Different Types of Messenger RNA Editing

  • Published on
    24-Feb-2017

  • View
    216

  • Download
    1

Embed Size (px)

Transcript

<ul><li><p>Annu. Rev. Genet. 1991. 25:718 Copyright by Annual Reviews Inc. All rights reserved </p><p>DIFFERENT TYPES OF MESSENGER </p><p>RNA EDITING </p><p>Roberto Cattaneo </p><p>Institut fur Molekularbiologie I, Universitat Zurich, Honggerberg, CH-8093 Zurich, Switzerland </p><p>KEY WORDS: messenger RNA, RNA processing, gene expression, RNA modification </p><p>CONTENTS </p><p>INTRODUCTION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71 POSTTRANSCRIPTIONAL INSERTION AND DELETION OF NUCLEOTIDES . . . . . 73 </p><p>Small RNAs Guide the Insertion and Deletion of Uridines in Mitochondrial Transcripts of Trypanosomes. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73 </p><p>3' to 5' Polarity: An Imprecise System. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76 Insertion of Cytidines in Mitochondrial Transcripts of a Slime Mold. . . . . . ............ 77 </p><p>COTRANSCRIPTIONAL INSERTION OF NUCLEOTIDES................................ 77 Insertion of Guanosines in a Transcript of RNA Viruses . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . 77 UAA Stop Codons Are Produced by Polyadenylation of Vertebrate </p><p>Mitochondrial Transcripts . . . . . . .. . . . . . . . .. . . . . . . . . . . . . . .. . . .. . . . . . . . .............. 79 Other Cases of RNA Polymerase Stuttering. . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . 79 </p><p>CONVERSION OF NUCLEOTIDES .. .. . . . . . ... .. . . . . . ... . . . . . . .... . . . . . . . . . . . . . . . . . . ... . . . . . . . . 80 Tissue-specific Cytidine Deamination Generates a UAA Stop Codon in </p><p>a Nuclear Transcript . . . .... . . . . . . .. ... . . . ....... . . . .. . . . . . .. . . . 80 C to U and U to C Transitions in Plant Mitochondria. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Modifications of Nucleotides. . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82 </p><p>SUMMARY AND OUTLOOK . . . . . . . . . . . . . . ..... . . . . . ... .. . . . "". . . . . . . . . . . . . . . . .... . . . . . ..... . . . 83 </p><p>INTRODUCTION </p><p>Eukaryotic messenger RNA (mRNA) undergoes various co- and posttranscriptional modifications. The 5' end of the molecule is generally capped, the 3' end polyadenylated, and up to 98% of the internal sequences can be eliminated by splicing. Although capping and polyadenylation generally do not affect the protein coding capacity of mRNA, splicing generally determines or alters its coding potential (2, 72). </p><p>71 0066-4197/91/1215-0071 $02:00 </p><p>Ann</p><p>u. R</p><p>ev. G</p><p>enet</p><p>. 199</p><p>1.25</p><p>:71-</p><p>88. D</p><p>ownl</p><p>oade</p><p>d fr</p><p>om w</p><p>ww</p><p>.ann</p><p>ualr</p><p>evie</p><p>ws.</p><p>org</p><p>by U</p><p>nive</p><p>rsity</p><p> of </p><p>Upp</p><p>sala</p><p> on </p><p>10/1</p><p>1/14</p><p>. For</p><p> per</p><p>sona</p><p>l use</p><p> onl</p><p>y.</p></li><li><p>72 CATTANEO </p><p>In the past five years, several editing phenomena that differ from splicing have been found to result in the predetermined modification of the coding potential of certain genes. The RNA editing system of trypanosome mitochondria, involving the posttranscriptional insertion and deletion of uridine (U) residues, attracted considerable interest because it allows generation of sensible RNAs from transcripts lacking features essential for correct translation, such as an initiation signal or an appropriate reading frame (reviewed in 8, 34, 71, 75). In a second mitochondrial system, that of the slime mold Physarum polycephalum, single C residues are added at multiple positions of several transcripts, allowing the reconstitution of reading frames (55; D. Miller, personal communication). The editing systems of trypanosomes and P. polycephalum are both characterized by the insertion (and for trypanosomes, deletion) of nucleotides. Since the trypanosomal RNA editing process is clearly posUranscriptional and the P. polycephalum process apparently so, these two editing types are discussed together. </p><p>Two other types of editing by nucleotide insertion are known, but these processes are believed to be cotranscriptional, or to immediately follow transcription. In certain RNA viruses, one or more guanylate (0) residues are inserted at a precise position of a transcript, allowing the production of at least two, and sometimes three, proteins with a common amino-terminus and different carboxyl-termini (reviewed in 18). Moreover, in transcripts of vertebrate mitochondria UAA stop codons are produced by polyadenylation (3, 59). </p><p>The last two types of RNA editing discussed here are characterized by the conversion of nucleotides. In the mammalian apolipoprotein B mRNA, a cytidine (C) to U conversion results in the tissue-specific generation of a stop codon (reviewed in 67). This is the only editing process currently known to alter the expression of a nuclear gene. Another editing process with farreaching consequences for gene expression was recently discovered in plant mitochondria. The sequences of most, if not all, transcripts of mitochondrial genes of higher plants are altered by C to U changes and, to a lesser extent, by U to C conversions (reviewed in 88). </p><p>This review I aims to describe and compare the different mechanisms of these editing phenomena, which are all characterized by some degree of imprecision, and to discuss the sources of editing information. I also deal briefly with certain mRNA modification systems that do not lead to predetermined alterations of the coding region. </p><p>'Two recent publications have further broadened the impact of mRNA editing: B Sommer et al. 199 1 . RNA editing in brain controls a detenninant of ion flow in glutamate-gated channels. Cell 67: 11-19; B. Hoch et al. 1991. Editing of a chloroplast mRNA by creation of an initiation codon. Nature 353:178-80. </p><p>Ann</p><p>u. R</p><p>ev. G</p><p>enet</p><p>. 199</p><p>1.25</p><p>:71-</p><p>88. D</p><p>ownl</p><p>oade</p><p>d fr</p><p>om w</p><p>ww</p><p>.ann</p><p>ualr</p><p>evie</p><p>ws.</p><p>org</p><p>by U</p><p>nive</p><p>rsity</p><p> of </p><p>Upp</p><p>sala</p><p> on </p><p>10/1</p><p>1/14</p><p>. For</p><p> per</p><p>sona</p><p>l use</p><p> onl</p><p>y.</p></li><li><p>mRNA EDITING 73 </p><p>POSTTRANSCRIPTIONAL INSERTION AND DELETION OF NUCLEOTIDES </p><p>Small RNAs Guide the Insertion and Deletion of Uridines in Mitochondrial Transcripts of Trypanosomes </p><p>The most thoroughly studied form of mRNA editing occurs in the single mitochondrion, or kinetoplast, of trypanosomes, where editing creates translatable open reading frames by insertion and, to a minor degree, deletion of many U residues (9, 35, 36, 69; Table 1 ). This type of RNA editing occurs in at least seven different mRNAs in each of three trypanosome species: the lizard parasite Leishmania tarentolae, the human parasite Trypanosoma brucei, and the insect parasite Crithidiafasciculata. Table 1 illustrates some characteristics of the trypanosomal type of RNA editing on the example of the RNA for the NADH dehydrogenase subunit 7 (ND7, previously designated MURF3; 51). First, RNA editing can be more or less extensive. In the ND7 transcript of L. tarentolae and C. fasciculata, 25 and 27 Us, respectively, are added. In T. brucei, on the other hand, not less than 551 Us are inserted and 88 deleted. As a result, in T. brucei the genomic region coding for the ND7 </p><p>RNA (called cryptogene, as any gene which has to be edited) is short and very GC-rich. </p><p>For the trypanosomal form of RNA editing the longstanding question concerned the source of information. It was only in 1990 that Blum, Bakalara, &amp; Simpson (13) discovered the editing information in RNA molecules 50-80 </p><p>Table t ND 7 RNA editing in the mitochondria of three trypanosome species </p><p>Added/deleted Us -at the 5 I end -at the "fs" position </p><p>Initiation codon </p><p>Termination codon </p><p>Localization of the guide RNAs </p><p>adata from (13, 69). b data from (82, 83). C data from (51). </p><p>Leishmania tarentolaea </p><p>2010 510 </p><p>non-AUG? </p><p>encoded </p><p>maxicircle </p><p>d extensive editing over most of the gene. e AUG moved out of frame by editing. </p><p>Crithidia fasciculatab </p><p>2210 510 </p><p>alterede </p><p>encoded </p><p>maxicircle </p><p>f many other guide RNAs are predicted, but not yet found. </p><p>Trypanosoma bruceic </p><p>70113 48l175d </p><p>created </p><p>created </p><p>minicircle (at least twO)f </p><p>Ann</p><p>u. R</p><p>ev. G</p><p>enet</p><p>. 199</p><p>1.25</p><p>:71-</p><p>88. D</p><p>ownl</p><p>oade</p><p>d fr</p><p>om w</p><p>ww</p><p>.ann</p><p>ualr</p><p>evie</p><p>ws.</p><p>org</p><p>by U</p><p>nive</p><p>rsity</p><p> of </p><p>Upp</p><p>sala</p><p> on </p><p>10/1</p><p>1/14</p><p>. For</p><p> per</p><p>sona</p><p>l use</p><p> onl</p><p>y.</p></li><li><p>74 CATTANEO </p><p>nucleotides long, which they termed guide RNAs (gRNAs). Guide RNAs contain regions of perfect complementarity to the edited mRNA segments, if G:U base-pairing is allowed. This wobble base-pairing implies that gRNAs </p><p>are not functioning as conventional templates, because Us are specified during editing not only by As, but also by Gs. </p><p>The precise mechanism of mRNA editing in trypanosomes is still unre</p><p>solved, but for simplicity, the model first proposed (13) then successively modified by Blum and associates (15) is presented in extenso, followed by discussion of the one controversial part. As shown in Figure l A, in the example of the modification of the pre-edited L. tarentolae ND7 RNA (top) </p><p>by its cognate "5'" gRNA (bottom), the gRNA is supposed to base pair with the cognate mRNA at a region indicated as "3 ' anchor" (right). After this base pairing, the editing reaction begins with the attack by the mRNA at the 3' phosphate of the first mismatched base by the terminal hydroxyl (-OH) group of the gRNA (thick arrow in Figure lA). The gRNA and the mRNAs become covalently linked before or after base pairing of the poly-U tail with the first block of seven guide A or G residues (Figure l B). A second transesterification reaction, beginning with the attack by the terrninal-OH group of the mRNA on the gRNA/mRNA hybrid (thick arrow in Figure l B), results in the transfer of seven (or less) Us to the mRNA. For the transfer of each additional block of Us, at least one transesterification cycle is required. Because the poly-U tail of the gRNA (14) is initially not long enough to provide the 20 U residues necessary for editing, it is assumed that this tail can be elongated (4) during the editing process. </p><p>Indeed, Blum et al (15) demonstrated the existence of chimeric gRNAlmRNA molecules, thus providing direct evidence for specific interactions between gRNAs and the corresponding mRNA. The structure of these hybrid molecules and the structure of resolved intermediates (76) suggests that the transfer of a block of Us often requires more than one transesterification cycle, or, alternatively, that only single U residues are transferred with each transesterification. Deletion of U residues from pre-edited RNAs can also be explained on the basis of transesterifications, in a process having several mechanistical analogies to RNA splicing (15, 22; J. Taylor, personal communication). </p><p>The initial findings of Benne et al (9) and the editing model of Blum et al (13) stimulated the efforts of many groups trying to analyze the complex genome of kinetoplasts, which contains about 10,000 more or less heterogenous short circular DNA molecules interlocked with about 50 maxicircles of a single type (70, 75). Guide RNA genes were soon detected in the kinetoplast DNA of T. brucei and C. Jasciculata, often in a position in the maxicircle virtually identical to that in L. tarentolae (82). In T. brucei and L. tarentolae other potential gRNA genes were found in minicircle DNA (10, 5 1, 62, 77; D. J. Koslowsky, &amp; K. Stuart, personal communication; Table 1), </p><p>Ann</p><p>u. R</p><p>ev. G</p><p>enet</p><p>. 199</p><p>1.25</p><p>:71-</p><p>88. D</p><p>ownl</p><p>oade</p><p>d fr</p><p>om w</p><p>ww</p><p>.ann</p><p>ualr</p><p>evie</p><p>ws.</p><p>org</p><p>by U</p><p>nive</p><p>rsity</p><p> of </p><p>Upp</p><p>sala</p><p> on </p><p>10/1</p><p>1/14</p><p>. For</p><p> per</p><p>sona</p><p>l use</p><p> onl</p><p>y.</p></li><li><p>A uAu </p><p>A A G-C C-G G A C A-U </p><p>pre-edited ND7 RNA </p><p>g=;:+</p><p>:2+:7 </p><p>3- anchor </p><p>A-U/+</p><p>3</p><p>! I , ------'-,_ U-A ;; ,,..-- ---., </p><p>5'-UUAAAUUU UAAAAAGACACUUGUAUAGAU .. //.-3-.II I II I I I I I I * I I </p><p>UUU,OH GUGAACAUUUUUA_5 ' UU A U G </p><p>U A Uu </p><p>A 7 UUu ND7 "5-" gUide RNA </p><p>poly-U tail UUu A A-U uiAl 2 Uill 2 (A)-= U </p><p>W r1b UV2 </p><p>3 3 A \hl G U Gu 1 </p><p>B UAU </p><p>A A G-C C-G G A C A_U U-A U-A U-A A-U U-A U 5' -UUAAAUUU UAAAAAG,OH--euUUUUUUUACACUUGUA AGAU .. / / . -3' </p><p>uUUU 11111*1111111111 1*11 U AAAAAGAUGUGAACAUUUUUA-5' UUA-U </p><p>ufAl U.W U </p><p>-iJ G</p><p>G G U 'CI </p><p>Figure 1 Model for RNA editing in trypanosomes (13, IS), exemplified by the 5' part of the ND7 transcript. A. The ND7 pre-edited RNA is represented on the top and the ND7 "5'" guide RNA on the bottom. A region of complementarity between these two RNAs is indicated as "3' anchor" (right). Standard complementarity i5 indicated by dashes, G:U base pairs by asterisks. Residues (A's or G's) guiding U insertion are bold and boxed. The poly-U tail, added posttransc riptionally to the gRNA (14), is indicated. For details see text. B. Same as A, but after the first trans esterification and base-pairing of the gRNA 3' terminal5even U residues with the "guide" A and G residues of the first block. </p><p>3 :::0 Z &gt;-</p><p>gj </p><p> Cl </p><p>........ Ut </p><p>Ann</p><p>u. R</p><p>ev. G</p><p>enet</p><p>. 199</p><p>1.25</p><p>:71-</p><p>88. D</p><p>ownl</p><p>oade</p><p>d fr</p><p>om w</p><p>ww</p><p>.ann</p><p>ualr</p><p>evie</p><p>ws.</p><p>org</p><p>by U</p><p>nive</p><p>rsity</p><p> of </p><p>Upp</p><p>sala</p><p> on </p><p>10/1</p><p>1/14</p><p>. For</p><p> per</p><p>sona</p><p>l use</p><p> onl</p><p>y.</p></li><li><p>76 CATTANEO </p><p>an observation finally hinting at a genetic function of the minicircle DNA. </p><p>RNA editing alone is not always sufficient to explain the mode of synthesis of certain proteins in trypanosome mitochondria. For example, in the ND7 transcript of T. brucei editing creates a novel initiation and a novel termination codon (Table 1, right columns), whereas in L. tarentolae no AUG seem to be available before or after editing, and in C. fasciculata a potential initiation codon is moved out of frame by editing. In the two latter cases translation might be initiated on a non-AUG codon. </p><p>3' to 5' Polarity: An Imprecise System </p><p>Partially edited RNAs, presumably molecules in the process of being edited, generally have edited 3' regions but unedited 5' regions, an observation suggesting that editing starts at the mRN A 3 r end and proceeds towards the 5 r end (35). This suggestion was generally confirmed by extensive studies based on selective peR amplification, and to a lesser extent on direct cDNA cloning, of partially edited transcripts of T. brucei (1, 30; D. 1. Koslowsky, G. J. Bhat, J. E. Feagin, G. R. Riley &amp; K. Stuart, personal communication). However, these studies also confirmed that so-called partially edited RNA can often differ from both the pre-edited and the fully edited RNA version by having no clearcut polarity of editing in a short region separating fully edited from pre-edited segments. This observation was interpreted by Sollner-Webb and associates and Stuart and associates to be incompatible with Blum's editing model (13). Sturm &amp; Simpson (76), on the other hand, also observed editing intermediates "scrambled" at the editing area in transcripts of L. tarentolae. These authors, however, suggested that these molecules are the result of editing cycles based on spurious hybridization of gRNAs with partially homologous RNAs, or on hybridization of gRNAs with the cognate transcript, but not precisely at the correct site. </p><p>Partially edited RNA molecules comprise a substantial fractio...</p></li></ul>

Recommended

View more >