DNA and Genes

Thing to find out:

• What is DNA?• The Genetic code• The Human genome• Passing on the genomic

information• Inheritance patterns

Diversity of Life

• All biological systems are composed of the same types of molecules

• Similar organization priciples are used at the cellular level

The Cell

• Basic component of life

• Two main categories, prokarytic and eukaryotic cells

• Differences in the nucleus

• Prokaryotes lack a defined nucleus and have a simplified internal structure

• Eukaryotes have membrane limited nucleus and more complicated internal structure

• Three branches of life

• Genetic material is located to the nucleus• The genetic information is stored in

Deoxyribonucleic acid, DNA • DNA contains all the information needed to

build an individual

What is DNA needed for?•Genetic informationis used for gene expression

•Information of a gene is transferred from DNA and converted to protein

•RNA molecules work as messangers

•Proteins are the biological workers

•Information of the DNA is copied by directing the synthesis of a RNA moleculein a process called transcription

•RNA directs the protein synthesis in a translation

•Protein’s 3D structure determines it’s function

•Information can transfer only in one direction

DNA (Deoxyribo Nucleic Acid)

•DNA is a polymer of nucleotide monomers•2’-deoxyribose sugar•Four bases:

•Adenine, A•Guanine, G•Thymine, T•Cytosine, C

• Together a sugar and a base are called a nucleoside

Sugar part

Base part

Four bases...

Purine bases• Adenine and

guanine• Two carbon

rings

Pyrimidine bases• Thymine and

cytosine• A single carbon

ring

DNA chains• Nucleosides are

joiden together with phospsodiesteri bond

• Sequence of bases vary genetic information

• Chains are extremely long!

DNA Molecules

• DNA molecules are composed of two polynucleotide chains

• Double helix, twisted in right handed way

• Twists a full circle in every 10 bases

•”ladder-structure”

–Bases = steps

–Sugars and phosphates = suporting pilars

•Two nucleotide chains run in opposite directions chemical direction

Complementary Pairing

• Bases interact with other bases• Purines with two carbon rings interact

only with single ring pyrimidines Space between the chains is limited.

• A T• G C• Complementary pairing Vital for

retainins of the genetic information!

•Interaction is stabilized by hydrogen bonds

•A-T bond two hydrogen bonds•G-C bond three hydrogen bonds

The Genetic Code

• Describes how base sequences are converted to protein sequence

• DNA sequence is divided into series of units of three bases a codon

• One codon is spesific to one amino acid ( structural component of protein)

• The four bases can form 64 codons

• 20 amino acids are found from the nature

• Codons hava also alternative functions needed to regulate protein synthesis

Frame 1Met F P P S G S T G L I P P S H F Q A R P L S T L P R Met A P T W L S D I P L V Q  Frame 2C F H L Q V P L G Stop F P P P T F K L G P F Q L C Q E W L P P G S Q T F P W S N  Frame 1G L D Q G N V Stop E P G G S H S W Q S Stop K G P S L K V G G G N Q P S G T Stop R W K H

•Right reading frame is obligatory!!!•Sequence of human HCR gene, which assosiates with psoriasis

•Many different reading frames can be used, but only one is the right one

•Transleate tools can found form the internet

atgtttccac cttcaggttc cactgggctg attcccccct cccactttca agctcggccc ctttcaactc tgccaagaat ggctcccacc tggctctcag acattcccct ggtccaaccc

The right one

Genes

• Genetic information is encoded in the base sequence of the DNA

• A gene : DNA sequence that encodes amino acid sequence of a protein

• Beside the coding area, also other elements are needed control elements and ”empty areas”

• Genes vary a lot in size

•Genes are separeted from each others by sequences which function is unknown

•Only other strand of the DNA carries biological information template strand

•Potential to store biological information is enormous

DNA

chromatin

chromatin fibers

fibers connected to chromosome scaffold

Condenced scaffold

Chromosome

Mutations• Mutations are alterations in DNA sequence

• Many chemical and physiological agents and errors in DNA replication

• Cells can repaire some mistakes

•Once introduced and not repaired, changes in DNA sequence are made permanent by DNA replication

Sequence variations:

Single nucleotide polymorphims:

Alteration of a single base

1. Causes an alteration in the amino acid that the codon codes

2. Does not cause alteration on the amino acid that the codon codes

3. Alters codon in the way that it becomes stop-codon for protein synthesis

• Frameshift mutation: insertion/deletion of bases reading frame is alterered

The Human Genome

The different typesof sequences that make up the total DNA of a human cell

• 3 billion base pairs

• about 30000 genes

• 23 chromosome pares 46 chromosomes

• 25 % of the DNA is gene related

• Only 5 % encodes proteins

• Genes include exons and introns

• Beside coding areas also additional secuences are found

The Human genome...

Two important terms...

Phenotype: The outlook of an organism

Genotype: The genetic information written in the DNA

ATGTTTCCACCTTCAGGTTCCACTGGGCTGATTCCCCCCTCCCACTTTCAAGCTCGGCCCCTTTCAACTCAGAGAGGCGGCTAGACACCCAGAGACCTCAAGTGACCATGTGGGAACGGGATGTTTCCAGTGACAGGCAG

GCCAAGAATGGCTCCCACCTGGCTCTCAGACATTCCCCTGGTCCAACCCCCAGGCCATCAAGATGTCTCAGAGAGGCGGCTAGACACCCAGAGACCTCAAGTGACCATGTGGGAACGGGATGTTTCCAGTGACAGGCA

Genotype

Phenotypes

Genotype

Passing on the genetic information:

• Information passed on in the sexual reproduction• Needed for new characteristics to develope

All somatic cells• 46 chromosomes• Diploid cells, 2n

Sperm cell• 23 chromosomes• Haploid cell, n

Egg cell• 23 chromosomes• Haploid cell, n

Fertilization:

n n

+

Fertilized egg • 2n• 46 chromosomes

Mitosis

• Every cell division • The number of chromosomes does not change

• DNA dublicates before entering the mitosis

• Takes 1-2 hours

Meiosis

• Nuclear division

• Only in gamete formation

• Results formation of the haploid gametosytes

• Mature gametocytes have 23 chromosomes (n)

Humans

•46 chromosomes ( 44 autosomes, 2 sex chromosomes)

•X and Y –chromosomes

•XX female

•XY Male

The chromosome pare:

• A locus• An allele• Heterozygous (Aa)• Homozygous (AA or aa)

• Dominant character: only one allele needed to cause the phenotype (heterozygous)

• Recessive character: both allels needed to cause the phenotype (homozygous)

•We have two copies of each gene, one from the mother and one from the father Genotype

Inherited diseases• DNA mutations are significant in development of diseases

• Inherited diseases are caused by mutations passed from a parent to a offspring

• Monogenic diseases: disease is caused by mutation in one gene

•Multifactioria diseases: disease is caused by co-operative action of different mutations in different genes and environmental factors

• Mendelian inheritance: Presence or absence depends of the genotype at the single locus

Autosomal dominant inheritance:

Autosomal recessive inheritance:

X-chromosome linked recessive inheritance:

X-chromosome linked dominant inheritance: