Dna Genes Chromosomes 2011[1]

7/31/2019 Dna Genes Chromosomes 2011[1]

1/65

INTRODUCTION

Genetic diseases occur because of mutations in DNA. Many of

these mutations affect the repair of other mutations that occur

during DNA replication or at other times, which in turn affect

the flow of genetic information from DNA to RNA(transcription and processing) and from RNA to protein

synthesis (translation). Many of these mutations also affect the

structures of the resulting proteins, affecting their functions.


2/65

THE FLOW OF GENETIC INFORMATION

DNA RNA PROTEIN

DNA

1

2 3

1. REPLICATION (DNA SYNTHESIS)2. TRANSCRIPTION (RNA SYNTHESIS)3. TRANSLATION (PROTEIN SYNTHESIS)


3/65

DNA Structure and Chemistry

a). Evidence that DNA is the genetic informationi). DNA transformation know this termii). Transgenic experiments know this processiii). Mutation alters phenotype be able to define

genotype and phenotype

b). Structure of DNAi). Structure of the bases, nucleosides, and nucleotidesii). Structure of the DNA double helixiii). Complementarity of the DNA strands

c). Chemistry of DNAi). Forces contributing to the stability of the double helixii). Denaturation of DNA


4/65

DNA transformation experiments show that DNA is the carrier of the genetic

information. These experiments have been carried out both in vivo (in animals) and

in vitro (in cell culture). The in vivo experiments were carried out by injecting mice

with both a heat-killed virulent strain of Streptococcus and a non-heated, non-

virulent strain of Streptococcus. The experiments showed that something (DNA)from the heat-killed virulent strain of Streptococcus was able to alter the (still

viable) non-virulent strain, converting some of the cells to virulent bacteria and

killing the host. We now know that purified DNA confers this virulence. In vitro

experiments have shown that purified DNA from Type S (smooth colony) Strep

cells is able to be taken up by Type R (rough colonies) Strep cells. The process of

getting functionally active DNA into cells is called DNA transformation.Transformation by Type S DNA alters the "genotype" of host cells, since new

genes are introduced into these cells thus altering their genetic constitution. The

expression of this Type S DNA changes the "phenotype of the transformed cells,

making their colonies look "smooth" instead of "rough. Genotype is an organisms

genetic constitution. Phenotype is the observed characteristics of an organism as

determined by the genetic makeup and the environment.


5/65

Transgenic experiments, which are usually

carried out in mice, involve the transfer of a

specific gene into the nucleus of a fertilized

egg. The gene integrates randomly into

chromosomal DNA and can be engineered to

be expressed in every cell, or only in certain

cells at certain times. For example,

introduction of the growth hormone gene into

transgenic mice alters their genotype and

confers a phenotype characterized by increase

growth and therefore size. Transgenic

experiments show that specific phenotypic

traits can be conferred by specific genes, and

thus that DNA is the carrier of genetic

information. Other types of transgenic

experiments involve mutation of specific

genes in the mouse to determine the functionsof those genes and to create mouse models of

human genetic disease. The mutation of a gene

in a transgenic mouse that eliminates the

gene's function, is called a knockout mutation

and the mouse carrying that mutation is called

a knockout mouse.


6/65

Phenotypic differences between individuals are due in large

measure to differences between genes. Evidence suggests that at

least one-third of our genes are polymorphic, in other words that

there are differences in the nucleotide sequences in one-third of

our genes when these genes are compared from one individual to

another individual. It is most likely that these differences

occurred by mutation of DNA over many hundreds of thousands

of years of human evolution. It is also clear that new DNA

mutations give rise to phenotypic differences between individuals,the most dramatic being those that give rise to genetic diseases.

All of this evidence indicates that DNA is the carrier of the

genetic information. Genetic differences between individuals can

have a myriad of clinical implications. Some inherited differences,

which may be less severe, can confer a predisposition to certain

medical problems. Other examples are individual rates of aging orindividual rates of drug metabolism, both of which probably have

an underlying genetic basis. More severe genetic differences can

be the causes of debilitating inherited diseases.


7/65

Thymine (T)

Guanine (G) Cytosine (C)

Adenine (A)

Structures of the bases

Purines Pyrimidines

5-Methylcytosine (5mC)


8/65

Be familiar with the structures of the purine bases, adenine (A)

and guanine (G); and the pyrimidine bases, thymine (T) and

cytosine (C). A common base modification in DNA results from

the methylation of cytosine, giving rise to 5-methylcytosine

(5mC). As we shall see subsequently, 5mC is highly mutagenic.

It is believed that this methylation functions to regulate geneexpression because 5-methylcytosine (5mC) residues are often

clustered near the promoters of genes in so-called "CpG islands.

(Along one strand of DNA the nucleotides are sometimes

indicated by the base followed by a phosphate or p such as

ApTpCpCpGpApCpTpGpGp - this sequence contains one CpG

site.) The problem that arises from these methylations is that

subsequent deamination of a 5mC results in the production of

thymine, which is not foreign to DNA. As such, 5'-mCG-3' sites

(or mCpG sites) are "hot-spots" for mutation, and when mutated

are a common cause of cancer.


9/65

[structure of deoxyadenosine]

Nucleoside

Nucleotide


10/65

This table lists the common bases and theircorresponding names when in the nucleoside or

nucleotide form. Hypoxanthine (inosine) is seen in

DNA following deamination of adenine

(adenosine). It is also seen in transfer RNA as a

common, functionally important posttranscriptionalmodification. Uracil (uridine) is found in RNA,

instead of thymine (thymidine), which is specific

for DNA.


11/65

Nomenclature

Purines

adenine adenosineguanine guanosine

hypoxanthine inosine

Pyrimidinesthymine thymidinecytosine cytidine

+ribose

uracil uridine

Nucleoside NucleotideBase +deoxyribose +phosphate


12/65

When a base, such as adenine, is linked to a deoxyribose sugar

through a glycosidic bond, the structure is a nucleoside, in this

case deoxyadenosine. The deoxyribose sugar lacks a hydroxyl

group on the 2' carbon, hence deoxy. This is in contrast to the

presence of a hydroxyl at that position in the ribose sugar found

in RNA. When the deoxyribose sugar is phosphorylated, on

either the 3' or the 5' position (or both), the structure is a

nucleotide, in this case deoxyadenosine-5'-phosphate. The

precursors of DNA synthesis are deoxynucleoside-5'-

triphosphates or dNTPs.


13/65

polynucleotide chain

3,5-phosphodiester bond

ii). Structure of the

DNA double helixStructure of the DNApolynucleotide chain

5

3


14/65

A-T base pair

G-C base pair

Chargaffs rule: The content of A equals the content of T,and the content of G equals the content of Cin double-stranded DNA from any species

Hydrogen bonding of the bases


15/65

The DNA double helix requires that the two

polynucleotide chains be base-paired to each other. This

slide shows an adenine-thymine (A-T) base pair (which

is the A and which is the T?); and a guanine-cytosine(G-C) base pair (which is the G and which is the C?).

Because of base pairing, the polynucleotide chains in

double-stranded DNA are complementary to each other.


16/65

Double-stranded DNA

Major groove

Minor groove

5 3

5 33 5B DNA


17/65

This slide shows double-stranded DNA,

which is composed of two base-paired,

complementary polynucleotide chains. Base-

pairing between the complementary strands

is required for two important functions of

DNA: 1) DNA replication involves an

unwinding of the double helix (right)

followed by synthesis of a complementary

strand from each of the unpaired template

strands, and 2) DNA serves as a template for

RNA synthesis by utilizing the information inone strand to code for a complementary RNA

strand.


18/65

DNA in the "B" form has a major groove and a minor groove, and has 10 basepairs per one turn of the double helix. DNA that is overwound or underwound,

with fewer than or more than 10 base pairs per turn, is said to be "supercoiled".

It should also be noted that the complementary strands in double helical DNA

are antiparallel with respect to each other. Each polynucleotide chain has a 5' end

and a 3' end. Deoxyribonucleases (or DNases) are enzymes that cleave

phosphodiester bonds. Some are used for constructive purposes, such asproofreading during DNA replication, whereas others are used to degrade DNA.

There are two basic classes of DNases: exonucleases and endonucleases.

Exonucleases remove only the terminal nucleotide, whereas endonucleases

cleave anywhere within the DNA double helix.


19/65

Chemistry of DNA

Forces affecting the stability of the DNA double helix

hydrophobic interactions - stabilize- hydrophobic inside and hydrophilic outside

stacking interactions - stabilize- relatively weak but additive van der Waals forces

hydrogen bonding - stabilize- relatively weak but additive and facilitates stacking

electrostatic interactions - destabilize- contributed primarily by the (negative) phosphates

- affect intrastrand and interstrand interactions- repulsion can be neutralized with positive charges

(e.g., positively charged Na+ ions or proteins)


20/65

Three types of forces contribute to maintaining the

stability of the DNA double helix: 1) hydrophobic

interactions, 2) stacking interactions, and 3)

hydrogen bonding. The base pairs in the interior

of the DNA molecule create a hydrophobic

environment, with the negatively charged

phosphates along the backbone being exposed to

the solvent. Thus, in an aqueous environment, the

double-stranded structure is stabilized by the

hydrophobic interior. Reagents that solubilize the

DNA bases (e.g., methanol) destabilize the double

helix. Stacking interactions and hydrogen

bonding interactions are relatively weak butadditive. Reagents that disrupt hydrogen bonding

[e.g., formamide, urea, and solutions with very

low pH (pH 10)]

destabilize the double helix.


21/65

Electrostatic replusion by negatively charged

phosphates along the DNA backbone destabilize

the double helix. For example, if the phosphates

are left unshielded, as when DNA is dissolved in

distilled water, the DNA strands will separate at

room temperature. Neutralizing these negativecharges by the addition of NaCl (which

contributes positively charged sodium ions) to the

DNA solution will prevent strand separation. In

the cell, the phosphates also interact with

positively charged (magnesium, potassium, or

sodium) ions and with positively charged (basic)

proteins.


22/65

Stacking interactions

Charge repulsion

Charger

epulsion


23/65

Model of double-stranded DNA showing three base pairs


24/65

This slide shows a side view of three

base pairs in the DNA double helix.

Note the base-pair stacking

interactions, the hydrophobic interior,

and the phosphates on the exterior


25/65

Denaturation of DNA

Double-stranded DNA

A-T rich regions

denature first

Cooperative unwindingof the DNA strands

Extremes in pH or

high temperature

Strand separationand formation of

single-strandedrandom coils


26/65

The forces stabilizing the DNA double helix can be overcome by heating the DNA in solution

or by treating it with very high or very low pH (low pH will also damage the DNA, whereas

high pH will simply separate the polynucleotide chains). When the strands of DNA separate,

the DNA is said to be denatured (when high temperature is used to denature DNA, the DNA issaid to be melted). Because some of the forces stabilizing the DNA double helix are

contributed by base pairing interactions, and because A-T base pairs have only two hydrogen

bonds in contrast to G-C base pairs which have three hydrogen bonds, regions of the DNA

duplex that are A-T rich will denature first. Once denaturation has begun, there is a

cooperative unwinding of the double helix that ultimately results in complete strand

separation.


27/65

Electron micrograph of partially melted DNA

A-T rich regions melt first, followed by G-C rich regions

Double-stranded, G-C richDNA has not yet melted

A-T rich region of DNAhas melted into asingle-stranded bubble


28/65

This slide shows an electron micrographtracing of a DNA molecule that is only

partially melted. The thicker regions are

double-stranded and probably more G-C rich.

The A-T rich regions are more prone to

denaturation, and as seen here, form single-

stranded "bubbles."

H h i it


29/65

Hyperchromicity

The absorbance at 260 nm of a DNA solution increaseswhen the double helix is melted into single strands.

260

Absorbance

Absorbance maximum

for single-stranded DNA

Absorbancemaximum fordouble-stranded DNA

220 300


30/65

Hyperchromicity can be used to follow the denaturation of DNA as a function of

increasing temperature. As the temperature of a DNA solution gradually rises above

50 degrees C, the A-T regions will melt first giving rise to an increase in the UVabsorbance. As the temperature increases further, more of the DNA will become

single-stranded, further increasing the UV absorbance, until the DNA is fully

denatured above 90 degrees C. The temperature at the mid-point of the melting

curve is termed "melting temperature" and is abbreviated Tm. The Tm for a DNA

depends on its average G+C content: the higher the G+C content, the higher the Tm.

Note: G+C content, G-C content, and GC content are equivalent terms.

DNA melting curve


31/65

100

50

0

7050 90

Temperature oC

Percenth

yperchromicit

y

DNA melting curve

Tm is the temperature at the midpoint of the transition


32/65

When a solution of double-stranded DNA is

placed in a spectrophotometer cuvette and theabsorbance of the DNA is determined across the

electromagnetic spectrum, it characteristically

shows an absorbance maximum at 260 nm (in the

UV region of the spectrum). If the same DNA

solution is melted, the absorbance at 260 nm

increases approximately 40%. This property is

termed "hyperchromicity." The hyperchromic

shift is due to the fact that unstacked bases absorb

more light than stacked bases.

T i d d t th G C t t f th DNA


33/65

Average base composition (G-C content) can bedetermined from the melting temperature of DNA

50

7060 80

Temperatureo

C

Tm is dependent on the G-C content of the DNA

Percenthyperchromicity

E. coli DNA is50% G-C


34/65

This slide shows the dependence of Tm on average G+C content of three

different DNAs. Under the conditions used in this experiment, E. coli DNAwhich has an average G+C content of about 50%, melted with a Tm of 69

degrees C. The curve on the left represents a DNA with a lower G+C content

and the curve on the right represents a DNA with a higher G+C content. Tm

is dependent on the ionic strength of the solution. At a fixed ionic strength

there is a linear relation between Tm and G+C content.

Genomic DNA, Genes, Chromatin


35/65

, ,

a). Complexity of chromosomal DNAi). DNA reassociationii).Repetitive DNA and Alu sequencesiii). Genome size and complexity of genomic DNA

b). Gene structure

i). Introns and exonsii). Properties of the human genomeiii). Mutations caused by Alu sequences

c). Chromosome structure - packaging of genomic DNAi). Nucleosomes

ii). Histonesiii). Nucleofilament structureiv). Telomeres, aging, and cancer

DNA reassociation (renaturation)


36/65

DNA reassociation (renaturation)

Double-stranded DNA

Denatured,single-stranded

DNA

Slower, rate-limiting,second-order process offinding complementarysequences to nucleate

base-pairing

k2

Faster,zipperingreaction toform long

moleculesof double-strandedDNA

DNA reassociation kinetics for human genomic DNA


37/65

Cot1/2

DNA reassociation kinetics for human genomic DNA

Cot1/2 = 1 /k2 k2 = second-order rate constant

Co = DNA concentration (initial)t1/2 = time for half reaction of each

component or fraction

50

100

0

%D

N

Areassociated

I I I I I I I I I

log Cot

fast (repeated)intermediate(repeated)

slow (single-copy)

Kinetic fractions:

fastintermediateslow

Cot1/2

Cot1/2


38/65

This illustrates the concept of how sequence complexity affects the rate of DNA

reassociation. Imagine two different DNA sequences in a genome, one present

one time per haploid genome (right) and the other present 1,000,000 times per

haploid genome (left). They would be present at a 1:1,000,000 ratio with respect

to each other. If these sequences were mixed together (which is what would

happen if total genomic DNA was isolated for analysis), then fragmented,

denatured and allowed to reassociate, the repeated sequences would reassociate

much more rapidly because it would be much easier for them to find

complementary strands to base pair with. The repeated sequences would

reassociate with a very low Cot1/2 and therefore with a very high k2, consistentwith a rapid rate of reassociation.

106 copies per genome of 1 copy per genome of


39/65

high k2

p p ga low complexity sequence

of e.g. 300 base pairs

py p ga high complexity sequence

of e.g. 300 x 106 base pairs

low k2


40/65

The human genome consists of three populations of DNA: the fast and intermediate fractions

make up about 10% and 15% of the genome, respectively, and the slow fraction makes up

about 75% of the genome. Most of the genes in the human genome are in the single-copy

fraction. As shown in the next slide, repeated sequences can be of two types: those that are

interspersed throughout the genome or those that are tandemly repeated satellite DNAs.

Among the interspersed repetitive sequences are so-called "Alu" sequences, which are about300 base pairs in length and are repeated about 300,000 times in the genome. They can be

found adjacent to or within genes, and as illustrated later, their presence can sometimes lead to

the occasional disruption of genes. The interspersed repetitive sequences also include VNTRs

(variable numbers of tandem repeats), which are comprised of short repeated sequences of

only a few base-pairs, but of variable lengths. They, too, are interspersed throughout the

genome, and are quite useful as landmarks for mapping genes because they are highlypolymorphic (they differ in length or number of repeats from individual to individual).

Type of DNA % of Genome Features


41/65

Single-copy (unique) ~75% Includes most genes 1

Repetitive

Interspersed ~15% Interspersed throughout genome between

and within genes; includes Alu sequences 2and VNTRs or mini (micro) satellites

Satellite (tandem) ~10% Highly repeated, low complexity sequences

usually located in centromeres

and telomeres

2Alu sequences areabout 300 bp in lengthand are repeated about300,000 times in thegenome. They can be

found adjacent to orwithin genes in intronsor nontranslated regions.

1 Some genes are repeated a few times to thousands-fold and thus would be in

the repetitive DNA fraction

50

100

0

I I I I I I I I I

fast ~10%intermediate

~15%

slow (single-copy)~75%

Classes of repetitive DNA


42/65

Interspersed (dispersed) repeats (e.g., Alu sequences)

TTAGGGTTAGGGTTAGGGTTAGGG

Tandem repeats (e.g., microsatellites)

GCTGAGG GCTGAGGGCTGAGG


43/65

. Knowing the complete sequence of the human genome will allow medical researchers to more easily

find disease-causing genes. In addition, it should become possible to understand how differences in

our DNA sequences from individual to individual may affect our predisposition to diseases and our

ability to metabolize drugs. Because the human genome has ~3 billion bp of DNA and there are 23

pairs of chromosomes in diploid human cells, the average metaphase chromosome has ~130 million bp

DNA.

Genome sizes in nucleotide pairs (base-pairs)


44/65

viruses

plasmids

bacteriafungi

plants

algae

insects

mollusks

reptilesbirds

mammals

104 108105 106 107 10111010109

The size of the humangenome is ~ 3 X 109 bp;almost all of its complexity

is in single-copy DNA.

The human genome is thoughtto contain ~30,000 to 40,000 genes.

bony fish

amphibians

Gene structure


45/65

5 3

promoterregion

exons (filled and unfilled boxed regions)

introns (between exons)

transcribed region

translated region

mRNA structure

+1


46/65

This slide shows the structure of a typical human gene and its corresponding messenger

RNA (mRNA). Most genes in the human genome are called "split genes" because they are

composed of "exons" separated by "introns." The exons are the regions of genes that

encode information that ends up in mRNA. The transcribed region of a gene (double-

ended arrow) starts at the +1 nucleotide at the 5' end of the first exon and includes all ofthe exons and introns (initiation of transcription is regulated by the promoter region of a

gene, which is upstream of the +1 site). RNA processing (the subject of a another lecture)

then removes the intron sequences, "splicing" together the exon sequences to produce the

mature mRNA. The translated region of the mRNA (the region that encodes the protein) is

indicated in blue. Note that there are untranslated regions at the 5' and 3 ends of mRNAs

that are encoded by exon sequence but are not directly translated.

The (exon-intron-exon)n structure of various genes


47/65

-globin

HGPRT(HPRT)

total = 1,660 bp; exons = 990 bp

histone

factor VIII

total = 400 bp; exon = 400 bp

total = 42,830 bp; exons = 1263 bp

total = ~186,000 bp; exons = ~9,000 bp


48/65

This figure shows examples of the wide variety of gene structures seen in the human genome.

Some (very few) genes do not have introns. One example is the histone genes, which encode the

small DNA-binding proteins, histones H1, H2A, H2B, H3, and H4. Shown here is a histone

gene that is only 400 base pairs (bp) in length and is composed of only one exon. The beta-

globin gene has three exons and two introns. The hypoxanthine-guanine phosphoribosyl

transferase (HGPRT or HPRT) gene has nine exons and is over 100-times larger than the histone

gene, yet has an mRNA that is only about 3-times larger than the histone mRNA (total exon

length is 1,263 bp). This is due to the fact that introns can be very long, while exons are usually

relatively short. An extreme example of this is the factor VIII gene which has numerous exons

(the blue boxes and blue vertical lines).

Properties of the human genome


49/65

Properties of the human genome

Nuclear genome

the haploid human genome has ~3 X 109 bp of DNA single-copy DNA comprises ~75% of the human genome the human genome contains ~30,000 to 40,000 genes

most genes are single-copy in the haploid genome genes are composed of from 1 to >75 exons genes vary in length from 2,300,000 bp Alu sequences are present throughout the genome

Mitochondrial genome

circular genome of ~17,000 bp contains


50/65

Familial hypercholesterolemia autosomal dominant

LDL receptor deficiency

From Nussbaum, R.L. et al. "Thompson & Thompson Genetics in Medicine," 6th edition (Revised Reprint), Saunders, 2004.


51/65

The rather common (~1 in 500) autosomal dominant disease, familial hypercholesterolemia

(FH), is caused by mutations in the LDL (low density lipoprotein) receptor gene (for more

information about FH, look at pages 218-222 of Thompson & Thompson and at Case 9).

Plasma LDL, which carries circulating cholesterol, is cleared from the serum by binding to the

LDL receptor on liver cells and is internalized. Normal plasma cholesterol levels average

below 200 mg/dl. Individuals who have one defective LDL receptor gene (heterozygous) have

approximately double this amount, and those with two defective genes (homozygous) have

approximately four times this amount. Heterozygous individuals are predisposed to

cardiovascular disease, with males having a 50% risk of myocardial infarction by age 50. There

are many ways that the LDL receptor gene has been mutated rendering it inactive or abnormal.

As shown in the next figure, one mechanism has involved Alu sequences.

LDL receptor gene

Al t t ithi i t


52/65

Alu repeats present within introns

Alu repeats in exons

4

4

4

5

5

5 6

6

6

Alu Alu

AluAlu

X

46

Alu

unequalcrossing over

one product has adeleted exon 5

(the other product is not shown)


53/65

Here you see the structure of the LDL receptor gene (which has 18 exons). Six Alu

sequences are present within three of the introns and two of the exons. Because of the

close proximity of the two Alu repeats located within introns 4 and 5, unequal crossing

over can occur during meiosis. Crossing over (the topic of a future lecture) requires

homologous sequences, which base pair with each other during the process of meiosis.The homologous sequences can be provided by the Alu repeats, which can cause an out-

of-register misalignment and subsequent crossing over deleting exon 5 from one of the

two products of crossing over. This exon 5 in-frame deletion can be inherited and is

currently a cause of FH. This deletion affects the LDL binding region of the receptor.

Thus, while Alu sequences have no known function in our genomes, there are a lot of

them scattered throughout our genomes, within and around genes, and they can be quitedisruptive.

Chromatin structure


54/65

Chromatin structure

EM of chromatin shows presence of

nucleosomes as beads on a string


55/65

Each nucleosome is composed of a core (left) consisting of two each of the histones, H2A,

H2B, H3, and H4, around which the DNA winds 1 3/4 times. The DNA undergoes negative

supercoiling as a consequence of being wound around the core histones. Histones are

positively charged proteins and thus interact with the negatively charged phosphates along the

backbone of the DNA double helix. While the core has 146 bp of DNA, the nucleosome

proper (right) has approximately 200 bp of DNA and also includes one histone H1 monomer

lying on the outside of the structure. Nucleosomes are regularly spaced along eukaryotic

chromosomal DNA every ~200 bp, giving rise to the "beads on a string" structure.

Nucleosome structure


56/65

Nucleosome structure

Nucleosome core (left)

146 bp DNA; 1 3/4 turns of DNA

DNA is negatively supercoiled

two each: H2A, H2B, H3, H4 (histone octomer)Nucleosome (right)

~200 bp DNA; 2 turns of DNA plus spacer

also includes H1 histone


57/65

Histones are small, positively charged proteins that can be extensively modified

posttranslationally, in general to make them less positively charged. Histone

deacetylases (HDACs) are associated with transcriptional repression because they

make histones better able to bind DNA, thus making DNA less accessible to the

transcription machinery. Histone deacetylases are recruited to the chromosome by

transcriptional repressors such as the retinoblastoma (Rb) protein (the subject of

another lecture). Histone acetylases are recruited to chromosomes by transcription

factors (TFs). Histone acetylases reduce the positive charges on histones, causing

them to loosen their grip on the DNA to allow transcription factors to bind.

Histones (H1, H2A, H2B, H3, H4)small proteins


58/65

small proteins arginine or lysine rich: positively charged

interact with negatively charged DNA can be extensively modified - modifications in

general make them less positively chargedPhosphorylationPoly(ADP) ribosylation

MethylationAcetylation

Hypoacetylation

by histone deacetylase (facilitated by Rb)tight nucleosomesassoc with transcriptional repression

Hyperacetylationby histone acetylase (facilitated by TFs)loose nucleosomesassoc with transcriptional activation


59/65

The orderly packaging of DNA in the cell is essential for the process of DNA

replication, as well as for the process of transcription. Packaging of DNA into

nucleosomes is only the first step, foreshortening chromosomal DNA somewhat

by virtue of its being wrapped around the core histones 1 3/4 times. However, if

the average human genomic DNA molecule is ~130 million bp in length, its

length would be an astounding 44 mm. All this DNA X 23 chromosomes has to

packaged in the nucleus of a cell that is too small to be seen with the unaided eye.

Thus, the DNA needs to be packaged in higher-order structures such as shown

above, first into closely packed arrays of nucleosomes called nucleofilaments,which are then coiled into thicker and thicker filaments.

Nucleofilament structure


60/65


61/65

The interphase nucleus contains loosely

packed, filamentous chromosomes, whoseDNA is available for gene transcription.

During each round of cell division, the

chromosomal DNA is replicated and then

condensed into metaphase chromosomes for

segregation into the daughter cells, followed

by decondensation as the interphase nucleus

is formed.

Condensation and decondensationof a chromosome in the cell cycle


62/65


63/65

The chromosome contains a single, long molecule of double stranded DNA, and thus has two

ends. These ends create two problems: they are difficult to replicate and they have a tendency

to fuse with other chromosome ends causing karyotypic rearrangements. To prevent these

problems, chromosomes have protective ends called "telomeres" that are composed of tandemly

repeated, 5-8 bp sequences up to 12 kb in length. In germline cells and in the cells of youngindividuals, telomeres are of maximal length, but with every round of somatic cell division

telomeres get a little shorter. After many rounds of replication and cell division, telomeres

become too short to protect the chromosome ends from fusing with other chromosomes. At this

stage, cells are said to be "senescent." Telomere length is maintained in germline cells by an

enzyme called "telomerase," which can restore any shortening that has occurred. Tumor cells

also have telomerase and thus are immortal and can grow indefinitely.

Telomeres and agingTelomeres are protectivecaps on chromosomeends consisting of short5-8 bp tandemly repeated


64/65

Metaphase chromosome

centromere telomeretelomere

telomere structure

young

senescent

5 8 bp tandemly repeatedGC-rich DNA sequences,that prevent chromosomes

from fusing and causingkaryotypic rearrangements.

(TTAGGG)many

(TTAGGG)few

telomerase (an enzyme) is required to maintain telomere length ingermline cells

most differentiated somatic cells have decreased levels of telomeraseand therefore their chromosomes shorten with each cell division

12 kb


65/65

Class Assignment (for discussion on Sept 9th)

Botchkina GI, et al.

Noninvasive detection of prostate cancer byquantitative analysis of telomerase activity.Clin Cancer Res. May 1;11(9):3243-3249, 2005

PDF of article is accessible on the website

Documents

Dna Genes Chromosomes 2011[1]