DNA/GENE TECHNOLOGY

Chapter 9

Types of Genetic Engineering

• Selective Breeding• GMO’s• Gene Sequencing• Gene Cloning/Pharmaceutical Production• DNA Fingerprinting• Transgenic Organisms• Therapeutic Cloning/Stem Cells• Reproductive Cloning• Gene Therapy• Human Genome Project

DNA fingerprinting

The promise and perhaps perils of embryonic stem cells

• Genetic Engineering – The process and outcome of

making changes in the DNA code of living organisms

• Genetic Technology– The tools and instruments

used and developed for the process of manipulating genes

Engineering vs. Technology

Selective breeding• Produces organisms with

desired traits

• 2 Types – Inbreeding & Hybrids– What traits might breeders want to

select for in these organisms?

Inbreeding• Mating of closely related

individuals

• Ensures that offspring remain homozygous for most traits– Keeps wanted traits in

the breed– Keeps out un-wanted

traits

Inbred Weimeraner Dog

Pure-Bred (inbred) Bulldog

Inbreeding• Does have a high risk of

offspring receiving 2 HARMFUL recessive alleles that were present in the family line– Which means???

• Causes mutations that ALREADY exist to pair at a higher frequency

Hybrids• Usually produce larger, stronger organisms

– AND VARIATION!

• Mixing dominant & recessive keeps out harmful recessive phenotypes– ESPECIALLY IN PLANTS!

HybridsDogs and Ligers and Geep – oh my!Hybridization – Mating of slightly

dissimilar organisms to produce desired combination

Must have same chromosome number, similar structure

Liger Geep – Hybrid of Goat and Sheep

Genetically Modified Organisms: GMOs

• Altering the genetics of plants or animals for human benefit

• One of the first was Bt cotton:– Bacterial gene from

Bacillus thuringiensis was put in cotton

• Made it toxic to insects

• Specifically the Boll Weevil

GMO Cotton (contains a bacterial gene for pest resistance); 80% of all cotton

Standard Cotton

Genetically Modified OrganismsGMOs

• Altering the genetics of plants and animals for human consumption– Polyploidy – chemicals disrupt meiosis – bigger fruit

or seedless fruit

Genetically Modified OrganismsGMOs

Fourteen month-old genetically engineered (GMO) salmon (left) and standard salmon (right).

Transgenic organisms• Organisms with genes from other species• Ex: Mice with jellyfish gene – will glow!!!• Benefits of transgenics:

– Gene function determination– Medical studies, drug trials– Creation of medical proteins/drugs – Hybrid organisms/GMO’s

• EX: Human chemotherapy drug in chickens

Transgenic vs. CloneTransgenic Organisms have genes inserted from

another organism

Cloned Organisms have the exact same DNA as another organism

Tobacco Plant with firefly gene Dolly the cloned sheep

Cloning

Types of cloning

• Gene cloning– Inserting just one gene into org to copy

• Therapeutic cloning– Stem cells new cells/organs

• Reproductive cloning– Creating an entire organism

Therapeutic Cloning/Stem Cells• Stem cells –

undifferentiated cells • Can develop into any

type of cell in body• Embryonic* – most

potential for success– But regulated by law

• Bone marrow/Spinal – some potential for success

Possible clone use…

• Cloning new stem cells to repair tissues

Stem Cells are Found in the Adult, but the Most Promising Types of Stem Cells for Therapy are Embryonic Stem Cells

Therapeutic Cloning/Stem Cells

Therapeutic cloning- cloning of specific cells/tissues/organs; not whole organism

Some Thorny Ethical Questions

Is it ethical to harvest embryonic stem cells from the “extra” embryos created during in vitro fertilization?

Are these masses of cells a human?

Gene Cloning

• Cloning a single GENE in an organism…

• Organism copies gene through replication

• Produces proteins

Reproductive Cloning• Making an identical organisms

genetically speaking • Steps:

– 1. Take DNA (nucleus) from existing org.– 2. Take egg cell and replace its nucleus

(DNA) with existing org. DNA (nucleus)– 3. Allow egg cell to develop into offspring– 4. Offspring will have same DNA as

existing organism• Why should we clone?

– Food industry?– Endangered species?

• Problems/Ethics?

Dolly I and Dolly II – her clone

(Science (2002) 295:1443)

Reproductive Cloning - Pet Cloning?

University of Texas 2002 –Success Rate of 1/87 embryos

Significantly, Carbon Copy is not a phenotypic “carbon copy” of the animal she was cloned from

Environmental factors and proteome interactions cause phenotypic differences

Nature vs. Nurture argument FYI – cost $ 3.7 million

Clones

Possible clone use…

• Clone successful plants

Gene Therapy

• Vectors-carry DNA from one source to another. Useful in gene therapy and making recombinant DNA– A virus is often used

• Knock out the viral DNA and add desired gene to ‘infect’ patient

Gene Therapy• Restriction enzymes cut out

‘normal’ gene from genome sample

• Take out viral DNA and add ‘normal’ human gene to virus

• Viral vector infects patient with ‘normal’ gene to replace mutated one

• Normal gene inserts into patient’s DNA and now produces proper protein/trait

• Ex: normal CF gene being infected into a cystic fibrosis patient

Creating Recombinant DNA

1. Cut (cleave) DNA from one organism with a restriction enzyme

2. Insert (splice) the wanted genes (DNA) from another organism (Fig 13.4)

• RESULT:– RECOMBINANT DNA =

TRANSGENIC ORGANISM

• Usually done on plasmid DNA = (bacterial) circular DNA

What if there isn’t enough DNA in the sample?

• Tiny amounts of DNA can be amplified by a technique called PCR (polymerase chain reaction)

PCRMaking enough DNA to read

• Three – step amplification cycle– Cycles of heating and cooling– Causes DNA to separate

(DENATURE) and then come back together (ANNEAL)

– Use DNA Polymerase

• Generates MORE DNA a certain size of DNA fragment (from one sample)

PCR

Now that we have enough DNA…

What’s next?

CUTTING DNARestriction Enzyme

• We will use TA-ase, an imaginary enyzme, to cut our DNA

• Sample DNA strand

CTGGCTAGGCTACCATGCCCGTAAAT

Restriction Enzymes

CUTTING THE DNARestriction Enzyme

• We will use TA-ase, an imaginary enyzme, to cut our DNA

• Sample DNA strand CTGGCTAGGCTACCATGCCCGTAAAT

CTGGCTA GGCTA CCATGCCCGTA AAT

SEPARATING THE DNA Gel Electrophoresis

• Electricity separates fragments by size in a gel

• Largest fragment travels least– Smallest the most

Gel Electrophoresis

DNA is slightly (-), thus it will move towards (+)

Here are our DNA fragments

• Which one will travel fast and far?– WHY?

• Which one will travel slow and short?– WHY?

CTGGCTA GGCTA CCATGCCCGTA AAT1 2 3 4

SEPARATING THE DNA Gel Electrophoresis

CCATGCCCGTA

CTGGCTA

GGCTA

AAT

SEPARATING THE DNA Gel Electrophoresis

RESULTS…DNA “Fingerprint”• Can be used to ID persons• Very effective means of:

– Criminal identification & exclusion

– Paternity cases– Missing persons

• Entire DNA is not used, only portions known to differ from individual to individual

• Gel is sometimes called an “autoradiograph” or “autorad”

M = Marker (control) DNA

DNA FINGERPRINT:THE LAB BASICS (A SUMMARY)

• PCR = to increase the amount of DNA

• Restriction enzymes = to cut the DNA into different sized fragments

• Gel Electrophoresis = to separate fragments according to size

• CONCLUSION = Try to match fragments from different samples

STEP 4 = READINGHow do you read a DNA

fingerprint?

Victim’s DNAfinger print

STEP 4 = READINGHow do you read a DNA

fingerprint?

Victim’s DNAfinger print

A B C D E

Which sample is a match?,

STEP 4 = READINGHow do you read a DNA

fingerprint?Victim’s DNAfinger print

A B C D E

Which sample is a match?,

STEP 4 = READINGHow do you read a DNA

fingerprint?Victim’s DNAfinger print

C

Which sample is a match?,

ANALYZING DNA SAMPLES

• Let’s try some…

DNA FINGERPRINTING

• Comparing different samples of DNA

Paternity Testing

• Not just matching evidence to suspect…

• Gene cloning (in a bacterium) protein synthesis analysis of amino acid sequence

• Gene “knockout” in “lab” animals• Comparative sequences in people with

disease/without

Gene Sequencing – How do we know what a gene does?

Gene Sequencing – How do we know what the DNA is?

• Take gene cut by restriction enzymes• Put gene into bacteria/rat to see what protein

does• Use florescent DNA probes to bind to

complementary sequences• Ex: Glowing ACT DNA probe would attach to

TGA DNA & id that sequence•

Human Genome Project

• Linkage map– Location of genes on a chromosome

• Sequencing– Entire human genome was completed in 2003– “HUMAN GENOME PROJECT”– 30,000 plus genes

• Applications:– Diagnosis of disorders– Gene therapy

Huntington’s Disease Pedigree

• An application of the Human Genome Project• Sequencing the Human Genome has allowed

us to genetically test for genes causing diseases

• Huntington’s is caused by a DOMINANT mutation on chromosome 4 which has an increased number CAG DNA triplet repeats compared to the normal allele