamense and Gymnodinium catenatum (Dinophyceae) producing saxitoxins 53
(STX) are the most widespread and economically important HAB phenomena worldwide, 54
with both ecosystem and human health impacts. STX selectively blocks voltage-gated Na+ 55
channels in excitable cells, thereby affecting neural impulse generation in animals (9). It has 56
been considered a ‘keystone metabolite’ due to its profound impacts on ecosystems, 57
including on vertebrates such as marine mammals and birds and on invertebrates such as 58
zooplankton and molluscs (59). The public health impacts of HABs have been most 59
pronounced in developing countries. For example, from 1983-2005, 2161 cases of poisoning 60
due to STX were reported in the Philippines, resulting in 123 fatalities (5). For this reason, 61
public health monitoring programs and harvesting closures are necessary worldwide, at 62
considerable expense. It has been estimated that the economic impact of HABs in the United 63
States alone is greater than US$82 million per annum (27). 64
65
In Australian marine waters, four species are known to produce STX: Alexandrium minutum, A. 66
catenella, A. tamarense, and Gymnodinium catenatum (23, 25,10). Alexandrium minutum and A. 67
catenella have caused blooms associated with STX uptake in shellfish in south-eastern Australia 68
since the first probable report of paralytic shellfish poisoning in 1935, with up to 10 000 µg/100 69
g STX detected (7). The main shellfish vector is the Sydney Rock Oyster (Saccostrea 70
glomerata), which is native to sheltered rocky shorelines from eastern Victoria (37°46′S, 71
149°25′E) to southern Queensland (27°00′S, 153°10′E), and has been sustainably cultivated for 72
>130 years (46). In the past 5 years, blooms of A. catenella associated with STX accumulation in 73
S. glomerata have occurred annually along the temperate east coast Australia. 74
75
In a recent breakthrough study, core genes putatively involved in the saxitoxin (STX) 76
biosynthesis pathway in Alexandrium fundyense, A. minutum, A. catenella, Gymnodinium 77
catenatum and A. tamarense have been identified and characterized (53, GenBank accession 78
numbers JF343238- JF343356). This has suggested that in situ detection of these genes may 79
be possible. Several of the core sxt genes, including the unique core gene sxtA, were most 80
closely related to a clade including STX-producing cyanobacterial sxtA genes (47). SxtA 81
catalyses one of the initial steps of the STX synthesis pathway (32). This gene has four 82
catalytic domains in all producing cyanobacterial species: a putative SAM-dependent 83
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
4 methyltransferase (sxtA1), acetyltransferase (sxtA2), acyl carrier protein (sxtA3) and class II 84
aminotransferase (sxtA4) (32, 44). In Alexandrium, sxtA has a typical dinoflagellate 85
organization (53) the gene is encoded in repeated copies in the nuclear genome, the mRNA 86
transcripts are monocistronic as opposed to the polycistronic sxt transcripts found in 87
cyanobacteria, specific dinoflagellate spliced-leader sequences (58) are present on the 5’ end 88
and eukaryotic polyA tails on the 3’ end, and the GC content is more typical of Alexandrium 89
transcriptomes rather than cyanobacterial sxt clusters. 90
91
Importantly, far from being a single copy gene, sxtA was found to be present in the order of 92
102 copies in a strain of Alexandium catenella (53). In A. fundyense, sxtA was found to be 93
transcribed in two different transcript families. Both transcript families had dinoflagellate 94
spliced-leader sequences at the 5’end and polyA-tails at the 3’end, but they differed in 95
sequence, length, and in the number of sxt domains they encoded (53) . The shorter 96
transcripts encoded the domains sxtA1, sxtA2 and sxtA3, while the longer transcripts encoded 97
all four sxtA domains (53). The relative role of the two families of transcripts in STX 98
biosynthesis is not clear. As the domain sxtA4 appears to be necessary for STX biosynthesis 99
in cyanobacteria (32), it may be that the larger transcript family is more likely to be directly 100
involved in STX biosynthesis. The primary sequences of sxtA4 domains from Alexandrium 101
species and Gymnodinium catenatum appeared to be relatively conserved (53). This 102
suggested the potential to develop genetic methods that may allow us to detect sxtA4 in 103
environmental samples. 104
105
In this study, we determined the degree of conservation of sxtA4 genes, the specificity and 106
sensitivity of a new primer pair targeted to sxtA4 in multiple strains of six species of 107
Alexandrium and Gymnodinium catenatum, and determined the copy number of this gene in 108
strains of Alexandrium catenella. We tested this assay on samples taken during three 109
environmental blooms of A. catenella along the eastern Australia coastline, each causing 110
uptake of STX in S. glomerata. In particular, we wished to determine the relationship 111
between genomic DNA copy number of sxtA4 and cellular toxicity in lab cultures of A. 112
catenella, and between sxtA4, cell abundance, and toxicity in Saccostrea glomerata during 113
blooms of A. catenella. 114
115
Methods 116
117
Culture maintenance 118
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
5 Dinoflagellate cultures (Table 1) were maintained in GSe (10) or L1 media (21) at 16-20°C. 119
Light was provided by white fluorescent bulbs (Crompton Light), with photon flux of 60-100 120
μmol photon m-2 sec-1 on 12/12 hour dark/light cycle. Strains used were provided by the 121
University of Tasmania (isolated by M. de Salas) the Australian National Culture Collection 122
of Marine Microalgae, Provasoli-Guillard Culture Collection (CCMP) and the Cawthron 123
Institute Culture Collection. Strains used for qPCR were isolated from Australian waters by 124
M. de Salas (UTAS): ACCC01, isolated from Cowan Creek, NSW, approximately 20 km 125
from the Brisbane Water site and 50 km from Georges River site, ACSH02, isolated from 126
Sydney Harbour, approximately 35 km north of the Georges River site, and ACTRA02, 127
isolated from Tasmania, Australia. Cultures were harvested during late logarithmic or early 128
stationary phase for extraction for toxins and for estimates of gene copy number. 129
130
DNA extraction and PCR 131
Culture density was determined regularly using a Sedgewick Rafter cell (Proscitech) and an 132
inverted light microscope (Leica Microsystems). Known numbers of cultured cells were 133
harvested during exponential growth phase. DNA was extracted from the cell pellets using 134
the CTAB method (11), with an additional overnight DNA precipitation at -20°C. Quality 135
and quantity of DNA was determined using a Nanodrop (Thermoscientific), and by 136
amplifying a control dinoflagellate gene (cytb or SSU rRNA), according to the protocols of 137
(38), using the primer pair 4f and 6r, which amplify a 440 bp fragment, or 18S r DNA 138
primers 18SF08 (5’-TTGATCCTGCCAGTAGTCATATGCTTG-3’) and R0ITS (5’-139
CCTTGTTACGACTTCTCCTTCCTC-3’) that amplify ~1780 bp (47). 140
141
sxt qPCR assay development and copy number determination 142
An alignment of sxtA4 genomic and sequences from 9 strains of the species Alexandrium 143
catenella, A. tamarense, A. minutum, A. fundyense and Gymnodinium catenatum (JF343238 – 144
JF343239, JF343259-JF343265) was constructed. The degree of conservation of the gene 145
sequences was checked for a 440 bp fraction of the sxtA4 domain and found to be 94-98% 146
between Alexandrium species, and 89% between Gymnodinium catenatum and Alexandrium 147
species. Primers specific for sxtA4 were designed using Primer3 software and a consensus 148
sequence. The specificity of the primer sequences was then confirmed using BLAST (Basic 149
Local Alignment Search Tool) on NCBI (National Centre for Biotechnology Information). 150
The sequences of the primers were sxtA4F 5’ CTGAGCAAGGCGTTCAATTC 3’ and 151
sxtA4R 5‘ TACAGATMGGCCCTGTGARC 3’, resulting in an 125 bp product. 152
153
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
6 To determine their specificity to STX-producing, or potentially STX-producing strains, the 154
sxtA4 primer pair was amplified from 6 species of Alexandrium, Gymnodinium catenatum, 3 155
other toxin producing species of Gonyaulacales: Ostreopsis ovata, Gambierdiscus australes, 156
Ostreopsis siamensis, an additional dinoflagellate, Amphidinium massartii, and an 157
environmental sample containing a mixed phytoplankton community, including 6 identified 158
dinoflagellate species (Table 1). PCR amplification was performed in 20 µl reactions 159
containing template, 0.5 µM of each primer, 3 mM MgCl2, 1 µl BSA (NEB), and 10 µL 160
Immomix (Bioline), containing dNTPs, Immolase Taq polymerase and reaction buffer or 20 161
µl containing template, 0.2 µM of each primer, 3 mM MgCl2, 1 µl BSA, 2 µl MyTaq reaction 162
buffer (Bioline) containing dNTPs, 0.2 µl MyTaq (Bioline) hot start polymerase and H2O. 163
Hot start PCRs were performed with an initial denaturing step of 95oC for 5-10 min, and 35 164
cycles of 30 s at 95oC, 30 s at 55 or 60oC (for the cytb and sxtA4 primers, respectively), 30s at 165
72oC followed by a final extension step of 7 min at 72oC. The 18S fragment was amplified in 166
25 µL reactions containing template, 1 unit 10X BD Advantage 2 PCR buffer (BD 167
Biosciences), 5 mM dNTPs, 0.2 µM of each primer, DMSO (10 % final concentration) and 168
0.25 units 50X BD Advantage 2 Polymerase Mix (BD Biosciences). PCRs were amplified as 169
follows: 94 °C - 1 min; 30 x (94 °C - 30 s; 57 °C - 30 s; 68 °C - 120 s); 68 °C - 10 min; 8 °C 170
– hold. Products were analysed using 3% agarose gel electrophoresis, stained with ethidium 171
bromide and visualized. 172
173
qPCR was also performed using a primer pair specific for the temperate Asian ribotype of 174
Alexandrium catenella, found in Australian temperate waters, based on a region of the large 175
subunit (LSU) ribosomal RNA region (28), amplifying an 160 bp fragment, catF (5’-176
CCTCAGTGAGATTGTAGTGC-3’) and catR (5’-GTGCAAAGGTAATCAAATGTCC-3’). 177
178
qPCR cycling was carried out on a Rotor Gene 3000 (Corbett Life Science) using SSOFast 179
Evagreen supermix (Biorad). qPCR assays were performed in a final volume of 20 μl 180
consisting of 10 μl Evagreen master mix (containing DNA intercalating dye, buffer and Taq 181
polymerase), 1 μl of template DNA, 0.5 µM of each primer, and 1 μl of BSA. qPCR assays 182
were performed in triplicate with the following cycles: 95°C for 10 s, and 35 replicates of 183
95°C for 15 s and 60°C for 30 s. Melting curve analysis was performed at the end of each 184
cycle to confirm amplification specificity, and selected PCR products were sequenced. 185
186
Standard curves for both sxtA4 and LSU rRNA were constructed in two ways: (1) Using a 187
dilution series of a known concentration of fresh PCR product, ranging from 5.7–5.7 x 10 -5 188
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
7 ng (n=6). Standard curves using PCR product were used to determine the efficiency of the 189
assay (49), as well as to determine copy number. The molecules of PCR product were 190
determined: (A x 6.022 x 1023) x (660 x B)-1 with A: concentration of PCR product, 6.022 x 191
1023: Avogadro’s number, 660: average molecular weight per base pair and B: length of PCR 192
product. The number of molecules in the unknown samples were determined and divided by 193
the known number of cells in the DNA qPCR template, to obtain copy number per cell. (2) 194
Extracting DNA from duplicate samples of known numbers of cells of strains of Alexandrium 195
catenella (ACCC01, ACSH02, ACTRA02) taken during exponential growth phase, and 196
diluting the DNA at 50% over 3 orders of magnitude (n=6). 197
198
To estimate the environmental abundance of A. catenella in the samples based on the LSU 199
rRNA assay, the equations from (2) were extrapolated and applied to the CT values measured 200
for these samples. Because variability has been found in copy numbers of the rRNA genes 201
among strains of some Alexandrium species (16), as well as a variability of up to a factor of 2 202
expected due to variability in growth and cell cycle conditions of cells, new standard curves 203
of this LSU rRNA primer pair were constructed based on duplicate extracts of the cultures 204
ACCC01 and ACSH02, from the Sydney region. The copy number of the LSU rDNA in 205
these strains was found to be 53767 +/- 39312 and 103380 +/- 98679, respectively. The 206
abundance of A.catenella in the environmental samples based on LSU rDNA qPCR was 207
estimated based on these copy number estimates and triplicate samples, and therefore given 208
as the mean of 6 independent abundance estimates. 209
210
Phytoplankton and oyster sample collection 211
The phytoplankton community was sampled daily at mid-tide during the 15–20th November, 212
2010, at standard monitoring sites close to Sydney rock oyster (Saccostrea glomerata) farms 213
in Wagonga Inlet, Narooma, NSW, -36’ 13’’ E 150’ 6’’ S and the Georges River, NSW -34’ 214
1’’ E 151’ 8’’ S (Fig. 1). Samples were also taken at Brisbane Water, NSW -33’ 28’’ E 151’ 215
18’’ S on 22nd July, 2010 (Fig. 1). 216
217
Triplicate 4 L bottle samples were taken each day for molecular analysis. A further 500 ml 218
bottle was taken and immediately fixed with Lugol’s iodide for microscopic identification 219
and counting. Samples were filtered using 3 µm Millipore filters and frozen at -20°C until 220
DNA extraction. Ten individual S. glomerata samples were taken from farms in the 221
immediate vicinity of the phytoplankton sampling site on the 17/11/10 and the 19/11/10. S. 222
glomerata samples were pooled for toxin testing. 223
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
8 224
To determine the specificity of the primer pair in mixed environmental samples, a 225
phytoplankton community in which no known STX-producing species were present was 226
sampled. We took 1 L samples of the surface community at Jervis Bay on 19th January, 2011, 227
and preserved, concentrated, identified and counted species present from 500 ml of one 228
sample, as above. Dinoflagellates present were identified as Protoceratium reticulatum, 229
Karlodinium cf veneficum, Karenia sp., Prorocentrum micans, Polarella glacialis, Pfiesteria 230
shumwayae, and Symbiodinium sp. We filtered 500 ml and performed DNA extraction and 231
PCR as described above. An additional sample from the site was used to assess the STX 232
content of the phytoplankton using a Jellett PSP test (Jellett Rapid Testing Ltd, Canada ) 233
according to the manufacturer’s instructions. 234
235
Alexandrium cell counts using microscopy 236
Phytoplankton cells in ~300 ml of the Lugol’s preserved samples were concentrated by 237
gravity assisted membrane filtration on to 5 µm cellulose ester filters (Advantec) prior to 238
washing into 4 ml and counting. Alexandrium species were identified and counted using a 239
Sedgewick Rafter cell and a Zeiss Axiolab microscope equipped with phase-contrast optics. 240
The number of cells counted varied among samples, depending on Alexandrium abundance, 241
and standard error rates were calculated using the equation: Error = 2 / √n, where n is the 242
number of cells observed in the sample. 243
244
Toxin determination in oysters and cultures 245
Shellfish samples and dinoflagellate cell pellets were tested using HPLC, according to the 246
AOAC Official Method 2005.06 for paralytic shellfish poisoning toxins in shellfish (33) at 247
the Cawthron Institute, New Zealand. A matrix modifier as described in the original protocol 248
was not used, instead we used average spike recoveries for each separate compound. HPLC 249
analysis was performed on a Waters Acquity UPLC system (Waters) coupled to a Waters 250
Acquity FLR detector. Separation was achieved with a Waters Acquity C18 BEH 1.7 µm 2.1 251
x 50 mm column at 30°C, eluted at 0.2 mL min-1. Mobile phases were 0.1 M ammonium 252
formate (A) and 0.1 M ammonium formate in 5% acetonitrile (B), both adjusted to pH 6. The 253
gradient consisted of 100% A for 0.5 min, a linear gradient to 80% B over 3.5 min, then 254
returning to initial conditions over 0.1 min and held for 1.9 min. The fluorescence detector 255
had excitation set to 340 nm and emission to 395 nm. Analytical standards for the STX 256
analogs were obtained from the National Research Council, Canada. The detection limit of 257
the HPLC of the cell cultures was considered to be 0.1 pg cell-1 for NEO and STX, 0.2 pg 258
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
9 cell-1 for GTX1/4, GTX6 (B2) and GTX5 (B1), 0.5 pg cell-1 for C1,2, and <0.3 pg cell-1 for 259
the analogs C3,4. 260
261
Results 262
263
Specificity, sensitivity and efficiency of the primer pair 264
The primers designed in this study were found to amplify a fragment of the correct size in all 265
tested STX-producing dinoflagellates of the species: Alexandrium minutum, A. catenella, A 266
fundyense, A. tamarense and Gymnodinium catenatum (Table 1). In addition, it amplified a 267
fragment of the correct size from the species A. tamarense, strain ATCJ33, Tasmanian 268
ribotype, which was not found to produce STX at a level above the detection limit of our 269
HPLC method. Sequencing of the products confirmed this to be a homolog of sxtA4. 270
271
The sxtA4 primer pair did not amplify DNA from the non-STX producing related 272
Gonyaulacalean species Alexandrium andersonii, Alexandrium affine, Gambierdiscus 273
australes, Ostreopsis ovata or Ostreopsis siamensis nor from the more distantly related 274
dinoflagellate species Amphidinium massartii. In addition, the sxtA4 primer pair did not 275
amplify DNA from the phytoplankton samples, which contained a mixed planktonic 276
community including bacteria, diatoms, picoplankton and the dinoflagellates Protoceratium 277
reticulatum, Karlodinium cf veneficum, Karenia sp., Prorocentrum micans, Polarella 278
glacialis, Pfiesteria shumwayae, and Symbiodinium sp. (Table 1). In contrast, DNA from all 279
samples was amplified using the positive control primer pair to ensure the reaction template 280
was intact and free of inhibitors (data not shown). 281
282
The efficiency of the sxtA4 assay based on this primer pair was 97% as calculated using a 283
dilution series of fresh PCR product over 6 orders of magnitude. The assay was 93–107% 284
efficient as calculated using a duplicate 50% dilution series of gDNA from the three strains of 285
A. catenella (49), Fig 2). For standard curves based on both PCR product and based on 286
gDNA, r2 values of the regression equations were 0.95 or greater (Fig 2). The assay was 287
sensitive to DNA quantities representing ~30 to >2000 cells of the three strains of 288
A.catenella. Therefore, if collection of samples was carried out following a similar protocol 289
to our own, and 4 L of seawater was collected, extracted and eluted in 15 µL, of which 1 µL 290
was assayed, then the assay would detect environmental concentrations of A.catenella with a 291
lower limit of approximately 110 cells L-1 . 292
293
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
10 Copy number of sxtA4 genes 294
The mean copy number of sxtA4 in the 3 cultured strains of temperate Asian clade 295
Alexandrium catenella had a range of 178–280 cell-1 (Table 2). These strains produced 296
similar amounts of analogs of STX and had relatively similar toxin profiles, producing 297
primarily C1/C2 analogs (2- 2.55 pg cell-1), and GTX1/GTX4 analogs (1.13 – 1.75 pg cell-1), 298
while the strain ACCC01 additionally produced analogs B2 and C3,4 (Table 2). 299
In the environmental samples containing A. catenella, the copy number of sxtA4 was 300
estimated to be 226 and 376 cell-1 in the Georges River and Wagonga Inlet samples, 301
respectively, and most variable amongst the estimates based on the Wagonga Inlet samples. 302
303
Environmental samples 304
We detected sxtA4 in the single Brisbane Water sample, as well as in the Georges River and 305
Wagonga Inlet sample sets (Fig 3). Sequencing and melt-curve analysis confirmed this to be 306
sxtA4, with an average identity of 99% or higher to the corresponding gene from the 307
Alexandrium catenella strains. A positive relationship between cell number, as estimated 308
from microscopy, cell number as estimated from LSU rDNA, and the sxtA4 copy number was 309
observed in both sets of environmental samples. The regression between cell number as 310
estimated from LSU rRNA gene qPCR and the estimated sxtA4 gene copy number showed a 311
highly significant relationship for the Georges River samples (r2=0.97, slope=0.0059, 312
Student’s t test p<0.001), and a less significant relationship for the Wagonga Inlet sample 313
(r2=0.70, slope= 0.001, Student’s t test p<0.07) (Fig 3, Supplementary data, Figs 1-3). 314
315
We detected STX in pooled S. glomerata samples from each of these three sites, with the 316
highest concentrations reported for the Georges River site (200 µg STX equivalent kg-1 of 317
shellfish) with lower levels recorded for both Wagonga Inlet and Brisbane Water (48 and 145 318
µg STX equivalent kg-1 of shellfish, respectively, Table 2). 319
320
Discussion 321
322
We present a new method for detecting and quantifying the potential for STX production in 323
marine environmental samples, based on the detection of the gene sxtA. This represents the 324
first environmental detection of a gene putatively involved in the biosynthesis of a marine 325
biotoxin. Due to the large, highly complex genomes (37, 50, 52) of many marine harmful 326
algal bloom forming taxa, in particular, dinoflagellates, the function of many or most of the 327
genes sequenced in transcriptomic studies is not known (2, 8, 22, 34, 36, 41, 42, 55), and 328
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
11 genes putatively involved in toxin production have been difficult to identify. Therefore, the 329
recent identification of genes involved in the production of STXs (32) represents a significant 330
opportunity for the development of novel detection tools. We detected sxtA in all STX-331
producing cultures, and did not detect it in the non STX-producing cultures or the 332
environmental sample that did not contain known STX-producing species. However, sxtA 333
genes were also detected in the non-producing strain of Alexandrium tamarense, Tasmanian 334
ribotype, ATCJ33. As a very closely related strain of the Tasmanian ribotype of this species 335
has been found to produce STX (unpublished data), it is possible that the strain ATCJ33 has 336
the potential to produce STX under certain circumstances. The amplification of sxtA4 from 337
the Alexandrium and Gymnodinium catenatum species and strains in our study are in line 338
with our previous findings (53), in which we amplified approximately 550 bp and 750 bp 339
fragments of sxtA1 and sxtA4 from the same strains as tested here, and detected no 340
amplification of these fragments from the species Alexandrium affine and A. andersonii. 341
342
sxtA4, A. catenella and STX in south-eastern Australia 343
Alexandrium catenella has been reported occasionally from south-eastern Australian waters 344
since its first confirmed documentation (23). Blooms of this species have been associated 345
with the uptake of STX in wild and farmed oysters, including samples from the Sydney 346
region that have contained up to 3000 µg STX equivalents kg-1 (1), and cyst beds of this 347
species are known from this region (24). There is no published data on the inter-annual or 348
seasonal distribution and abundance of A. catenella and its relationship to STX in this region, 349
and our results represent the first information on the fine scale bloom dynamics of A. 350
catenella in south-eastern Australia. Since 2003, fortnightly phytoplankton monitoring of the 351
75 harvest areas in 32 estuaries has been conducted, and an analyses of these data is currently 352
underway. Our data over a short temporal scale in combination with the long term monitoring 353
information will allow for a deeper understanding of bloom dynamics in this region. 354
355
In this study, we detected sxtA4 on each occasion that Alexandrium catenella was sampled in 356
southeastern Australian estuaries (Table 2). For the Georges River sample set, the correlation 357
between sxtA4 copies L-1 and cell abundance L-1 was highly significant (Fig 3), and total STX 358
load in oyster samples taken during this week were the highest of the three samples taken 359
during this study. At Wagonga Inlet, mean abundances were several orders of magnitude 360
lower (Fig 3), and the correlation between sxtA4 copies L-1 and cell number was lower, 361
possibly due to the fact that two of these samples were below the lower limit of reliable 362
detection of our assay. Alternatively, the lower correlation coefficient of this sampling set 363
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
12 may be due to the presence of several strains of Alexandrium catenella which differed in 364
copy number of sxtA. 365
366
Detection methods for STX and Alexandrium species 367
Generally, the enumeration of HAB-forming phytoplankton and their toxins for industry and 368
for biological oceanographic research relies on microscope-based counting of species and 369
direct toxin detection methods. Quantification of STX is generally conducted by mouse 370
bioassay, instrumental HPLC, LC-MS or antibody-based immunoassays, such as enzyme 371
linked immunosorbent assays (ELISA). HPLC is a time-consuming and expensive process, 372
requiring a well-equipped analytical laboratory and pure standards of STX and its numerous 373
analogs (54). While newly developed ELISA methods have overcome some of these 374
drawbacks, they are not available for several common STX derivatives, and have problems of 375
cross-reactivity, as toxin profiles are often quite complex (15). 376
377
Molecular genetic and antibody-based methods for marine phytoplankton species 378
identification and enumeration have been the focus of increased development in recent years, 379
particularly for species of the genus Alexandrium (51, 48, 18, 19, 3, 17, 30, 12, 13, 20, 28, 380
31, 14). These methods have many advantages when compared to microscope-based counts 381
and direct toxin detection methods: their simplicity, with a much lower requirement for 382
extensive training and experience compared to microscope-based taxonomic identification, 383
cost effectiveness (qPCR reagents generally cost less than ~US $1 per sample), speed and 384
potential for automation (up to 30 samples may be run in triplicate in under 2 hours on a 385
standard qPCR machine using 96 well plates). Real time qPCR machines have substantially 386
decreased in cost in recent years, and are now comparable in cost to microscopes, and it is 387
possible to operate them with a basic training in molecular biology techniques. 388
389
Assays based on qPCR for the detection of Alexandrium may be more sensitive than 390
microscopy-based methods at low cell abundances and where the species of interest may be a 391
minor component of the phytoplankton (3, 20). A reliable detection limit of ~110 cells L-1 of 392
Alexandrium catenella is achievable using the qPCR method reported here. The Sedgewick-393
Rafter counting chamber method, as it is applied in the majority phytoplankton monitoring 394
programs, is considered to have a reliable detection limit of 1000 cells L-1 (35). However, this 395
is dependent on the volume of sample observed, and lower levels (down to < 20 cells L-1 ) are 396
achievable by filtering larger volumes of sample for observation. The standard error of 397
microscope-based counts is dependent on the number of cells observed, and increases with 398
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
13 decreasing cell number. For molecular genetic based methods, the standard error associated 399
with cell counts is independent of the abundance of cells. Molecular genetic identification 400
and enumeration methods have reported detection thresholds in the order of 10-100 cells L-1 401
of Alexandrium species using qPCR and FISH probes (19, 3, 12, 20), depending on the 402
volume of water (typically 1-8 L) sampled using these methods. As concentrations as low as 403
200 cells L-1 of Alexandrium species have been associated with STX uptake in shellfish (54), 404
the reliable detection of species at low cell abundances is an important advantage of qPCR 405
based enumeration methods over microscope counts as currently practiced in the majority of 406
phytoplankton monitoring programs. 407
408
While many advantages have been noted in molecular genetic based monitoring methods, 409
current methods have several drawbacks. qPCR for species enumeration using marker genes 410
requires the use of multiple probes in habitats where several species of Alexandrium, 411
Pyrodinium bahamense and Gymnodinium catenatum occur and produce STX. Species not 412
previously documented in a particular habitat are occasionally identified, and they may not be 413
noticed if a suitable probe is not available for their identification. In addition, ribosomal RNA 414
genes, which have been used for detection as their relatively fast divergence rates allow for 415
the design of species-specific markers, can vary significantly in copy number among some 416
strains, and in some cases, during culture growth (16). This may be due to the presence of 417
unstable rDNA pseudogenes in some Alexandrium species, and possibly the presence of 418
extra-chromosomal rDNA molecules (16). The effect of this variation is to cause disparities 419
between the estimated gene number and cell number, and ensuing errors in cell abundance 420
estimates (16,20,13). 421
422
The method presented here relies on the direct detection of a gene (sxtA) putatively involved 423
in the synthesis of STX (53,32). Therefore, it may be more closely correlated with STX 424
presence than the abundance of a particular species. Using our primer pair, sxtA4 was not 425
amplified from two non-STX producing Alexandrium species tested but was amplified from 426
the relatively distantly related STX-producing species Gymnodinium catenatum. This allows 427
for the use of a single assay to simultaneously detect distantly related potential STX-428
producing taxa, including those not previously known from a particular site. In addition, we 429
found sxtA4 cell-1 to be relatively similar among strains and samples tested (178-376 cell-1, 430
Table 2), similar to our previous finding of 100-240 copies cell-1 throughout the growth of 431
Alexandrium catenella strain ACSH02 (53), suggesting that abundance estimates of 432
organisms based on cultured strains may be applicable to naturally occurring strains. 433
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
14 434
Transcription level regulation may play a relatively minor role in the expression of many 435
dinoflagellate genes, compared to regulation in some other eukaryotes, as genes that are up-436
regulated have been reported to increase in transcript abundance by no more than ca. 5-fold, 437
compared to levels during standard growth (56, 57, 43). This has led to the theory that the 438
multiple copies of highly expressed genes in dinoflagellates may function as a means of 439
increasing their transcription (4). If this were true, there may be a relationship between the 440
copy number of sxtA cell-1 and the quantity of STX produced by a strain. In this study, the 441
species tested had similar copy numbers of sxtA cell-1 and similar STX production (Table 2), 442
within the range reported for common STX-producing species (0.66–9.8 pg STX equivalent 443
cell-1 , 29, 39, 45), but lower than the most toxic strains reported, such as strains of 444
Gymnodinium catenatum (26–28 pg STX equiv. cell-1, (6), and Alexandrium ostenfeldii (up to 445
217 pg STX equiv. cell-1, 40). Detailed studies of sxtA cell-1 in strains of the same species that 446
differ considerably in STX production are necessary in order to determine if such a 447
relationship exists. Similarly, the assay presented here requires further validation on a global 448
scale in order to quantify the true rate of false positives, or the silencing of sxtA in some 449
species, and confirm its broad applicability for coastal waters and shellfish testing. 450
451
Acknowledgements 452
We thank Anthony Zammit, Melanie Field, John Richie, Peter O’Kane, Christopher Richie, 453
Bob Crake, James Murray, Gurjeet Kohli, Jocelyn de la Cruz, Nathan Knott and Alper Yasar 454
for sample collection of oysters and phytoplankton, and child-minding while SM collected 455
samples. We thank the NSW Food Authority, Wayne O’Connor of Industry and Investment 456
NSW, Diagnostic Technology, Ray Brown of the Tasmanian Department of Health and 457
Human Services, and Ken Lee of Primary Industries and Resources South Australia for co-458
funding and supporting this research. We thank Lesley Rhodes for allowing use of her strains. 459
We thank the Cawthron Institute for conducting the HPLC analyses and Rouna Yauwenas for 460
laboratory assistance. This study was funded by the Australian Research Council Grant 461
LP0776759 to BN, SM and GH. AS was supported by grant 186292/V40 from the Research 462
Council of Norway. This study is dedicated to the Wagonga Inlet oyster farmers. This is 463
contribution number xx from the Sydney Institute of Marine Sciences. 464
465
466
467
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
15 Tables 468
469
Table 1. Dinoflagellate strains tested, STX content and whether the sxtA4 qPCR primer pair 470
resulted in a product. All samples were tested with a positive control to ensure PCR inhibitors 471
were not present.1 (Stüken et al 2011) 472
Dinoflagellate Strain
number
STX
detected1
sxtA4 qPCR
product
Alexandrium
affine CCMP112 - -
affine CS-312/02 - -
andersonii CCMP1597 - -
andersonii CCMP2222 - -
catenella ACCC01 + +
catenella ACSH02 + +
catenella ACTRA02 + +
fundyense CCMP1719 + +
minutum CCMP113 + +
minutum CS-324 + +
tamarense ATCJ33 - +
tamarense ATNWB01 + +
Gambierdiscus
australes CAWD148 - -
Ostreopsis
ovata CAWD174 - -
siamensis CAWD - -
Amphidinium
massarti CS-259 - -
Gymnodinium
catenatum GCTRA01 + +
Environmental water
sample containing:
- -
Protoceratium
reticulatum
Prorocentrum micans,
Karenia sp
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
16 Karlodinium veneficum
Polarella glacialis
Symbiodinium sp
473 474
Table 2. STX present in Alexandrium catenella strains, in pg cell-1 and in Saccrostrea 475
glomerata from the sampling sites, in µg STX equivalents kg-1 of shellfish, and mean copy 476
number of sxtA4 genes in the strain or in all phytoplankton samples from that sampling site. 477
A reading of 0 indicates levels were below the detection limit of the test. The S. glomerata 478
samples were taken on 17/11/10, 19/11/10 and 22/7/10 for the Georges River, Wagonga Inlet 479
and Brisbane Water, respectively. 480
481
STX
equiv
GTX-
1,4
GTX-6 C1,2 GTX
-5
(B1)
NEO/
STX
C-3,4 B2 sxtA4 cell-1 +/- sd
in strain or in
plankton sample
cultures
ACSH02 1.75 0.60 2.40 0.5 <0.1 <0.3 0 178 +/- 49 (n=9)
ACCC01 1.15 0 2.55 0 0 1.00 1.9 240 +/- 97 (n=3)
ACTRA02 1.13 0 2.00 0 0 0 0 280 +/- 85 (n=3)
S.glomerata
Georges River 200 160 trace 30 10 0 trace 0 226 +/- 97 (n=15)
Wagonga Inlet 48 32 0 16 0 0 0 0 376 +/- 257
(n=12)
Brisbane Water 145 53 92 0 0 0 0 275 (n=1)
482
483
484
485
486
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
17 Figure legends 487
488
Figure 1. Phytoplankton and S. glomerata sampling sites. A), New South Wales (in white), 489
Australia, and the sites in three estuaries in which A.catenella blooms were sampled: B) 490
Brisbane Water, C) the Georges River and D) Wagonga Inlet. Scale bar in D represents 2 km 491
in inset maps B, C and D. 492
493
494
Figure 2. Standard curve of the sxtA4 primer pair based on replicate dilutions (+/- stdev) of 495
DNA from known numbers of cells of three exponentially growing Alexandrium catenella 496
strains, ACSH02, ACTRA01, ACCC01. The assay was tested using DNA concentrations 497
representing 30-2600 cells. The regression equations are shown. 498
499
500
501
Figure 3. Abundance of sxtA4 gene copies (primary y axis) and estimates of Alexandrium 502
catenella cells (secondary y axis) based on cell identifications and counts using a microscope; 503
and cell enumeration using LSU rDNA qPCR at a) the Georges River and b) Wagonga Inlet 504
sampling sites, during November 2010. 505
506
507
508
509
510
511
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
18 References 512
513
1. Ajani, P., G. Hallegraeff, and T. Pritchard. 2001. Historic overview of algal 514 blooms in marine and estuarine waters of New South Wales, Australia. Proc Linn Soc 515 NSW 123:1-22 516
2. Allen, A. E., B. B. Ward, and B. Song. 2005. Characterization of diatom 517 (Bacillariophyceae) nitrate reductase genes and their detection in marine 518 phytoplankton communities. J Phycol 41:95-104. 519
3. Anderson, D. M., D. M. Kulis, B. A. Keafer, K. E. Gribble, R. Marin, and C. A. 520 Scholin. 2005. Identification and enumeration of Alexandrium spp. from the Gulf of 521 Maine using molecular probes. Deep Sea Res (II Top Stud Oceanogr) 52:2467-2490. 522
4. Bachvaroff, T. 2008. From stop to start: tandem gene arrangement, copy number and 523 trans-splicing sites in the dinoflagellate Amphidinium carterae. PloS One 3. 524
5. Bajarias, F. F., T. Relox Jr, and Y. Fukuyo. 2006. PSP in the Philippines: three 525 decades of monitoring a disaster. Coastal Mar Sci 30:104-106. 526
6. Band-Schmidt, C., J. Bustillos-Guzmán, I. Gárate-Lizárraga, C. Lechuga-527 Devéze, K. Reinhardt, and B. Luckas. 2005. Paralytic shellfish toxin profile in 528 strains of the dinoflagellate Gymnodinium catenatum Graham and the scallop 529 Argopecten ventricosus GB Sowerby II from Bahía Concepción, Gulf of California, 530 Mexico. Harmful Algae 4:21-31. 531
7. Bolch, C. J. S., and M. F. de Salas. 2007. A review of the molecular evidence for 532 ballast water introduction of the toxic dinoflagellates Gymnodinium catenatum and 533 the Alexandrium. Harmful Algae 6:465-485. 534
8. Bowler, C., A. E. Allen, J. H. Badger, J. Grimwood, K. Jabbari, A. Kuo, U. 535 Maheswari, C. Martens, F. Maumus, and R. P. Otillar. 2008. The Phaeodactylum 536 genome reveals the evolutionary history of diatom genomes. Nature 456:239-244. 537
9. Catterall, W. A. 1980. Neurotoxins that act on voltage-sensitive sodium channels in 538 excitable membranes. Annu Rev Pharmacol Toxicol 20:15-43. 539
10. Doblin, M. A., S. I. Blackburn, and G. M. Hallegraeff. 1999. Growth and biomass 540 stimulation of the toxic dinoflagellate Gymnodinium catenatum (Graham) by 541 dissolved organic substances. J Experim Mar Biol Ecol 236:33-47. 542
11. Doyle, J., and J. Doyle. 1987. A rapid DNA isolation procedure for small quantities 543 of fresh leaf tissue. Phytochem Bull 19:11-15. 544
12. Dyhrman, S. T., D. Erdner, J. L. Du, M. Galac, and D. M. Anderson. 2006. 545 Molecular quantification of toxic Alexandrium fundyense in the Gulf of Maine using 546 real-time PCR. Harmful Algae 5:242-250. 547
13. Dyhrman, S. T., S. T. Haley, J. A. Borchert, B. Lona, N. Kollars, and D. L. 548 Erdner. 2010. Parallel analyses of Alexandrium catenella cell concentrations and 549 shellfish toxicity in the Puget Sound. App Env Micro 76:4647. 550
14. Erdner, D. L., L. Percy, B. Keafer, J. Lewis, and D. M. Anderson. 2010. A 551 quantitative real-time PCR assay for the identification and enumeration of 552 Alexandrium cysts in marine sediments. Deep Sea Res Part II: Top Stud Oceanogr 553 57:279-287. 554
15. Etheridge, S. M. 2010. Paralytic shellfish poisoning: seafood safety and human 555 health perspectives. Toxicon 56:108-122. 556
16. Galluzzi, L., E. Bertozzini, A. Penna, F. Perini, E. Garcés, and M. Magnani. 557 2009. Analysis of rRNA gene content in the Mediterranean dinoflagellate 558 Alexandrium catenella and Alexandrium taylori: implications for the quantitative real-559 time PCR-based monitoring methods. J Appl Phycol 22:1-9. 560
17. Galluzzi, L., E. Bertozzini, A. Penna, F. Perini, E. Garcés, and M. Magnani. 561 2010. Analysis of rRNA gene content in the Mediterranean dinoflagellate 562
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
19
Alexandrium catenella and Alexandrium taylori: implications for the quantitative real-563 time PCR-based monitoring methods. Journal of Applied Phycology 22:1-9. 564
18. Galluzzi, L., A. Penna, E. Bertozzini, M. G. Giacobbe, M. Vila, E. Garces, S. 565 Prioli, and M. Magnani. 2005. Development of a qualitative PCR method for the 566 Alexandrium spp.(Dinophyceae) detection in contaminated mussels (Mytilus 567 galloprovincialis). Harmful Algae 4:973-983. 568
19. Galluzzi, L., A. Penna, E. Bertozzini, M. Vila, E. Garces, and M. Magnani. 2004. 569 Development of a real-time PCR assay for rapid detection and quantification of 570 Alexandrium minutum (a dinoflagellate). Appl Environ Microbiol 70:1199. 571
20. Godhe, A., C. Cusack, J. Pedersen, P. Andersen, D. M. Anderson, E. Bresnan, A. 572 Cembella, E. Dahl, S. Diercks, and M. Elbrachter. 2007. Intercalibration of 573 classical and molecular techniques for identification of Alexandrium fundyense 574 (Dinophyceae) and estimation of cell densities. Harmful Algae 6:56-72. 575
21. Guillard, R., and P. Hargraves. 1993. Stichochrysis immobilis is a diatom, not a 576 chrysophyte. J Phycol 32:234-236. 577
22. Hackett, J. D., T. E. Scheetz, H. S. Yoon, M. B. Soares, M. F. Bonaldo, T. L. 578 Casavant, and D. Bhattacharya. 2005. Insights into a dinoflagellate genome 579 through expressed sequence tag analysis. BMC Genomics 6:80. 580
23. Hallegraeff, G., C. Bolch, S. Blackburn, and Y. Oshima. 1991. Species of the 581 toxigenic dinoflagellate genus Alexandrium in southeastern Australian waters. Bot 582 Mar 34:575-588. 583
24. Hallegraeff, G., J. Marshall, S. Hardiman, and J. Valentine. 1998. Short cyst-584 dormancy period of an Australian isolate of the toxic dinoflagellate Alexandrium 585 catenella. Mar Freshw Res 49:415-420. 586
25. Hallegraeff, G., D. Steffensen, and R. Wetherbee. 1988. Three estuarine Australian 587 dinoflagellates that can produce paralytic shellfish toxins. J Plankt Res 10:533. 588
26. Hamasaki, K., M. Horie, S. Tokimitsu, T. Toda, and S. Taguchi. 2001. Variability 589 in toxicity of the dinoflagellate Alexandrium tamarense isolated from Hiroshima Bay, 590 western Japan, as a reflection of changing environmental conditions. J Plankt Res 591 23:271. 592
27. Hoagland, P., and S. Scatasta. 2006. The economic effects of harmful algal blooms. 593 Ecol Harmful Algae:391-402. 594
28. Hosoi-Tanabe, S., and Y. Sako. 2005. Species-specific detection and quantification 595 of toxic marine dinoflagellates Alexandrium tamarense and Alexandrium catenella by 596 real-time PCR assay. Mar Biotechnol 7:506-514. 597
29. Jester, R., L. Rhodes, and V. Beuzenberg. 2009. Uptake of paralytic shellfish 598 poisoning and spirolide toxins by paddle crabs (Ovalipes catharus) via a bivalve 599 vector. Harmful Algae 8:369-376. 600
30. John, U., L. K. Medlin, and R. Groben. 2005. Development of specific rRNA 601 probes to distinguish between geographic clades of the Alexandrium tamarense 602 species complex. J Plank Res 27:199. 603
31. Kamikawa, R., S. Nagai, S. Hosoi-Tanabe, S. Itakura, M. Yamaguchi, Y. Uchida, 604 T. Baba, and Y. Sako. 2007. Application of real-time PCR assay for detection and 605 quantification of Alexandrium tamarense and Alexandrium catenella cysts from 606 marine sediments. Harmful Algae 6:413-420. 607
32. Kellmann, R., T. K. Mihali, Y. J. Jeon, R. Pickford, F. Pomati, and B. A. Neilan. 608 2008. Biosynthetic intermediate analysis and functional homology reveal a saxitoxin 609 gene cluster in cyanobacteria. Appl Environ Microbiol 74:4044. 610
33. Lawrence, J. F., B. Niedzwiadek, and C. Menard. 2005. Quantitative determination 611 of paralytic shellfish poisoning toxins in shellfish using prechromatographic oxidation 612 and liquid chromatography with fluorescence detection: collaborative study. J AOAC 613 Intern 88:1714-1732. 614
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
20 34. Leggat, W., O. Hoegh Guldberg, S. Dove, and D. Yellowlees. 2007. Analysis of an 615
EST library from the dinoflagellate (Symbiodinium sp.) symbiont of reef building 616 corals1. J Phycol 43:1010-1021. 617
35. LeGresley, M., and G. McDermott. 2010. 4 Counting chamber methods for 618 quantitative phytoplankton analysis-haemocytometer, Palmer-Maloney cell and 619 Sedgewick-Rafter cell. Microsc Molec Meth Quant Phytoplank Anal:25. 620
36. Lidie, K. B., J. C. Ryan, M. Barbier, and F. M. Dolah. 2005. Gene expression in 621 Florida red tide dinoflagellate Karenia brevis: analysis of an expressed sequence tag 622 library and development of DNA microarray. Mar Biotechnol 7:481-493. 623
37. Lin, S. 2006. The smallest dinoflagellate genome is yet to be found: a comment on 624 LaJeunesse et al. “Symbiodinium (Pyrrhophyta) genome sizes (DNA content) are 625 smallest among dinoflagellates". J Phycol 42:746-748. 626
38. Lin, S., H. Zhang, Y. Hou, Y. Zhuang, and L. Miranda. 2009. High-level diversity 627 of dinoflagellates in the natural environment, revealed by assessment of mitochondrial 628 cox1 and cob genes for dinoflagellate DNA barcoding. Appl Environ Microbiol 629 75:1279. 630
39. Lippemeier, S., D. M. F. Frampton, S. I. Blackburn, S. C. Geier, and A. P. Negri. 631 2003. Influence of phosphorous limitation on toxicity and photosynthesis of 632 Alexandrium minutum (Dinophyceae) monitored by in line detection of variable 633 chlorophyll fluorescence. J Phyol 39:320-331. 634
40. Mackenzie, L., D. White, Y. Oshima, and J. Kapa. 1996. The resting cyst and 635 toxicity of Alexandrium ostenfeldii (Dinophyceae) in New Zealand. J Phycol 35:148-636 155. 637
41. Marchetti, A., M. S. Parker, L. P. Moccia, E. O. Lin, A. L. Arrieta, F. Ribalet, M. 638 E. P. Murphy, M. T. Maldonado, and E. V. Armbrust. 2008. Ferritin is used for 639 iron storage in bloom-forming marine pennate diatoms. Nature 457:467-470. 640
42. Mock, T., M. P. Samanta, V. Iverson, C. Berthiaume, M. Robison, K. 641 Holtermann, C. Durkin, S. S. BonDurant, K. Richmond, and M. Rodesch. 2008. 642 Whole-genome expression profiling of the marine diatom Thalassiosira pseudonana 643 identifies genes involved in silicon bioprocesses. Proc Nat Acad Sci 105:1579. 644
43. Monroe, E. A., J. G. Johnson, Z. Wang, R. K. Pierce, and F. M. Van Dolah. 2010. 645 Characterization and expression of nuclear encoded polyketide synthases in the 646 brevetoxin producing dinoflagellate Karenia brevis. J Phycol 46:541-552. 647
44. Murray, S. A., T. K. Mihali, and B. A. Neilan. 2011. Extraordinary conservation, 648 gene loss, and positive selection in the evolution of an ancient neurotoxin. Mol Biol 649 Evol 28:1173. 650
45. Murray, S. A., W. A. O'Connor, A. Alvin, T. K. Mihali, J. Kalaitzis, and B. A. 651 Neilan. 2009. Differential accumulation of paralytic shellfish toxins from 652 Alexandrium minutum in the pearl oyster, Pinctada imbricata. Toxicon 54:217-223. 653
46. O'Connor, W. A., and M. C. Dove. 2009. The changing face of oyster culture in 654 New South Wales, Australia. J Shell Res 28:803-811. 655
47. Orr R.J.S., Stüken A, Rundberget T., Eikrem W, Jakobsen K.S. 2011. Improved 656 phylogenetic resolution of toxic and non-toxic Alexandrium strains using a 657 concatenated rDNA approach. Harmful Algae. In Press. 658
48. Penna, A., and M. Magnani. 1999. Identification of Alexandrium (Dinophyceae) 659 species using PCR rDNA trageted probes. J Phycol 35:615-621. 660
49. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-661 time RT–PCR. Nucl Acid Res 29:e45. 662
50. Rae, P. 1976. Hydroxymethyluracil in eukaryote DNA: a natural feature of the 663 Pyrrophyta (Dinoflagellates). Science 194:1062. 664
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
21 51. Scholin, C. A., and D. M. Anderson. 1996. LSU rDNA based RFLP assays for 665
discriminating species and strains of Alexandrium (Dinophyceae). J Phycol 32:1022-666 1035. 667
52. Slamovits, C. H., and P. J. Keeling. 2008. Widespread recycling of processed 668 cDNAs in dinoflagellates. Curr Biol 18:R550-R552. 669
53. Stüken, A., Kellmann, R., Orr, R. J. S., Murray S. A., Neilan, B. A., Jakobsen, K. 670 S. 2011, Discovery of nuclear-encoded genes for the neurotoxin saxitoxin in 671 dinoflagellates. PLoS One 6: e20096. 672
54. Todd, K. 2001. Australian Marine Biotoxin Management Plan for Shellfish Farming. 673 Cawthron Inst Report. 674 55. Vardi, A., K. D. Bidle, C. Kwityn, D. J. Hirsh, S. M. Thompson, J. A. Callow, P. 675
Falkowski, and C. Bowler. 2008. A diatom gene regulating nitric-oxide signaling 676 and susceptibility to diatom-derived aldehydes. Curr Biol 18:895-899. 677
56. Wohlrab, S., M. H. Iversen, and U. John. 2010. A molecular and co-evolutionary 678 context for grazer induced toxin production in Alexandrium tamarense. PloS One 679 5:e15039. 680
57. Yang, I., U. John, S. Beszteri, G. Glöckner, B. Krock, A. Goesmann, and A. D. 681 Cembella. 2010. Comparative gene expression in toxic versus non-toxic strains of the 682 marine dinoflagellate Alexandrium minutum. BMC Genomics 11:248. 683
58. Zhang, H., Y. Hou, L. Miranda, D. A. Campbell, N. R. Sturm, T. Gaasterland, 684 and S. Lin. 2007. Spliced leader RNA trans-splicing in dinoflagellates. Proc Nat 685 Acad Sci 104:4618. 686
59. Zimmer, R. K., and R. P. Ferrer. 2007. Neuroecology, chemical defense, and the 687 keystone species concept. Biol Bull 213:208. 688
689 690
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
