DNA – Life’s Code

Biology 2

The DNA Molecule • When we discussed

mitosis and meiosis we talked about “genes” – DNA is what makes genes

• DNA stands for deoxyribonucleic acid

• It is a molecule that makes up genes and determines the traits of all living things

• All living things contain DNA in their cells

• The structure is similar to that of a ladder

The DNA Molecule

Ladder Upright

Ladder Rung

The DNA Molecule • Six features of the

DNA model• Two main sides (similar to the

ladder) • Sides are made of alternating

sugar and acid molecules • Parts connect the sides

together (similar to the rungs of a ladder) called nitrogen bases

• There are 4 types of nitrogen bases: adenine (A), cytosine (C), thymine (T), guanine (G)

• The four bases join together in certain ways

• The “ladder” is twisted in a spiral

The DNA Molecule• Nitrogen bases:

• Adenine always pairs with thymine

• Guanine always pairs with cytosine

• They fit together similar to that of a puzzle

• All your DNA comes together to form chromosomes

• Remember: chromosomes are found in the nucleus of cells and your body is made entirely of cells

Hoe DNA Works• DNA is a code for life • So, the code determines

if the organism is a plant or animal, is tall or short, have dark or light hair and every other unique thing we see in life

• Example:GAGTGAGGCTTCCTCACTCCGAAG This code

is a code

How DNA Works• The code is read similar

to how you read a sentence

• The code starts on the right and continues reading until a stop code is reached

• For example: you read and understand each word and when you reach a period (.) you know the sentence is complete.

• The code gives the cell information it needs to function

How DNA Copies Itself to RNA• Think about the ladder

model of DNA again• The ladder breaks apart into

2 sides• A strand of RNA attaches

itself to the DNA and makes a copy of the code – the only difference is RNA does not have the nitrogen base thymine (T), but has uracil (U) which pairs with adenine (A)

• Example:AACGTTT DNAUUGCAAA RNA

How DNA Copies Itself to RNA• The copied mRNA

detaches from the DNA• The DNA closes back up• The mRNA moves out of

the nucleus into the cytoplasm

• The mRNA attaches to the ribosome and gives the information tRNA to make the proteins

Making Proteins • Remember: your cells

have ribosomes, which make proteins & ribosomes are located in the cytoplasm (not the nucleus where the DNA is found)

• DNA codes for the proteins that the ribosomes make

• There has to be a messenger to relay information from the DNA (in the nucleus) to the ribosomes (in the cytoplasm)

Making Proteins • The messenger is called

ribonucleic acid or RNA• Types of RNA

• Messenger RNA (mRNA)• Transfer RNA (tRNA)

• The DNA copies it’s information onto the mRNA and the mRNA travels out of the nucleus into the cytoplasm where the ribosome is and give the information to the tRNA