THE ANATOMICAL RECORD 292:891–901 (2009)

Developmental Expression Profile of theCXCL12c Isoform: Insights Into its

Tissue-Specific RoleDIEGO FRANCO,1* PATRICIA RUEDA,2 ELENA LENDINEZ,3

FERNANDO ARENZANA-SEISDEDOS,2 AND ANTONIO CARUZ3

1Department of Experimental Biology, Cardiovascular Development Laboratory,University of Jaen, Jaen, Spain

2Department of Virology, Viral Molecular Pathogenics Unit, Institut Pasteur, Paris, France3Department of Experimental Biology, Immunogenetics Laboratory,

University of Jaen, Jaen, Spain

ABSTRACTThe CXCL12c chemokine arises by alternative splicing from Cxcl12,

an highly conserved gene that plays pivotal, non-redundant roles duringdevelopment. The interaction of the highly cationic carboxy-terminal (C-ter) domain of CXCL12c with glycosaminoglycans (GAG) critically deter-mines the biological properties of this chemokine. Indeed, CXCL12c iso-form displays sustained in vivo recruitment of leukocytes and endothelialprogenitor cells as compared to other CXCL12 isoforms. Despite the im-portant, specific roles of CXCL12c in vivo, the current knowledge aboutits distribution in embryo and adult tissues is scarce. In this study, wehave characterized by both RT-PCR and immunohistochemistry theexpression profile and tissue distribution of CXCL12c, which showed adistinct mRNA expression pattern during organogenesis that correlateswith the specific expression of the CXCL12 c protein in several tissuesand cell types during development. Our results support the biologicalrelevance of CXCL12 c in vivo, and shed light on the specific roles thatthis novel isoform could play in muscle development and vascularizationas well as on the regulation of essential homeostatic functions during theembryonic development. Anat Rec, 292:891–901, 2009. VVC 2009 Wiley-Liss, Inc.

Keywords: chemokine; CXCL12c; expression; organogenesis;homeostasis

Embryonic development is a complex process wherebymultiple tissue layers are formed, each of them display-ing unique gene expression profiles. The expression pat-terns of these genes are mainly set up by distinctgrowth factor and cytokine signaling pathways that, inturn, activate tissue-specific transcription factors.CXCL12 (Stromal cell-Derived Factor 1; SDF-1) isamong those cytokines that play pivotal roles indevelopment.

CXCL12 is a constitutive and ubiquitous CXC chemo-kine that exerts its functions through the G-proteincoupled receptor (GPCR) CXCR4 (Bleul et al., 1996).Recently, a novel receptor for CXCL12, CXCR7/RDC1,

Grant sponsors: Junta de Andalucıa grant-in-aid and Juntade Andalucıa Project of Excellence; Grant numbers: CTS446and CTS1614.

*Correspondence to: Diego Franco, Department of Experimen-tal Biology, Cardiovascular Development Group, University ofJaen, 23071 Jaen, Spain. Fax: 34-953211875.E-mail: dfranco@ujaen.es

Received 10 June 2008; Accepted 11 December 2008

DOI 10.1002/ar.20899Published online in Wiley InterScience (www.interscience.wiley.com).

VVC 2009 WILEY-LISS, INC.

has been identified (Balabanian et al., 2005; Burnset al., 2006). CXCL12 plays non-redundant roles duringembryogenesis. Indeed, lack of Cxcl12 expression in miceresults in non-viable animals and perinatal mortality,affecting the cardiovascular and central nervous systems(Nagasawa et al., 1996; Tachibana et al., 1998; Zouet al., 1998; Klein et al., 2001), hematopoiesis (Ma et al.,1998), and gonad development (Ara et al., 2003). Inadult stages, CXCL12 also plays critical roles, since ittriggers adhesion of lymphocytes to activated endothelialcells (Kantele et al., 2000; Shamri et al., 2005), and pro-motes trans-endothelial migration of leukocytes (Aiutiet al., 1997; Campbell et al., 1998; Grabovsky et al., 2000;Kantele et al., 2000), modulating thus lymphocyte traffick-ing homeostasis. Furthermore, CXCL12 regulates both thebone-marrow homing and egress of CD34þ progenitor cellsand their migration into peripheral tissues, a property thatunderlies the contribution of CXCL12 to important physio-pathological processes like angiogenesis and tissue repair(Aiuti et al., 1997; Ceradini et al., 2004; Gallagher et al.,2007). Beside its contribution to homeostasis, an over-whelming body of evidence supports the role of CXCL12 asa key factor for growth, survival, and metastasis of a num-ber of epithelial tumors (Burger and Kipps, 2006).

CXCL12 protein distribution has been widely docu-mented in distinct adult human tissues such as the bonemarrow (Imai et al., 1999; Ponomaryov et al., 2000), theskin (Fedyk et al., 2001), the thymus (Zaitseva et al.,2002; Ide et al., 2003), the tonsil (Casamayor-Pallejaet al., 2001), and the digestive tract (Agace et al., 2000),resulting in most cases to be associated to immune sys-tem related structures. Similarly, there are distinctreports regarding the tissue distribution of CXCL12 inadult mouse organs (Suzuki et al., 1999; Lu et al., 2001;Okada et al., 2002; Stumm et al., 2002), using bothimmunohistochemistry and in situ hybridization techni-ques. However, there is scarce information regarding thetissue distribution of CXCL12 during mouse develop-ment, despite its pivotal role during embryogenesis, asrevealed by loss-of-function experiments. More impor-tantly, three CXCL12 isoforms (a, b, and c), arising byalternative splicing, have been reported in distinctmouse and human adult tissues, in addition to threeminor species in humans (d, e, and /) (Ohtani et al.,1998; Gleichmann et al., 2000; Stumm et al., 2002; Yuet al., 2006), whereas scarce information is availableregarding their tissue distribution during embryogenesis(Yu et al., 2006; Tiveron et al., 2006). Furthermore, thestudy of the well-characterized CXCL12 a and b isoformsprovides most of the knowledge of CXCL12 biologicalproperties. In contrast, the novel CXCL12c remainslargely unexplored. CXCL12 c is formed by a core do-main encompassing 68 amino acids that correspond tothe CXCL12 a isoform and are shared by all CXCL12proteins which is extended by 30 additional amino acidsin the carboxy-terminal (C-ter) end. This CXCL12 c C-ter region is highly-enriched in basic amino acids andencodes four overlapped heparan sulfate-binding motifsand shows identical sequence in human, rat, and mousespecies (Shirozu et al., 1995; Gleichmann et al., 2000; Yuet al., 2006). Such a large and charged domain confersCXCL12 c with both a high affinity for glycosaminogly-cans and an in vivo sustained biological activity, deter-mining distinct structural and biological capabilities forCXCL12 c as compared to other isoforms (Laguri et al.,

2007; Rueda et al., 2008). However, the current knowl-edge about the tissue distribution of these isoforms indeveloping and adult tissues is scarce (Yu et al., 2006). Toget insights into the putative tissue-specific role of the dis-tinct CXCL12 isoforms during development as well as inthe adulthood, we have characterized in this study theexpression profile and tissue distribution of the distinctCXCL12 isoforms by RT-PCR and immunohistochemistry.

MATERIALS AND METHODSEmbryos and Adult Mice

For RT-PCR experiments, embryonic organs wereextracted from pregnant C57/BL6 females, spanningfrom embryonic day E14 to E17. Adult and neonatalorgans were also obtained and processed. Organs weredissected and stored in liquid nitrogen before RNA isola-tion. For immunohistochemical experiments, fullembryos (E15.5), isolated neonatal and adult organswere fixed overnight in 4% paraformaldehyde, and proc-essed accordingly (Franco et al., 2001). Tissues sampleswere sectioned at 10 lm and processed as previouslydescribed (Franco et al., 2001).

mRNA Isolation and Reverse Transcription

Total RNA was isolated using Trizol (Roche) accordingto manufacture’s guidelines and DNase treated usingRNase-Free DNase (Roche) for 1 hr at 30�C. First-strandcDNA was synthesized at 37�C for 1 hr using 1 lg ofRNA, oligo-dT primers and Superscript III ReverseTranscriptase (Invitrogen) according to manufacture’sguidelines. To check for possible genomic contamination,a control reaction without reverse transcriptase wereperformed for each sample, which resulted in all casesin no detectable amplification signal.

RT-PCRs were performed using standard PCR condi-tions in an Eppendorf Thermocycler. Reactions were per-formed in 200 lL reaction tubes, with a 20 lL totalvolume containing 10 mM dNTPs, 50 mM Cl2Mg, 1 lLDMSO, and 2U BioTaq DNA polymerase (Bioline). As in-ternal control, mouse b-actin was amplified in parallelfor each run. Amplification conditions were as follows:initial step of 95�C for 10 min, followed by 40 cycles of95�C for 30 sec, 58�C for 30 sec, 72�C for 5 sec, withfinal elongation step of 72�C for 5 min. Primers weredesigned by comparative alignment of the three CXCL12isoforms and search for unique isoform-specific regions.All primers were designed to span exon–exon boundariesusing online Primer3 software (http://fokker.wi.mit.edu/primer3/input.htm). No amplifications were observed inPCR control reactions containing only water as the tem-plate. The primers used are listed below: CXCL12a (for-ward 50tgcccttcagattgttgcac30, reverse 50gctaactggttagggtaatac30), CXCL12b (forward 50tgcccttcagattgttgcac30,reverse 50cttgagcctctttaaagc30), CXCL12c (forward 50tgcccttcagattgttgcac30, reverse 50gctagcttacaaagcgccagagcagagcgcactgcg30), b-actin (forward 50acactgtgcccatctagcagggg30, reverse 50atgatggagttgaaggtagtttcgtggat30).

Immunohistochemistry

Tissue slides were deparaffinized and hydrated as pre-viously described (Franco et al., 2001) and incubatedovernight with the corresponding primary antibody. The

892 FRANCO ET AL.

monoclonal antibodies (mAb) used were a pan-CXCL12K15C (Amara et al., 1999) and a series of gamma-specificantibodies [2A8, 2H7, and 6E9 (Rueda et al., 2008), Fig.1A]. Immunohistochemical detection was performed usingalkaline phosphatase-conjugated method as previouslydescribed (Franco et al., 2001). Lack of primary antibodyincubation or isotype primary antibody incubation resultedin all cases in no detectable staining (Fig. 1B).

RESULTS

We have examined the expression profiles of distinctCXCL12 isoforms (a, b, and c) by RT-PCR to investigatetheir relative contribution during embryonic develop-ment as well as at postnatal and adult stages. Secondly,we have developed monoclonal antibodies (mAb) againstCXCL12 c isoform to study in detail its tissue distribu-tion during embryogenesis. Detailed characterization ofthe antibodies specificity is provided by Rueda et al.(2008). CXCL12 c tissue distribution, detected by thespecific 6E9 mAb, has been compared with tissue distri-bution provided by a pan-CXCL12 (K15C) mAb, givingus further insights about the distinct CXCL12 isoform-specific tissue distribution at protein level. Comparisonof RT-PCR and protein data allows us to uncover if tran-scriptional differences are also reflected at protein level.

Developmental Profiles of CXCL12 a, b,and c mRNA Expression

We have investigated the developmental expressionprofiles of CXCL12 a, b, and c isoforms in the gut, liver,

lung, kidney, heart, and brain at different embryonic(E14 to E17), neonatal (N), and adult stages (A), by RT-PCR, using beta-actin as an internal normalizing control(Fig. 2).

We have observed that the expression of the threeCXCL12 isoforms can be documented at all stages andin all tissues tested during development. However, it isalso clearly observed that expression of CXCL12 b is inmost cases much weaker that CXCL12 a or c at differentstages during embryogenesis, including also the adultstages, even at saturating PCR conditions (40 cycles) asreported herein.

We have centered our attention to those organs wherethe relative expression profiles CXCL12 a versus c aremore prominent than those of CXCL12 b. Detailed anal-ysis of the RT-PCR experiments reveals that two typesof developmental profiles can be observed. Some organs,such as lung, display similar expression profiles forCXCL12 a and c during development, indicating thatthese two isoforms might have redundant roles. Otherorgans, such as the gut, liver, kidney, and heart, displaydifferent CXCL12 a expression profiles as compared toCXCL12 c during development. For example, CXCL12 aexpression seems to be similar at all stage in the devel-oping heart, whereas CXCL12 c expression seems toincrease towards the adulthood. Similarly, CXCL12 aexpression is similar at all stages in the developing gutwhereas CXCL12 c seems to peak only at early fetalstages (E15). On the contrary, other organs such as thekidney and the liver display a more complementary pat-tern during organogenesis. It is noteworthy in this con-text that expression of CXCL12 a in the liver seems to

Fig. 1. (A) Schematic representation of epitopes localization recog-nized by the pan-CXCL12 K15C and the isoform-specific anti-CXCL12c monoclonal antibodies. Open and gray boxes indicate addi-tional C-ter amino acids for CXCL12 b and c isoforms, respectively.

(B) Immunohistochemistry using several batches of specific anti-CXCL12c monoclonal antibodies applied to normal mouse (E15.5) lungparaffin sections. Lack of primary antibody incubation resulted in allcases in no detectable signal (control).

CXCL12c EXPRESSION DURING DEVELOPMENT 893

decrease towards the adulthood, whereas the expres-sion of CXCL12 c seems to increase during develop-ment. A rather similar CXCL12 a versus c expressionprofile was observed in the developing kidney, but sur-prisingly, CXCL12 c expression peaks at E17 anddeclines during neonatal stages, being also undetect-able at adult stages.

Tissue Distribution of CXCL12 cDuring Embryogenesis

To investigate the tissue distribution of the CXCL12 cisoform during development, we generated monoclonalantibodies against an isoform-specific epitope asdescribed by Rueda et al. (2008) (Fig. 1A). Severalbatches of CXCL12 c-specific monoclonal were tested,displaying in all cases the same expression profile, asillustrated in Fig. 1B. Lack of incubation of the primaryantibody or isotype primary antibody incubation resultedin all cases in undetectable signal. We thus selected asingle anti-CXCL12 c mAb (6E9) to further dissect itstissue distribution. Immunohistochemical experiments

using a pan-specific CXCL12 mAb (K15C) as well as con-trol antibodies such as anti-alpha smooth muscle actin(a-SMA) or anti-desmin (desmin) were also performed.

We have characterized the tissue distribution ofCXCL12 c in different organs at three stages, embryonic(E15.5), neonatal (ND1), and adult stage. We havefocused our attention to those organs that were previ-ously documented by RT-PCR displaying prominent aversus c different expression profiles, including thereinthe respiratory, digestive, excretory, and cardiovascularsystems.

CXCL12 c Expression in the RespiratorySystem (Trachea and Lungs)

Expression of CXCL12 c is absent in the upper respi-ratory airways at fetal stages whereas immunostainingwith the K15C mAb results in high staining against allCXCL12 isoforms in the epithelial layer of the upper re-spiratory pathways, suggesting that a and/or b areexpressed in these cells but not c (Fig. 3).

Fig. 2. RT-PCR detection of Cxcl12a, Cxcl12b, and Cxcl12c mRNA expression using different gut, liver,lung, kidney, heart, and brain tissue samples at different embryonic developmental stages [(e14, e15, e16,e17), neonatal (N), and adult (A)]. b-actin was used as loading control. RTþ/RT� denote presence orabsence of RT enzyme.

894 FRANCO ET AL.

Expression in the lungs is observed since late embry-onic stages (E15.5). CXCL12 c expression is confined tothe alveoli whereas no expression can be observed in thebronchial epithelia. On the contrary, K15C mAb immu-nostaining can be observed in the bronchial epithelia butis hardly detectable in the alveoli (Fig. 3), supporting acell-type isoform-specific distribution in the developingrespiratory system.

CXCL12 c Expression in the DigestiveSystem (Gut and Liver)

The expression of CXCL12 c is observed weakly at fe-tal stages, confined to the surrounding smooth musclelayers of the digestive tract as well as on the developingvilli. A similar expression pattern is observed for K15CmAb (Fig. 4). At later developmental stages, just after

birth, the expression profile of CXCL12 c is confined tothe intestinal villi, but no expression can be observed inthe surrounding smooth muscle cells. In contrast, K15Cstaining can be observed both in the villi as well as inthe surrounding smooth muscle cells, suggesting thatCXCL12 a and/or b but not CXCL12 c are expressed inthe smooth muscle layers. Curiously, CXCL12 c isexpressed in the epithelial lining and most likely a and/or b too, due to the wider distribution of the immuno-stained signal obtained by K15C labeling. A similarexpression profile is observed in the adulthood, being cconfined to the epithelial layer and K15C staining inboth the epithelial and the smooth muscle components(Fig. 4). It is worth noting that expression of both anti-bodies (6E9; c and K15C; a/b/c) display an extracellularstaining in the developing and adult villi, showing fur-thermore an apical-basal gradient of expression (Fig. 4).

Fig. 3. CXCL12 c expression in the respiratory system. Detection ofCXCL12 isoforms using K15C mAb and anti-CXCL12c 6E9 mAb inmouse embryonic (E15.5), neonatal (ND1), and adult tissues. Observethat K15C mAb nicely delineates high expression levels on the tra-cheal epithelium (arrow, panel A) whereas no expression is observedfor CXCL12 c (arrowhead, panel F). Within the developing lungs,expression using the pan-CXCL12 K15C antibody is observed con-fined to the bronchia (arrow, panel C) at E15.5 whereas CXCL12 c

expression is detected exclusively in the alveoli (arrow, panel H). Atadult stages, both K15C and CXCL12 c display a prominent expres-sion in the smooth muscle cells around the bronchia (arrows, panels Eand J), whereas just basal expression is observed in the surroundinglung alveoli (asterisks, panels E and J). Panels K and L illustratedesmin and alpha-smooth muscle actin expression in the E15.5 andneonatal upper respiratory tracts, respectively. tr, trachea; eso,esophagus.

CXCL12c EXPRESSION DURING DEVELOPMENT 895

The expression in the developing liver is highlydynamic for the distinct CXCL12 isoforms. At early fetalstages, expression of CXCL12 c is basal and rather ho-mogeneous. At postnatal stages, a discrete expression ofCXCL12 c can be traced for the first time, being confinedto the developing vascular beds. Interestingly, in theadult liver, expression of CXCL12 c is confined to theportal triad structures; portal vein and artery, and biliarducts. A gradient of expression is observed on the hepa-tocytes located along the portal-central axis, similar tothat observed for the glutamine synthase. Expression ofCXCL12 c on the central vein is absent.

The expression pattern depicted by K15C mAb stain-ing is rather similar to that observed for CXCL12 c atlater fetal (E15.5) and neonatal stages, but differs drasti-cally at adult stages. K15C immunostaining displays amuch-scattered expression pattern in the portal-centralaxis and it is basically absent on the triad portal struc-tures. These data support a differential distributionof the CXCL12 a, b, and c isoforms in the adult liver(Fig. 4).

Gamma CXCL12 Expression in the ExcretorySystem (Kidney and Bladder)

The expression of CXCL12 c can be observed in thedeveloping kidney confined to the developing collectingtubes, whereas no expression can be detected in the

developing glomeruli or the convoluted tubes. Suchexpression profile remains similar in the neonatal stagebut surprisingly, almost no detectable CXCL12 c proteinexpression could be observed in the adult kidney(Fig. 5). Only some scattered cells in the interstitial tis-sue are highly positive for CXCL12 c. Similarly, K15Cdetectable expression is observed at early fetal and neo-natal stages confined to the developing collecting tubes,while it becomes rather homogeneous in the collectingand convoluted tubes in the adult kidney (Fig. 5). Thesedata are in agreement with our RT-PCR data, sinceexpression of c is repressed in the adult kidney whereasstrong expression of CXCL12 a and b can be observed atthis stage. CXCL12 isoform expression during bladderdevelopment is highly illustrative of the differential iso-form distribution within different cell types. As isreflected in Fig. 5, the epithelial bladder displays noexpression of CXCL12 c, whereas K15C immunostainingis highly detectable.

Gamma CXCL12 Expression in theCardiovascular System (Heart)

We have observed that expression of CXCL12 c duringcardiac development displays a weak but regionalizedexpression profile (Fig. 6). At early fetal stages, expres-sion of CXCL12 c is confined essentially to the develop-ing atrial myocardial structures while expression in the

Fig. 4. CXCL12 c expression in the digestive system. Detection ofCXCL12 isoforms using K15C mAb and anti-CXCL12c 6E9 mAb inmouse embryonic (E15.5), neonatal (ND1), and adult tissues. Observethat both K15C and anti-CXCL12c 6E9 antibodies display an overtexpression in the developing gut epithelia (arrows, panels A, B, C, G,H, and I), being more conspicuous of K15C (arrow, panel C) in theadult stage as compared to CXCL12c (arrow, panel I). Furthermore,CXCL12 expression in the smooth muscle layer is clearly detectable

at all developmental stages by K15C mAb (arrowheads, panels A, B,and C) whereas is most prominently detected at adult stages by 6E9(CXCL12c) mAb (arrowhead, panel I). In the liver, K15C antibody label-ing at embryonic and neonatal stages reveals weak expression levels(panels D and E), whereas at adult stages, scattered expression isobserved (arrowheads, panel F). On the contrary, expression ofCXCL12c is discretely observed in the hepatic sinusoids (arrowheads,panel L) as well as on the triads (arrow, panel L).

896 FRANCO ET AL.

ventricular myocardium is absent. With further develop-ment, at postnatal stages, CXCL12 c expression becomesmore pronounced in the atrial myocardial structures,including the venous return, the caval, and pulmonaryvein myocardium. Expression in the ventricular myocar-dium remains undetectable. Notably, expression ofCXCL12 c is highly detectable in the entirety of the epi-cardial lining, surrounding the neonatal heart. In theadult heart, expression of CXCL12 c displays a mostprominent atrial expression. Expression can be observedalso in the adult ventricular myocardium, whereasexpression in the epicardial lining is patchy, discontinu-ous and thus heterogeneous.

In contrast, expression of all three CXCL12 isoforms,as revealed by K15C immunostaining, demonstrates asimilar expression profile at early fetal stages (E15.5)between the atrial and the ventricular myocardial cham-bers. With further development, at postnatal stages,K15C immunostaining reveals an atrial chamberenhanced expression as compared to the ventricularchambers. Expression in the surrounding epicardial lin-ing is homogeneously observed also with the K15C anti-body. At adult stages, the expression profile obtained by

K15C antibody is rather similar to that observed forCXCL12 c (Fig. 6).

Gamma CXCL12 Expression During SkeletalMuscle Development

Skeletal muscles are mainly derived from a discretepart of the developing somites, the dermomyotome. Cellswithin the myotome compartment receive early specifica-tion signals from surrounding tissues, and activemigrate to distinct parts of the forming embryo as myo-blast precursor cells (Buckingham, 2006). Soon there-after, these myoblasts will fuse leading to the formationof myotubes and terminally differentiating into striatedskeletal muscle fibers (Buckingham, 2006). We haveobserved that expression of CXCL12 c during skeletalmuscle development is initiated as the myotome-derivedmyoblasts are actively migrating, approximately aroundE12.5 (Fig. 7A–C). At this stage, K15C and E69 mAbsdisplay a similar profiles, with a rather homogenousexpression in the majority of the migrating muscle cells(Fig. 7A), whereas is more heterogeneous in some otherforming muscle packages (Fig. 7C). With further

Fig. 5. CXCL12 c expression in the excretory system. Detection ofCXCL12 isoforms using K15C mAb and anti-CXCL12c 6E9 mAb inmouse embryonic (E15.5), neonatal (ND1), and adult tissues. Note thatK15C and anti-CXCL12c widely stain the developing collecting tubesat both embryonic and neonatal stages (arrows, panels A, B, F, andG). Notably at adult stages, staining of K15C is widely observed in theadult kidney (panel C), whereas expression of CXCL12c is confined todiscrete interstitial cells (arrow, panel H). In the urinary bladder, a dis-

tinct expression profile is revealed using K15C and 6E9 antibodies.Whereas K15C displays an overt expression within the bladder epithe-lium, both at embryonic (arrowhead, panel D) and adult stages (arrow-head, panel E), virtually no expression can be detected for CXCL12c(arrowhead, panels I and J). Interestingly, both antibodies display asimilar expression profile in the surrounding skeletal muscle layers(asterisks, panels E and J) at adult stages.

CXCL12c EXPRESSION DURING DEVELOPMENT 897

development, expression of both K15C and CXCL12 c iswidely observed within all epaxially and hypoxiallyderived skeletal muscles, as it can be observed at E13.5(Fig. 7D–F). K15C and CXCL12 c immunostainingremains to be strongly expressed in the skeletal musclesat late embryonic (E14.5) (Fig. 7G,H asterisks) and fetalstages (E18.5) (Fig. 7I,J asterisks), although a wider het-erogeneity is observed at these later stages, specially forE69 (Fig. 7J, arrows). In line with these observations,expression of K15C and CXCL12 c is vaguely detectableat adult stages (data not shown).

DISCUSSION

The characterization of the CXCL12 a and b mouseisoforms (Tashiro et al., 1993), the description of theessential role played by CXCL12 during embryo develop-ment (Nagasawa et al., 1996; Tachibana et al., 1998; Araet al., 2003), and the high level of gene conservationacross species (Tashiro et al., 1993; Shirozu et al., 1995;Pillarisetti and Gupta, 2001) generate numerous studiesaimed to find the differential, specific biological functionscharacterizing both CXCL12 a and b isoforms. However,to date, no major differences have been found regardingCXCL12 a and b functions, including binding to- and sig-naling through CXCR4 or expression in different tissues

or physiological conditions. Recently, a novel CXCL12isoform, CXCL12 c, has been described in rat (Gleich-mann et al., 2000), human (Yu et al., 2006), and mouse(Laguri et al., 2007; Rueda et al., 2008). In contrast toCXCL12 b isoform, that differs from CXCL12 a only forfour additional amino acids at the carboxi-terminal (C-ter) end of the protein, CXCL12c isoform results in sub-stantial changes in the C-ter region by the addition of 30aminoacids, fully conserved between mouse, rat, andhuman (Nagasawa et al., 1996; Tachibana et al., 1998;Ara et al., 2003), conducing to differences in its biologi-cal function. Indeed, it has been recently shown thatCXCL12c isoform displays a higher GAG-binding affinitythat grants this isoform with in vivo increased biologicalfunctions as compared to CXCL12 a (Laguri et al., 2007;Rueda et al., 2008).

As we have reported in the present study, mRNAexpression of the CXCL12 a, b, and c isoforms can bedocumented at all stages (E14–E17, neonatal, and adult)and in all tissues during development. However, wefound different expression patterns of the CXCL12 a andc isoforms in gut or heart, whereas kidney and liver dis-played a more complementary pattern during organo-genesis. Several studies have described different rolesplayed by the differentially expressed CXCL12 isoformsin the adulthood of the mouse under physiopathological

Fig. 6. CXCL12 c expression during cardiogenesis. Detection ofCXCL12 isoforms using K15C mAb and anti-CXCL12c 6E9 mAb inmouse embryonic (E15.5), neonatal (ND1), and adult tissues. Stainingwith K15C mAb and 6E9 mAb is rather similar during cardiac develop-ment as well as in the adult hearts, mainly confined to the developing

atrial and ventricular myocardium as well as in the forming epicardium(arrow, panel E). Notably, a scattered distribution within the adult epi-cardial layer is also observed (arrowheads, panels C and F). ra, rightatrium; rv, right ventricle; la, left atrium; lv, left ventricle.

898 FRANCO ET AL.

Fig. 7. CXCL12 c expression during skeletal muscle development.Detection of CXCL12 isoforms using K15C mAb and anti-CXCL12c6E9 mAb in mouse embryonic (E12.5–E13.5) and fetal (E14.5–E18.5)tissues. Expression of K15C can be already observed in migratingmyoblasts at late embryonic stages as depicted in panels A, B, andC. Panels A and C are the close-up of the boxed areas depicted inpanel B. At later developmental stages (E13.5), expression of K15Cand anti-CXCL12c mAbs revealed a prominent expression in the inter-costal muscles (panel D, arrow), diaphragmatic muscles (panel E,

arrow) and limb bud skeletal masses (panel F, arrows). Observe thatexpression of K15C and anti-CXCL12c 6E9 mAbs remains highlyprominent on the diaphragmatic muscles (panels G and H) at early fe-tal stages (E14.5). At later developmental stages, K15C and anti-CXCL12c 6E9 mAbs also display high expression levels in the fullystructured tongue muscles (arrows and asterisks, panel I; asterisk,panel J), although the expression of anti-CXCL12c 6E9 progressivelybecome more heterogeneous (arrows, panel J).

conditions (Gleichmann et al., 2000; Stumm et al., 2002;Segret et al., 2007). In full agreement, our mRNAexpression results support and extend the differentexpression patterns during organogenesis and suggest afunctional replacement of the distinct CXCL12 isoforms.Alternatively, it might be possible that each CXCL12 iso-form is being expressed in different cell types that arebecoming present in the different organs as morphogene-sis takes place. By using monoclonal antibodies recogniz-ing specifically CXCL12 c, we demonstrate for the firsttime that the differential mRNA expression of this iso-form correlates with the specific expression of theCXCL12 c protein in several tissues and cell types dur-ing development. The differential expression pattern ofthe CXCL12 c protein suggests that this isoform mightplay specific roles during different developmental stages.Interestingly, CXCL12 c protein expression has beenconsistently detected in two tissues.

First, CXCL12 c protein is repetitively found in mus-cular tissues. CXCL12 is a potent attractant for musclecells lines essential for muscle regeneration (Ratajczaket al., 2003), and CXCL12/CXCR4 axis is involved inmuscle development. This essential role in muscle for-mation during embryo development is supported by thedefect in heart muscle formation displayed by the Cxcl12and Cxcr4 knock out mice (Aiuti et al., 1997; Zou et al.,1998). In addition, CXCL12 expressed by muscle fibro-blasts is a high chemo-attractant for CD34þ cells(Ratajczak et al., 2003), a mechanism involved in the for-mation of vessels both under physiological (Ceradiniet al., 2004) and pathological conditions (Orimo et al.,2005). The role of CXCL12 in the regulation of the biol-ogy of muscle and hematopoietic progenitor cells, thehigher in vivo capacity of CXCL12 c to attract endothe-lial progenitor cells as compared to CXCL12 a and ourresults in CXCL12 c expression point out to CXCL12 cas the major player of muscle development andvascularization.

Second, the recently described enhanced affinity forGAG and in vivo cell attraction of CXCL12 c as com-pared to other CXCL12 isoforms (Rueda et al., 2008), to-gether with the enhanced expression of CXCL12 c inorgan epithelia (this study) supports the notion thatCXCL12c might play an important role on regulatinginteractions between the bone marrow cell reservoir andperipheral organs during normal tissue regenerationand/or during alarm situations, in which immature andmaturing leukocytes are recruited from the bone marrowto the circulation as part of host defense and repairmechanisms. However, further experiments are requiredto uncover if CXCL12c is actively present or latentwithin these epithelial tissue layers as it has beenrecently reported in platelets (Massberg et al., 2006).

Our results confirm the biological relevance and non-redundant roles played by the CXCL12 c in vivo, andshed light into the specific roles that this interesting iso-form could play during embryo development that, as ithas been recently reported (Rueda et al., 2008) itdepends on the high capacity of CXCL12 c to bind to-and immobilizes on the extracellular matrix and cell sur-face. Development of animal models, like a conditionalCxcl12 c knock out mouse, would help to elucidate thespecific functions played by CXCL12 c in developmentand in the adult life.

Both, the total conservation of the additional carboxi-terminal amino acids of the CXCL12 c isoform and itsdescribed differential biological functions, point out toan important physiological relevance of this isoform.Our recent study demonstrates that CXCL12 c displaysa differential and characteristic RNA and proteinexpression pattern in the adult mouse, thus sustainingthe important and non-redundant character of thischemokine.

LITERATURE CITED

Agace WW, Amara A, Roberts AI, Pablos JL, Thelen S, UguccioniM, Li XL, Marsal J, Arenzana-Seisdedos F, Delaunay T, EbertEC, Moser B, Parker CM. 2000. Constitutive expression of stro-mal derived factor-1 by mucosal epithelia and its role in HIVtransmission and propagation. Curr Biol 10:325–328.

Aiuti A, Webb IJ, Bleul C, Springer T, Gutierrez-Ramos JC. 1997.The chemokine SDF-1 is a chemoattractant for human CD34þ he-matopoietic progenitor cells and provides a new mechanism toexplain the mobilization of CD34þ progenitors to peripheralblood. J Exp Med 185:111–120.

Amara A, Lorthioir O, Valenzuela A, Magerus A, Thelen M, MontesM, Virelizier JL, Delepierre M, Baleux F, Lortat-Jacob H, Are-nzana-Seisdedos F. 1999. Stromal cell-derived factor-1alpha asso-ciates with heparan sulfates through the first beta-strand of thechemokine. J Biol Chem 274:23916–23925.

Ara T, Nakamura Y, Egawa T, Sugiyama T, Abe K, Kishimoto T,Matsui Y, Nagasawa T. 2003. Impaired colonization of the gonadsby primordial germ cells in mice lacking a chemokine, stromalcell-derived factor-1 (SDF-1). Proc Natl Acad Sci USA 100:5319–5323.

Balabanian K, Lagane B, Infantino S, Chow KY, Harriague J,Moepps B, Arenzana-Seisdedos F, Thelen M, Bachelerie F. 2005.The chemokine SDF-1/CXCL12 binds to and signals through theorphan receptor RDC1 in T lymphocytes. J Biol Chem 280:35760–35766.

Bleul CC, Farzan M, Choe H, Parolin C, Clark-Lewis I, Sodroski J,Springer TA. 1996. The lymphocyte chemoattractant SDF-1 is aligand for LESTR/fusin and blocks HIV-1 entry. Nature 382: 829–833.

Buckingham M. 2006. Myogenic progenitor cells and skeletal myo-genesis in vertebrates. Curr Opin Genet Dev 16:525–532.

Burger JA, Kipps TJ. 2006. CXCR4: a key receptor in the crosstalkbetween tumor cells and their microenvironment. Blood 107:1761–1767.

Burns JM, Summers BC, Wang Y, Melikian A, Berahovich R, MiaoZ, Penfold ME, Sunshine MJ, Littman DR, Kuo CJ, Wei K,McMaster BE, Wright K, Howard MC, Schall TJ. 2006. A novelchemokine receptor for SDF-1 and I-TAC involved in cell survival,cell adhesion, and tumor development. J Exp Med 203: 2201–2213.

Campbell JJ, Hedrick J, Zlotnik A, Siani MA, Thompson DA,Butcher EC. 1998. Chemokines and the arrest of lymphocytesrolling under flow conditions. Science 279:381–384.

Casamayor-Palleja M, Mondiere P, Amara A, Bella C, Dieu-NosjeanMC, Caux C, Defrance T. 2001. Expression of macrophage inflam-matory protein-3alpha, stromal cell-derived factor-1, and B-cell-attracting chemokine-1 identifies the tonsil crypt as an attractivesite for B cells. Blood 97:3992–3994.

Ceradini DJ, Kulkarni AR, Callaghan MJ, Tepper OM, Bastidas N,Kleinman ME, Capla J, Galiano RD, Levine JP, Gurtner GC.2004. Progenitor cell trafficking is regulated by hypoxic gradientsthrough HIF-1 induction of SDF-1. Nat Med 10:858–864.

Fedyk ER, Jones D, Critchley HO, Phipps RP, Blieden TM, SpringerTA. 2001. Expression of stromal-derived factor-1 is decreased byIL-1 and TNF and in dermal wound healing. J Immunol166:5749–5754.

900 FRANCO ET AL.

Franco D, de Boer PA, de Gier-de Vries C, Lamers WH, Moorman AF.2001. Methods on in situ hybridization, immunohistochemistry andbeta-galactosidase reporter gene detection. Eur J Morphol 39:3–25.

Gallagher KA, Liu ZJ, Xiao M, Chen H, Goldstein LJ, Buerk DG,Nedeau A, Thom SR, Velazquez OC. 2007. Diabetic impairmentsin NO-mediated endothelial progenitor cell mobilization and hom-ing are reversed by hyperoxia and SDF-1 alpha. J Clin Invest117:1249–1259.

Gleichmann M, Gillen C, Czardybon M, Bosse F, Greiner-Petter R,Auer J, Muller HW. 2000. Cloning and characterization of SDF-1gamma, a novel SDF-1 chemokine transcript with developmen-tally regulated expression in the nervous system. Eur J Neurosci12:1857–1866.

Grabovsky V, Feigelson S, Chen C, Bleijs DA, Peled A, Cinamon G,Baleux F, Arenzana-Seisdedos F, Lapidot T, van Kooyk Y, LobbRR, Alon R. 2000. Subsecond induction of alpha4 integrin cluster-ing by immobilized chemokines stimulates leukocyte tetheringand rolling on endothelial vascular cell adhesion molecule 1 underflow conditions. J Exp Med 192:495–506.

Ide A, Kawasaki E, Abiru N, Sun F, Fukushima T, Takahashi R,Kuwahara H, Fujita N, Kita A, Oshima K, Uotani S, Yamasaki H,Yamaguchi Y, Kawabata Y, Fujisawa T, Ikegami H, Eguchi K.2003. Stromal-cell derived factor-1 chemokine gene variant isassociated with type 1 diabetes age at onset in Japanese popula-tion. Hum Immunol 64:973–978.

Imai K, Kobayashi M, Wang J, Shinobu N, Yoshida H, Hamada J,Shindo M, Higashino F, Tanaka J, Asaka M, Hosokawa M. 1999.Selective secretion of chemoattractants for haemopoietic progeni-tor cells by bone marrow endothelial cells: a possible role in hom-ing of haemopoietic progenitor cells to bone marrow. Br JHaematol 106:905–911.

Kantele JM, Kurk S, Jutila MA. 2000. Effects of continuous expo-sure to stromal cell-derived factor-1 alpha on T cell rolling andtight adhesion to monolayers of activated endothelial cells. JImmunol 164:5035–5040.

Klein RS, Rubin JB, Gibson HD, DeHaan EN, Alvarez-HernandezX, Segal RA, Luster AD. 2001. SDF-1 alpha induces chemotaxisand enhances Sonic hedgehog-induced proliferation of cerebellargranule cells. Development 128:1971–1981.

Laguri C, Sadir R, Rueda P, Baleux F, Gans P, Arenzana-SeisdedosF, Lortat-Jacob H. 2007. The novel CXCL12gamma isoform enco-des an unstructured cationic domain which regulates bioactivityand interaction with both glycosaminoglycans and CXCR4. PLoSOne 2:e1110.

Lu Q, Sun EE, Klein RS, Flanagan JG. 2001. Ephrin-B reverse sig-naling is mediated by a novel PDZ-RGS protein and selectivelyinhibits G protein-coupled chemoattraction. Cell 105:69–79.

Ma Q, Jones D, Borghesani PR, Segal RA, Nagasawa J, Kishi-moto T, Bronson RT, Springer TA. 1998. Impaired B-lymphopoie-sis, myewpoiesis, and derailed cerebellar neuron migration inCXCR4- and SDF1 deficient mice. PNAS 95:9448–9453.

Massberg S, Konrad I, Schurzinger K, Lorenz M, Schneider S,Zohlnhoefer D, Hoppe K, Schiemann M, Kennerknecht E, SauerS, Schulz C, Kerstan S, Rudelius M, Seidl S, Sorge F, Langer H,Peluso M, Goyal P, Vestweber D, Emambokus NR, Busch DH,Frampton J, Gawaz M. 2006. Platelets secrete stromal cell-derivedfactor 1alpha and recruit bone marrow-derived progenitor cells toarterial thrombi in vivo. J Exp Med 203:1221–1233.

Nagasawa T, Hirota S, Tachibana K, Takakura N, Nishikawa S,Kitamura Y, Yoshida N, Kikutani H, Kishimoto T. 1996. Defects ofB-cell lymphopoiesis and bone-marrow myelopoiesis in mice lackingthe CXC chemokine PBSF/SDF-1. Nature 382:635–638.

Ohtani Y, Minami M, Kawaguchi N, Nishiyori A, Yamamoto J,Takami S, Satoh M. 1998. Expression of stromal cell-derived fac-tor-1 and CXCR4 chemokine receptor mRNAs in cultured rat glialand neuronal cells. Neurosci Lett 249:163–166.

Okada T, Ngo VN, Ekland EH, Forster R, Lipp M, Littman DR,Cyster JG. 2002. Chemokine requirements for B cell entry tolymph nodes and Peyer’s patches. J Exp Med 196:65–75.

Orimo A, Gupta PB, Sgroi DC, Arenzana-Seisdedos F, Delaunay T,Naeem R, Carey VJ, Richardson AL, Weinberg RA. 2005. Stromalfibroblasts present in invasive human breast carcinomas promote

tumor growth and angiogenesis through elevated SDF-1/CXCL12secretion. Cell 121:335–348.

Pillarisetti K, Gupta SK. 2001. Cloning and relative expressionanalysis of rat stromal cell derived factor-1 (SDF-1)1: SDF-1alpha mRNA is selectively induced in rat model of myocardial in-farction. Inflammation 25:293–300.

Ponomaryov T, Peled A, Petit I, Taichman RS, Habler L, SandbankJ, Arenzana-Seisdedos F, Magerus A, Caruz A, Fujii N, Nagler A,Lahav M, Szyper-Kravitz M, Zipori D, Lapidot T. 2000. Induc-tion of the chemokine stromal-derived factor-1 following DNAdamage improves human stem cell function. J Clin Invest106:1331–1339.

Ratajczak MZ, Majka M, Kucia M, Drukala J, Pietrzkowski Z,Peiper S, Janowska-Wieczorek A. 2003. Expression of functionalCXCR4 by muscle satellite cells and secretion of SDF-1 by mus-cle-derived fibroblasts is associated with the presence of bothmuscle progenitors in bone marrow and hematopoietic stem/pro-genitor cells in muscles. Stem Cells 21:363–371.

Rueda P, Balabanian K, Lagane B, Staropoli I, Chow K, LevoyeA, Laguri C, Sadir R, Delaunay T, Izquierdo E, Pablos JL,Lendinez E, Caruz A, Franco D, Baleux F, Lortat-Jacob H, Are-nzana-Seisdedos F. 2008. The CXCL12gamma chemokine dis-plays unprecedented structural and functional properties thatmake it a paradigm of chemoattractant proteins. PLoS One 3:e2543.

Segret A, Rucker-Martin C, Pavoine C, Flavigny J, Deroubaix E,Chatel MA, Lombet A, Renaud JF. 2007. Structural localizationand expression of CXCL12 and CXCR4 in rat heart and isolatedcardiac myocytes. J Histochem Cytochem 55:141–150.

Shamri R, Grabovsky V, Gauguet JM, Feigelson S, Manevich E,Kolanus W, Robinson NK, Staunton DE, von Andrian UH, AlonR. 2005. Lymphocyte arrest requires instantaneous induction ofan extended LFA-1 conformation mediated by endothelium-boundchemokines. Nat Immunol 6:497–506.

Shirozu M, Nakano T, Inazawa J, Tashiro K, Tada H, Shinohara T,Honjo T. 1995. Structure and chromosomal localization of thehuman stromal cell-derived factor 1 (SDF1) gene. Genomics 28:495–500.

Stumm RK, Rummel J, Junker V, Culmsee C, Pfeiffer M, Kriegl-stein J, Hollt V, Schulz S. 2002. A dual role for the SDF-1/CXCR4chemokine receptor system in adult brain: isoform-selective regu-lation of SDF-1 expression modulates CXCR4-dependent neuronalplasticity and cerebral leukocyte recruitment after focal ischemia.J Neurosci 22:5865–5878.

Suzuki G, Sawa H, Kobayashi Y, Nakata Y, Nakagawa K, Uzawa A,Sakiyama H, Kakinuma S, Iwabuchi K, Nagashima K. 1999. Per-tussis toxin-sensitive signal controls the trafficking of thymocytesacross the corticomedullary junction in the thymus. J Immunol162:5981–5985.

Tachibana K, Hirota S, Iizasa H, Yoshida H, Kawabata K, KataokaY, Kitamura Y, Matsushima K, Yoshida N, Nishikawa S, Kishi-moto T, Nagasawa T. 1998. The chemokine receptor CXCR4 isessential for vascularization of the gastrointestinal tract. Nature393:591–594.

Tashiro K, Tada H, Heilker R, Shirozu M, Nakano T, Honjo T. 1993.Signal sequence trap: a cloning strategy for secreted proteins andtype I membrane proteins. Science 261:600–603.

Tiveron MC, Rossel M, Moepps B, Zhang YL, Seidenfaden R, FavorJ, Konig N, Cremer N. 2006. Molecular interaction between pro-jection neuron precursors and invading interneurons via stro-mal-derived factor 1 (CXCL12)/CXCR4 signaling in the corticalsubventricular zone/intermediate zone. J Neurosci 26:13273–13278.

Yu L, Cecil J, Peng SB, Schrementi J, Kovacevic S, Paul D, Su EW,Wang J. 2006. Identification and expression of novel isoforms ofhuman stromal cell-derived factor 1. Gene 374:174–179.

Zaitseva M, Kawamura T, Loomis R, Goldstein H, Blauvelt A, Gold-ing H. 2002. Stromal-derived factor 1 expression in the humanthymus. J Immunol 168:2609–2617.

Zou YR, Kottmann AH, Kuroda M, Taniuchi I, Littman DR. 1998.Function of the chemokine receptor CXCR4 in haematopoiesisand in cerebellar development. Nature 393:595–599.

CXCL12c EXPRESSION DURING DEVELOPMENT 901