Upload
rhoda-gordon
View
217
Download
1
Embed Size (px)
Citation preview
DNA
How is the expression of genes controlled in prokaryotes?
What are some ways the expression of genes are controlled in eukaryotes?
What are histones?
DNA Technology
Meet Dolly
Biotechnology
The manipulation of organisms or use of living things as technology
i.e. genetic engineering, manipulating genes for practical purposes
Studying One Gene
If we want to study a particular gene in depth, it is cumbersome to use the entire DNA molecule
Much easier if we can make multiple copies of that one gene to focus on
Gene Cloning
We will first look at the overview of cloning a particular gene, then go into it in detail
The goal is to create multiple copies of a single segment of DNA
Step 1A
Isolate a plasmid from a bacterial cell
Step 1B
Isolate the DNA we wish to clone
Step 2
Insert gene into plasmid
Recombinant DNA
Step 3
Reinsert Plasmid into Bacteria
Recombinant Bacterium
Step 4
Plasmids replicate independently, reproducing the gene of interest
Step 5 / Step 6
Identify the bacterial plasmids that did in fact clone the gene
Use the gene! Can use copies of the gene itself Can use the protein products of the gene
Why Is This Useful?
We can insert genes into other organisms
i.e. in agriculture we can introduce pest-resistance to crops
Alter bacteria to accomplish a task Create proteins for medicines and other uses
Create Human Growth Hormone to treat short kids
Restriction Enzymes
Cut DNA at specific places (recognize target sequences)
Used to combat foreign DNA in nature
Create restriction fragments
Creates the same fragments every time
Sticky Ends
Doesn't cut at the same spot on both strands
Leaves single stranded edges called sticky ends
These two ends can be resealed by DNA ligase
Or new DNA can be inserted between
Recombinant DNA using Restriction Enzymes
DNA
What is a restriction enzyme? What are sticky ends? What is a plasmid? What are some of the uses of genetic
engineering?
A More Detailed Look at Cloning
We use a plasmid containing 2 useful genes
1 – ampicillin resistance
2 – lacz gene Called a cloning
Vector Easy to insert in
bacteria
Restriction Enzyme Targets lacz Gene
A restriction enzyme recognizes and cuts a segment of the lacz gene
Also cuts DNA containing gene of interest into small fragments
Mix Plasmids with Our DNA
Sticky ends of plasmid can base pair with sticky ends of DNA
Also end up with plasmid-plasmid combos and DNA-DNA combos etc.
Seal Plasmid and DNA using DNA ligase
Some Plasmids take in the DNA, some Don't
DNA is inserted in the middle of the lacz gene if DNA is taken by plasmid
Amp gene is intact either way
Introduction of Plasmids to Bacterial Cells
Recall transformation, bacteria will take up plasmids
The bacteria do not have the lacz gene
Some bacteria take in plasmids with our DNA
Some take in unaffected plasmids
Plate the Bacteria
We place the bacteria on a plate containing ampicillin and X-gal
Only bacteria containing the plasmid can grow (the ampicillin resistance allows their survival)
Bacterial Colonies
What Is X-Gal?
X-gal reacts with galactosidase to create a blue product
The product of the lacz gene breaks down galactosidase
If the lacz gene is intact – no blue
If there is foreign DNA then lacz gene is interrupted and bacteria are blue White Blue
Checking our Agar Plate
Blue colonies have taken in foreign DNA in their plasmids
White colonies have the plasmid – but no foreign DNA is in the plasmid and the lacz gene is intact
Isolate Our Gene of Interest
The foreign DNA may not have been the gene we care about!
We must use nucleic acid probe (a short segment of complementary DNA) to find the gene of interest
Attach fluorescent protein to probe
Making the Bacteria Express the Gene
We can express the gene in the bacteria, but sometimes we need to insert a promoter as well
Called an expression vector
The promoter tells the prokaryotic RNA polymerase to transcribe the gene
cDNA
Introns are a pain for prokaryotes
Sometimes it's necessary to make DNA without the introns first
Use reverse transcriptase to make cDNA from mRNA
Genomic Library vs. cDNA library
Collection of all of the segments of the DNA that is separated by restriction fragments
The library will have multiple copies of each gene
Some genes are split between two segments
cDNA library contains only the segments that code for a gene
In fact only codes for genes transcribed – useful for studying genes expressed in brain cells for example
Polymerase Chain Reaction (PCR)
Allows us to quickly make many copies of a segment of DNA
Very specific, due to use of specific primers that recognize each gene
Need only small amount of DNA to replicate
PCR
Heat the DNA to separate the strands
Cool strands and allow DNA primers to bind to DNA
DNA polymerase synthesizes new strand
Repeat
Why is PCR So Amazing?
From a small amount of DNA we can make millions of copies
Important in solving crimes with DNA, determining paternity etc.
Useful for a lot of other biotech processes
Gel Electrophoresis
Separates DNA, Proteins etc. based on charge and size
For DNA, all molecules have the same charges, so separates DNA by length of strand
Restriction Fragment Analysis
Cut pieces of DNA with restriction enzymes
The same DNA with the same enzymes will produce the same fragments every time
Show up as bands on gel electrophoresis
Southern Blotting
The full genome has too many genes to use simple gel electrophoresis (get too many bands)
But we can use Southern Blotting to identify only the genes we care about
Southern Blotting
We add radioactively labelled DNA to our gel electrophoresis
We can figure out A) if the DNA segment we are interested in is present and
B) What size fragment the segment is located on
C) How many times the gene is present
Restriction Length Polymorphisms (RFLPs)
Recall that human's have DNA that is 99.9% similar
So how can we compare DNA? By identifying locations in the genome where
people often differ If two people differ in a nucleotide that is part of
a restriction site, then only one of the people will have their DNA cut by that restriction enzyme
RFLPs
Finding Genes in Genomes
In situ hybridization Use a radioactive
probe that can base pair with the gene
i.e. we can see if a gene from a mouse is present in humans
The Human Genome Project
Working version of genome worked out in 2000
“Final Draft” in 2003 Not a single individual
– there are many places where nucleotides differ
Available on the Internet
Genetic Linkage Mapping
As discussed earlier, we can figure out the order of genes by the frequency of recombination
Genes that are further apart are more likely to be separated during crossing over
Getting the Whole Genome
Cut the genome into tons of little pieces
These pieces are identifiable restriction fragments
Then order fragments by how they overlap
Must first clone DNA so we have copies
Chromosome Walking
Each segment overlaps, so we can use the end of one segment to probe for the next segment
DNA Sequencing (The Basics)
We take a strand of DNA and make copies of it The DNA is added to a solution containing
everything necessary for DNA replication Primer, DNA Polymerase, A, T, G and C
nucleotides One more ingredient in each batch
Dideoxy Nucleotides!
Special nucleotides that are missing another OH group
ddA nucleotides are added to the DNA
If a dd nucleotide is added DNA replication ends
No phosphodiester bond can be made
Each dd nucleotide is labelled with a fluorescent color
Synthesize New DNA
The DNA is replicated, BUT replication ends as soon as a dd nucleotide is added
We end up with a bunch of different length strands, each labelled by the dd nucleotide on the end
DNA Segments Are Separated By Size
DNA is run through a machine – smaller segments get through faster
A computer reads the color at the end
Tells us the order of the nucleotides
Much Faster than the Sanger Method
This revolutionized the Human Genome Project Sanger method – have 4 batches, introduce 1
dd nucleotide to each batch Use gel electrophoresis 4 separate times to
determine the length of the strands ending in A, C, G and T
We Can Use cDNA to Identify Which Genes Are Expressed
Separate genes (by gene cloning and hybridization)
Make cDNA and label it Mix cDNA and each gene to see if they match Can tell which genes are in that cDNA
Microassay
Practical Applications
Identify diseases Gene Therapy Pharmaceuticals Forensics Genetic Engineering Nitrogen fixation and other agricultural uses Understanding our blueprints!
Identifying Diseases
Using PCR we can identify a small amount of a virus in a blood sample
Can examine a person's genes to look for diseases
i.e. Huntington's disease
Gene Therapy
Correct genetic disorders by changing genes or inserting genes
Can we change a person's genes using retroviruses?
Ethical dilemma?
Pharmaceuticals
Make hormones and proteins using bacteria
Make vaccines by altering viruses
Antisense nucleic acids – prevent translation of mRNA of cancer and viruses?
Forensics
We can match up DNA found at a crime scene with suspect's DNA
Used both to help prove guilt and innocence!
Ethical dilemma – should we store DNA of convicted criminals?
Agricultural Uses
Bovine Growth Hormone to raise milk production
Can speed up growth of animals
Easier to manipulate genes in plants
Can introduce pest resistance, or change nutrition
Ti Plasmids in Plants
Certain plants can have genes enter their chromosomes via Ti plasmids from a specific bacteria
Plants can be regenerated from one cell, making it much easier to introduce new genes to the entire plant
Gene CloningRestriction Enzyme
Plasmid
Restriction Enzyme Cuts Plasmid
Sticky Ends
Same Restriction Enzyme Cuts DNA
Mix Plasmid and DNA
Make Bacteria Take Up Plasmid
Place Bacteria on Agar Plate
Bacteria with No Plasmids Are Killed By Ampicillin
ampicillin
Bacteria with DNA Turns Blue
Our DNA
Bacteria and Plasmids Replicate
DNA Libraries
DNA Libraries
Genomic(all DNA)
cDNA(DNA expressed)
Then we make copies!
Isolate Cells and Collect mRNA
Cells from Brain Tissue
RNA Polymerase
pre-mRNA
SpliceosomemRNA
Make cDNA out of RNA
mRNAReverse Transcriptase
DNA
DNA Polymerase
cDNA
DNA Libraries
Genomic(all DNA)
cDNA(DNA expressed)
Restriction Fragment Length Polymorphism
AAAATTTTAAAATTTTAAAATTTT TTTTAAAATTTTAAAATTTTAAAA
AAAATTTTAAAGTTTTAAAATTTT TTTTAAAATT TCAAAATTTTAAAA
We find the one spot in the sequence where human's are known to differ. We can then find a restriction enzyme that cuts around that spot
If We Then Place the DNA in Gel Electrophoresis, We Can Tell the
DNA Apart
Southern Blotting
DNA A DNA B DNA C
Red is our gene of interest. We can check if any of the 3 individuals have it and how many times. If we have a sample containing the gene 3 times, we can figure out which person it belongs to
Chop up DNA with Restriction Enzyme
DNA A DNA B DNA C
Use Gel Electrophoresis to Separate Fragments
Use X-Ray to View Only the Gene of Interest
Compare that to our sample DNA to confirm a match!
Chromosome Walking
ACGTTGCATTGCAACGTA Use GCAT as a probe
Chromosome Walking
ACGTTGCATTGCAACGTA
GCATACGTCGATTGCGTATGCAGCTAAC
Use ATTG as probeGATTGCCTGC
CTAACCGACG
We Can Use cDNA to Identify Which Genes Are Expressed
Separate genes (by gene cloning and hybridization)
Make cDNA and label it Mix cDNA and each gene to see if they match Can tell which genes are in that cDNA
Microassay
Fluorescent labelled cDNA from a salivary gland
Practical Applications
Identify diseases Gene Therapy Pharmaceuticals Forensics Genetic Engineering Nitrogen fixation and other agricultural uses Understanding our blueprints!
Identifying Diseases
Using PCR we can identify a small amount of a virus in a blood sample
Can examine a person's genes to look for diseases
i.e. Huntington's disease
Gene Therapy
Correct genetic disorders by changing genes or inserting genes
Can we change a person's genes using retroviruses?
Ethical dilemma?
Pharmaceuticals
Make hormones and proteins using bacteria
Make vaccines by altering viruses
Antisense nucleic acids – prevent translation of mRNA of cancer and viruses?
Forensics
We can match up DNA found at a crime scene with suspect's DNA
Used both to help prove guilt and innocence!
Ethical dilemma – should we store DNA of convicted criminals?
Agricultural Uses
Bovine Growth Hormone to raise milk production
Can speed up growth of animals
Easier to manipulate genes in plants
Can introduce pest resistance, or change nutrition
Ti Plasmids in Plants
Certain plants can have genes enter their chromosomes via Ti plasmids from a specific bacteria
Plants can be regenerated from one cell, making it much easier to introduce new genes to the entire plant
DNA
How can we separate bacteria that took up the plasmid from those that did not? What important gene does the plasmid contain?
How can we separate bacteria that have our DNA in them from those that do not What gene gets interrupted when foreign DNA is
inserted? What is Gel Electrophoresis?