Upload
frederick-cain
View
216
Download
0
Tags:
Embed Size (px)
Citation preview
DNA Subway
Green Line Overview
Growth of Sequence Read Archive (SRA)2.2 Quadrillion bases
Log
Scal
e!
http://www.ncbi.nlm.nih.gov/Traces/sra/
DNA SubwayGreen Line: Transcriptome analysis
Green Line
• Examine RNA-Seq data for differential expression or annotate sequenced genome
• Use high-performance computing to analyze complete datasets
• Generate lists of genes and fold-changes; add results to Red Line projects
• RNA Collected from multiple samples/time points
• Library prep and sequencing
• QC of Reads
• Assembly and mapping
• Abundance estimation
RNA-Seq OverviewGreen Line: Differential expression
Next Generation RNA-Sequencing for Undergraduates
2. Isolate RNA
1. Design experiment(Differential expression or genome annotation)
3. Sequence RNA 4. Analyze RNA sequence datasets using the Green Line of DNA Subway and other bioinformatics tools
5. Follow-up validations
Working Group Faculty Projects 2014
Agnes Ayme-Southgate College of Charleston, SC Gene expression changes in Apis melifera flight muscle during life-stage transitions
Judy Brusslan California State University, Long Beach, CA Gene expression changes during leaf development and senescence in Arabidopsis thaliana
Raymond Enke James Madison University, VA Gene expression changes during retina development in Gallus gallus
Shaye Lewis Prarie View A&M University, TX Gene expression in caprine testes during juvenile development to puberty
Irina Makarevitch Hamline University, MN Gene expression changes in maize in response to cold stress
Judith Ogilvie Saint Louis University, MO Gene expression changes in the retinas of mice with retinitis pigmentosa
Jeremy Seto New York City College of Technology – CUNY, NY Gene expression changes during differentiation of rat pheochromocytoma line cells (PC12) to a neuronal-like phenotype
Carrie Thurber Abraham Baldwin Agricultural College, IL Gene expression changes during seed abscission in Sorghum bicolor
George Ude Bowie State University, MD Transcriptome analysis of floral inflorescence genes in banana/plantains
Deirdre Vaden Prairie View A&M University, TX Gene expression changes in peripheral blood mononuclear cells from hypertensive rats treated with captopril
Scott Woody University of Wisconsin, WI Gene expression changes upon gibberellic acid exposure in Brassica rapa (Fast Plants, self-compatible) gibberellic acid (gad) mutants
RNA-Seq OverviewGreen Line: Differential expression and genome annotation
Biologically rich Biologically rich
Technical challenge(bottleneck)
Molecular techniques
Sequencing technologies
Expression plots
Validation experimentsImage from Advanced Sequencing Technologies & Applications http://meetings.cshl.edu/courses.html
RNA-Seq OverviewGreen Line: Technical challenges
1. Crowded field of choices
RNA-Seq OverviewGreen Line: Technical challenges
2. Bioinformatics skill level
@SRR070570.4 HWUSI-EAS455:3:1:1:1096 length=41CAAGGCCCGGGAACGAATTCACCGCCGTATGGCTGACCGGC+BA?39AAA933BA05>A@A=?4,9#################@SRR070570.12 HWUSI-EAS455:3:1:2:1592 length=41GAGGCGTTGACGGGAAAAGGGATATTAGCTCAGCTGAATCT+@=:9>5+.5=?@<6>A?@6+2?:</7>,%1/=0/7/>48##@SRR070570.13 HWUSI-EAS455:3:1:2:869 length=41TGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCA+
Bioinformatician
010011010 1
RNA-Seq OverviewGreen Line: Technical challenges
3. Data and computation
DNA SubwayGreen Line: Transcriptome analysis
• Tuxedo Workflow
• Simple layout
• HPC powered
• Integrated with iPlant Data Store
DNA SubwayGreen Line: Tuxedo Workflow
DNA SubwayGreen Line: HPC through iPlant Agave API
Base Cluster (Dell/Intel/Mellanox):• Intel Sandy Bridge processors• Dell dual-socket nodes w/32GB RAM (2GB/core)• 6,400 nodes• 56 Gb/s Mellanox FDR InfiniBand interconnect• More than 100,000 cores, 2.2 PF peak performance
Co-Processors: • Intel Xeon Phi “MIC” Many Integrated Core processors• Special release of “Knight’s Corner” (61 cores)• All MIC cards are on site at TACC
o more than 6000 installed• 7+ PF peak performance
Max Total Concurrency:exceeds 500,000 cores1.8M threads
Stampede
DNA SubwayGreen Line: iPlant Data Store
Initial 100 GB allocation – TB allocations available
Automatic data backup
Easy upload /download and sharing
DNA SubwayPublic Maize RNA-Seq Dataset
http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?study=SRP010680
DNA SubwayGreen Line: Differential expression
DNA SubwayGreen Line: Differential expression
DNA SubwayGreen Line: Differential expression
DNA SubwayGreen Line: Differential expression
DNA SubwayGreen Line: Differential expression
DNA SubwayGreen Line: Differential expression
DNA SubwayGreen Line: Differential expression
DNA SubwayGreen Line: Differential expression
DNA SubwayGreen Line: Differential expression
DNA SubwayGreen Line: Differential expression
DNA Subway“Power Desktop”
• Intuitive interface to support seamless genome “round trip” for eukaryote of choice• Access high performance computing to analyze whole genome data (RNA-
seq, initially)• Scaffold data to sequenced genomes available in iPlant Data Store• Directly upload RNA-seq reads as biological evidence for genome
annotation using Red Line
The iPlant Collaborative is funded by a grant from the National Science Foundation Plant Cyberinfrastructure Program (#DBI-0735191).