# 2008 The Authors

Journal compilation # 2008 Blackwell Munksgaard

doi: 10.1111/j.1600-0854.2008.00855.xTraffic 2009; 10: 161–171Blackwell Munksgaard

Dictyostelium Tom1 Contributes to an AncestralESCRT-0 Complex

Cedric Blanc1, Steve J. Charette2, Sara Mattei3,

Laurence Aubry3, Ewan W. Smith4,

Pierre Cosson4 and Francxois Letourneur1,*

1IFR 128 BioSciences Gerland-Lyon Sud, Institut deBiologie et Chimie des Proteines, UMR5086 - CNRS/Universite Lyon I, 7 Passage du Vercors,69367 Lyon cedex 07, France2Centre de Recherche en Pneumologie, Pavillon Mallet,Hopital Laval, 2725 Chemin Sainte-Foy, Quebec,Qc, G1V 4G5, Canada3Laboratoire de Biochimie et Biophysique des SystemesIntegres, DRDC/BBSI, UMR 5092 CNRS-CEA-UJF,CEA-Grenoble, 17 rue des Martyrs, F-38054 Grenoblecedex 9, France4Departement de Physiologie Cellulaire et Metabolisme,Centre Medical Universitaire, Universite de Geneve,CH-1211 Geneve 4, Switzerland*Corresponding author: Francxois Letourneur,f.letourneur@ibcp.fr

Sorting of ubiquitinated proteins to multivesicular bodies

(MVBs) inmammalian cells relies on proteinswith a Vps27/

Hrs/STAM (VHS) domain. Here, we show that the amoeba

Dictyostelium presents only one protein with a VHS

domain: DdTom1. We demonstrate that the VHS

domain of DdTom1 is followed by a Golgi-localized, g-ear-containing, ADP-ribosylation-factor-binding and Tom1

(GAT) domain that binds ubiquitin, and by a non-

conserved C-terminal domain that can recruit clathrin, EGFr

pathway substrate 15 and tumor susceptibility gene 101,

a component of theMVBbiogenesismachinery [endosomal

complexes required for transport (ESCRT) complexes]. Both

VHS and GAT domains interact with phospholipids and

therefore could ensure the recruitment of DdTom1 to endo-

somal membranes. We propose that DdTom1 participates

in an ancestral ESCRT-0 complex implicated in the sorting

of ubiquitinated proteins into MVBs.

Key words: clathrin, Dictyostelium, multivesicular body,

Tom1, ubiquitin

Received 2 June 2008, revised and accepted for publication

6 November 2008, uncorrected manuscript published on-

line 20 November 2008, published online 10 December 2008

Biochemical and genetic studies have revealed that the

attachment of monoubiquitin to membrane proteins trig-

gers the sorting of cargo into the lumen of multivesicular

bodies (MVBs) that eventually fuse with lysosomes. In

mammalian cells, the first step in this pathway is the

recognition and the concentration of ubiquitinated cargo on

endosomal subdomains by the Hrs/STAM complex also

named endosomal sorting complex required for transport

(ESCRT)-0 (1,2). The ESCRT-0 complex also associates

with clathrin and EGFr pathway substrate 15 (Eps15) (3) or

with an isoform of Eps15 (4), which could participate in

cargo recognition. This initial step is followed by the

sequential recruitment of three other multisubunit ESCRT

complexes termed ESCRT-I, II and III that are implicated in

the biogenesis of MVBs (5–9).

Hrs and STAM are ubiquitin-binding proteins that contain

a VHS domain (Vps27/Hrs/STAM). This domain is a 140-

residue-long domain found at the N-terminus of various

proteins that function in the endocytic pathway and in

signal transduction (10,11). The function of the VHS

domain has only been established for Golgi-localized,

g-ear-containing, ADP-ribosylation-factor-binding (GGA) pro-

teins in which it recognizes acidic-cluster-dileucine signals

found in endocytic proteins such as mannose-6-phosphate

receptors, and thus participates in their sorting (12–15).

Interestingly, both Hrs and STAM are absent in plants and

the amoeba Dictyostelium discoideum, whereas homologs

of all other ESCRT complexes components are found in

these organisms (16–18). This observation has led to the

hypothesis that the ESCRT-0 complexmade of Hrs/STAM is

dispensable for basic endosomal functions and represents

a late evolutionary contribution to the ESCRT machinery to

improve the sorting efficiency of ubiquinated cargos into the

MVB pathway (19). In the absence of Hrs/STAM com-

plexes, sorting of ubiquitinated proteins in plants and

Dictyostelium might rely on other ESCRT complexes or

alternative components not yet identified.

In addition to the Hrs/STAM complex, two other families of

VHS-containing proteins, GGAs and Tom1 (target of

Myb1), can recruit ubiquitinated proteins to endosomal

membranes and may also contribute to the loading of the

MVB biogenesis machinery with ubiquinated cargo (20). In

humans, the Tom1 family of proteins comprises three

members termed Tom1, Tom1L1, and Tom1L2. This

family is characterized by the presence of a N-terminus

VHS domain followed by a GAT domain. The GAT domains

of all Tom1 members interact with ubiquitin and Toll-

interacting protein (Tollip) (21,22), an endosomal protein

with a CUE domain (coupling of ubiquitin to endoplasmic

reticulum degradation), which binds ubiquitin (23). The link

between the Tom1 family and theMVB formation pathway

is reinforced by the observation that Tom1L1 interacts with

Hrs and tumor susceptibility gene 101 (Tsg101), a subunit

of the ESCRT-I complex (24). Interestingly, GGAs are not

encoded in plant and Dictyostelium genomes, whereas

Tom1 homologs are present (17). It is conceivable that in

www.traffic.dk 161

these organisms, Tom1 might be a component of an

ancestral ESCRT-0 complex (17), but to date, no experi-

mental evidence is available.

In this paper, we analyzed the function of Tom1 in

D. discoideum. This amoeba is a genetically tractable

eukaryotic cell with active endocytic functions making it

a very attractive cellular model to study membrane traf-

ficking in the endocytic pathway (25). We present evi-

dence that Dictyostelium Tom1, like mammalian Tom1,

interacts with ubiquitin, clathrin and Tsg101, a component

of the ESCRT-I complex. Tom1 participates in a minimal

ESCRT-0 complex that could be recruited to endosomal

membranes by its direct interaction with phospholipids

and the support of Eps15.

Results

The single Dictyostelium VHS-containing

protein is a Tom1 ortholog

As VHS-containing proteins play a major role in vesicular

traffic, we searched the Dictyostelium genome database

(www.dictybase.org) and found only one putative protein

of 663 amino acids (DDB0232160) containing a VHS

domain (IPR002014). In addition to the VHS domain, this

protein showed a GAT domain (IPR004152). The juxtapo-

sition of VHS and GAT domains is only found in GGAs

and Tom1 family of proteins. However, the C-terminal

g-adaptin ear homology (GAE) domain, a feature of GGAs

is absent in mammalian Tom1 as well as in this Dictyos-

telium VHS- and GAT-containing protein. Because of

a similar domain organization between mammalian Tom1

and DDB0232160 and shared functional properties (as

detailed hereafter), this amoeba protein is referred to here

as DdTom1, although its C-terminal domain after the GAT

domain has no homology with the mammalian Tom1

C-terminal domain (Figure 1A). The VHS and GAT domains

of DdTom1 shared 27 and 29% of identity with the VHS

and GAT domains of human Tom1, respectively.

In contrast to GGAs, the Tom1 family of proteins exhibit

VHS domains that do not interact with acidic-cluster-

dileucine signals. Critical residues involved in this interac-

tion were mapped in GGAs (26–28), and alignment of the

DdTom1 VHS domain with GGAs VHS domains revealed

that these residues are not conserved in DdTom1 (data not

shown). To test the interaction of DdTom1 with acidic-

cluster-dileucine signals, a yeast two-hybrid assay was

developed. In this assay, as already reported (15,26,29),

the acidic-cluster-dileucine signal of the cation-independent

mannose-6-phosphate receptor (CI-M6PR), interacted with

the VHS domain of human GGA1. As shown in Figure 1B,

human Tom1 and DdTom1 did not bind to the CI-M6PR

acidic-cluster-dileucine signal.

The GAT domain of GGAs interacts with a GTP-bound form

of the small GTPase ADP-ribosylation factor 1 (ARF1) and

is responsible for the association of GGAs to membranes

(12,30,31). The X-ray crystal structures of the complex

between GGA1-GAT and ARF1-GTP have revealed resi-

dues involved in the interaction with ARF1 (28,32), all

found in a helical extension in the N-terminal part of GAT

domains. These residues are not conserved in mammalian

Tom1, which does not interact with ARF1, nor in DdTom1

(data not shown). The presumed absence of interaction

between DdTom1 and ARF1was confirmed in a yeast two-

hybrid assay that showed that the constitutively activated

ARF1 mutant, ARF1/Q71L did not interact with DdTom1

VHS–GAT domains (Figure 1C). In this assay, as already

reported (12,30,31), the VHS–GAT domains of human

GGA3 (Figure 1C) and of other GGAs (data not shown)

interacted with ARF1.

As mammalian Tom1 binds ubiquitin (21,22), a signal for

sorting transmembrane proteins into luminal vesicles of

Figure 1: Domain organization of DdTom1 and binding prop-

erties of VHS and GAT domains. (A) Schematic representation

of human Tom1 and DdTom1. Both proteins share a same domain

organization; however, the C-terminal domains after the GAT

domains show no homology. B, C, E) Two-hybrid assays. Yeast

transformants expressing the combinations of constructs indi-

cated in the figure were spotted onto plates with or without

histidine (þHis and �His) respectively. Yeast growth on �His

plates indicated an interaction between the tested proteins.

D) In vitro binding assays. Lysates of cells expressing the GFP–

DdTom1 chimera were incubated with glutathione-Sepharose

beads containing GST or GST-Ubiquitin (GST-Ub). Bound proteins

were analyzed by immunoblotting with an anti-GFP monoclonal

antibody.

162 Traffic 2009; 10: 161–171

Blanc et al.

the multivesicular body along both the endocytic and the

biosynthetic pathways, we next assayed the interaction of

DdTom1 with ubiquitin. Green fluorescent protein (GFP)-

tagged DdTom1 expressed in Dictyostelium cells was

pulled-down from cell lysates with glutathione S-transferase

(GST)-ubiquitin bound to glutathione-Sepharose beads

(Figure 1D). In addition, a yeast two-hybrid assay revealed

that the GAT domain was sufficient for the interaction

between DdTom1 and ubiquitin (Figure 1E). Note that

human GGA3 was used here as a positive control of the

interaction with ubiquitin as GGA3 was reported to interact

more efficiently with ubiquitin than GGAs (33).

The VHS and GAT domains of GGAs were recently

reported to interact with phosphoinositides (34). This

result prompted us to determine the lipid-binding proper-

ties of DdTom1. A protein-lipid overlay assay was per-

formed in which purified GST-VHS and GST-GAT proteins

were used to probe a commercial nitrocellulose mem-

brane spotted with various immobilized phosphoinosides.

The VHS domain of DdTom1 mainly interacted with

phosphatidylinositol (PI)(3)P and PI(4)P, whereas the GAT

domain bound to PI(3)P, PI(4)P, PI(3,5)P2 and PI(4,5)P2

(Figure 2). Noteworthy, PI(3)P and PI(3,5)P2 are two

phospholipids that participate in the recruitment of the

ESCRT machinery to endosomal membranes. Hence, the

interaction of DdTom1 with these phosphoinositides could

ensure its recruitment to endomembranes.

Previous studies have established that human Tom1

interacts with clathrin mainly through a so-called ‘clathrin

box’ sequence (321DLIDMG326) within its C-terminal region

(21,35). Although this sequence is not conserved in

DdTom1, we examined whether the C-terminal domain

of DdTom1 interacted with clathrin. To this end, this

domain (residues 290–663) was appended to GST

(pFL839; Figure 3A). This GST fusion protein bound to

glutathione-Sepharose beads was incubated with Dictyos-

telium cell lysates. Bound proteins were immunoblotted

with an anti-clathrin heavy chain (CHC) polyclonal antibody.

As shown in Figure 3B, the C-terminal fragment of

DdTom1 interacted with clathrin, while the VHS and GAT

domains (pFL826) did not. Deletion of the first 181

residues from the C-terminal domain abrogated this in-

teraction (pFL840). Finally, we noticed the sequence351ELEEID356, which is reminiscent to clathrin box sequen-

ces. Indeed, when fused to GST (pFL952), this sequence

was sufficient to interact with clathrin (Figure 3B).

In conclusion, the VHS and GAT domains of mammalian

and DdTom1 appear to display common functional charac-

teristics reinforcing the notion that this unique Dictyoste-

lium VHS-containing protein is related to the mammalian

Tom1 family of proteins.

DdTom1 interacts with DdEps15

Detailed sequence analysis revealed that the DdTom1

C-terminal domain contains three copies of the amino acid

triplet Asparagine, Proline, and Phenylalanine (NPF) (at

position 386, 458 and 528; Figure 3A). NPF repeats are

known to bind Eps15 through its N-terminal region that

contains three copies of the Eps15 homology (EH) domain

(36,37). Eps15 is an essential adaptor protein (AP) of

clathrin-mediated endocytic machinery. It directly interacts

with the AP-2 complex and is involved in the formation of

Figure 2: The VHS and GAT domains of DdTom1 bind to

phospholipids in a protein-lipid overlay assay. Lipid blot

membranes (PIP strips) containing the following samples in

100 pmol spots were used: lysophosphatidic acid (LPA), lysophos-

phocholine (LPC), PtdIns(PI), PtdIns(3)P [PI(3)P], PtdIns(4)P

[PI(4)P], PtdIns(5)P [PI(5)P], phosphatidylethanolamine (PE),

phosphatidylcholine (PC), sphingosine1-phosphate (S1P), PtdIns

(3,4)P2 [PI(3,4)P2], PtdIns(3,5)P2 [PI(3,5)P2], PtdIns(4,5)P2

[PI(4,5)P2], PtdIns(3,4,5)P3 [PI(3,4,5)P3], PA, phosphatidylserine

(PS) and Blank. PIP strips were incubated with 1 mg/mL of GST-

VHS and GST-GAT fusion proteins. Bound proteins were detected

by western blot using anti-GST antibody. Incubation with GST

alone, used as a negative control, gave no signal.

Figure 3: Interaction between DdTom1 and clathrin. A) Sche-

matic representation of DdTom1 domains fused to GST. Con-

structs were given a name (e.g. pFL826) as indicated on the left.

The positions of the clathrin box and NPF sequences are indicated.

B) Clathrin in vitro binding assay. Dictyostelium cell lysates were

incubated with glutathione-Sepharose beads containing the indi-

cated GST fusion proteins. Bound proteins were analyzed by

immunoblotting with an anti-CHC polyclonal antibody.

Traffic 2009; 10: 161–171 163

Dictyostelium Tom1

clathrin-coated pits (38–40). In addition, Eps15 has been

show to form a ternary complex with Hrs and STAM (3),

two components of the ESCRT-0 complex, suggesting

a role for Eps15 in ubiquitinated cargo sorting. Recently, an

isoform of Eps15 restricted to endosomeswas also shown

to interact with Hrs (4). However, no interaction between

Eps15 and mammalian GGAs or Tom1 has been reported

so far. Interestingly, we identified a potential ortholog of

mammalian Eps15 in the Dictyostelium genome. Dictyos-

telium Eps15 (geneDDB0238505) (Figure 4A) also con-

tains three copies of the EH domain, a coil-coiled

domain, DPF motifs for binding to AP2 but no ubiquitin-

interacting motif; however, its function has not yet been

characterized in Dictyostelium.

To determine whether DdTom1 interacted with DdEps15,

we first performed GST pull-down experiments. As shown

in Figure 4B, GFP-tagged DdEps15 expressed in Dictyos-

telium cells was pulled-down from cell lysates with

GST-DdTom1 C-terminal domain bound to glutathione-

Sepharose beads. This in vitro interaction between

DdTom1 and DdEps15 was confirmed by immunoprecip-

itation studies. Indeed, lysates from cells overexpressing

myc-tagged DdTom1 were immunoprecipitated with an

anti-myc antibody and immunoblotting of bound protein

with a rabbit polyclonal anti-DdEps15 revealed a faint but

consistent interaction between both proteins (Figure 4C).

DdTom1 interacts with DdTsg101, a component

of the ESCRT-I complex

The fact that DdTom1 interacts with ubiquitin suggested

that DdTom1 could participate in the sorting of ubiquiti-

nated proteins into multivesicular bodies. In addition, one

mammalian member of the Tom1 family, Tom1L1 was

reported to interact with Tsg101, a component of the

multisubunit complex termed ESCRT-I involved in MVB

vesicle formation (24). Orthologs of the ESCRT machinery

are present in Dictyostelium (16). In particular, DdTsg101

(DDB0218848) presents the same domain organization as

mammalian Tsg101 with, for instance, the presence of

a ubiquitin E2 variant domain (UEV) domain known to bind

both ubiquitin and the Proline, Threonine, Alanine, Proline/

Proline, Serine, Alanine, Proline (PTAP/PSAP) tetrapeptide

motif found in some viral proteins, Hrs and Tom1L1

(3,24,41,42).

To test the interaction between DdTom1 and DdTsg101,

GST pull-down experiments were performed (Figure 5B).

When total Dictyostelium cell lysates were incubated with

GST-DdTom1 C-terminal domain (pFL839, Figure 5A)

Figure 4: Interaction between DdTom1 and DdEps15. A)

Schematic representation of human and DdEps15. Both proteins

share a same domain organization, three EH domains, a coil-coiled

(CC) domain and DPF motifs binding to AP2. However, DdEPs15

has no ubiquitin-interacting motif (UIM). B) DdEps15 in vitro

binding assay. Lysates of cells expressing the GFP-DdEps15

chimera were incubated with glutathione-Sepharose beads con-

taining the indicated GST fusion proteins. Bound proteins were

analyzed by immunoblotting with a monoclonal anti-GFP antibody.

(C) Co-immunoprecipitation between DdTom1 and DdEps15. Total

lysates from cells expressing myc-DdTom1 were immunoprecipi-

tated with an anti-myc monoclonal antibody (9E10) coated on

protein G-Sepharose beads. Bound proteins were detected by

immunoblotting with a rabbit anti-Eps15 polyclonal antibody.

Figure 5: Analysis of the interaction between DdTom1 and

DdTsg101. A) Schematic representation of DdTom1 domains

fused to GST. The positions of the clathrin box and PSAP

sequences are indicated. B) DdTsg101 in vitro binding assay.

Dictyostelium cell lysateswere incubatedwith glutathione-Sepharose

beads containing the indicated GST fusion proteins. Bound

proteins were analyzed by immunoblotting with an anti-DdTsg101

polyclonal antibody. C) Co-immunoprecipitation between DdTom1

and DdEps15. Total lysates from cells expressing myc-DdTom1

were immunoprecipitated with an anti-myc monoclonal antibody

(9E10) coated on protein G–Sepharose beads. Bound proteins

were detected by immunoblotting with an anti-DdTsg101 poly-

clonal antibody. Signals from total lysates of DH1 (wild-type cells)

and Tsg101 knockout cells (DTsg101) are shown to demonstrate

the specificity of the anti-DdTsg101 antibody. D) GST-DdTom1

pull-down experiments from cells expressing native or mutated

DdTsg101. Lysates from cells expressing myc-tagged native or

mutated DdTsg101 were incubated with the indicated GST fusion

proteins. Bound proteins were revealed by immunoblotting with

an anti-myc monoclonal antibody.

164 Traffic 2009; 10: 161–171

Blanc et al.

bound to glutathione-Sepharose beads, immunoblotting

with a polyclonal anti-DdTsg101 rabbit antiserum revealed

the presence of DdTsg101 on the beads. This interaction

was not mediated through clathrin because deletion of the

clathrin box (pFL912) had no effect on the binding of

DdTsg101. However, mutation of a 514PSAP517 tetrapeptide

found in DdTom1 C-terminal domain (pFL913, Figure 5A)

completely abrogated DdTsg101 binding. In addition,

DdTsg101 could be coprecipitated from lysates of cells

overexpressing myc-tagged DdTom1 (Figure 5C). As ex-

pected, the interaction between DdTsg101 and DdTom1

wasmediated through the UEV domain of Tsg101. Indeed,

in pull-down experiments with GST-DdTom1 C-terminal

domain (pFL839), deletion of the UEV domain or mutation

of a residue (M117A) conserved within UEVs of different

species, prevented DdTsg101 interaction, whereas the

UEV expressed alone was sufficient to interact with

DdTom1 (Figure 5D).

DdTom1 localizes within cytoplasmic punctae

The interaction of DdTom1 with phosphoinositides sug-

gested that DdTom1 associated with membranes in vivo.

To examine its subcellular localization, DdTom1 was

tagged with GFP and expressed in Dictyostelium cells.

Fluorescence microscopy analysis revealed that GFP-

DdTom1 localized in discrete punctae throughout the

cytoplasm (Figure 6). These punctae of heterogeneous

size were distinct from endocytic vacuoles expressing

the integral protein p80 (43). In addition, GFP-DdTom1

did not colocalize with p25 (Figure 6), a protein that is

continuously internalized, concentrated in recycling

endosomes and recycled back to the plasma membrane

(44).

As DdTom1 binds ubiquitin in vitro, we next assessed

whether DdTom1 colocalized with ubiquitinated proteins.

GFP-DdTom1 expressing cells were stained with a mono-

clonal antibody to ubiquitinated proteins (FK2). As obser-

ved in Figure 6, GFP-DdTom1 colocalized with ubiquitin,

although not all ubiquitin-labeled compartments contained

GFP-DdTom1.

Together these results suggest the existence of a new

membrane compartment, distinct from the previously

described p25- and p80-positive endosomes. DdTom1

would be specifically localized in this compartment, as

well as ubiquitinated proteins, an observation compa-

tible with the notion that DdTom1 may participate in the

sorting of ubiqutinated proteins in Dictyostelium. However,

we cannot formally exclude that the overexpression of

GFP-DdTom1 may result in an inadequate intracellular

localization, although identical results were obtained

with DdTom1 null cells (see below) complemented with

GFP-DdTom1 (data not shown).

Deletion of DdTom1 has no effect on the

morphology of endocytic compartments

To determine the function of Tom1 in Dictyostelium, the

gene encoding DdTom1 was disrupted by targeted inte-

gration of the blasticidin selection marker. The resulting

DTom1 cells did not express the DdTom1 protein as tested

by immunoblotting with an anti-DdTom1 rabbit antiserum

(Figure 7A). DTom1 cells were viable and grew as wild-

type cells on bacterial lawns (data not shown). Upon

nutrient depletion, Dictyostelium cells aggregate and pro-

ceed to a developmental cycle leading to the formation of

fruiting bodies. This process was not altered in DTom1

cells (data not shown). However, we noticed a slight

decrease in the internalization rate of fluorescein isothio-

cyanate-dextran used as a marker of fluid-phase endocy-

tosis (Figure 7B). This result suggests that DdTom1 is

indeed involved in the function of the endocytic pathway in

Dictyostelium.

In yeast, deletion of components of the ESCRT machinery

results in the formation of enlarged multilamellar ring-like

structures, which have been termed the class E compart-

ment (45,46). As DdTom1 is possibly connected to the

MVB formation machinery, deletion of DdTom1 might

affect the overall morphology and the number of endocytic

compartments. To assess this possibility, we analyzed the

Figure 6: Localization of GFP-tagged DdTom1. Dictyostelium

cells (DH1) expressing GFP-DdTom1 were processed for total

immunofluorescence and analyzed by confocal microscopy. GFP–

DdTom1was in found in punctae structures distinct from vacuoles

containing p80 and p25 endocytic markers. However, GFP–

DdTom1 colocalized with ubiquitinated proteins. Scale bar: 5 mm.

Traffic 2009; 10: 161–171 165

Dictyostelium Tom1

intracellular distribution of the endocytic marker p80.

In both DTom1 and wild-type (DH1) cells, p80 was similarly

distributed in vacuoles with low and high p80 contents

corresponding, respectively, to early and late endocytic

compartments (Figure 7C). In addition, the number and the

size of lysosomes and post-lysosomes, defined as p80-

positive/Hþ-ATPase-positive compartments and p80-posi-

tive/Hþ-ATPase-negative compartments, respectively (47),

were comparable in DTom1 and wild-type cells (Table 1).

We also analyzed the distribution of the endocytic marker

p25, a marker of recycling endosomes in Dictyostelium.

This protein was correctly addressed in DTom1 cells

(Figure 7C). In addition, staining of DTom1 cells with an

anti-ubiquitinated protein antibody (FK2) was comparable

with that observed in wild-type cells (Figure 7D), suggest-

ing that deletion of DdTom1 did not affect the sorting of

ubiquitinated proteins. Finally, the morphology of the

contractile vacuole, an osmoregulatory organelle, was

analyzed because a connection between endosomes and

this organelle has been reported (48). In both DTom1 and

wild-type cells, the Rhesus 50 (Rh50) protein (Figure 7C)

and the proton ATPase (data not shown), two markers of

this intracellular compartment, were localized to the con-

tractile vacuole, and no morphological alteration of the

compartment was apparent.

We next tested whether the formation of MVBs was

affected in DTom1 cells. For this purpose, we took

advantage of the drug U18666A (U18) known to stimulate

intra-endosomal budding and to lead to the accumulation

of enlarged endosomes filled with membranousmaterial in

mammalian (49) and Dictyostelium cells (50). To test

whether DdTom1 was required for the formation of these

multivesicular endosomes induced by U18, both DTom1

and wild-type cells were treated with U18 and analyzed by

thin sections electron microscopy. After 10 min of treat-

ment with U18, intralumenal budding was observed in

both cell types and longer treatment resulted in compara-

ble formation of multivesicular endosomes (Figure 8). This

result suggests that DdTom1 is not required for the

formation of U18-induced MVBs. However, we cannot

rule out that subtle morphological or quantitative differ-

ences might have been overlooked.

Discussion

In this study, we report the characterization of Tom1 as

the only protein containing a VHS domain in the model

organism D. discoideum. This exceptional situation

provides a unique cellular model to study the role of

VHS-containing proteins in membrane traffic. By analyz-

ing the network of protein interactions made by

DdTom1, we propose that this protein could serve as

a receptor for ubiquitinated proteins and make a

Figure 7: Analysis of cells with no expression of DdTom1. A)

Detection of DdTom1 by immunoblotting. Lysates fromDH1 (wild-

type) and DTom1 (DdTom1 null) cells were analyzed by 10% SDS–

PAGE and processed for immunoblotting with anti-Tom1 (upper

panel) or anti-p80 (lower panel)-specific rabbit antibodies. B) Fluid-

phase endocytosis. Cells were incubated with fresh HL5 medium

containing 0.5 mg/mL fluorescein isothiocyanate-dextran for

20 min, then washed twice with ice-cold HL5 and analyzed using

a fluorescence spectrofluorometer. Results are expressed as% of

internalization in comparison to DH1 (wild-type cells) and are the

means of three independent experiments. C) Localization of p25,

p80 and Rh50 in DTom1 cells. The indicated cells were processed

for total immunofluorescence and analyzed by confocal micros-

copy. The p25 protein is shown in red, the p80 protein in green and

the Rh50 protein in blue. D) Localization of ubiquitinated proteins

in DTom1 cells. Staining of DTom1 cells with an anti-ubiquitinated

protein antibody (FK2) was comparable with that observed in wild-

type cells. Scale bars: 5 mm.

Table 1: Number and size of lysosomes and post-lysosomes in

DH1 and DTom1 cells

Cells Lysosomes Post-lysosomes

Number

per cell

Size (mm) Number

per cell

Size (mm)

DH1 8.57 � 0.32 1.38 � 0.08 2.29 � 0.08 1.83 � 0.08

DTom1 9.08 � 0.45 1.30 � 0.05 2.17 � 0.08 1.61 � 0.03

166 Traffic 2009; 10: 161–171

Blanc et al.

connection with ESCRT complexes implicated in the

biogenesis of MVBs.

Life without GGAs

Protein transport between compartments of the endocytic

and secretory pathways relies on vesicles covered with

cytosolic coat proteins (51,52). Among these coat proteins,

clathrin associated with APs participate in cargo protein

sorting and vesicle formation (53,54). Major components

of clathrin coats are heterotetrameric adaptor complexes

(AP), which connect clathrin and cargo proteins (55).

Besides these conventional adaptors, the monomeric

clathrin adaptors GGAs also participate in vesicule bud-

ding, mainly at the level of the Golgi apparatus in yeast and

mammalian cells (56,57). Indeed, the VHS domains of

mammalian GGAs were shown to interact with acidic-

cluster-dileucine signals, D/EXXLL, found in the M6PRs

and several other receptors (15,29,58–60). The exact role

and relative importance of APs and GGAs clathrin adaptors

in cargo sorting is still a debated issue. Both families of

adaptors could either cooperate in packaging cargo in

clathrin-coated vesicles or allow cargo delivery to different

destinations (56,57).

As observed in mammalian cells, Dictyostelium contains

four adaptor complexes (AP-1 to AP-4) (61) but no GGAs

orthologs are present. Instead, the only monomeric cla-

thrin adaptor with a VHS domain found in Dictyostelium is

a protein homologous to mammalian Tom1 comprised of

juxtaposed VHS and GAT domains. At least three possibil-

ities could explain how Dictyostelium can survive without

GGAs. First, Dictyostelium may have a simpler organiza-

tion of the endocytic pathway in comparison with mam-

malian cells and therefore may not require diversified cargo

packaging possibilities. Second, GGAs could be dispens-

able for cargo sorting and clathrin-coated vesicle forma-

tion, APs being the main actors in this process. This

hypothesis is consistent with the possibility that in mam-

malian cells, GGAs may have only an intermediary role in

the transfer of cargo to APs during the packaging into

forming vesicles (56,57). Therefore, the ancestral cargo

packaging machinery found in Dictyostelium would rely

only on APs, whereas GGAs, which appeared later in

evolution (17), would have brought an additional step

improving cargo sorting. Third, Tom1 could functionally

replace GGAs in Dictyostelium. In view of our results, we

do not favor this third model as we show that contrary to

GGAs, the VHS domain of DdTom1 does not interact with

acidic-cluster-dileucine sorting signals and its GAT domain

does not bind the small GTPase ARF1. Thus, DdTom1

does not appear to be a functional homolog of GGAs,

although they both bind ubiquitin. Phylogenic studies have

indicated that Dictyostelium diverged from the line leading

to animals shortly after the plant–animal split, and before

the divergence of fungi (62). In plants, the same situation

as in Dictyostelium is observed as they do not contain

GGAs (17) but display all four APs (63). However, plants

show an expanded Tom1 family of proteins with nine

members identified in Arabidopsis (17). In this case, life

without GGAs could be explained by the possibility that

some Tom1 family members may have evolved indepen-

dently to acquire functional properties similar to GGAs or

more appropriate to plant physiology.

Figure 8: Structure of multivesicular endosomes induced by

U18 in DTom1 cells. DH1 (wild-type) and DTom1 cells were

incubated in HL5 medium containing U18 for the indicated times

and processed for electron microscopy. The formation of multi-

vesicular endosomes induced by U18 does not required DdTom1.

Scale bar: 0.5 mm.

Figure 9: Models for Tom1 complexes in mammalian and

Dictyostelium cells. A) In mammalian cells, Tom1 binds ubiquitin

(Ub), indicated by a flag, and clathrin and is recruited to endosomal

membranes through Tollip, which also binds ubiquitin. B) In

Dictyostelium cell, DdTom1 interacts with ubiquitin and clathrin.

As Tollip is not present in the Dictyostelium genome, we propose

that the recruitment of DdTom1 to endosomal membranes might

rely on DdEps15 in addition a direct interaction of DdTom1 with

membrane lipids. The ancestral ESCRT-0 complex would thus be

composed of Tom1, clathrin and Eps15.

Traffic 2009; 10: 161–171 167

Dictyostelium Tom1

Tom1, a component of an ancestral

ESCRT-0 complex

The biogenesis of MVBs has been shown to depend on

protein complexes known as ESCRT-I, II and III in yeast

and mammalian cells. Subunits of these ESCRT com-

plexes are found in other organisms including plants,

Drosophila melanogaster, Caenorhabditis elegans and

D. discoideum (16–18). Upstream of this machinery,

a cargo recognition and sorting system ensures the loading

of the MVBs formation machinery with monoubiquitinated

cargos destined to degradation. This complex is often

named ESCRT-0 and is composed of ubiquitin-binding

proteins (Hrs, STAM, GGAs and Tom1), which all contain

a VHS domain. Of these proteins, plants and Dictyostelium

only present in their genomes genes encoding the Tom1

family of proteins. This suggests that in these organisms,

Tom1 proteins could be components of an ancestral

complex contributing to the sorting of ubiquinated proteins

to the MVB formation machinery. Our study provides the

first indications supporting this hypothesis. Indeed, here

we present in vitro evidences that DdTom1 may provide

the same functions as mammalian Tom1 in interacting

with ubiquitin, clathrin and recruiting Tsg101, a component

of the ESCRT-I complex. In mammalian cells, while Hrs is

recruited to endosomal membranes through a direct interac-

tion with phosphoinositides, recruitment of Tom1 on endo-

somes depends on two membrane-docking proteins, Tollip

(21,22) andEndofin (35,64). InDictyostelium, no orthologs of

these proteins are found in its genome; however, we show

here that DdTom1 associates with endomembranes in vivo.

Consequently, the recruitment of DdTom1 to membranes

might be ensured by another protein or by DdTom1 itself.

Here, we reveal that the VHS and GAT domains of DdTom1

interact with phospholipids in vitro. This interaction with

phospholipids could be thus sufficient to DdTom1 mem-

brane recruitment. Interestingly, mammalian Eps15 was

recently shown to interact directly to membrane by phos-

phoinositols through its EH domains (65). As our work

establishes that Eps15 interacts with DdTom1, we propose

that the recruitment of Tom1 to endosomal membranes

might also rely on Eps15 in Dictyostelium cells, whereas in

mammalian cells no interaction between Tom1 and Eps15 is

reported. To our knowledge, an interaction between mam-

malian Tom1 and lipids has never been reported. In conclu-

sion, the absence of VHS-containing proteins such as Hrs,

STAM and GGAs in Dictyostelium has allowed us to reveal

for the first time, that Tom1 can be part of the MVB sorting

machinery. This ancestral ESCRT-0 complex (see the pro-

posedmodel in Figure 9) would be thus composed of Tom1,

Eps15 and clathrin proteins (although we cannot formally

exclude the presence of other proteins not yet identified)

and might still operate in fungi and mammalian cells where

other VHS-domain-containing proteins have brought addi-

tional ubiquitin-binding capacities.

As Tom1 is the only GGA-like protein in Dictyostelium and

seems to play a central role in the formation of an ancestral

ESCRT-0 complex, this would seem like an ideal situation

to evaluate the role(s) of GGA proteins in intracellular

transport. It is thus striking that DdTom1 knockout cells

show virtually no phenotypic alterations. Indeed, in

DdTom1 null cells, the overall morphology and the number

of endocytic compartments was unaffected, MVBs still

formed correctly and ubiquitinated proteins did not accumu-

late in endosomal compartments. Therefore inDictyostelium

cells, the ESCRT-0 complex appears dispensable for both

sorting of ubiquitinated proteins and formation of MVBs.

More generally, our results suggest that in Dictyostelium,

other elements of the cellular machinery (e.g. APs) can

achieve efficient transport and sorting in the endocytic

pathway in the total absence of GGA or GGA-like proteins.

This absence of apparent defect is reminiscent of that

observed in mammalian cells where depletion of Hrs,

a component of the ESCRT-0 complex, only causes a small

reduction in EGF degradation and does not prevent the

formation of MVBs (66). Furthermore, several mammalian

proteins are also delivered to lysosomes independently of

Hrs (67–69), indicating that Hrs-containing ESCRT-0 com-

plexes might be dispensable for the sorting of a number of

cargo proteins. As Dictyostelium has no alternative

ESCRT-0 complex because of the absence of other VHS-

containing proteins besides DdTom1, our results raise the

possibility that ubiquinated proteins could enter the ESCRT

machinery by alternative routes, for instance through

a direct interaction with ESCRT-I components. Our results

also emphasize the possibility that, identically to mamma-

lian cells, ESCRT-independent mechanisms could be at

play in Dictyostelium for protein targeting to lysosomes.

Dictyostelium may be thus a valuable cellular model to

study GGA-independent sorting mechanisms in the endo-

cytic pathway. Although our results rather stress the

limited role of DdTom1, it seems likely that this unique

GGA-like protein does play a role in a process that remains

to be characterized. The only (weak) phenotype observed

in DdTom1 null cells is a decrease in fluid-phase endocy-

tosis, suggesting that Tom1 does participate to an endo-

somal function in Dictyostelium. A more detailed analysis

of the organization of the endocytic pathway inDictyostelium

will be necessary to identify the ancestral function of this

unique GGA-like protein.

Materials and Methods

Cell culture, antibodies and immunofluorescence

microscopyD. discoideum strain DH1-10 (70) was grown at 228C in HL5 medium and

subcultured twice a week. Cells were not allowed to reach a density of

more than 2 � 106 cells/mL. For anti-Tom1 and anti-Eps15 rabbit antisera

production, the Tom1 VHS–GAT domain and the Eps15 third EH domain,

respectively, were fused to GST after cloning into the pGEX4T1 vector

(Amersham Pharmacia), produced in BL21-DE3 bacteria (3 h, 248C, 100 mM

IPTG) and purified on glutathione-Sepharose beads. Rabbits were injected

with eluted recombinant proteins and sera collected after 54 days (Centre

168 Traffic 2009; 10: 161–171

Blanc et al.

Valbex). The specificity of the antibodies was checked on DTom1 and

DEps15 knockout strains respectively.

For anti-Tsg101 rabbit antiserum production, full-length Tsg101 cDNA was

subcloned in the BamHI and HindIII sites of pQE30 (Qiagen) or pGEX-KG

(Amersham Pharmacia) in frame with the 6� His or GST tags carried by the

vectors respectively. The proteins were expressed in BL21-DE3 bacteria (3 h,

378C, 100 mM IPTG) and purified on Ni-NTA agarose (His-Tsg101) or glutathi-

one-Sepharose (GST-Tsg101) affinity columns. His-Tsg101 was used to

immunize New Zealand White rabbits. The 81-day serum was then purified

on the GST-Tsg101 crosslinked to the glutathione-Sepharose column. The

specificity of the antibody was checked on the DTsg101 knockout strain.

Mouse monoclonal antibodies against the p80 endosomal marker (H161),

p25 (H72), were described previously (43). Rabbit polyclonal antibody

against the Rh50 was also described before (71). Rabbit polyclonal antibody

to CHC was a gift from T. O‘Halloran (University of Texas, Austin, TX, USA).

221-35-2 is a mouse monoclonal antibody recognizing the vacuolar

Hþ-ATPase (72) and was a generous gift of G. Gerisch (Max-Planck-

Institute, Martinsried, Germany). Monoclonal antibodies to GFP and myc

(9E10) were purchased (Roche Diagnostics) as well as the monoclonal

antibody to ubiquitinated proteins (clone FK2; tebu-bio SAS).

For immunofluorescence analysis, cells were applied on a glass coverslip

for 2 h, then fixed with 4% paraformaldehyde for 30 min, washed and

permeabilized with methanol at�208C for 2 min. Cells were incubated with

the indicated antibodies for 30 min and then stained with corresponding

fluorescent secondary antibodies for 30 min. Cells were observed by laser

scanning confocal microscopy (Zeiss LSM 510). In co-labeling experiment

with H161 antibody and other antibodies, the H161 antibody was coupled

beforehand with Alexa Fluor 488 (Molecular Probes/Invitrogen) and incu-

bated with the fixed cells subsequent to cell labeling with other primary and

secondary antibodies.

Electron microscopyCells were incubated in HL5 medium containing 20 mg/mL U18866A (tebu-

bio SAS) as indicated. Cells were then fixed for 1 h in HL5 containing 2%

glutaraldehyde and 0.3% osmium tetroxide. Cells were then embedded in

Epon resin and processed for conventional electron microscopy as

described previously (73).

Yeast two-hybrid assaysTwo-hydrid assays were carried out using the Matchmaker GAL4 two-

hybrid system (Clonetech Laboratories Inc). The Saccharomyces cerevisiae

strain HF7c was transfected with the indicated constructs in figures.

Constructs pGBT9-CI-M6PR, pGBT9-ARF1 Q71L, pGBT9-Ub, pGAD-

GGA1-VHS-GAT, pGAD-GGA3-VHS-GAT were a gift of Dr J. Bonifacino

(NIH). The vector pAD-human Tom1-VHS-GAT was a gift of Dr H. Yokosawa

(Hokkaido University, Sapporo, Japan). DdTom1–VHS–GAT domains were

cloned into pGAD424 and sequenced. For colony growth assays, colonies

of HF7c transfectants were resuspended in water to 0.1 O.D600/mL, then

5 mL were applied on plates lacking leucine and tryptophane or leucine,

tryptophane and histidine, and allowed to grow at 308C for 3–4 days.

Plasmids and cell transfectionFull-length Tom1 and Eps15 were produced by polymerase chain reaction

(PCR) using pairs of oligonucleotides containing BamHI and XhoI sites in 50

and 30, respectively. PCR fragments were digested by BamHI and XhoI and

cloned into BamHI/XhoI sites of pDXA-GFP2 (74) or pDXD-3C (75) contain-

ing a double myc-tag inserted at the KpnI–SacI sites for N-terminal fusion.

All constructs were sequenced (Genome Express). Plasmids were linear-

ized by ScaI and transfected in Dictyostelium by electroporation as

described (70). The Tsg101-derived constructs were made in pExp4þ

(neomycin resistance neor), using the actin15 promoter to control expres-

sion. All the constructs were generated by PCR using genomic DNA as

template and were verified by sequencing. Full-length proteins Tsg101 (aa

1–495) and Tsg101M117A (aa 1–495) and deletion mutants UEV (aa 1–170)

and Tsg101DUEV (aa 161–495) were tagged at their C-terminus with

a double myc epitope. Point mutation in the Tsg101M117A construct was

generated by PCR using oligonucleotides carrying the Met (atg) to Ala (gca)

point mutation as well as a silent mutation introducing an XbaI site at

position 515 of the cDNA to facilitate subcloning.

Immunoprecipitation, binding assay,

and western blottingFor immunoprecipitations, 2 � 107 cells were lysed in lysis buffer (50 mM

HEPES pH7.3, 90 mM KCl, 0.5% Triton-X-100, protease inhibitors) and

cleared by centrifugation for 15 min at 16 000 � g in a microfuge. Lysates

were incubated overnight at 48C with anti-myc antibody coated on Gamma-

bind Sepharose beads (Amersham Pharmacia). The beads were then

washed three times in lysis buffer and once in 50 mM HEPES (pH7.3). For

GST fusion proteins, the cDNA sequences encoding the indicated domains of

DdTom1 (Figures 2 and 3) were subcloned in the BamHI and XhoI sites of

pGEX-4T1 (Amersham Pharmacia) in frame with the GST sequence. The

proteins were expressed in BL21-DE3 bacteria (2 h, 308C, 100 mM IPTG) and

purified on glutathione-Sepharose beads. For binding assays, beads were

incubated for 2 h at 48Cwith cell lysates (2 � 107 cells/condition) prepared in

Tris–Triton buffer (50 mM Tris–HCl, pH 7.3, 300 mM NaCl, 0.5% Triton-X-100,

protease inhibitors). Beads were then washed five times in wash buffer

(50 mM Tris–HCl, pH 7.3, 300 mM NaCl, 0.1% Triton-X-100) and once in PBS.

For both immunoprecipitation and binding assays, bound proteins were

analyzed by immunoblots. SDS–PAGE and immunoblotting were performed

as previously described (70). Bands were visualized using an ECF kit

(Amersham Pharmacia).

Lipid dot-blotLipid dot-blot assays were performed on PIP Strips (Echelon Biosciences

Inc.) according to the manufacturer. Purified GST fusion proteins were

incubated at 1 mg/mL with PIP strip membranes overnight at 48C. Afterseveral washes, bound proteins were analyzed by western blot with anti-

GST antibodies (Sigma Aldrich).

Knockout cellsTo obtain the Tom1 knockout vector, the 50 fragment (including two introns)

was amplified from genomic DNA with sense (ATGGTTACAGAATTAGTT-

GATAAA) and antisense (TTTTATACAAGCTTCATGATCATTTA) oligonucleo-

tides and cloned into pBlueScript vector (Stratagene). The 30 fragment was

obtained by PCR using sense (CTAAATGATCATGAAGCTTGTATAAAA) and

antisense (TTAAATAAGAGATGATTTACCACTCATATT) oligonucleotides and

cloned in pBlueScript containing the 50 fragment. To obtain the Eps15

knockout vector, the 50 fragment was amplified from genomic DNA with

sense (TGGATAATAAGTAATGGTGAAAAACAA) and antisense (TTGAG-

GAAGTGATTGAGGTAATTCTTT) oligonucleotides and cloned into pBlue-

Script vector. The 30 fragment was obtained by PCR using sense

(AATAAACAACAAATCGAACAATTATTG) and antisense (ATTGTTTGATA-

CACTTTCACCACCAAA) oligonucleotides and cloned in pBlueScript contain-

ing the 50 fragment. The Tom1 and Eps15 knockout constructs were

completed by inserting the blasticidin resistance cassette between the

two 50 and 30 fragments. The resulting plasmids were linearized by digestion

with restriction enzymes (KpnI and NotI) and electroporated into DH1-10

cells. Transformants were selected in the presence of 10 mg/mL blasticidin.

Individual colonies were tested by PCR. The absence of expression of Tom1

and Eps15 mRNAs and proteins was then verified, respectively, by RT-PCR

and western blotting with anti-Tom1 or anti-Eps15 antibodies.

To obtain the Tsg101 knockout vector, the 50 and 30 fragments were

amplified by PCR from genomic DNA with the following oligonucleotide

pairs: ATGTATGGTCATCATGGATAC/AACTAATCCCTGTAAATTTACATG and

ATCCATATATATCAAGTTGG/TATCCATTTCTCCAATTGTTC, respectively.

Both fragments were cloned into pSP72 (Promega) and the blasticidin

resistance cassette was then inserted between these fragments. For

transfection, the resulting plasmid was linearized by SphI and ScaI and

electroporated into KAx-3 cells. Individual colonies were tested by PCR and

western blotting with an anti-Tsg101 antibody.

Traffic 2009; 10: 161–171 169

Dictyostelium Tom1

Acknowledgments

We thank Dr P. Rousselle (IBCP) for critical reading of the manuscript. This

work was supported by grants from the Association pour la Recherche

contre le Cancer (ARC), and the ‘Cible’ program of the Region Rhone-Alpes.

CB was supported by a predoctoral fellowship from the ARC. S. J. C.

received a fellowship from the Fondation Ernst et Lucie Schmidheiny.

P. C.’s laboratory is funded by the Fonds National Suisse pour la Recherche

Scientifique.

References

1. Bilodeau PS, Winistorfer SC, Kearney WR, Robertson AD, Piper RC.

Vps27-Hse1 and ESCRT-I complexes cooperate to increase efficiency

of sorting ubiquitinated proteins at the endosome. J Cell Biol 2003;163:

237–243.

2. Katzmann DJ, Stefan CJ, Babst M, Emr SD. Vps27 recruits ESCRT

machinery to endosomes during MVB sorting. J Cell Biol 2003;162:

413–423.

3. Bache KG, Raiborg C, Mehlum A, Stenmark H. STAM and Hrs are

subunits of a multivalent ubiquitin-binding complex on early endo-

somes. J Biol Chem 2003;278:12513–12521.

4. Roxrud I, Raiborg C, Pedersen NM, Stang E, Stenmark H. An endo-

somally localized isoform of Eps15 interacts with Hrs to mediate

degradation of epidermal growth factor receptor. J Cell Biol 2008;

180:1205–1218.

5. Hurley JH, Emr SD. The ESCRT complexes: structure and mechanism

of a membrane-trafficking network. Annu Rev Biophys Biomol Struct

2006;35:277–298.

6. Piper RC, Katzmann DJ. Biogenesis and function of multivesicular

bodies. Annu Rev Cell Dev Biol 2007;23:519–547.

7. Saksena S, Sun J, Chu T, Emr SD. ESCRTing proteins in the endocytic

pathway. Trends Biochem Sci 2007;32:561–573.

8. Williams RL, Urbe S. The emerging shape of the ESCRTmachinery. Nat

Rev Mol Cell Biol 2007;8:355–368.

9. Raiborg C, Malerød L, Pedersen NM, Stenmark H. Differential func-

tions of Hrs and ESCRT proteins in endocytic membrane trafficking.

Exp Cell Res 2008;314:801–813.

10. Lohi O, Lehto VP. VHS domain marks a group of proteins involved

in endocytosis and vesicular trafficking. FEBS Lett 1998;440:255–257.

11. Lohi O, Poussu A, Mao Y, Quiocho F, Lehto VP. VHS domain –

a longshoreman of vesicle lines. FEBS Lett 2002;513:19–23.

12. Dell’Angelica EC, Puertollano R, Mullins C, Aguilar RC, Vargas JD,

Hartnell LM, Bonifacino JS. GGAs: a family of ADP ribosylation factor-

binding proteins related to adaptors and associated with the Golgi

complex. J Cell Biol 2000;149:81–94.

13. Hirst J, Lui WW, Bright NA, Totty N, Seaman MN, Robinson MS.

A family of proteins with gamma-adaptin and VHS domains that

facilitate trafficking between the trans-Golgi network and the vacuo-

le/lysosome. J Cell Biol 2000;149:67–80.

14. Boman AL, Zhang C, Zhu X, Kahn RA. A family of ADP-ribosylation

factor effectors that can alter membrane transport through the trans-

Golgi. Mol Biol Cell 2000;11:1241–1255.

15. Puertollano R, Aguilar RC, Gorshkova I, Crouch RJ, Bonifacino JS.

Sorting of mannose 6-phosphate receptors mediated by the GGAs.

Science 2001;292:1712–1716.

16. Mattei S, Klein G, Satre M, Aubry L. Trafficking and develop-

mental signaling: Alix at the crossroads. Eur J Cell Biol 2006;85:

925–936.

17. Winter V, Hauser MT. Exploring the ESCRTing machinery in eukar-

yotes. Trends Plant Sci 2006;11:115–123.

18. Leung KF, Dacks JB, Field MC. Evolution of the multivesicular body

ESCRT machinery; retention across the eukaryotic lineage. Traffic

2008;9:1698–1716.

19. Field MC, Gabernet-Castello C, Dacks JB. Reconstructing the evolution

of the endocytic system: insights from genomics and molecular cell

biology. Adv Exp Med Biol 2007;607:84–96.

20. Raiborg C, Bache KG, Gillooly DJ, Madshus IH, Stang E, Stenmark H.

Hrs sorts ubiquitinated proteins into clathrin-coated microdomains of

early endosomes. Nat Cell Biol 2002;4:394–398.

21. Yamakami M, Yoshimori T, Yokosawa H. Tom1, a VHS domain-

containing protein, interacts with tollip, ubiquitin, and clathrin. J Biol

Chem 2003;278:52865–52872.

22. Katoh Y, Shiba Y, Mitsuhashi H, Yanagida Y, Takatsu H, Nakayama KJ.

Tollip and Tom1 form a complex and recruit ubiquitin-conjugated

proteins onto early endosomes. J Biol Chem 2004;279:24435–24443.

23. Burns K, Clatworthy J, Martin L, Martinon F, Plumpton C, Maschera B,

Lewis A, Ray K, Tschopp J, Volpe F. Tollip, a new component of the

IL-1RI pathway, links IRAK to the IL-1 receptor. Nat Cell Biol 2000;2:

346–351.

24. Puertollano R. Interactions of TOM1L1 with the multivesicular body

sorting machinery. J Biol Chem 2005;280:9258–9264.

25. Rupper A, Cardelli J. Regulation of phagocytosis and endo-phagosomal

trafficking pathways in Dictyostelium discoideum. Biochim Biophys

Acta 2001;1525:205–216.

26. Misra S, Puertollano R, Kato Y, Bonifacino JS, Hurley JH. Structural

basis for acidic-cluster-dileucine sorting-signal recognition by VHS

domains. Nature 2002;415:933–937.

27. Shiba T, Takatsu H, Nogi T, Matsugaki N, Kawasaki M, Igarashi N,

Suzuki M, Kato R, Earnest T, Nakayama K, Wakatsuki S. Structural

basis for recognition of acidic-cluster dileucine sequence by GGA1.

Nature 2002;415:937–941.

28. Zhu G, Zhai P, He X, Terzyan S, Zhang R, Joachimiak A, Tang J. Zhang XC.

Crystal structure of the human GGA1 GAT domain. Biochemistry 2003;

42:6392–6399.

29. Takatsu H, Katoh Y, Shiba Y, Nakayama K. Golgi-localizing, gamma-

adaptin ear homology domain, ADP-ribosylation factor-binding (GGA)

proteins interact with acidic dileucine sequences within the cytoplas-

mic domains of sorting receptors through their Vps27p/Hrs/STAM

(VHS) domains. J Biol Chem 2001;276:28541–28545.

30. Puertollano R, Randazzo PA, Presley JF, Hartnell LM, Bonifacino JS.

The GGAs promote ARF-dependent recruitment of clathrin to the TGN.

Cell 2001;105:93–102.

31. Takatsu H, Yoshino K, Toda K, Nakayama K. GGA proteins associate

with Golgi membranes through interaction between their GGAH

domains and ADP-ribosylation factors. Biochem J 2002;365:369–

378.

32. Shiba T, Kawasaki M, Takatsu H, Nogi T, Matsugaki N, Igarashi N,

Suzuki M, Kato R, Nakayama K, Wakatsuki S. Molecular mechanism of

membrane recruitment of GGA by ARF in lysosomal protein transport.

Nat Struct Biol 2003;10:386–393.

33. Puertollano R, Bonifacino JS. Interactions of GGA3 with the ubiquitin

sorting machinery. Nat Cell Biol 2004;6:244–251.

34. Wang J, Sun HQ, Macia E, Kirchhausen T, Watson H, Bonifacino JS,

Yin HL. PI4P promotes the recruitment of the GGA adaptor proteins to

the trans-Golgi network and regulates their recognition of the ubiquitin

sorting signal. Mol Biol Cell 2007;18:2646–2655.

35. Seet LF, Hong W. Endofin recruits clathrin to early endosomes via

TOM1. J Cell Sci 2005;118:575–587.

36. Confalonieri S, Di Fiore PP. The Eps15 homology (EH) domain. FEBS

Lett 2002;513:24–29.

37. Polo S, Confalonieri S, Salcini AE, Di Fiore PP. EH and UIM: endocytosis

and more. Sci STKE 2003;2003:re17.

170 Traffic 2009; 10: 161–171

Blanc et al.

38. Benmerah A, Lamaze C, Begue B, Schmid SL, Dautry-Varsat A,

Cerf-Bensussan N. AP-2/Eps15 interaction is required for receptor-

mediated endocytosis. J Cell Biol 1998;140:1055–1062.

39. Benmerah A, Bayrou M, Cerf-Bensussan N, Dautry-Varsat A. Inhibition

of clathrin-coated pit assembly by an Eps15 mutant. J Cell Sci 1999;

112:1303–1311.

40. Benmerah A, Poupon V, Cerf-Bensussan N, Dautry-Varsat A. Mapping

of Eps15 domains involved in its targeting to clathrin-coated pits. J Biol

Chem 2000;275:3288–3295.

41. Martin-Serrano J, Zang T, Bieniasz PD. HIV-1 and Ebola virus encode

small peptide motifs that recruit Tsg101 to sites of particle assembly to

facilitate egress. Nat Med 2001;7:1313–1319.

42. Garrus JE, von Schwedler UK, Pornillos OW, Morham SG, Zavitz KH,

Wang HE, Wettstein DA, Stray KM, Cote M, Rich RL, Myszka DG,

Sundquist WI. Tsg101 and the vacuolar protein sorting pathway are

essential for HIV-1 budding. Cell 2001;107:55–65.

43. Ravanel K, de Chassey B, Cornillon S, Benghezal M, Zulianello L,

Gebbie L, Letourneur F, Cosson P. Membrane sorting in the endocytic

and phagocytic pathway of Dictyostelium discoideum. Eur J Cell Biol

2001;80:754–764.

44. Charette SJ, Mercanti V, Letourneur F, Bennett N, Cosson P. A role for

adaptor protein-3 complex in the organization of the endocytic pathway

in Dictyostelium. Traffic 2006;7:1528–1538.

45. Raymond CK, Howald-Stevenson I, Vater CA, Stevens TH. Morpho-

logical classification of the yeast vacuolar protein sorting mutants:

evidence for a prevacuolar compartment in class E vps mutants. Mol

Biol Cell 1992;3:1389–1402.

46. Rieder SE, Banta LM, Kohrer K, McCaffery JM, Emr SD. Multilamellar

endosome-like compartment accumulates in the yeast vps28 vacuolar

protein sorting mutant. Mol Biol Cell 1996;7:985–999.

47. Charette SJ, Cosson P. A LYST/beige homolog is involved in biogenesis

of Dictyostelium secretory lysosomes. J Cell Sci 2007;120:2338–2343.

48. Mercanti V, Blanc C, Lefkir Y, Cosson P, Letourneur F. Acidic clusters

target transmembrane proteins to the contractile vacuole in Dictyos-

telium cells. J Cell Sci 2006;119:837–845.

49. Liscum L, Munn NJ. Intracellular cholesterol transport. Biochim Bio-

phys Acta 1999;1438:19–37.

50. Marchetti A, Mercanti V, Cornillon S, Alibaud L, Charette SJ, Cosson P.

Formation of multivesicular endosomes in Dictyostelium. J Cell Sci

2004;117:6053–6059.

51. Mellman I. Endocytosis and molecular sorting. Annu Rev Cell Dev Biol

1996;12:575–625.

52. Rothman JE, Wieland FT. Protein sorting by transport vesicles. Science

1996;272:227–234.

53. Hirst J, Robinson MS. Clathrin and adaptors. Biochim Biophys Acta

1998;1404:173–193.

54. Smith CJ, Pearse BM. Clathrin: anatomy of a coat protein. Trends Cell

Biol 1999;9:335–338.

55. Robinson MS. Adaptable adaptors for coated vesicles. Trends Cell Biol

2004;14:167–174.

56. Ghosh P, Kornfeld S. The GGA proteins: key players in protein sorting at

the trans-Golgi network. Eur J Cell Biol 2004;83:257–262.

57. Bonifacino JS. The GGA proteins: adaptors on the move. Nat Rev Mol

Cell Biol 2004;5:23–32.

58. He X, Chang WP, Koelsch G, Tang J. Memapsin 2 (beta-secretase)

cytosolic domain binds to the VHS domains of GGA1 and GGA2:

implications on the endocytosis mechanism of memapsin 2. FEBS Lett

2002;524:183–187.

59. Nielsen MS, Madsen P, Christensen EI, Nykjaer A, Gliemann J, Kasper

D, Pohlmann R, Petersen CM. The sortilin cytoplasmic tail conveys

Golgi-endosome transport and binds the VHS domain of the GGA2

sorting protein. EMBO J 2001;20:2180–2190.

60. Zhu Y, Doray B, Poussu A, Lehto VP, Kornfeld S. Binding of GGA2 to

the lysosomal enzyme sorting motif of the mannose 6-phosphate

receptor. Science 2001;292:1716–1718.

61. de Chassey B, Dubois A, Lefkir Y, Letourneur F. Identification of

clathrin-adaptor medium chains in Dictyostelium discoideum: differen-

tial expression during development. Gene 2001;262:115–122.

62. Eichinger L, Pachebat JA, Glockner G, Rajandream MA, Sucgang R,

Berriman M, Song J, Olsen R, Szafranski K, Xu Q, Tunggal B,

Kummerfeld S, Madera M, Konfortov BA, Rivero F et al. The genome

of the social amoeba Dictyostelium discoideum. Nature 2005;435:

43–57.

63. Boehm M, Bonifacino JS. Adaptins: the final recount. Mol Biol Cell

2001;12:2907–2920.

64. Seet LF, Liu N, Hanson BJ, Hong W. Endofin recruits TOM1 to

endosomes. J Biol Chem 2004;279:4670–4679.

65. Naslavsky N, Rahajeng J, Chenavas S, Sorgen PL, Caplan S. EHD1 and

Eps15 interact with phosphatidylinositols via their Eps15 homology

domains. J Biol Chem 2007;282:16612–16622.

66. RaziM, FutterCE.Distinct roles for Tsg101andHrs inmultivesicular body

formation and inward vesiculation. Mol Biol Cell 2006;17:3469–3483.

67. Hislop JN, Marley A, Von Zastrow M. Role of mammalian vacuolar

protein-sorting proteins in endocytic trafficking of a non-ubiquitinated

G protein-coupled receptor to lysosomes. J Biol Chem 2004;279:

22522–22531.

68. Gullapalli A, Wolfe BL, Griffin CT, Magnuson T, Trejo J. An essential

role for SNX1 in lysosomal sorting of protease-activated receptor-1:

evidence for retromer-, Hrs-, and Tsg101-independent functions of

sorting nexins. Mol Biol Cell 2006;17:1228–1238.

69. Theos AC, Truschel ST, Tenza D, Hurbain I, Harper DC, Berson JF,

Thomas PC, Raposo G, Marks MS. A lumenal domain-dependent

pathway for sorting to intralumenal vesicles of multivesicular endo-

somes involved in organelle morphogenesis. Dev Cell 2006;10:

343–354.

70. Cornillon S, Pech E, Benghezal M, Ravanel K, Gaynor E, Letourneur F,

Bruckert F, Cosson P. Phg1p is a nine-transmembrane protein super-

family member involved in dictyostelium adhesion and phagocytosis.

J Biol Chem 2000;275:34287–34292.

71. Benghezal M, Gotthardt D, Cornillon S, Cosson P. Localization of the

Rh50-like protein to the contractile vacuole in Dictyostelium. Immuno-

genetics 2001;52:284–288.

72. Neuhaus EM, Horstmann H, Almers W, Maniak M, Soldati T. Ethane-

freezing/methanol-fixation of cell monolayers: a procedure for

improved preservation of structure and antigenicity for light and

electron microscopies. J Struct Biol 1998;121:326–342.

73. Orci L, Like AA, Amherdt M, Blondel B, Kanazawa Y, Marliss EB,

Lambert AE, Wollheim CB, Renold AE. Monolayer cell culture of

neonatal rat pancreas: an ultrastructural and biochemical study of

functioning endocrine cells. J Ultrastruct Res 1973;43:270–297.

74. Levi S, Polyakov M, Egelhoff TT. Green fluorescent protein and epitope

tag fusion vectors for Dictyostelium discoideum. Plasmid 2000;44:

231–238.

75. Manstein DJ, Schuster HP, Morandini P, Hunt DM. Cloning vectors for

the production of proteins in Dictyostelium discoideum. Gene 1995;

162:129–134.

Traffic 2009; 10: 161–171 171

Dictyostelium Tom1