lable at ScienceDirect

Developmental and Comparative Immunology 84 (2018) 264e272

Contents lists avai

Developmental and Comparative Immunology

journal homepage: www.elsevier .com/locate/dci

An Ns1abp-like gene promotes white spot syndrome virus infection byinteracting with the viral envelope protein VP28 in red claw crayfishCherax quadricarinatus

Xiao-lu Xie a, Xue-jiao Chang a, Yan Gao a, Dong-li Li a, Ling-ke Liu a, Man-jun Liu a,Ke-jian Wang a, b, Hai-peng Liu a, b, *

a State Key Laboratory of Marine Environmental Science, Xiamen University, Xiamen 361102, Fujian, PR Chinab Collaborative Innovation Center for Exploitation and Utilization of Marine Biological Resources (Xiamen University), State-Province Joint EngineeringLaboratory of Marine Bioproducts and Technology, Xiamen 361102, Fujian, PR China

a r t i c l e i n f o

Article history:Received 31 January 2018Received in revised form26 February 2018Accepted 1 March 2018Available online 3 March 2018

Keywords:Ns1abp-like geneCherax quadricarinatusWhite spot syndrome virusAntiviral immunity

* Corresponding author. State Key Laboratory of MXiamen University, Fujian Province 361102, PR China

E-mail address: Haipengliu@xmu.edu.cn (H.-p. Liu

https://doi.org/10.1016/j.dci.2018.03.0010145-305X/© 2018 Elsevier Ltd. All rights reserved.

a b s t r a c t

Influenza A virus non-structural-1A binding protein (named as Ns1abp) was originally identified as ahost protein from human that bound to the viral NS-1 protein. In our previous study, the expression of anNs1abp-like gene (denoted as CqNs1abp-like gene) was found to be up-regulated in a transcriptome li-brary from the haematopoietic tissue (Hpt) cells of red claw crayfish Cherax quadricarinatus post whitespot syndrome virus (WSSV) infection. To elucidate the role of CqNs1abp-like gene involved in WSSVinfection, we cloned the CqNs1abp-like gene in which the open reading frame was 2232 bp, encoding 743amino acids with two typical domains of one BTB (Broad-Complex, Tramtrack and Bric a brac) domain atN-terminal and six Kelch domains at C-terminal. The gene expression profile showed that the mRNAtranscript of CqNs1abp-like gene was widely expressed in all the tested tissues with highest expression innerve, relatively high expression in Hpt and lowest expression in eyestalk. Importantly, both the WSSVentry and the viral replication were significantly reduced in Hpt cells after gene silencing of CqNs1abp-like gene. By using protein pull-down assay, we found that the recombinant BTB domain, six Kelch do-mains and CqNs1abp-like intact protein were all bound to the WSSV envelope protein VP28, respectively,in which the BTB domain showed slightly less binding affinity than that of the six Kelch domains or therecombinant intact protein. Besides, the WSSV entry into Hpt cells was clearly decreased when the viruswas pre-incubated with the recombinant BTB domain, six Kelch domains, or the recombinant CqNs1abp-like intact protein, respectively, suggesting that the CqNs1abp-like gene was likely to function as a pu-tative recognition molecular towards WSSV infection in a crustacean C. quadricarinatus. Taken together,these data shed new light on the mechanism of WSSV infection and a putatively novel target on anti-WSSV infection in crustacean farming.

© 2018 Elsevier Ltd. All rights reserved.

1. Introduction

White spot disease is one of the most common and damagingviral disease in shrimp aquaculture, which is caused by the whitespot syndrome virus. WSSV is a double-stranded DNA virus (about300 kb) with a large envelope (about 70e167 nm� 210e380 nm)(Escobedo-Bonilla et al., 2008). WSSV shows a rod- or elliptical-shaped like virus with a unique tail-like extension at one end by

arine Environmental Science,.).

transmission electron microscopy analysis. A rod-shaped nucleo-capsid is found inside the envelope. This virus has a very broad hostrange and strong pathogenicity among crustaceans, includingshrimp, crab, lobster and freshwater crayfish (Jiravanichpaisal et al.,2001; Sundar Raj et al., 2012). The farmed shrimp infected withWSSV will usually die within 3e10 days (Wang et al., 2008). Sinceits first identification in 1993, WSSV has caused serious economiclosses. Therefore, it is important to illuminate the mechanism ofWSSV infection. Due to the lack of shrimp cell lines for the WSSVinfection mechanism research, limited information has been un-covered from current understanding of the pathogenesis of WSSV.It is known that the haemocyte derives from the hematopoietic

X.-l. Xie et al. / Developmental and Comparative Immunology 84 (2018) 264e272 265

tissue (Hpt) and is finally released into the blood circulation incrayfish. Crayfish Hpt cell cultures has been well described byS€oderh€all et al. (Jiravanichpaisal et al., 2006; S€oderh€all et al., 2003),in which the Hpt cells are simple to be isolated and culturedin vitro, so it has been used as a good cell culturemodel for studyingthe process of WSSV infection (Huang et al., 2015; Jeswin et al.,2016; S€oderh€all, 2013). Therefore, research on WSSV infection inHpt cells will likely shed new light on the pathogenesis of this lethalvirus in crustacean aquaculture.

Influenza A virus non-structural-1A binding protein (Ns1abp,also known as NS1-BP, Nd1 or KLHL39) was first identified fromhumans that interacted with the nonstructural NS1 protein of theinfluenza A virus (Wolff et al., 1998). The Ns1abp protein containsan N-terminal BTB (Broad-Complex, Tramtrack and Bric a brac) orPOZ (poxvirus and zinc finger) domain and five Kelch-like tandemrepeat elements of ~50 amino acids in Hela cells. In humans, theKelch-repeat domain is the most prevalent substrate-bindingdomain and more than 95 BTB-Kelch family proteins have beenfound in human genome. However, it has not been well exploredin crustacean. A recent study revealed that Ns1abp participated inregulating the alternative splicing of influenza A virus M1 mRNAto yield M2 mRNA by its interacting partner hnRNP K. M1 mRNAsegments generate matrix protein M1 and ion channel protein M2which are involved in virus trafficking, release and budding.Thereby Ns1abp plays an important role in influenza A viral geneexpression during viral infection (Tsai et al., 2013). In consistentwith its role in mRNA splicing, Ns1abp is localized in the nucleusand co-localizes with splicesome assembly factor SC35. The co-localization can be destroyed during viral infection and it thenre-localizes throughout the nucleoplasm (Wolff et al., 1998).While in Drosophila and NIH3T3 cells, Ns1abp was found to be co-localized and physically associated with actin in the cytoplasm viaits Kelch domain (Adams et al., 2000; Sasagawa et al., 2002). It hasbeen suggested that Ns1abp functions as a stabilizer of actin fil-aments by binding to actin protein and may play a role in thedynamic organization of the actin cytoskeleton. However, it isunclear where it localizes during WSSV infection in red clawcrayfish.

By proteomic analysis, VP28 has been identified as one of themajor envelope proteins of WSSV, and it can interact with otherviral structural proteins like VP26 and VP24 of WSSV (Xie et al.,2006). In our previous study, we also found that VP28 plays animportant role in the entry of WSSV into host cells (Chen et al.,2016). Besides, VP28 can be recognized by several host cell pro-teins, such as GABARAP and Laminin receptor in a crustacean redclaw crayfish Cherax quadricarinatus (Chen et al., 2016; Liu et al.,2018). Hence, the relative quantification of VP28 can be regardedas a good indication ofWSSV infection andwe then chose this gene/protein for the indication of WSSV infection in our present study.Previously, we found that the transcript of CqNs1abp-like gene wasresponsive to WSSV infection in the Hpt cells from red claw cray-fish. Whereas, whether CqNs1abp-like gene affected the WSSV en-try and further the viral replication in crustacean was not clear. Tofurther investigate the contribution of Ns1abp-like gene in WSSVinfection in a crustacean, we then cloned the full-length openreading frame (ORF) of CqNs1abp-like from red claw crayfishC. quadricarinatus, and determined its gene expression profile andpotential functions involved in WSSV infection. Importantly, WSSVentry and replicationwas significantly reduced by gene silencing ofNs1abp-like gene. The CqNs1abp-like protein-WSSV interactionassay indicated that CqNs1abp-like protein was likely to act as aninteracting partner, which bound to one of the WSSV envelopeproteins VP28 and thus promoted the WSSV infection in red clawcrayfish Hpt cells.

2. Material and methods

2.1. Animals and tissue collection

Healthy red claw crayfish, C. quadricarinatus were purchasedfrom Source Sentai Agricultural Science and Technology Co., Ltd ofZhangzhou, Fujian Province, China, and acclimatized in aeratedfreshwater at 26 �C for at least one week before experiments. Afterthat, crayfish tissues were collected. Haemocyte was obtained witha sterile steel needle (16#) from the animal's abdomen and mixedwith anticoagulant solution (NaCl 510mM; glucose 100mM; citricacid 200mM; Na-citrate 30mM; EDTA-2Na 10mM; pH 7.3) (1:1)on the ice followed by centrifugation at 1000�g for 10min at 4 �C.Hpt cells were prepared fromHpt of C. quadricarinatus and culturedas described by S€oderh€all et al. and Liu et al. (Liu et al., 2011;S€oderh€all et al., 2003). Other tissues (stomach, gonad, muscle,nerve, intestine, heart, hepatopancreas, gill, epithelium andeyestalk) were sampled from three random individuals for totalRNA isolation.

2.2. Total RNA extraction and first strand cDNA synthesis

Total RNA from tissues as described above was isolated usingTrizol reagent (Roche, Mannheim, Germany) according to themanufacturer's instructions. The extracted RNAwas evaluated witha NanoDrop 2000 spectrophotometer (Thermo Scientific, USA) andanalyzed by 1.0% agarose gel electrophoresis. RNA was reverselytranscribed to cDNA by PrimeScript™ RT reagent Kit with gDNAEraser (Takara, code No. RR047A) following the manufacturer'sinstructions.

2.3. Gene cloning of the full-length ORF sequence of CqNs1abp-likegene

Two partial CqNs1abp-like gene cDNA sequences ofC. quadricarinatuswere isolated from a transcriptome library of Hptcells post WSSV infection in our lab (unpublished data). These twosequences contained the 50-end part with the initial codon "ATG"and the following 687 base pairs, and the 30-end part with the stopcodon "TAA" and the upstream of 1104 base pairs according to theBLAST result of NCBI web site, but which was lacking of the middlepart of full-length of ORF sequence. PCR primers (Ns1abp-F/Ns1abp-R, Table 1) were then designed to confirm these two partialsequences and fix gap sequence of CqNs1abp-like gene by using theHpt cell cDNA as template. The ORF of CqNs1abp-like gene cDNA(primers: Fl- Ns1abp-F/Fl- Ns1abp-R) was obtained by combinationof these two parts together and the PCR amplification conditionswere as follows: 3min at 94 �C; 30 cycles of 94 �C for 30 s, 65 �C for30 s (decrease 0.3 �C per cycle) and 72 �C for 2min; and 72 �C for5min. All PCR products were gel-purified using a Gel Extraction Kit(Sangon Biotech, Co., Ltd., Shanghai, China), and the expected DNAfragments were ligated into a pMD18-T vector (TaKaRa). The vec-tors were transformed into E. coli DH5a cells. Positive clones con-taining inserts of an expected size were sequenced at Xiamen BoruiBiotech Company, China.

2.4. Bioinformatics analysis

The similarity analysis of CqNs1abp-like gene sequence wasconducted using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi/),and the domain architecture prediction of the proteins was per-formed with SMART (Simple Modular Architecture Research Tool,http://smart.embl-heidelberg.de). The 3D structure of CqNs1abp-like protein was constructed by using SWISS-MODEL server(http://swissmodel.expasy.org/).

Table 1Primer sequences used in this study.

Primers Sequence

Ns1abp-F TCGGTCTGTCCTGGCTTGTGNs1abp-R CATCCTCGCCTTGGAGTGGTFl- Ns1abp-F ATGACCTCCACATCTGCACAATCFl- Ns1abp-R TTAATGGCCATTAGTGGCAATTGqNs1abp-F GAGGAGGACCTTCATTTGGACqNs1abp-R GTTGTGGCGTTGTTGACTTTCdsNs1abp-F TAATACGACTCACTATAGGGTAAGATGCGAAGAAAGTCAAdsNs1abp-R TAATACGACTCACTATAGGGCCATCACAGCCACCAATACq-Ns1abp-BTB-F CCGGAATTCTGCGATGTCATCCTCCAGGTCq-Ns1abp-BTB-R AATGCGGCCGCTTAGTGATGGTGATGGTGATGTAAATGAGCCACCAGATGCTCACq-Ns1abp-Kelch-F CCGGAATTCCATCTTTTGGTCTGTGGAGGCq-Ns1abp-Kelch-R AATGCGGCCGCTTAGTGATGGTGATGGTGATGTCTCTTCGTATAGTTATCAATGCCCq-Ns1abp-FL-F CCGGAATTCATGACCTCCACATCTGCACAATCCq-Ns1abp-FL-R AATGCGGCCGCTTAGTGATGGTGATGGTGATGATGGCCATTAGTGGCAATTGAA16S-F AATGGTTGGACGAGAAGGAA16S-R CCAACTAAACACCCTGCTGATAdsGFP-F TAATACGACTCACTATAGGGCGACGTAAACGGCCACAAGTdsGFP-R TAATACGACTCACTATAGGGTTCTTGTACAGCTCGTCCATGCVP28-F AAACCTCCGCATTCCTGTVP28-R GTGCCAACTTCATCCTCATC

X.-l. Xie et al. / Developmental and Comparative Immunology 84 (2018) 264e272266

2.5. Tissue distribution of CqNs1abp-like gene in red claw crayfish

The transcript level of CqNs1abp-like gene mRNA in differenttissues was analyzed by qRT-PCR using an ABI PCR machine(Applied Biosystems 7500, UK). The specific primers (qNs1abp-F/qNs1abp-R) were used to amplify target fragment and the crayfish16S ribosomal gene (Genbank: AF135975.1) was used as the inter-nal standard. The specific primers and 16S primers were shown inTable 1. The reaction was comprised of 10 mL of SYBR Green Master(2� ) (Roche, USA), 0.5 mL of sense primer and antisense primer(10mM), respectively, 5.0 mL of 50 times diluted cDNA, and 4 mL ofsterile water. And the conditions of qRT-PCR were as follows: 50 �Cfor 2min and 95 �C for 10min followed by 40 cycles of 95 �C for 15 sand 60 �C for 1min. Melting curve analysis was used to confirm thespecificity of qRT-PCR amplification. The relative transcriptexpression of CqNs1abp-like gene was calculated by using the 2-△△Ct method (Livak and Schmittgen, 2001). The qRT-PCR experi-ments were completed in biological triplicates.

2.6. RNA interference assay and WSSV challenge

To silence the CqNs1abp-like gene expression, the RNA inter-ference assay was performed. Hpt cell cultures were prepared in24-well and 96-well plates, respectively, as previously described(Liu et al., 2011). A pair of primers was designed to synthesizedsRNA of CqNs1abp-like gene (dsNs1abp-F/dsNs1abp-R, Table 1),which contained a T7 promoter ahead of 50-terminal of bothstrands. The dsRNA was synthesized by using the MegaScript kit(Ambion, Austin, TX, USA) according to the manufacturer's in-structions and purified with the Trizol and chloroform. The dsGFPRNAwas synthesized in the same way, which was used as a controltreatment. For dsRNA transfection, 400 ng of dsRNA/well (24-wellplates) or 100 ng of dsRNA/well (96-well plates) with CellfectinIIreagent (Life Techologies) were incubated for 10min at roomtemperature, then mixed with L-15 medium and added gently intothe cell wells.

WSSV was extracted from the swamp crayfish Procambarusclarkia (Xie et al., 2005). WSSV infection was performed in 24-wellplates (MOI¼ 1) for viral replication detection or 96-well plates(MOI¼ 10) for detecting the viral entry at 36 h after the dsRNAtransfection. The cells in 24-well plates were collected with lysisbuffer (Sigma) at 6 h after WSSV infection. The total RNA was

extracted by using GenElute™ Mammalian Total RNA miniprep kit(Sigma) according to the protocol and cDNA synthesis wasdescribed before using PrimeScript™ RT Reagent Kit (TaKaRa). qRT-PCR was carried out to determine whether gene silencing ofCqNs1abp-like gene had any effect on the viral replication. Theexpression of a late gene (VP28) of WSSV and 16S RNA (internalcontrol) were analyzed. The primers of VP28 (VP28-F, VP28-R) and16S RNA (16s-F, 16s-R) were shown in Table 1. The Hpt cells in 96-well plates were harvested at 1 h after infection. The cells werewashed twice with L-15 medium before suspension in 1� SDSsample buffer. To determine the WSSV entry, Western blot analysiswas performed, and b-actin was used as the internal control. TheRNA interference experiment was completed in biologicaltriplicates.

2.7. Recombinant proteins expression and purification

In order to study the function of CqNs1abp-like protein, specificprimers were designed (primers: CqNs1abp -BTB-F/R, CqNs1abp-Kelch-F/R, CqNs1abp -FL-F/R, Table 1) for BTB/Kelch Domains andintact CqNs1abp-like protein correspondingly. To improve the pu-rity of the recombinant protein, 6�His tag were added before C-terminal of these proteins. The target sequences were inserted intothe pMAL-c2X expression vector. The sequences were verified bysequencing. The MBP/His-tag fusion proteins were induced by0.1mM isopropyl-b-D-thiogalactopyranoside for 12 h at 16 �C inEscherichia coli strain BL21 and further purified. After centrifugationat 10,000�g for 30min, E. coli cells precipitation was re-suspendedin lysis buffer (50mM Tris-HCl [pH 7.4], 300mM NaCl, 20mMimidazole), The supernatant was mixed gently with 1mL of NiResin FF (Genscript, USA) beads for 12 h at 4 �C after ultrasonicationand centrifugation. After rinsing with ice-cold PBS containing10mM imidazole, the fusion proteins were eluted with gradientconcentration of imidazole. Then the purified recombinant proteinswere collected and dialyzed by 1� PBS. The purified protein wasthen analyzed by SDS-PAGE.

2.8. Protein pull-down assay

MBP/His-tag recombinant proteins were expressed and purifiedas described in Section 2.7. Equal amounts of the WSSV envelopeproteins were divided into each tube. Five microgram of MBP-tag

X.-l. Xie et al. / Developmental and Comparative Immunology 84 (2018) 264e272 267

rCqNs1abp-like recombinant proteins or MBP control protein and20 mL of dextrin beads (50/50 slurry in lysis buffer) was added intoeach tube and rotated at 4 �C for 2 h with end-over-end mixing.After incubation, the beads were washed with PBS for 5 times. Thebinding proteins were eluted at 4 �C for 2 h by incubation with15 mL of maltose elution buffer (10mM maltose in PBS buffer). Theprotein sample was denatured by boiling for 10min and electro-phoresed in 12% SDS-PAGE gels.

2.9. Effect on WSSV infection by preincubation of the virus withrecombinant CqNs1abp-like protein or its key domains

The Hpt cell cultures in 96-well plates were infected with WSSVthat had been pre-incubated with either 1 mg of recombinant MBPcontrol protein, MBP-tag rCqNs1abp-like protein, BTB domain, orsix Kelch domains, respectively, for 30min. To determine WSSVentry, viral infection was performed as described above at an MOIof 10 for 1 h before cell lysis in 10 mL of 1� SDS lysis buffer andfurther determined by immunoblotting analysis.

2.10. Statistical analysis

All the data were analyzed by one-way ANOVA and presented asthe mean± SD from at least three independently biological assays.Differences with p< 0.05 were considered as the significantdifference.

3. Results and discussion

3.1. Gene cloning and sequence analysis of CqNs1abp-like gene

Previously, CqNs1abp-like gene was found to be up-regulated ina transcriptome library post WSSV infection (unpublished data). Tofurther elucidate how CqNs1abp-like gene functioned during WSSVinfection, we then cloned CqNs1abp-like gene followed by func-tional study. As shown in Fig. 1, the ORF of CqNs1abp-like gene(MG824990) was 2232 bp that encoded 743 amino acids. Thecalculated protein molecular weight was 81.9 kDa with pI of 6.21.The predicted 3D model of the partial region (405-686aa) ofCqNs1abp-like gene is a channel-like structure (Fig. 2A) (Arnoldet al., 2006; Benkert et al., 2011; Biasini et al., 2014). The SMARTanalysis showed that the deduced CqNs1abp-like protein containeda BTB domain and 6 Kelch domains (Fig. 2B). BTB domain, alsoknown as POZ and a protein-protein interaction motif, has beenfound at the N-terminal of several C2H2-type transcription factorsas well as Shaw-type potassium channels (Kochneva et al., 2009). InDrosophila, Ns1abp protein forms a homodimer through its BTB/POZ domain (Adams et al., 2000), which is important for its asso-ciation with other BTB/POZ containing proteins (Soltysik-Espanolaet al., 1999) and participates in many aspects of cell function suchas regulating the transcriptional activity of zinc-finger proteins(Bardwell and Treisman, 1994). Kelch repeat superfamily protein isone of the actin-binding proteins which was named after itsisolation as a female sterile mutation affecting cytoplasm transportduring oocyte maturation in Drosophila (Xue and Cooley, 1993).Meanwhile, Kelch domain is a 44-56-residue motif segment con-taining eight conserved residues, including four hydrophobic resi-dues followed by a double glycine element separated from twocharacteristically spaced aromatic residues. This sequence motifrepresents one beta-sheet blade, and several of these repeats canform a beta-propeller (Adams et al., 2000). As a component of ringcanals in Drosophila, Kelch repeat protein regulates the flow ofcytoplasm between cells. Kelch repeat proteins also participate inmany aspects of cell functions, including cell morphology and or-ganization (Varkey et al., 1995), gene expression (Bresciani et al.,

2017), viral binding partners (Johnson et al., 1999; Wilson et al.,1997) and actin associating partners (Soltysik-Espanola et al.,1999). For example, it has been reported in colon cancer, in whicha BTB-family protein KLHL20 recruits substrate DAPK and itsadaptor, resulting in the ubiquitination and degradation of DAPK(Lee et al., 2010). In consideration to that the component of cyto-skeleton like actin functions in the WSSV entry into Hpt cells (Chenet al., 2016), these molecular properties together imply thatCqNs1abp-like gene might interact with actin and facilitate the viralentry into host cells, but which still needs further moreinvestigation.

3.2. The transcript distribution of CqNs1abp-like gene in varioustissues of red claw crayfish

To examine the transcript expression profile of CqNs1abp-likegene in red claw crayfish, real-time relative quantitative PCR wasperformed in multiple tissues, including nerve, epithelial tissue,haemocytes, gill, heart, intestine, hepatopancreas, gonad, hemato-poietic tissue, stomach, muscle and eyestalk. As shown in Fig. 3,CqNs1abp-like gene mRNA was widely expressed in all tested tis-sues. High expression was observed in nerve, epithelial tissue,haemocytes and gill, followed by heart, intestine, hepatopancreasand gonad. Relatively lower expressionwas found in hematopoietictissue, stomach and muscle. The lowest expressionwas observed ineyestalk. It is well known that crustacean is lacking of adaptiveimmunity and relies solely on innate immunity. The epithelial tis-sue is one of the first-line physical barriers protecting crustaceansfrom microbial invasion. It has been reported that CqALF (Lin et al.,2016) and LvCD63 (Guan et al., 2016) were relatively highlyexpressed in epithelial tissues of crustacean, and play importantroles in immune defense against WSSV. Pre-incubation of WSSVwith rCqALF clearly resulted in both a significant reduction inWSSVreplication in red claw crayfish Hpt cell cultures and also anincreased survival rate among the tested animals. Besides, themRNA expression of LvCD63 in epithelial tissue of Litopenaeusvannameiwas significantly up-regulated after WSSV infection at 12and 72 h. Hence, the high expression of CqNs1abp-like gene inepithelial tissue implied that CqNs1abp-like gene might play animportant role in immune response against microbial invasion.Additionally, haemocyte plays a key role in immune response, suchas pathogen recognition and generating immune defense mole-cules in crustaceans (Johansson et al., 2000). The high expression ofCqNs1abp-like gene in haemocyte indicated the likely crucial role ofCqNs1abp-like gene in immune protection against pathogens in redclaw crayfish.

3.3. Inhibition on WSSV entry and replication by gene loss-of-function of CqNs1abp-like gene in crayfish Hpt cells

As mentioned above, CqNs1abp-like gene contained severalprotein binding domains and was highly expressed in someimmune-related tissues in red claw crayfish. Although haemocyteis susceptible to WSSV infection, the propagation of progeny WSSVwas rarely found in crayfish haemocyte but in Hpt cells(Jiravanichpaisal et al., 2006; Wu et al., 2015). Meanwhile,CqNs1abp-like gene was relatively highly expressed in Hpt tissue.Therefore, the Hpt cells can be employed as a good model for themechanism study of WSSV infection. The CqNs1abp-like gene wasthen silenced by dsRNA in Hpt cells followed by theWSSV infection.As shown in Fig. 4A, the CqNs1abp-like gene transcript was signif-icantly reduced about 80% if compared with that of dsGFP controlgroup, indicating that CqNs1abp-like gene was efficiently silencedin Hpt cell cultures. It has been reported that WSSV can recruitmultiple endocytic routes to enter host cells (Chen et al., 2016;

Fig. 1. The full-length ORF sequence and the deduced amino acid sequence of CqNs1abp-like gene from the red claw crayfish C. quadricarinatus. The BTB domain was shown inshadow and the Kelch domains were underlined.

X.-l. Xie et al. / Developmental and Comparative Immunology 84 (2018) 264e272268

Huang et al., 2015; Li et al., 2015). Then, we wondered whethergene silencing ofNs1abp-like gene affected on the cellular entry andreplication of WSSV in consideration to that Ns1abp molecule in-teracts with cytoskeleton/actin in human brain andmurine NIH3T3

cell (Sasagawa et al., 2002; Soltysik-Espanola et al., 1999) As shownin Fig. 4B, the amount of a viral envelope protein VP28, an indica-tion of the entered WSSV at the early viral invasion stage, wassignificantly reduced after gene silencing of CqNs1abp-like gene,

Fig. 2. The bioinformatic analysis of CqNs1abp-like protein. (A) The 3D structure model of CqNs1abp-like domains. (B) Predicted protein domain structure of CqNs1abp-like gene.CqNs1abp-like protein contained a BTB domain (purple) and six Klech domains (orange). (For interpretation of the references to colour in this figure legend, the reader is referred tothe Web version of this article.)

Fig. 3. The mRNA expression profile of CqNs1abp-like gene in different tissues fromC. quadricarinatus. NE: nerve; EP: epithelial tissue; HE: haemocyte; GI: gill; HT: heart;IN: intestine; HP: hepatopancreas; GO: gonad; Hpt: hematopoietic tissue; ST: stomach;MU: muscle; EYE: eyestalk. The experiment was repeated for three times.

X.-l. Xie et al. / Developmental and Comparative Immunology 84 (2018) 264e272 269

suggesting that WSSV entry into Hpt cells was strongly suppressedby gene loss-of-function of CqNs1abp-like gene. Meanwhile, thetranscript of a viral gene VP28 exhibited significant lower level thanthat of the control group at 6 h post WSSV infection, clearly indi-cating that loss-of-function of CqNs1abp-like genewould inhibit the

WSSV infection in Hpt cells (Fig. 4C). It has been reported that Kelchrepeat proteins (named as Mayven) are the binding partners ofactin (Soltysik-Espanola et al., 1999), which may be translocatedalong axonal processes and be involved in the dynamic organiza-tion of the actin cytoskeleton in brain cells. And in NIH3T3 cells,Ns1abp protein (named as Nd1) functions as a stabilizer of actinfilaments to act as an actin-binding protein and then plays a role indynamic organization of the actin skeleton during cell division(Sasagawa et al., 2002). Previously, we also reported that rCq-GABARAP promotes WSSV entry by cooperation with microfila-ments (Chen et al., 2016). We then supposed that Ns1abp-likeprotein probably localizes in the cytoskeleton and associates withactin filaments in red claw crayfish. However, due to the lack ofspecific antibody, we could not predict its precise location in redclaw crayfish Hpt cells at present. Furthermore, no binding activitywas found between CqNs1abp-like protein and actin with immu-noblotting assays under our experimental condition (data notshown), which was probably caused by lacking of other key co-factors that needs further studies. Taken together, CqNs1abp-likegene was likely to promoteWSSV entry andmight also regulate thereplication of WSSV in red claw crayfish Hpt cells.

3.4. Reduced WSSV entry by pre-incubation of the virion withrCqNs1abp-like protein in Hpt cells

As described above, gene silencing of the CqNs1abp-like geneclearly suppressed the WSSV entry into crayfish Hpt cells. Besides,CqNs1abp-like protein contained one BTB domain and 6 Kelchdomains which were both involved in protein-protein interactions.For examples, the BTB/POZ domain is an evolutionarily conservedprotein-protein interaction motif that has been found in approxi-mately 40 mammalian transcription factors. BTB/POZ domainsmediate both the homodimerization and the heteromeric in-teractions of different BTB/POZ-domain containing transcription

Fig. 4. Reduced WSSV entry and viral replication by gene silencing of CqNs1abp-like gene in crayfish Hpt cells. (A) The mRNA expression of CqNs1abp-like gene was determined byqRT-PCR during WSSV infection. The expression of CqNs1abp-like gene was reduced significantly compared to control group during WSSV infection. GFP dsRNA treatment was usedas the control group. (B) Inhibition on WSSV entry by gene knocking down of CqNs1abp-like gene. WSSV challenge (MOI¼ 10) was performed at 36 h after dsRNA transfection in Hptcells. The major viral envelope protein VP28 was immunoblotted with a monoclonal antibody against VP28 at 1 hpi, and b-actin was employed as internal control. The bandintensities of three independent experiments were calculated by using Gel Image SystemID 4.2 program. (C) Relative gene expression of a viral late gene VP28 was examined inCqNs1abp-like gene silenced Hpt cells post WSSV challenge at 6 h. This experiment was repeated for three times. The asterisk indicated the significant difference compared withthose of controls (*p < 0.05, **p < 0.01).

X.-l. Xie et al. / Developmental and Comparative Immunology 84 (2018) 264e272270

factors with each other (Stead and Wright, 2014; Stogios et al.,2005). Many BTB/POZ-domain containing transcription factorsplay roles in development and several of them have been impli-cated in specific human malignancies (Kelly and Daniel, 2006).Meanwhile, Kelch repeat proteins can act as viral binding partners(Johnson et al., 1999; Wilson et al., 1997). To further elucidate therole of CqNs1abp-like protein in WSSV infection, recombinant BTBdomain, six Kelch domains and the CqNs1abp-like intact proteinwere recombinantly expressed in E. coli, respectively, and furtherpurified by the fusedMBP tag and His Tag. The calculatedmolecularweight of BTB, six Kelch domains and CqNs1abp-like intact proteinwas about 12 kDa, 31 kDa and 82 kDa, respectively, while MBP tagwas about 40 kDa. As shown in Fig. 5, the purified recombinantproteins were thus approximately 52 kDa, 71 kDa and 122 kDa inmolecular weight, which were in agreement with the calculated

Fig. 5. SDS-PAGE analysis of rCqNs1abp-like protein purification. Lane M: molecularweight marker. Lane 1: purified rCq-Ns1abp-like intact protein. Lane 2: purifiedrCqNs1abp-like-Kelch protein. Lane 3: purified rCqNs1abp-like-BTB protein.

molecular mass of the rCqNs1abp-like-BTB, rCqNs1abp-like-Kelchand rCqNs1abp-like intact protein correspondingly. To elucidatewhether CqNs1abp-like protein or its key domains could bind toany of WSSV envelope proteins which might facilitate the viralinfection, we performed the proteins pull-down experiment inwhich rCqNs1abp-like-BTB, rCqNs1abp-like-Kelch and rCqNs1abp-like intact protein showed clearly binding activity with one of theWSSV envelope proteins VP28 (Fig. 6). In our previous study, wefound that WSSV envelope protein VP28 could bind to the cyto-skeletal components like Cq-b-tubulin and Cq-b-actin in red clawcrayfish (Chen et al., 2016). Our finding was in consistent withanother study by Xie et al. in that the viral envelope protein likeVP26 of WSSV could bind to actin in swamp crayfish (Procambarusclarkii) by affinity-chromatography and co-immunoprecipitationassay (Xie and Yang, 2005), and also by Wu et al. in which theWSSV envelope protein like VP466 could bind to the cytoskeletoncomponents like tropomyosin and actin from shrimp (Penaeusjaponicus) by GST pull-down assay and immunoprecipitation assay(Wu et al., 2008). Additionally, the envelope protein VP28 of WSSVcan bind to shrimp cells as an attachment protein and then helpsthe viral entry into the cytoplasm, and the recombinant VP28protein is able to compete with WSSV in binding to Penaeus mon-odon shrimp cells (Yi et al., 2004). Further studies have revealedthat a multi-interaction complex, including VP24, VP26, VP28,VP38A, VP51A and WSV010, can form a membrane-associatedprotein complex which acts as an “infectome” that plays a role incell recognition, cell attaching and then guiding the virus into thehost cells (Chang et al., 2010; Zhou et al., 2009). These data togethersuggest that WSSV virion may “hijack” cytoskeleton componentsfor “viral entry” or intracellular transport once passing the cellmembrane intracellularly. Considering the important role of actinskeleton in WSSV internalization, we speculate that CqNs1abp-likeprotein probably affects the WSSV entry into Hpt cells by inter-fering the binding of VP28 with actin on one aspect and stabilizingthe actin skeleton on the other aspect but which requires furthermore investigation near future. Next, we analyzed the efficiency ofviral entry by pre-incubation of WSSV with recombinant extra

Fig. 6. Proteins interaction between WSSV envelope protein VP28 and the recombinant CqNs1abp-like intact protein, BTB domain, or six Kelch domains. The immunoblot wasperformed by using an anti-VP28 antibody. The binding affinity was observed with rCqNs1abp-like-BTB domain (lane 4), rCqNs1abp-like-Kelch domain (lane 5) and rCqNs1abp-likeintact protein (lane 6). No binding signal of VP28 was found in the negative controls including PBS buffer alone instead of the recombinant protein (lane 2) and the MBP-tag control(lane 3). The viral envelope protein (Input) was used as a positive control.

X.-l. Xie et al. / Developmental and Comparative Immunology 84 (2018) 264e272 271

rCqNs1abp-like intact protein or its key domains, including the BTBor six Kelch domains, followed by inoculation of the mixture intoHpt cell cultures. Importantly, we found that pre-incubation ofWSSV with the rCqNs1abp-like-BTB, rCqNs1abp-like-Kelch proteinor the rCqNs1abp-like intact protein clearly reduced the WSSVentry, respectively (Fig. 7). We then speculated that the reduced

Fig. 7. Inhibition on WSSV entry by pre-incubation of the WSSV with rCqNs1abp-likeintact protein or its key domain. WSSV was pre-incubated with 1 mg of MBP-tagproteins (MBP-tag only control, rCqNs1abp-like-BTB, rCqNs1abp-like-Kelch andrCqNs1abp-like intact protein) for 30 min followed by infection with MOI ¼ 10 in Hptcells. Then the cells were harvested at 1 h post WSSV infection. The viral envelopeprotein VP28 and the reference protein of red claw crayfish b-actin were determinedby immunoblotting (lower panel), respectively. The band intensities were analyzed byusing Gel Image System ID 4.2 program (upper panel). This experiment was repeatedfor three times. The asterisk indicated significant difference compared with those ofcontrols (*p < 0.05, **p< 0.01).

WSSV entry, by pre-incubation of the virions with recombinantrCqNs1abp-like proteins or its key domains, was likely to be causedby its direct binding to VP28 and then the blocking of VP28-mediated attaching and entering into host cells, in which theexcess binding could block the recognition sites on the envelope ofWSSV by other putative cellular factors involved in the endocytic ofWSSV in Hpt cells. Taken together, CqNs1abp-like gene is likely toregulate the WSSV entry into Hpt cells by interacting with one ofthe viral envelope proteins VP28.

4. Conclusions

In summary, we reported for the first time that a CqNs1abp-likegene was involved in WSSV infection in a crustacean red clawcrayfish C. quadricarinatus. Gene loss-of-function of CqNs1abp-likegene resulted in significantly reducedWSSV entry into crayfish Hptcells. Furthermore, CqNs1abp-like gene was likely to promoteWSSVentry into Hpt cells by binding to one of the WSSV envelope pro-teins VP28. These data together shed a new light of potential anti-viral target for WSSV disease control in crustacean aquaculture.

Acknowledgements

This work was supported by the National Natural ScienceFoundation of China (nos. U1605214, 41476117, 41676135) andFRFCU (20720162010, 20720170083, 2017X0622).

References

Adams, J., Kelso, R., Cooley, L., 2000. The kelch repeat superfamily of proteins:propellers of cell function. Trends Cell Biol. 10, 17e24.

Arnold, K., Bordoli, L., Kopp, J., Schwede, T., 2006. The SWISS-MODEL workspace: aweb-based environment for protein structure homology modelling. Bioinfor-matics 22, 195e201.

Bardwell, V.J., Treisman, R., 1994. The POZ domain: a conserved protein-proteininteraction motif. Gene Dev. 8, 1664e1677.

Benkert, P., Biasini, M., Schwede, T., 2011. Toward the estimation of the absolutequality of individual protein structure models. Bioinformatics 27, 343e350.

Biasini, M., Bienert, S., Waterhouse, A., Arnold, K., Studer, G., Schmidt, T., Kiefer, F.,Gallo Cassarino, T., Bertoni, M., Bordoli, L., Schwede, T., 2014. SWISS-MODEL:modelling protein tertiary and quaternary structure using evolutionary infor-mation. Nucleic Acids Res. 42, W252eW258.

Bresciani, A., Missineo, A., Gallo, M., Cerretani, M., Fezzardi, P., Tomei, L., Cicero, D.O.,Altamura, S., Santoprete, A., Ingenito, R., Bianchi, E., Pacifici, R., Dominguez, C.,Munoz-Sanjuan, I., Harper, S., Toledo-Sherman, L., Park, L.C., 2017. Nuclear factor(erythroid-derived 2)-like 2 (NRF2) drug discovery: biochemical toolbox todevelop NRF2 activators by reversible binding of Kelch-like ECH-associatedprotein 1 (KEAP1). Arch. Biochem. Biophys. 631, 31e41.

Chang, Y.S., Liu, W.J., Lee, C.C., Chou, T.L., Lee, Y.T., Wu, T.S., Huang, J.Y., Huang, W.T.,Lee, T.L., Kou, G.H., Wang, A.H., Lo, C.F., 2010. A 3D model of the membraneprotein complex formed by the white spot syndrome virus structural proteins.PLoS One 5, e10718.

Chen, R.Y., Shen, K.L., Chen, Z., Fan, W.W., Xie, X.L., Meng, C., Chang, X.J., Zheng, L.B.,Jeswin, J., Li, C.H., Wang, K.J., Liu, H.P., 2016. White spot syndrome virus entry isdependent on multiple endocytic routes and strongly facilitated by Cq-GABARAP in a CME-dependent manner. Sci. Rep. 6, 28694.

Escobedo-Bonilla, C.M., Alday-Sanz, V., Wille, M., Sorgeloos, P., Pensaert, M.B.,

X.-l. Xie et al. / Developmental and Comparative Immunology 84 (2018) 264e272272

Nauwynck, H.J., 2008. A review on the morphology, molecular characterization,morphogenesis and pathogenesis of white spot syndrome virus. J. Fish. Dis. 31,1e18.

Guan, G.K., Liu, Q.H., Li, C., Huang, J., 2016. Cloning of Litopenaeus vannamei CD63and it's role in white spot syndrome virus infection. Dev. Comp. Immunol. 60,209e217.

Huang, J., Li, F., Wu, J., Yang, F., 2015. White spot syndrome virus enters crayfishhematopoietic tissue cells via clathrin-mediated endocytosis. Virology 486,35e43.

Jeswin, J., Xie, X.L., Ji, Q.L., Wang, K.J., Liu, H.P., 2016. Proteomic analysis by iTRAQ inred claw crayfish, Cherax quadricarinatus, hematopoietic tissue cells post whitespot syndrome virus infection. Fish Shellfish Immunol. 50, 288e296.

Jiravanichpaisal, P., Bangyeekhun, E., S€oderh€all, K., S€oderh€all, I., 2001. Experimentalinfection of white spot syndrome virus in freshwater crayfish Pacifastacusleniusculus. Dis. Aquat. Org. 47, 151e157.

Jiravanichpaisal, P., S€oderh€all, K., S€oderh€all, I., 2006. Characterization of white spotsyndrome virus replication in in vitro-cultured haematopoietic stem cells offreshwater crayfish, Pacifastacus leniusculus. J. Gen. Virol. 87, 847e854.

Johansson, M.W., Keyser, P., Sritunyalucksana, K., S€oderh€all, K., 2000. Crustaceanhaemocytes and haematopoiesis. Aquaculture 191, 45e52.

Johnson, K.M., Mahajan, S.S., Wilson, A.C., 1999. Herpes simplex virus transactivatorVP16 discriminates between HCF-1 and a novel family member, HCF-2. J. Virol.73, 3930e3940.

Kelly, K.F., Daniel, J.M., 2006. POZ for effectePOZ-ZF transcription factors in cancerand development. Trends Cell Biol. 16, 578e587.

Kochneva, G.V., Taranov, O.S., Lupan, T.A., Iudin, P.V., Rubtsov, N.B., Baiborodin, S.I.,Kolosova, I.A., Shchelkunov, S.N., Drozdov, I.G., Riabchikova, E.I., 2009. Investi-gation of the impact of cowpox virus BTB/kelch gene deletion on some char-acteristics of infection in vitro. Vopr. Virusol. 54, 28e32.

Lee, Y.R., Yuan, W.C., Ho, H.C., Chen, C.H., Shih, H.M., Chen, R.H., 2010. The Cullin 3substrate adaptor KLHL20 mediates DAPK ubiquitination to control interferonresponses. EMBO J. 29, 1748e1761.

Li, Z., Li, F., Han, Y., Xu, L., Yang, F., 2015. VP24 is a chitin-binding protein involved inwhite spot syndrome virus infection. J. Virol. 90, 842e850.

Lin, F.Y., Gao, Y., Wang, H., Zhang, Q.X., Zeng, C.L., Liu, H.P., 2016. Identification of ananti-lipopolysacchride factor possessing both antiviral and antibacterial activityfrom the red claw crayfish Cherax quadricarinatus. Fish Shellfish Immunol. 57,213e221.

Liu, H.P., Chen, R.Y., Zhang, Q.X., Peng, H., Wang, K.J., 2011. Differential geneexpression profile from haematopoietic tissue stem cells of red claw crayfish,Cherax quadricarinatus, in response toWSSV infection. Dev. Comp. Immunol. 35,716e724.

Liu, L.K., Li, W.D., Gao, Y., Chen, R.Y., Xie, X.L., Hong, H., Wang, K.J., Liu, H.P., 2018.A laminin-receptor-like protein regulates white spot syndrome virus infectionby binding to the viral envelope protein VP28 in red claw crayfish Cheraxquadricarinatus. Dev. Comp. Immunol. 79, 186e194.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25,402e408.

Sasagawa, K., Matsudo, Y., Kang, M., Fujimura, L., Iitsuka, Y., Okada, S., Ochiai, T.,Tokuhisa, T., Hatano, M., 2002. Identification of Nd1, a novel murine kelchfamily protein, involved in stabilization of actin filaments. J. Biol. Chem. 277,44140e44146.

S€oderh€all, I., 2013. Recent advances in crayfish hematopoietic stem cell culture: a

model for studies of hemocyte differentiation and immunity. Cytotechnology65, 691e695.

S€oderh€all, I., Bangyeekhun, E., Mayo, S., S€oderh€all, K., 2003. Hemocyte productionand maturation in an invertebrate animal; proliferation and gene expression inhematopoietic stem cells of Pacifastacus leniusculus. Dev. Comp. Immunol. 27,661e672.

Soltysik-Espanola, M., Rogers, R.A., Jiang, S., Kim, T.A., Gaedigk, R., White, R.A.,Avraham, H., Avraham, S., 1999. Characterization of Mayven, a novel actin-binding protein predominantly expressed in brain. Mol. Biol. Cell 10,2361e2375.

Stead, M.A., Wright, S.C., 2014. Structures of heterodimeric POZ domains of Miz1/BCL6 and Miz1/NAC1. Acta Crystallogr. F 70, 1591e1596.

Stogios, P.J., Downs, G.S., Jauhal, J.J., Nandra, S.K., Prive, G.G., 2005. Sequence andstructural analysis of BTB domain proteins. Genome Biol. 6, R82.

Sundar Raj, N., Nathiga Nambi, K.S., Abdul Majeed, S., Taju, G., Vimal, S.,Farook, M.A., Sahul Hameed, A.S., 2012. High efficacy of white spot syndromevirus replication in tissues of freshwater rice-field crab, Paratelphusa hydrodo-mous (Herbst). J. Fish. Dis. 35, 917e925.

Tsai, P.L., Chiou, N.T., Kuss, S., Garcia-Sastre, A., Lynch, K.W., Fontoura, B.M., 2013.Cellular RNA binding proteins NS1-BP and hnRNP K regulate influenza A virusRNA splicing. PLoS Pathog. 9, e1003460.

Varkey, J.P., Muhlrad, P.J., Minniti, A.N., Do, B., Ward, S., 1995. The Caenorhabditiselegans spe-26 gene is necessary to form spermatids and encodes a proteinsimilar to the actin-associated proteins kelch and scruin. Gene Dev. 9,1074e1086.

Wang, H.C., Ko, T.P., Lee, Y.M., Leu, J.H., Ho, C.H., Huang, W.P., Lo, C.F., Wang, A.H.,2008. White spot syndrome virus protein ICP11: a histone-binding DNA mimicthat disrupts nucleosome assembly. Proc. Natl. Acad. Sci. U.S.A. 105,20758e20763.

Wilson, A.C., Freiman, R.N., Goto, H., Nishimoto, T., Herr, W., 1997. VP16 targets anamino-terminal domain of HCF involved in cell cycle progression. Mol. Cell Biol.17, 6139e6146.

Wolff, T., O'Neill, R.E., Palese, P., 1998. NS1-Binding protein (NS1-BP): a novel humanprotein that interacts with the influenza A virus nonstructural NS1 protein isrelocalized in the nuclei of infected cells. J. Virol. 72, 7170e7180.

Wu, J., Li, F., Huang, J., Xu, L., Yang, F., 2015. Crayfish hematopoietic tissue cells butnot hemocytes are permissive for white spot syndrome virus replication. FishShellfish Immunol. 43, 67e74.

Wu, W.L., Zong, R.R., Xu, J.Y., Zhang, X.B., 2008. Antiviral phagocytosis is regulatedby a novel Rab-dependent complex in shrimp Penaeus japonicus. J. ProteomeRes. 7, 424e431.

Xie, X., Li, H., Xu, L., Yang, F., 2005. A simple and efficient method for purification ofintact white spot syndrome virus (WSSV) viral particles. Virus Res. 108, 63e67.

Xie, X., Xu, L., Yang, F., 2006. Proteomic analysis of the major envelope and nucle-ocapsid proteins of white spot syndrome virus. J. Virol. 80, 10615e10623.

Xie, X., Yang, F., 2005. Interaction of white spot syndrome virus VP26 protein withactin. Virology 336, 93e99.

Xue, F., Cooley, L., 1993. Kelch encodes a component of intercellular bridges inDrosophila egg chambers. Cell 72, 681e693.

Yi, G., Wang, Z., Qi, Y., Yao, L., Qian, J., Hu, L., 2004. Vp28 of shrimp white spotsyndrome virus is involved in the attachment and penetration into shrimp cells.J. Biochem. Mol. Biol. 37, 726e734.

Zhou, Q., Xu, L., Li, H., Qi, Y.P., Yang, F., 2009. Four major envelope proteins of whitespot syndrome virus bind to form a complex. J. Virol. 83, 4709e4712.