Do Now 1. What is RNA?

2. What are proteins used for in our bodies?

DNA Transcription

and TranslationSections 12.3 and 12.4

Gene Segment of DNA that codes for

a protein The Central Dogma of

Biology: DNA codes for RNA and RNA

makes protein (the synthesis of)

Beadle and Tatum Experiment Experiments on mold, Neurospora, were

the first to demonstrate the relationship between genes and enzymes.

Studied mold spores that were mutated by exposure to X-rays and grown on a complete medium Minimal Medium- no amino acids

provided Complete Medium- all amino acids

provided. (normally Neurospora can grow on both)

Beadle and Tatum Continued Grew spores exposed to X-rays on minimal

medium. When there was no growth, the mutant was tested to see what amino acid it lacked.

When the mutant grew on the minimal medium with arginine (amino acid), the mutant was missing the enzyme needed to make arginine.

One Gene-One Enzyme Beadle and Tatum’s Hypothesis:

One Gene- One Enzyme.

One gene codes for one polypeptide. polypeptide - a chain of covalently bonded

amino acids.

(proteins are made of one or more polypeptide)

Let’s make some observations about RNA’s structure

RNA

RNA stands for:Ribonucleic acid

RNA is found:Nucleus and Cytoplasm

RNA Structure

Like DNA, RNA is made up of subunits called _____________, which are made of three parts: Sugar (ribose) Phosphate Nitrogen Base

RNA’s Nitrogen Bases Adenine (A) Cytosine (C) Guanine (G) Uracil (U)

There are 3 types of RNA:

1. Messenger RNA (mRNA) – long strands of RNA nucleotides that are formed complementary to one strand of DNA.

1. Carries genetic information from DNA in the nucleus to Ribosome in the cytoplasm.

Types of RNA:

2. Ribosomal RNA (rRNA) – associates with protein to form the ribosome.

Types of RNA:

3. Transfer RNA (tRNA) – smaller segments of RNA nucleotides that transport amino acids to the ribosomes.

All RNA is … Single stranded

Many different shapes

“Cheap copy” of DNA

Fill in chart below:

DNA RNA

Structure

Sugar

Base

Example strand: Complimentary:

TACGA

Do NowFill in the Venn Diagram below:

What are the three types of RNA? What is the purpose of each?

DNA RNABoth

Transcription

First step in making proteins Process of taking one gene (DNA) and

converting into a mRNA strand

Location: Nucleus of the cell

Steps to Transcription 1. An enzyme (RNA polymerase)

attaches to the promoter (start signal region) of a gene and unwinds the DNA

Steps to Transcription (Cont.) 2. One strand acts as a template.

Steps to Transcription (Cont.) 3. A mRNA copy is made from the

DNA template strand by RNA polymerase

4. mRNA is made until it reaches the termination (stop signal) sequence

5. mRNA is released, and the two strands of DNA rejoin.

Template vs. Non Template Strand

Transcription animation

https://www.youtube.com/watch?v=ztPkv7wc3yU

Transcribe this DNA to mRNA

Do Now Label the Transcription diagram

mRNA Processing

Pre-mRNA – the original sequence of RNA created during transcription

mRNA reaches the ribosomes

RNA ProcessingIn Eukaryotes only

Introns- non-coded sections (a.k.a “Junk” DNA)

Exons- codes for a protein

Before RNA leaves the nucleus, introns are removed and exons are spliced together

A 5’cap and poly A tail are added to ends of the sequence

mRNA leaves the nucleus through the nuclear pores

Why is it necessary to add the poly A tail and 5’ cap?

Keeps mRNA from degradation, and helps mRNA bind to ribosome.

RNA Processing

Let’s try this example…

Original DNA Sequence (DNA): 5’ GTACTACATGCTATGCAT 3’ Translate it (RNA): 3’ CAUGAUGUACGAUACGUA 5’

Add the 5’ cap:

3’ CAUGAUGUACGAUACGUA 5’ cap

Finish the job!

Remove the introns “UGUA” and “AUAC”:

3’ CAUGAUGUACGAUACGUA 5’ cap

3’ CAUGACGGUA 5’ cap

Add a poly A tail onto the 3’ end

3’ CAUGACGGUA 5’ capPoly A tail

Think, Pair, Share Take a minute think on your own, then pair with your

partner, and share your ideas!

Evolutionary, why do you think there are introns?

Where did they come from?

Remember there is NO wrong answer!

Do Now Perform transcription on this DNA

segment: GCTTCATACGA

Do RNA processing and remove the introns: GAA and UGC

Proteins are made up of amino acids!!!

Proteins are polymers of amino acids

Only 20 different amino acids

BUT there are hundreds of thousands of different proteins

How can this be?

Let’s compare to it to the English languageHow many letters are in the alphabet?A,b,c,d,…26

How many words are there?Miss, P, is, smart, .. Almost infinite!

Each word has a unique structure of letters.

Similar to proteins and amino acids

Proteins- (PCFNa)

-made of 20 different Amino Acids

- Amino Acids bond to form polypeptide chains

How do amino acids form these peptide chains?

Peptide Bonds – Link each amino acids together to form proteins created by dehydration synthesis!

How many water molecules are formed from 2 amino acids?

How many water molecules are formed from 100 amino acids?

Pg. 339

Pg. 339

Protein

Structure

http://www3.interscience.wiley.com:8100/legacy/college/boyer/0471661791/structure/HbMb/hbmb.htm

Translation Production of proteins from mRNA

mRNA goes to the ribosomes in the cytoplasm or the RoughER and produces proteins

Three main stages: Initation Elongation Termination

Ribosome

Two subunits to the ribosome Large subunit, and small subunit

3 sites (grooves) on the ribosome (A, P, E ) A: tRNA binding site

P: polypeptite bonding site

E: exit site

Steps to TranslationInitiation:1. mRNA leaves the nucleus and binds to a ribosome

2. The two ribosomal subunits come together at the 5’ end of the mRNA.

3. Ribosome will find the start Codon (AUG) and the first tRNA molecule will attach This is the only tRNA that will attach to the P site

(and skip the A site)

The first amino acid is always methionine.

Codon: group of 3 nucleotides on the messenger RNA that specifies one amino acid (64 different codons)

tRNA tRNA has an anticodon that

matches the codon on the mRNA strand

Anticodon: Group of 3 unpaired nucleotides on a tRNA strand. (binds to mRNA codon)

Steps to Translation (Cont.)Elongation:

4. Amino acids attached to a tRNA molecules are brought over to the mRNA, and load in at the A site of the ribosome.

5. A polypeptide bond is formed between the amino acids in the P and A sites of ribosome.

6. Ribosome shifts over, opening up the A site for a new tRNA molecule.

7. tRNA in the E site leaves, leaving behind the amino acid.

Steps to Translation (Cont.) Termination:

8.Translation is terminated when a stop codon is reached. There are three different stop codons UGA, UAA, UAG.

9. The release factor recognizes the stop codon, attaches to the mRNA strand in the A site of ribosome, and releases the polypeptide strand. All the factors break apart and can be reused again.

Translation Animations

http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/translation.swf

https://www.youtube.com/watch?v=JTc18Yh7bSU

Think-Pair-Share The mRNA sequence reads the following

codons: What amino acids do they stand for? AUG

GGA

GAG

CAA

** What amino acid does the anticodon CGU stand for?***

Think – Pair - Share

Find the amino acid sequence for the following mRNA sequence (translation)

AUGCGACGAAUUUAA

Do Now Do transcription on this DNA

sequence:

TTTTATACTGAGGGTTAACTCGT

Do Translation- Remember to start the right place!

1. 2. 3.

4. 5. 6.

Do Now

Take the following amino acid sequence, do reverse transcription and translation (find RNA and DNA).

Methionine, Arginine, Alanine, Serine, Tryptophan, Tyrosine, Leucine, Valine, stop

What do you notice about your DNA sequences?

Do Now Template strand of DNA: 5’ TTACGGCTAGGAGTAGCCGAATTCTG 3’

Remove the introns: CUCAUC

Determine protein sequence

How do cells know what protein to make when? Gene Regulation: ability of an organism to

control which genes are transcribed.

Controlling Transcription Transcription factors ensure that a gene is used

at the right time and that protein are made in the right amounts

The complex structure of eukaryotic DNA also regulate transcription.

Everyone develops from a zygote

Zygote undergoes mitosis

Cell differentiation: cells become specialized

Certain gene sequences determine cell differentiation ……But how does that happen?

HOX Genes

Homeobox Genes (Hox Genes) are sequences of DNA that are responsible for the general body pattern of most animals.

Are transcribed at specific times, and located in specific places on the genome.

Control what body part will develop in a given location.

Telephone

We are going to play the game telephone.

Every time a DNA makes a copy (spreading of a message), mutations can happen (mistakes in a message)

Mistakes in DNA Cell make mistakes in replication, and

transcription

Most often these mistakes are fixed

When these mistakes aren’t fixed, it causes a mutation.

A permanent change that occurs in a cell’s DNA is called a mutation.

Point Mutation Substitution: A change in just one base pair

Missense Mutation: amino acid is change

Nonsense Mutation: amino acid is changed to a stop codon

Cause translation to terminate early.

Usually leads to proteins that can’t function normally.

Silent Mutation: change codes for same amino acid and cause no change in protein produced.

Frameshift Mutations Causes the reading frame to shift to the left or the right

Insertion: Addition of a nucleotide

Deletion: Removal of a nucleotide

ACGAAATACAGACAT Decide what type of mutation occurred:

ACGAAATAGAGACAT

ACAAATACAGACAT

ACGAAATACAGGACAT

Causes of Mutations Mutations can happen spontaneously

Mutagens: Certain chemicals or radiation that can cause DNA damage

Causes bases to mispair and bond with the wrong base

High-energy forms of radiation, such as X rays and gamma rays, are highly mutagenic.

Sex Cell vs. Somatic Cell Mutations

Somatic cell mutations are not passed on to the next generation.

Mutations that occur in sex cells (gamete cells) are passed on to the organism’s offspring and will be present in every cell of the offspring

Chromosomal MutationsInversion: Piece of chromosome can be

broken off, duplicated, or moved to another chromosome

Fragile X Syndrome Repeat of CGG about 30 times

Causes mental and behavior impairments

Protein Folding and Stability Substitutions also can lead to genetic

disorders.

Ex. Sickle Cell Anemia (caused by a substitution mutation)

Can change both the folding and stability of the protein

Sickle Cell Anemia