Different Types of Messenger RNA Editing

  • Published on
    24-Feb-2017

  • View
    213

  • Download
    1

Transcript

  • Annu. Rev. Genet. 1991. 25:718 Copyright by Annual Reviews Inc. All rights reserved

    DIFFERENT TYPES OF MESSENGER

    RNA EDITING

    Roberto Cattaneo

    Institut fur Molekularbiologie I, Universitat Zurich, Honggerberg, CH-8093 Zurich, Switzerland

    KEY WORDS: messenger RNA, RNA processing, gene expression, RNA modification

    CONTENTS

    INTRODUCTION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71 POSTTRANSCRIPTIONAL INSERTION AND DELETION OF NUCLEOTIDES . . . . . 73

    Small RNAs Guide the Insertion and Deletion of Uridines in Mitochondrial Transcripts of Trypanosomes. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73

    3' to 5' Polarity: An Imprecise System. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76 Insertion of Cytidines in Mitochondrial Transcripts of a Slime Mold. . . . . . ............ 77

    COTRANSCRIPTIONAL INSERTION OF NUCLEOTIDES................................ 77 Insertion of Guanosines in a Transcript of RNA Viruses . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . 77 UAA Stop Codons Are Produced by Polyadenylation of Vertebrate

    Mitochondrial Transcripts . . . . . . .. . . . . . . . .. . . . . . . . . . . . . . .. . . .. . . . . . . . .............. 79 Other Cases of RNA Polymerase Stuttering. . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . 79

    CONVERSION OF NUCLEOTIDES .. .. . . . . . ... .. . . . . . ... . . . . . . .... . . . . . . . . . . . . . . . . . . ... . . . . . . . . 80 Tissue-specific Cytidine Deamination Generates a UAA Stop Codon in

    a Nuclear Transcript . . . .... . . . . . . .. ... . . . ....... . . . .. . . . . . .. . . . 80 C to U and U to C Transitions in Plant Mitochondria. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Modifications of Nucleotides. . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82

    SUMMARY AND OUTLOOK . . . . . . . . . . . . . . ..... . . . . . ... .. . . . "". . . . . . . . . . . . . . . . .... . . . . . ..... . . . 83

    INTRODUCTION

    Eukaryotic messenger RNA (mRNA) undergoes various co- and posttranscriptional modifications. The 5' end of the molecule is generally capped, the 3' end polyadenylated, and up to 98% of the internal sequences can be eliminated by splicing. Although capping and polyadenylation generally do not affect the protein coding capacity of mRNA, splicing generally determines or alters its coding potential (2, 72).

    71 0066-4197/91/1215-0071 $02:00

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • 72 CATTANEO

    In the past five years, several editing phenomena that differ from splicing have been found to result in the predetermined modification of the coding potential of certain genes. The RNA editing system of trypanosome mitochondria, involving the posttranscriptional insertion and deletion of uridine (U) residues, attracted considerable interest because it allows generation of sensible RNAs from transcripts lacking features essential for correct translation, such as an initiation signal or an appropriate reading frame (reviewed in 8, 34, 71, 75). In a second mitochondrial system, that of the slime mold Physarum polycephalum, single C residues are added at multiple positions of several transcripts, allowing the reconstitution of reading frames (55; D. Miller, personal communication). The editing systems of trypanosomes and P. polycephalum are both characterized by the insertion (and for trypanosomes, deletion) of nucleotides. Since the trypanosomal RNA editing process is clearly posUranscriptional and the P. polycephalum process apparently so, these two editing types are discussed together.

    Two other types of editing by nucleotide insertion are known, but these processes are believed to be cotranscriptional, or to immediately follow transcription. In certain RNA viruses, one or more guanylate (0) residues are inserted at a precise position of a transcript, allowing the production of at least two, and sometimes three, proteins with a common amino-terminus and different carboxyl-termini (reviewed in 18). Moreover, in transcripts of vertebrate mitochondria UAA stop codons are produced by polyadenylation (3, 59).

    The last two types of RNA editing discussed here are characterized by the conversion of nucleotides. In the mammalian apolipoprotein B mRNA, a cytidine (C) to U conversion results in the tissue-specific generation of a stop codon (reviewed in 67). This is the only editing process currently known to alter the expression of a nuclear gene. Another editing process with farreaching consequences for gene expression was recently discovered in plant mitochondria. The sequences of most, if not all, transcripts of mitochondrial genes of higher plants are altered by C to U changes and, to a lesser extent, by U to C conversions (reviewed in 88).

    This review I aims to describe and compare the different mechanisms of these editing phenomena, which are all characterized by some degree of imprecision, and to discuss the sources of editing information. I also deal briefly with certain mRNA modification systems that do not lead to predetermined alterations of the coding region.

    'Two recent publications have further broadened the impact of mRNA editing: B Sommer et al. 199 1 . RNA editing in brain controls a detenninant of ion flow in glutamate-gated channels. Cell 67: 11-19; B. Hoch et al. 1991. Editing of a chloroplast mRNA by creation of an initiation codon. Nature 353:178-80.

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • mRNA EDITING 73

    POSTTRANSCRIPTIONAL INSERTION AND DELETION OF NUCLEOTIDES

    Small RNAs Guide the Insertion and Deletion of Uridines in Mitochondrial Transcripts of Trypanosomes

    The most thoroughly studied form of mRNA editing occurs in the single mitochondrion, or kinetoplast, of trypanosomes, where editing creates translatable open reading frames by insertion and, to a minor degree, deletion of many U residues (9, 35, 36, 69; Table 1 ). This type of RNA editing occurs in at least seven different mRNAs in each of three trypanosome species: the lizard parasite Leishmania tarentolae, the human parasite Trypanosoma brucei, and the insect parasite Crithidiafasciculata. Table 1 illustrates some characteristics of the trypanosomal type of RNA editing on the example of the RNA for the NADH dehydrogenase subunit 7 (ND7, previously designated MURF3; 51). First, RNA editing can be more or less extensive. In the ND7 transcript of L. tarentolae and C. fasciculata, 25 and 27 Us, respectively, are added. In T. brucei, on the other hand, not less than 551 Us are inserted and 88 deleted. As a result, in T. brucei the genomic region coding for the ND7

    RNA (called cryptogene, as any gene which has to be edited) is short and very GC-rich.

    For the trypanosomal form of RNA editing the longstanding question concerned the source of information. It was only in 1990 that Blum, Bakalara, & Simpson (13) discovered the editing information in RNA molecules 50-80

    Table t ND 7 RNA editing in the mitochondria of three trypanosome species

    Added/deleted Us -at the 5 I end -at the "fs" position

    Initiation codon

    Termination codon

    Localization of the guide RNAs

    adata from (13, 69). b data from (82, 83). C data from (51).

    Leishmania tarentolaea

    2010 510

    non-AUG?

    encoded

    maxicircle

    d extensive editing over most of the gene. e AUG moved out of frame by editing.

    Crithidia fasciculatab

    2210 510

    alterede

    encoded

    maxicircle

    f many other guide RNAs are predicted, but not yet found.

    Trypanosoma bruceic

    70113 48l175d

    created

    created

    minicircle (at least twO)f

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • 74 CATTANEO

    nucleotides long, which they termed guide RNAs (gRNAs). Guide RNAs contain regions of perfect complementarity to the edited mRNA segments, if G:U base-pairing is allowed. This wobble base-pairing implies that gRNAs

    are not functioning as conventional templates, because Us are specified during editing not only by As, but also by Gs.

    The precise mechanism of mRNA editing in trypanosomes is still unre

    solved, but for simplicity, the model first proposed (13) then successively modified by Blum and associates (15) is presented in extenso, followed by discussion of the one controversial part. As shown in Figure l A, in the example of the modification of the pre-edited L. tarentolae ND7 RNA (top)

    by its cognate "5'" gRNA (bottom), the gRNA is supposed to base pair with the cognate mRNA at a region indicated as "3 ' anchor" (right). After this base pairing, the editing reaction begins with the attack by the mRNA at the 3' phosphate of the first mismatched base by the terminal hydroxyl (-OH) group of the gRNA (thick arrow in Figure lA). The gRNA and the mRNAs become covalently linked before or after base pairing of the poly-U tail with the first block of seven guide A or G residues (Figure l B). A second transesterification reaction, beginning with the attack by the terrninal-OH group of the mRNA on the gRNA/mRNA hybrid (thick arrow in Figure l B), results in the transfer of seven (or less) Us to the mRNA. For the transfer of each additional block of Us, at least one transesterification cycle is required. Because the poly-U tail of the gRNA (14) is initially not long enough to provide the 20 U residues necessary for editing, it is assumed that this tail can be elongated (4) during the editing process.

    Indeed, Blum et al (15) demonstrated the existence of chimeric gRNAlmRNA molecules, thus providing direct evidence for specific interactions between gRNAs and the corresponding mRNA. The structure of these hybrid molecules and the structure of resolved intermediates (76) suggests that the transfer of a block of Us often requires more than one transesterification cycle, or, alternatively, that only single U residues are transferred with each transesterification. Deletion of U residues from pre-edited RNAs can also be explained on the basis of transesterifications, in a process having several mechanistical analogies to RNA splicing (15, 22; J. Taylor, personal communication).

    The initial findings of Benne et al (9) and the editing model of Blum et al (13) stimulated the efforts of many groups trying to analyze the complex genome of kinetoplasts, which contains about 10,000 more or less heterogenous short circular DNA molecules interlocked with about 50 maxicircles of a single type (70, 75). Guide RNA genes were soon detected in the kinetoplast DNA of T. brucei and C. Jasciculata, often in a position in the maxicircle virtually identical to that in L. tarentolae (82). In T. brucei and L. tarentolae other potential gRNA genes were found in minicircle DNA (10, 5 1, 62, 77; D. J. Koslowsky, & K. Stuart, personal communication; Table 1),

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • A uAu

    A A G-C C-G G A C A-U

    pre-edited ND7 RNA

    g=;:+

    :2+:7

    3- anchor

    A-U/+

    3

    ! I , ------'-,_ U-A ;; ,,..-- ---.,

    5'-UUAAAUUU UAAAAAGACACUUGUAUAGAU .. //.-3-.II I II I I I I I I * I I

    UUU,OH GUGAACAUUUUUA_5 ' UU A U G

    U A Uu

    A 7 UUu ND7 "5-" gUide RNA

    poly-U tail UUu A A-U uiAl 2 Uill 2 (A)-= U

    W r1b UV2

    3 3 A \hl G U Gu 1

    B UAU

    A A G-C C-G G A C A_U U-A U-A U-A A-U U-A U 5' -UUAAAUUU UAAAAAG,OH--euUUUUUUUACACUUGUA AGAU .. / / . -3'

    uUUU 11111*1111111111 1*11 U AAAAAGAUGUGAACAUUUUUA-5' UUA-U

    ufAl U.W U

    -iJ G

    G G U 'CI

    Figure 1 Model for RNA editing in trypanosomes (13, IS), exemplified by the 5' part of the ND7 transcript. A. The ND7 pre-edited RNA is represented on the top and the ND7 "5'" guide RNA on the bottom. A region of complementarity between these two RNAs is indicated as "3' anchor" (right). Standard complementarity i5 indicated by dashes, G:U base pairs by asterisks. Residues (A's or G's) guiding U insertion are bold and boxed. The poly-U tail, added posttransc riptionally to the gRNA (14), is indicated. For details see text. B. Same as A, but after the first trans esterification and base-pairing of the gRNA 3' terminal5even U residues with the "guide" A and G residues of the first block.

    3 :::0 Z >-

    gj

    Cl

    ........ Ut

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • 76 CATTANEO

    an observation finally hinting at a genetic function of the minicircle DNA.

    RNA editing alone is not always sufficient to explain the mode of synthesis of certain proteins in trypanosome mitochondria. For example, in the ND7 transcript of T. brucei editing creates a novel initiation and a novel termination codon (Table 1, right columns), whereas in L. tarentolae no AUG seem to be available before or after editing, and in C. fasciculata a potential initiation codon is moved out of frame by editing. In the two latter cases translation might be initiated on a non-AUG codon.

    3' to 5' Polarity: An Imprecise System

    Partially edited RNAs, presumably molecules in the process of being edited, generally have edited 3' regions but unedited 5' regions, an observation suggesting that editing starts at the mRN A 3 r end and proceeds towards the 5 r end (35). This suggestion was generally confirmed by extensive studies based on selective peR amplification, and to a lesser extent on direct cDNA cloning, of partially edited transcripts of T. brucei (1, 30; D. 1. Koslowsky, G. J. Bhat, J. E. Feagin, G. R. Riley & K. Stuart, personal communication). However, these studies also confirmed that so-called partially edited RNA can often differ from both the pre-edited and the fully edited RNA version by having no clearcut polarity of editing in a short region separating fully edited from pre-edited segments. This observation was interpreted by Sollner-Webb and associates and Stuart and associates to be incompatible with Blum's editing model (13). Sturm & Simpson (76), on the other hand, also observed editing intermediates "scrambled" at the editing area in transcripts of L. tarentolae. These authors, however, suggested that these molecules are the result of editing cycles based on spurious hybridization of gRNAs with partially homologous RNAs, or on hybridization of gRNAs with the cognate transcript, but not precisely at the correct site.

    Partially edited RNA molecules comprise a substantial fraction of the steady-state levels of RNA, reaching about 4% and 42% in moderately and extensively edited transcripts of L. tarentolae, respectively (76). What (if anything) prevents the translation of partially edited RNAs? In some cases the lack of an AUG codon, but other, more subtle, mechanisms might be at work. Investigation of the mRNAs present in poly somes should indicate whether translated RNAs are more completely edited than the total transcript pool. The existence of unedited and partially edited transcripts, however, opens the possibility that protein isoforms with slightly different function are encoded by these transcripts. Sequence analysis of the proteins produced in trypanosome mitochondria is needed to evaluate the uniformity of the protein products, but such studies are difficult to perform in this system (68).

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • mRNA EDITING 77

    Insertion of Cytidines in Mitochondrial Transcripts of a Slime Mold

    In the transcript coding for the a subunit of the mitochondrial ATP synthetase of the slime mold Physarum polycephalum, insertions of a single C were found at 54 different sites relative to the mitochondrial DNA (55). Recently, sequences of cDNAs and of the genes of two. further proteins produced in mitochondria of P. polycephalum have also been obtained, indicating similarly high levels of C insertion (D. Miller, personal communication). Moreover, not only have 41 single C insertion sites been identified in the mitochondrial small subunit ribosomal RNA, but also three sites where single uridines have been inserted and two sites where two consecutive adenosine residues have been inserted (D. Miller, personal communication). These data extend RNA editing by C insertion into a structural RNA and indicate that not only Cs but also Us or As can be inserted in mitochondrial RNAs of P. polycephalum.

    The mechanism for C insertion has not been studied, but the absence of a short C homopolymer upstream of most of the editing sites makes cotranscriptional insertion by polymerase stuttering unlikely (see below). Furthermore, there is a significant preference for C insertion at sites following a purinepyrimidine dinucleotide, and the C insertion sites are often in third positions of codons, but no specific rule for insertion has been deduced. The relatively regular spacing of the editing events, which in the a subunit of the mitochondrial ATP synthetase are never closer than 1 1 nucleotides nor more distant than 54 nucleotides, (on average 26 nucleotides), is a marked difference to the trypanosome system, whcre the sitcs of U insertion/deletion are clustered. If a guide RNA-like mechanism is postulated for P. polycephalum, at least a dozen relatively large gRNAs would have to serve as guides in the a subunit alone of the ATP synthetase.

    COTRANSCRIPTIONAL INSERTION OF NUCLEOTIDES

    Insertion of Guanosines in a Transcript of RNA viruses

    A case of cotranscriptional insertion of nucleotides leading to the predetem1ined modification of the coding region of a transcript was described in paramyxoviruses, a class of negative-strand RNA viruses comprising the important human pathogens measles and mumps. In the P gene of these viruses, one or more G residues are inserted with a defined frequency at a specific site containing a stretch of purines (as read in the mRNA sense, Table 2). Using this editing mechanism, two (or sometimes three) proteins with a common amino- and different carboxy-terminal regions are produced (20, 81; for review see 1 8).

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • 78 CATTANEO

    Table 2 Editing sUbtypes in paramyxoviruses: efficiency of G nucleotide insertion

    Yirus Editing region

    Measles AUUAAAAAGGGCACAC Sendai ACMAAAAGGGCAUAG BPIY 3" UUMAAAAGGGGUUGG

    Mumps AUUUAAGAGGGGGGCC HPIY 4C AUUUAAGAGGGGGGGA HPIY 2d GUUUAAGAGGGGGGGA Simian virus 5 UUUUAAGAGGGGGGCA

    'bovine parainfluenza virus 3 b direct RNA analysis C human parainfluenza virus 4 d human parainfluenza virus 2

    No. of G inserted (%) Clones 0 I 2 3 4 5 6 analyzed

    3753 - 10 - -- 19

    60 31 I I 3 I 3 161 35 12 9 8 10 10 16

    69 2 17 6 6 -- lSI 15 - 70 5 10-- 20

    60-40---- 5

    55 - 45 - - -- 22

    Reference

    20

    84

    61

    33, 60, 7

    50

    58,74

    81

    RNA editing by G insertion has been demonstrated in seven paramyxoviruses (Table 2, and references therein). Measles and Sendai virus (Table 2, top lines) insert mostly only one G residue after the conserved sequence AAAAAGGG (it is not clear in which position of the G cluster the insertion of the additional G residue(s) occurs). On the other hand, mumps, human parainfluenza virus 2 and 4, and simian virus 5 generally insert two Gs after a longer conserved sequence: UUUAAGAGGGGGG (Table 2, bottom lines). Bovine parainfluenza virus 3 (Table 2, third line) inserts one or more Gs with a similar efficiency after a consensus sequence similar to that of measles and Sendai virus. The viral RNAs whose sequences are shown in the three top lines of Table 2 encode the largest protein (P) in the genome and produce the shorter protein (V) from edited mRNAs, whereas for the four viral RNAs whose sequences are represented on the bottom, the contrary is true. Interes tingly , not just two but three proteins are produced with a common amino- and different carboxy-terminal domains in mumps virus and in bovine parainfluenza virus 3-infected cells (33, 60, 61, 78). On the other hand, a paramyxovirus, human parainfluenza virus 1, produces only one protein from the P gene. In this virus the otherwise strongly conserved cysteine-rich part of the V reading frame is interrupted by several stop codons (56).

    The source of information for editing in paramyxovirus P transcripts is thought to be intragenic, and located around the site of G addition. That editing in paramyxoviruses cannot act in trans was demonstrated by expressing two slightly different versions of Sendai virus P mRNAs in the same cells, either from Sendai virus itself or from a recombinant vaccinia virus; only the transcripts produced by Sendai were edited (84). Regarding the mechanism of paramyxoviral RNA editing, Thomas et al (81) proposed that polymerase stuttering (see below) accounts for G nucleotide insertion, and Vidal et al (85)

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • mRNA EDITING 79

    used an in vitro transcription system from the Sendai virus to study the effects of limited concentrations of the standard nucleoside triphosphates, or of nucleotide analogues like inosine and bromo-uracil, on editing of the P gene transcript. Vidal et al concluded that the sequence surrounding the editing region influences the number of G inserted, possibly by determining the length of the pause of the polymerase on the editing site.

    UAA Stop Codons Are Produced by Polyadenylation of Vertebrate Mitochondrial Transcripts A form of RNA processing that in retrospect can be classified as RNA editing

    was described in 1981 in another mitochondrial system. In the human mitochondrial genome, in which genetic information is coded in an extremely compact form, most transcription termination codons are truncated: only T, or TA, of the TAA termination codon is retained (3). Functional UAA translation termination codons are then created by polyadenylation immediately following transcription (59). A similar genetic organization exists in the mitochondria of several other higher vertebrates, where the compact circular DNA genome ranges in size from 14.5 to 19.5 kilobases (64, and references therein). Note, in this context, that the vertebrate mitochondrial genome is slightly smaller in size than the maxicircle DNA of trypanosomes, and that heterogeneous minicircles are a peculiarity of kinetoplasts. In plant mitochondria (see below), the genome is 10-100 times mo

    're complex than in higher

    vertebrates.

    Other Cases of RNA Polymerase Stuttering

    RNA polymerase stuttering at the onset of transcription results in the addition of G residues at the 5' end of transcripts of the prokaryotic DNA bacteriophage fd (57), and of A residues at the 5' end of transcripts of bacteriophage T4 (48), of a hybrid gene of Escherichia coli (42), and of the eukaryotic DNA virus vaccinia (66). RNA polymerase stuttering on a short poly-U stretch appears to mediate the addition of poly-A tails at the 3' end of transcripts of two families of eukaryotic RNA viruses, Rhabdoviridae and Paramyxoviridae (41, 46).

    In all these cases the coding region of the genes is not modified. In the last two viral families, however, there are indications that RNA polymerases sometimes stutter even before reaching the 3' end of the gene, as discussed above in G insertions in coding regions of Paramyxoviruses. Other events resulting from instances of polymerase stuttering concern the 3' untranslated region of the glycoprotein gene of vesicular stomatitis virus (VSV, a rhabdovirus), where imprecise reiterations of the sequence UUUUUAA have been found in many natural isolates (11). Moreover, neutralization-resistant mutants of human respiratory syncytial virus (RSV, a paramyxovirus) differ

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • 80 CATTANEO

    from the original population by the length of thc adenosine stretches situated in the middle of the protein coding region (37). Poly U-addition, probably due to a stuttering mechanism, was also monitored in mutants of a plant satellite RNA (c. D. Carpenter, P. J. Cascone, & A. E. Simon, personal communication). These last three examples of alterations of the genome (rather than of the transcripts) of RNA viruses indicate that stuttering of RNA polymerase could be a common event during RNA replication. It is likely that in certain other viral or cellular genes polymerase stuttering during transcription causes yet unrecognized editing phenomena: transcriptional slippage was shown to occur in vitro in the early 1960s (23a) and was recently found to occur during elongation of runs of adenine or thymine in Escherichia coli (86).

    CONVERSION OF NUCLEOTIDES

    Tissue-specific Cytidine Deamination Generates a U AA Stop Codon in a Nuclear Transcript

    Messenger RNA editing by base conversion was first documented in 1987 in the apolipoprotein B transcript of mammalian cells (24, 63). This 14-kb long transcript, containing more than 3000 cytidines, undergoes a C to U posttranscriptional conversion at position 6666 to generate a novel stop codon that defines the carboxyl terminus of apo-B48, a major intestine-specific form of apolipoprotein B. In this type of editing too, a key question is how its specificity comes about. Four nucleotides preceding the C and 18 following it are perfectly conserved among man, pig, rabbit, rat, and mouse (79). Twentysix nucleotides have been defined as sufficient to confer efficient editing in vivo to another transcript: 5 preceding the edited C and 20 following it (29). On the other hand, when analogous studies were performed in vitro, efficient editing required at least 55 (32), but was better with 280 (31) nucleotides surrounding the editing site.

    The efficiency of editing in vitro was only slightly reduced (and in some cases even increased) when the three bases preceding, and the five following, the edited C (ATACAATTT) were mutated (25). Among 22 different mutants involving one or more nucleotides, only a double mutation (ATtCtATTT; the mutated bases are indicated in lower case letters) and a deletion (ATACDA ITT) completely abolished editing. Single point mutations generally had little or no effect, and even six point mutations (gctCAAccc) decreased editing activity by only half.

    The mutants produced by Chen et al (25) also provided some clues as to the specificity of the editing reaction: mutants bearing C rcsidues adjacent to the editing site were also often edited at these Cs. The naturally occurring sequence AaACAATcc (nucleotides differing from the original site are indicated in lower-case letters), situated 136 nucleotides downstream of the

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • mRNA EDITING 81

    editing site, was found to be edited in vitro 10-15% as efficiently as the ATACAATTT site (N. Navaratnam & 1. Scott, personal communication). Taken together these data suggest that not only the few nuclcotidcs immediately surrounding the editing site, but also more distal sequences influence editing specificity and efficiency.

    One aspect of apo-B mRNA editing that has been recently clarified is the nature of the conversion process. Bostrom et al (16) and Hodges et al (45) have edited in vitro synthetic apo-B RNA containing 32p-cytidine, and after purification and digestion of the edited RNA to nucleoside 5' -monophosphates found that the edited base was indistinguishable from uridine 5' -32P-monophosphate. Thus, cytidine 6666 is converted to uracil, most likely by a site-specific cytidine deaminase, but transglycosidation has not yet been excluded. Formally ruled out is the activity of any polymerase, which would replace the a-phosphate.

    Purification of the enzymatic activity involved in apo-B RNA editing is also progressing. A 40-kd protein binding around the editing site has been studied (52), and an activity sensitive to proteinase K with an estimated mass of 125 kd has been partially purified (31). Moreover, a 27S complex that might be involved in editing site selection has been described (73). It will be important to establish whether the activities described above contain an RNA component.

    The final aspect of apo-B mRNA editing discussed here is its regulation, and the consequences for protein expression. Clearly, apo-B mRNA is edited not only in the intestine, but with varying degrees of efficiency in other tissues as well (16, 80, 92). In spite of this, and of the fact that many tissues synthesize and secrete apo-BIOO from unedited RNAs, apo-B48 synthesis is confined to the small intestine. Thus regulation of apo-B48 expression must be achieved at least in part at translation.

    C to U and U to C Transitions in Plant Mitochondria

    Editing by C to U conversion has been found not only in a nuclear RNA of mammals but also in many different mitochondrial RNAs of plants. Several groups of investigators (26, 39, 44) have described this type of editing in transcripts of wheat (Triticum aestivum) and of the evening primrose (Oenothera berteriana), and have speculated that editing by C to U conversion explains the apparent coding anomalies of mitochondrial genes of many other higher plants, including maize (Zea mays) and pea (Pisum sativum). It was soon confirmed that editing occurs in maize and pea mitochondrial transcripts (27) and also in transcripts of carrots (Daucus carota; 90), and thus probably in many mitochondrial systems of higher plants.

    The discovery of RNA editing in plant mitochondria invalidated the prcvious speculation that in these systems CGG codes for tryptophan rather than

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • 82 CATTANEO

    for arginine [UGG encodes tryptophan in the "universal" code; see (47) for a recent review on the genetic code]. The full extension and the implications of editing in these systems are just beginning to be appreciated: Walbot (88) recently listed 180 C to U changes occurring in mitochondrial transcripts of wheat or of the evening primrose. It is clear that all mitochondrial proteincoding transcripts examined are edited, that the extent of editing varies from 2 to 23 editings per transcripts, and that up to 13% of the amino acid residues predicted from the DNA sequence can be altered in the mRNA (88). There is also a strong bias (87% in wheat, 81% in the evening primrose) towards editing that alters the amino acid specified by the codon. In addition, two edited sites have been detected in the ribosomal 26S RNA of the evening primrose [Brennicke, cited in (88)]. In conclusion, protein sequences deduced from the mitochondrial genes of higher plants, rather than from cDNAs of the corresponding transcripts, might not be completely correct.

    Other important characteristics of RNA editing in plant mitochondria are the existence not only of C to U, but also of U to C transitions, and the different patterns of editing in different species. U to C conversions have been detected in the cytochrome b and in the cytochrome oxidase subunit II transcripts of the evening primrose (43, 65), and in the cytochrome oxidase subunit III transcript of wheat (40). It is not yet clear whether two different enzymatic complexes are involved in the catalysis of the two directions of conversion. The comparison of editing of homologous sites in genes of different plant mitochondria indicated that a number of homologous sites show differences in editing among species, and certain positions show partial editing within a species (27, 90). Moreover, an intriguing correlation was observed between certain sequence differences among species and differential editing (27).

    Just as in trypanosome kinetoplast editing before the discovery of guide RNAs, the central question now in the plant mitochondrial system is the source of editing information. To examine whether common structural determinants could be defined near the editing sites, nucleotide frequencies in DNA for a distance of 10 positions both upstream and downstream of 61 fully edited positions from different genes were computed, but only a weak "TCR" consensus, where C is the editing site and R a purine, could be found at 43% of the editing sites considered (27). Nor could higher-ordcr RNA structures be defined around the edited Cs. Two alternative hypotheses, namely that the information might reside in separate and multiple nucleic acid templates or "guides", or that RNA regions of the mRNA itself fold back and somehow direct editing at specific sites, deserve careful consideration.

    Modifications of Nucleotides

    Modification of messenger RNA in eukaryotic cells is less extensive than in transfer and ribosomal RNA, where many different types of modified bases

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • mRNA EDITING 83

    have been defined (12, 54). Messenger RNA N6-adenosine methyltransferase selectively methylates certain A residues, but this modification generally does not alter the coding potential of genes, and rarely otherwise influences gene expression (17, 28).

    An RNA-modifying activity, converting A residues to inosines (I) by deamination (A. Polson, B. L. Bass, personal communication), unwinds double-stranded RNA hybrids (6, 49, 86a, 87). Some modified mRNAs, but not all (5), are rapidly degraded, and thus altered proteins are rarely produced. A secondary effect of this RNA modifying activity was observed in persistent and lytic infections of certain RNA viruses (7, 21, 91). In the genomes of these viruses the All modifying activity can accidentally introduce dozens of mutations, thereby indirectly causing the expression of altered proteins, and sometimes favoring viral persistence (reviewed in 19).

    It has also been speculated that the genome of the only known human viroid, the hepatitis delta agent, is another substrate of the All modifying activity, because in this RNA genome a specific base transition (A to G) has to be introduced to allow efficient propagation (53). Moreover, two groups of investigators (B. L. Bass, K. Nishikura, personal communications) have demonstrated that double-stranded RNA hybrids formed intramolecularly can be modified, an event that can result in precisely localized A to I modifications. Thus, instances in which the All modifying activity alters the expression, and possibly also the coding potential of certain transcripts, may soon be disclosed.

    SUMMARY AND OUTLOOK

    As summarized in Table 3, six different types of RNA editing have been discussed in this review. The mechanisms have been clarified to different extents for different kinds of editing. In trypanosomes, the editing information has been found in the so-called guide RNA, which is outside of the edited genes. Guide RNAs carry not only the editing information, but also, at their 3' ends, the U residues to be inserted in the pre-edited RNAs. In paramyxoviruses, sequences surrounding the editing site induce the stuttering of the viral polymerase. In vertebratc mitochondria, the 3' end of transcripts induce polyadenylation and thus the reconstitution of truncated stop codons.

    In the other three cases of RNA editing the source of editorial information has not yet been determined. In P. polycephalum, the broad and somewhat regular spacing of the editing sites indicates that either potential guide RNAs must be larger than those of trypanosomes, or that a large number of guide RNAs are required. The fact that in transcripts of P. polycephalum more than one nucleotide type can be inserted could be accounted for by a model based on transesterifications, with the use of guide RNAs bearing different 3' nucleotides or homopolymeric nucleotide tails.

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • 84 CATTANEO

    Table 3 Different types of messenger RNA editing (modified from 89)

    Type of editing Mechanism Occurrence

    Insertion or deletion of guide RNAs (transester- mitochondria of U residues ifieations) trypanosomes

    Insertion of C, A, or U ? mitochondria of residues P. polycephalum

    Insertion of G residues polymerase stuttering paramyxoviruses (P gene)

    3' terminal A residues polyadenylation mitochondria of vertebrates addition

    Conversion of C to U deamination apolipoprotein B gene of mammals

    Conversion of Cs to Us, deamination-amination? mitochondria of higher plants or vice versa

    In apolipoprotein B transcripts, it has been demonstrated that 26 nucleotides surrounding the editing site are sufficient to induce correct editing in the context of a test gene. It is, however, not yet clear whether editing is directed uniquely by the primary or secondary structure of the sequence, or whether an extragenic nucleic acid is somehow guiding the U to C conversion.

    The most puzzling RNA-editing system discussed here is that of plant mitochondria. In these organelles, hundreds of different C residues, dispersed over the whole length of many different transcripts, are posttranscriptionally converted to U, or U-like, residues. Moreover, few U to C transitions have been detected. The search for intragenic sequence or structural determinants of editing has not yielded any clue, and editing of plant mitochondrial transcripts could not be reproduced in an in vitro apolipoprotein B editing system (J. Scott, D. M. Driscoll, personal communications). It should be noted that the size of plant mitochondrial genomes, which are on average 10-100 times larger than those of vertebrates, might allow storage of large amounts of editing information. In trypanosomes the editing information is coded in part on the minicircle DNAs, whose complexity correlates with the quantity of needed editing information (75), creating a precedent for this hypothesis. Finally, it is striking that of the six RNA editing types discussed here four concern mitochondrial systems. This observation suggests that RNA editing could also exist in some of today's descendants of the prokaryotes that became endosymbionts of the original eukaryotic cells. The elucidation of the mechanisms of the different types of messenger RNA editing might shed

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • mRNA EDITING 85

    some light on the relationship of the editing phenomena observed. These mechanisms, could prompt new insights on the structure and replication of nucleic acids of earlier forms of life.

    ACKNOWLEDGMENTS

    Thanks are due to the many colleagues who contributed unpublished information. I thank Charles Weissmann, Iris Kemler, Martin A. Billeter, and Hans Weber for constructive comments on the manuscript, and Beat Blum, Karin Kaelin, and Martin A. Billeter for discussions. The author was supported by the Kanton Zurich and by a START Fellowship of the Schweizerische N ationalfonds.

    Literature Cited

    1. Abraham, J. M., Feagin, J. E., Stuart, K. 1988. Characterization of cytochrome c oxidase III transcipts that are edited only in the 3' region. Cell 55:267-72

    2. Aebi, M., Weissmann, C. 1 987. Precision and orderliness in splicing. Trends Genet. 3:1 02-7

    3 . Anderson, S., Bankier, A. T .. Barrell, B. G., De Bruijn, M. H. L., Coulson, A. R. , et al. 1981 . Sequence and organization of the human mitochondrial genome. Nature 290:457-65

    4. Bakalara, N., Simpson, A. M., Simpson, L. 1989. The Leishmania kinetoplast-mitochondrion contains terminal uridylyltransferase and RNA ligase activities. J. Bioi. Chem. 264:18679-86

    5. Bass, B. L., Weintraub, H. 1 987. A developmentally regulated activity that unwinds RNA duplexes. Cell 4!l: 607-1 3

    6 . Bass, B. L., Weintraub. H . 1 988. An unwinding activity that covalently modifies its double-stranded RNA substrate. Cell 55: 1089-98

    7 . Bass, B. L., Weintraub, H., Cattaneo, R., Billeter, M. A. 1989. Biased hypermutation of viral RNA genomes could be due to unwinding/modification of double-stranded RNA. Cell 56:331

    8. Benne, R. 1990. RNA editing in trypanosomes: is there a message? Trends Genet. 6:177-81

    9 . Benne, R., Van Den Burg, J., Brakenhoff, J. P. J., Sioof, P., Van Boom, J. H., Tromp, M. C. 1986. Major transcript of the frameshitted coxll gene from trypanosome mitochondria contains four nucleotides that are not encoded in the DNA. Cell 46:819-26

    1 0. Bhat, G. J., Koslowsky, D. J., Feagin,

    J. E., Smiley, B. L., Stuart, K. 1990. An extensively edited mitochondrial transcript in kinetoplastids encodes a protein homologous to ATPase subunit 6. Cell 61 :886-94

    1 1 . Bilsel, P. A . , Nichol, S. 1 990. Polymerase errors accumulating during natural evolution of the glycoprotein gene of vesicular stomatitis virus Indiana serotype isolates. J. Viral. 64:4873-83

    1 2. Bjork, G. R., Ericson, 1. U., Gustafsson, C. E. D., Hagervali, T. G., Jonsson, Y. H., Wikstrom, P. M. 1 987 . Transfer RNA modification. A nnu. Rev. Biochem. 56:263-87

    13. Blum, B., Bakalara, N., Simpson, L. 1 990. A model for RNA editing in kinetoplastid mitochondria: "guide" RNA molecules transcribed from maxicircle DNA provide the edited information. Cell 60: I !l9-9!l

    14. Blum, B., Simpson, L. 1 990. Guide RNAs in kinetoplastid mitochondria have a nonencoded 3' oligo(U) tail involved in recognition of the preedited region. Cell 62:391 -97

    1 5. Blum, B., Sturm, N. R., Simpson, A. M., Simpson, L. 199 1 . Chimeric gRNA-mRNA molecules with oligo(U) tails covalently linked at sites of RNA editing suggest that U addition occurs by transesterification. Cell 65:543-50

    1 6. Bostrom, K., Garcia, Z., Poksay, K. S., Johnson, D. F . , Lusis, A. J., lnnerarity , T. L. 1990. Apolipoprotein B mRNA editing: Direct determination of the edited base and occurrence in nonapolipoprotein B-producing cell lines. J. Bioi. Chem. 265:22446-52

    17. CarrOll, S. M . , Narayan, P., Rottman, F. M. 1990. N6-methyladenosine residues in an intron-specific region of

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • 86 CATTANEO

    prolactin pre-mRNA. Mol. Cell. Bioi. 10:4456-65

    18. Cattaneo, R. 1990. Messenger RNA editing and the genetic code. Experientia 46:1142-48

    19. Cattaneo, R., Billeter, M. A. 1991. Mutations and All hypermutations in measles virus persistent infections. Curro Topics Microbial. Irnrnunol. In press

    20. Cattaneo, R., Kaelin, K., Baczko, K., Billeter, M. A. 1989. Measles virus editing provides an additional cysteinerich protein. Cell 56:759-64

    21. Cattaneo, R., Schmid, A., Eschle, D., Baczko, K., ter Meulen, Y., Billeter, M. A. 1988. Biased hypermutation and other genetic changes in defective measles viruses in human brain infections. Cell 55:255-65

    22. Cech, T. R. 1991. RNA editing: world's smallest introns? Cell 64:667-69

    23. Cech, T. R., Bass, B. L. 1986. Biological catalysis by RNA. Annu. Rev. Biochem. 55:599-629

    23a. Chamberlin, M., Berg, P. 1964. Mechanism of RNA polymerase action: characterization of the DNA-dependent synthesis of polyadenylic acid. 1. Mol. Bioi. 8:708-26

    24. Chen, S-H., Habib, G. , Yang, C-Y., Gu, Z-W. , Lee, B. R. , et al. 1987. Apolipoprotein B-48 is the product of a messenger RNA with an organ-specific in-frame stop codon. Science 238:363-66

    25. Chen, S-H. , Li, X., Liao, W. S. L.. Wu, J. H., Chan, L. 1990. RNA editing of apolipoprotein B mRNA: sequence specificity determined by in vitro coupled transcription editing. 1. Bioi. Chern. 265:6811-16

    26. Covello, P. S., Gray, M. W. 1989. RNA editing in plant mitochondria. Nature 341 :662-66

    27. Covello, P. S., Gray, M. W. 1990. Differences in editing at homologous sites in messenger RNAs from angiosperm mitochondria. Nucleic Acids Res. 18:5189-96

    28. Csepany, T . , Lin, A., Baldick, C. J. , Beemon, K. 1990. Sequence specificity of mRNA N-adenosine methyltransferase. 1. Biol. Chern. 265:20117-22

    29. Davies, M. S., Wallis, S. C., Driscoll, D. M., Wynne, J. K., Williams, G. W. , et al. 1989. Sequence requirements for apolipoprotein B RNA editing in transfeeted rat hepatoma cells. 1. Bioi. Chern. 264:13395-98

    30. Decker, C. J., Sollner-Webb, B. 1990. RNA editing involves indiscriminate U changes throughout precisely defined editing domains. Cell 61:1001-11

    31. Driscoll, D. M., Casanova, E. 1990. Characterization of the apolipoprotein B mRNA editing activity in enterocyte extracts. 1. Biol. Chern. 265:21401-3

    32. Driscoll, D. M., Wynne. J. K., Wallis, S. C., Scott, J. 1989. An in vitro system for the editing of apolipoprotein B mRNA. Cell 58:519-25

    33. Elliott, G. D., Yeo, R. P., Afzal, M. A., Simpson, E. J. B., Curran. J. A., Rima, B. K. 1990. Strain-variable editing during transcription of the P gene of mumps virus may lead to the generation of non-structural proteins NS 1 (Y) and NS2. 1. Gen. Viral. 71:1555-60

    34. Feagin, J. E. 1990. RNA editing in kinetoplastid mitochondria. J. Biol. Chern. 265:19373-76

    35. Feagin, J. E. , Abraham, J. M., Stuart, K. 1 988. Extensive editing of the cytochrome c oxidase III transcript in Trypanosoma bruce;. Cell 53:413-22

    36. Feagin, J. E., Jasmer, D. P., Stuart, K. 1987. Developmentally regulated addition of nucleotides within apocytochrome b transcripts in Trypanosoma brucei. Cell 49:337-45

    37. Garda-Barreno, B., Portela. A., Delgado, T., Lopez, J. A., Melero, J. A. 1990. Frame shift mutations as a novel mechanism for the generation of neutralization resistant mutants of human respiratory syncytial virus. EMBO J. 9:4181-87

    38. Deleted in proof 39. Gualberto, J. M., Lamattina, L., Bon

    nard. G., Weil, J-H .. Grienenberger, J-M. 1989. RNA editing in wheat mitochondria results in the conservation of protein sequences. Nature 341 :660-62

    40. Gualberto, J. M. , Weil, J-H., Grienenberger, J-M. 1990. Editing of the wheat coxIII transcript: evidence for twelve C to U and one U to C conversions and fOf" sequence similarities around editing sites. Nucleic Acids Res. 18:3771-76

    41. Gupta, K. c., Kingsbury, D. W. 1985. Poly transcripts of Sendai virus do not contain intervening polyadenyJate sequences. Virology 141: 102-9

    42. Harley, C. B. , Lawrie, J., Boyer, H. W., Hedgpeth, J. 1990. Reiterative copying by E. coli RNA polymerase during transcription initiation of mutant pBR322 tet promoters. Nucleic A cids Res. 18:547-52

    43. Hiesel, R., Wissinger, B., Brennicke, A. 1990. Cytochrome oxidase subunit II mRNAs in Oenothera mitochondria are edited at 24 sites. Curro Genet. 18:371-75

    44. Hiesel, R., Wissinger, B., Schuster,

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • W., Brennicke, A. 1989. RNA editing in plant mitochondria. Science 246: 1632-34

    45. Hodges, P. E. , Navaratnam, N . , Greeve, J . c. , Scott, J . 199 1 . Sitespccific creation of uridine from cytidine in apolipoprotein B mRNA editing. Nucleic Acids Res. 19: 1 197-201

    46. Iverson, L. E . , Rose, J. K. 1 98 1 . Localized attenuation and discontinuous synthesis during vesicular stomatitis virus transcription. Cell 23:477-84

    47. Jukes , T. H. 1990. Genetic code 1990. Outlook. Experientia 46: 1 149-57

    48. Kassavetis, G . A . , Zentner, P. G., Geiduschek, E. P. 1 986. Transcription at bacteriophage T4 variant late promoters. J. Bioi. Chern. 261 : 14256-65

    49. Kimelman, D . , Kirschner, M. W. 1 989. An antisense mRNA directs the covalent modification of the transcript encoding fibroblast growth factor in Xenopus oocytes. Cell 59:687-96

    SO. Kondo, K., Bando, H . , Tsurudome, M . , Kawano, M., Nishio, M . , Ito, Y . 1990. Sequence analysis of the phosphoprotein (P) genes of human parainfluenza type 4A and 4B viruses and RNA editing at transcript of the P genes: the number of G residues added is imprecise. Virology 178:321-26

    5 1 . Koslowsky, D. J . , Bhat, G. J . , Perrollaz, A. L., Feagin, J. E. , Stuart, K. 1 990. The MURF3 gene of T. brucei contains multiple domains of extensive editing and is homologous to a subunit of NADH dehydrogenase. Cell 62:901-1 1

    52. Lau, P. P., Chen, S-H . , Wang, J . C. , Chan, L. 1990. A 40 kilodalton rat liver nuclear protein binds specifically to apolipuprotein B mRNA around the RNA editing site. Nucleic Acids Res. 18 : 5 8 1 7-21

    53. Luo, G . , Chao, M . , Hsieh, S-Y., Sureau, C., Nishikura, K., Taylor, J. 1990. A specific base transition occurs on replicating hepatitis delta virus RNA. 1. Virol. 64: 1021-27

    54. Maden, B. E. H. 1 990. The numerous modified nucleotides in eukaryotic ribosomal RNA. Progr. Nucleic Acids Res. Mol. Bioi. 39:241-303

    55. Mahendran, R., Spottswood, M. R., Miller, D. L. 1 99 1 . RNA editing by cytidine insertion in mitochondria of Physarum polycephalum. Nature 349: 434-38

    56. Matsuoka, Y., Curran, J . , Pelet, T . , Kolakofsky, D., Ray, R . , Compans, R . W. 1 99 1 . The P gene o f human parainfluenza type 1 virus encodes P and C proteins, but not a cysteine-rich V protein. J. Virol. 65:3406-10

    mRNA EDITING 87

    57. Niisslein, c. , Schaller, H. 1975. Stabilization of promoter complexes with a single ribonucleoside triphosphate . Eur. 1. Biochern. 56:563-69

    58. Ohgimoto, S., Bando, H . , Kawano, M . , Okamoto, K., Kondo, K., e t al. 1 990. Sequence analysis of P gene of human parainfluenza type 2 virus: P and cysteine-rich proteins are translated by two mRNAs that differ by two nontemplated G residues. Virology 177: 1 1 6-23

    59. Ojala, D., Montoya, J., Attardi, G. 198 1 . tRNA punctuation model of RNA processing in human mitochondria. Nature 290:470-74

    60. Paterson, R. G., Lamb, R. A. 1 990. RNA editing by G-nucleotide insertion in mumps virus P-gene mRNA transcripts. 1. Viral. 64:41 37-45

    6 1 . Pelet, T., Curran, J., Kolakofsky, D. 1 99 I. The P gene of bovine parainfluenza virus 3 expresses all three reading frames from a single mRNA editing site. EMBO 1. 1 0:443-48

    62. Pollard, V. W., Rohrer, S. P., Michelotti, E. F. , Hancock, K. , Hajduk, S. L. 1990. Organisation of minicircle genes for guide RNAs in Trypanosoma brucei. Cell 63:783-90

    63. Powell , L. M . , Wallis, S . C . , Pease, R. J. , Edwards, Y. H., Knott, T. J. , Scott, J. 1987. A novel form of tissue-specific RNA processing produces apolipoprotein-B48 in intestine. Cell 50:83 1-40

    64. Roe, B. A . , Ma, D-P., Wilson, R. K . , Wong, J . F-H. 1 985. The complete nucleotide sequence of the Xenopus laevis mitochondrial genome. J. Bioi. Chern. 260:9759-74

    65. Schuster, W., Hiesel, R., Wissinger, B . , Brennicke, A. 1 990. RNA editing in lhe cytochrome b locus of the higher plant Oenothera berteriana includes a U-to-C transition. Mol. Cell. Bioi. 10:2428-3 1

    66. Schwer, B . , Stunnenberg, H. G. 1988. Vaccinia virus late transcripts generated in vitro have a poly(A) head. EMBO 1. 7 : 1 183-90

    67. Scott, J. 1989. Messenger RNA editing and modification. Curro Opinion Cell Bioi. 1 : 1 141-47

    68. Shaw, 1. M . , Campbell, D., Simpson, L. 1 989. Internal frameshifts within the mitochondrial genes for cytochrome oxidase subunit II and maxicircle unidentified reading frame 3 of Leishmania tarentolae are corrected by RNA editing: evidence for translation of the edited cytochrome oxidase subunit II mRNA. Proc. Natl. Acad. Sci. USA 86:6220-24

    69. Shaw, J. M . , Feagin, 1. E., Stuart, K., Simpson , L. 1 988. Editing of kinetoplastid mitochondrial mRNAs by uridine

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

  • 88 CATTANEO

    addition and deletion generates conserved amino acid sequences and AVG initiation cuduns. Cell 53:401 -1 1

    70. Simpson, L. 1987. The mitochondrial genome of kine top las tid protozoa: genomic organization, transcription, replication, and evolution. Annu. Rev. Microbial. 4 1 :363-82

    7 1 . Simpson, L. , Shaw, J. 1 989. RNA editing and the mitochondrial cryptogenes of kinetoplastid protozoa. Cell 57:355-66

    72. Smith, C. W. J . , Patton, J. G. , NadalGinard, B. 1 989. Alternative splicing in the control of gene expression. Annu. Rev. Genet. 23:527-77

    73. Smith, H. C. , Kuo, S-R . , Backus, J. W . , Harris, S. G., Sparks, C. E . , Sparks, J . D . 1 99 1 . In vitro apolipoprotein B mRNA editing: identification of a 27S editing complex. Proc. Natl. Acad. Sci. USA 88: 1 489-93

    74. Southern, J. A . , Precious, B . , Randall, R. E. 1990. Two nontemplated nucleotide additions are required to generate the P mRNA of parainfluenza virus type 2 since the RNA genome encodes protein V. Virology 1 77:388-90

    75. Stuart, K . 1 99 1 . RNA editing in trypanosomatid mitochondria. Annu. Rev. Microbiol. 45 :In press

    76. Sturm, N. R . , Simpson, L. 1 990. Partially edited mRNAs for cytochrome b and subunit III of cytochrome oxidase from Leishmania tarentolae mitochondria: RNA editing intermediates. Cell 6 1 :87 1-78

    77. Sturm, N. R . , Simpson, L. 1 990, Kinetoplast DNA minicircles encode guide RNAs for editing of cytochrome oxidase subunit III mRNA. Cell 6 1 :879-84

    78. Takeuchi, K. , Tanabayashi, K. , Hishiyama, M . , Yamada, Y. K . , Yamada, A . , Sugiura, A. 1 990. Detection and characterization of mumps virus V protein. Virology 1 78:247-53

    79. Teng, B . , Black, D. D . , Davidson, N . O. 1990. Apolipoprotein B messenger RNA editing is developmentally regulated in pig small intestine: nucleotide comparison of apolipoprotein B editing regions in five species. Biochem. Biophys. Res. Commun. 1 73 :74-80

    80. Teng, B . , Verp, M. , Salomon, J., Davidson, N. O. 1 990. Apolipoprotein B messenger RNA editing is developmentally regulated and widely expressed in human tissue. J. BioI. Chem. 265:20616-20

    8 1 . Thomas, S. M . , Lamb, R. A. , Paterson, R. G. 1988. Two mRNAs that differ by two nontemplated nucleotides encode the amino coterminal proteins P and V of the paramyxovirus SV5. Cell 54:891-902

    82. van der Spek, H . , Arts, G-J . , Zwaal, R. R . , van den Burg, J. , Sioof, P . , Benne, R. 1 99 1 . Conserved genes encude guide RNAs in mitochondria of Crithidia lasciculata. EMBO J. 1 0: 12 17-24

    83. van der Spek, H . , van den Burg, J . , Croiset, A . , van den Broek, M . , Sioof, P. , Benne, R. 1 988. Transcripts from the frameshifted MVRF3 gene from Crithidia lasciculata are edited by V insertion at multiple sites. EMBO J. 7:2509-14

    84. Vidal, S. , Curran, J., Kolakofsky, D. 1990. Editing of the Sendai virus PIC mRNA by G insertion occurs during mRNA synthesis via a virus-encoded activity. 1. Virol. 64:239-46

    85. Vidal, S . , Curran, J . , Kolakofsky, D . 1990. A stuttering model for paramyxovirus P mRNA editing. E MBO J. 9 :20 17-22

    86. Wagner, L. A. , Weiss, R. B . , Driscoll, R . , Dunn, D. S . , Gesteland, R. F. 1 990. Transcriptional slippage occurs during elongation at runs of adenine or thymine in Escherichia coli. Nucleic Acids Res. 1 8 :3529-35

    86a. Wagner, R. W . , Smith, J. E. , Cooperman, B . S . , Nishikura, K. 1 989. A double-stranded RNA unwinding activity introduces structural alterations by means of adenosine to inosine conver sions in mammalian cells and Xenopus eggs. Proc. Natl. Acad. Sci. USA 86:2647-5 1

    87. Wagner, R. W . , Yoo, c. , Wrabetz, L., Kamholz, J . , Buchhalter, 1 . , et al. 1990. Double-stranded RNA unwinding and modifying activity is detected ubiquitously in primary tissues and cell lines. Mol. Cell. Bioi. 1O:558fr-90

    88. Walbot, V. 1 99 1 . RNA editing fixes problems in plant mitochondrial transcripts. Trends Genet. 7:37-39

    89. Weissmann, c. , Cattaneo, R . , Billeter, M . A. 1990. Sometimes an editor makes sense. Nature 343:697-99

    90. Wissinger, B . , Schuster, W . , Brennicke, A. 1990. Species-specific RNA editing patterns in the mitochondrial rps 13 transcripts of Oenothera and Daucus. Mol. Gen. Genet. 224:389-95

    9 1 . Wong, T. C . , Ayata, M. , Veda, S . , Hirano, A. 199 1 . Role of biased hypermutation in evolution of subacute sclerosing panencephalitis virus from progenitor acute measles virus. J. Viral. 65:2191-99

    92. Wu, J. H . , Semenkovich, C. F. , Chen, S-H . , Li, W-H . , Chan, L. 1 990. Apolipoprotein B mRNA editing: validation of a sensitive assay and developmental biology of RNA editing in the rat. J. Bioi. Chem. 265:123 1 2-16

    Ann

    u. R

    ev. G

    enet

    . 199

    1.25

    :71-

    88. D

    ownl

    oade

    d fr

    om w

    ww

    .ann

    ualr

    evie

    ws.

    org

    by U

    nive

    rsity

    of

    Upp

    sala

    on

    10/1

    1/14

    . For

    per

    sona

    l use

    onl

    y.

    Annual Reviews OnlineSearch Annual ReviewsAnnual Review of Genetics OnlineMost Downloaded Genetics ReviewsMost Cited Genetics ReviewsAnnual Review of Genetics ErrataView Current Editorial Committee

    ar: logo:

Recommended

View more >