Upload
joleen-moody
View
219
Download
3
Tags:
Embed Size (px)
Citation preview
DNA & Genetics
Biology
Remember chromosomes?
• What are genes?• Made up of DNA and are units of
heredity; unique to everyone• What are traits?• Are physical and unseen characteristics.• Examples: • physical: color of skin or eyes• unseen: blood type or intelligence level
Remember chromosomes?• What are chromosomes?• Carrier of genetic
materials, thread-like fibers found in the nucleus
• They are composed of genes
• What is an allele?• Gene form for each
variation of a trait of an organism. Example: gene for height can express tall or short
DNA structure
• DNA = deoxyribonucleic acid• A nucleic acid, genetic material• Carries the code for all proteins that
make up the human body• Composed of paired nucleotides• Nucleotides contain a phosphate
group, 5-carbon sugar (deoxyribose), and a nitrogen base
DNA structure
• The 4 nitrogen bases of DNA:– Thymine (T)– Cytosine (C)– Adenine (A)– Guanine (G)
DNA structureNucleotide
structures:1 phosphate
group1 5-carbon
sugar1 nitrogen
base
DNA structure
• Structurally pyrimidines pair with purines
• Thymine (T) and Cytosine (C) are pyrimidines
• Adenine (A) and Guanine (G) are purines
• Nitrogen bases are held together by hydrogen bonds
• Guanine (G) pairs with Cytosine (C)• Adenine (A) pairs with Thymine (T)
DNA structure
• Composed of 2 complementary strands
• Complete the following DNA strand:
•TACGTACCGCAGGTAATC•ATGCATGGCGTCCATTAG
DNA
What does DNA look like?
• Double helix• 1st published in
1951• Credited to
Watson and Crick• 1st seen by
Rosalind Franklin, whose pictures were stolen from her lab
DNA Replication
• Process where DNA copies itself• DNA replicates before mitosis• DNA replicates before meiosis I• The 2 strands of a DNA molecule
separate when the hydrogen bonds break. Two complimentary strands form, each using one of the single DNA as a template
DNA Replication
http://video.google.com/videoplay?docid=5595842121339099106&q=DNA+replication&hl=en
http://video.yahoo.com/video/play?p=DNA+replication&toggle=1&cop=mss&ei=UTF-8&b=2&oid=b4115effae59a11e&rurl=www.bioteach.ubc.ca&vdone=http%3A%2F%2Fvideo.yahoo.com%2Fsearch%2Fvideo%3Fp%3DDNA%2Breplication%26toggle%3D1%26cop%3Dmss%26ei%3DUTF-8
Steps of DNA Replication
• Enzyme breaks hydrogen bonds between paired nucleotides
• DNA strand unzips• Free nucleotides move in and bond with
complementary pairs on unzipped strands of DNA
• Enzyme bonds the newly paired nucleotides together
• 2 exact copies of the original DNA strand are produced
Steps of DNA Replication
• Replicate the following DNA strand:
•TACGTACCGCAGGTAATCATGCATGGCGTCCATTAG
DNA Replication
RNA structure
• RNA is produced from a DNA strand• What is RNA?• Ribonucleic acid• Consists of 1 strand of nucleotides• RNA nucleotides have 1 phosphate
group, 1 5-carbon sugar (ribose), and 1 nitrogen base
RNA structure• The 4 nitrogen bases of RNA:
– Uracil (U)– Cytosine (C)– Adenine (A)– Guanine (G)
RNA structure
• Nitrogen bases are held together by hydrogen bonds
• Guanine (G) pairs with Cytosine (C)• Adenine (A) pairs with Uracil (U)
Compare DNA and RNA
DNA:• 2 strands• Deoxyribose sugar• Phosphate group• 4 nitrogen bases:
adeninethymineguaninecytosine
RNA:• 1 strand• Ribose sugar• Phosphate group• 4 nitrogen bases
adenineuracilguaninecytosine
Types of RNA
• Messenger RNA – mRNA: carries sequence of nucleotides that code for protein from nucleus to ribosomes
• Transfer RNA – tRNA: picks up individual amino acids in the cytoplasm & carries them to the ribosomes
• Ribosomal RNA – rRNA: found in ribosomes, helps bind mRNA and tRNA together during translation (protein synthesis)
Transcription: DNA into RNA
• Enzymes break hydrogen bonds in DNA strands
• Unzipped strand of DNA gets paired with free RNA nucleotides
• RNA nucleotides bond together• Enzymes break hydrogen bonds
between DNA and RNA strands.• RNA strand becomes mRNA and
leaves the nucleus
Transcription: DNA into RNA
mRNA• Composed of a codons• A codon is a series of “3” letters or bases
that make up the code of mRNA• Codons are the “recipe” for making all
amino acids in the body• Every strand of mRNA starts with the
codon AUG or the start codon – starts protein synthesis. There is only 1 start codon
• Every strand of mRNA ends with a terminator or “stop” codon – stops protein synthesis. There are 3 stop codons.
Translation of mRNA
• Translate the following mRNA into amino acids using the Universal codon chart
• AUGAGGGCUCGAUGA• MET-ARG-GLY-ARG-STOP
Universal codon chart
What does mRNA do?
• Brings the code for protein production and assembly to the ribosome
• At the ribosome the code in the mRNA is translated into amino acids
• mRNA codons enter the ribosome• transfer RNA or tRNA brings the
complementary base pairs or the anti-codon - to the ribosome from the cytoplasm
• A protein is produced when the mRNA codon and the tRNA anti-codon bond
Translation