Development of bat flight: Morphologic andmolecular evolution of bat wing digitsKaren E. Sears*, Richard R. Behringer†, John J. Rasweiler IV‡, and Lee A. Niswander*§

*Howard Hughes Medical Institute, Department of Pediatrics, Section of Developmental Biology, University of Colorado at Denver andHealth Sciences Center, 12800 East 19th Avenue, Aurora, CO 80045; †Department of Molecular Genetics, University of Texas M. D. AndersonCancer Center, 1515 Holcombe Boulevard, Houston, TX 77030; and ‡Department of Obstetrics and Gynecology, State University of New YorkDownstate Medical Center, Brooklyn, NY 11203

Edited by Cliff Tabin, Harvard Medical School, Boston, MA, and accepted by the Editorial Board March 14, 2006 (received for review November 8, 2005)

The earliest fossil bats resemble their modern counterparts inpossessing greatly elongated digits to support the wing mem-brane, which is an anatomical hallmark of powered flight. Toquantitatively confirm these similarities, we performed a morpho-metric analysis of wing bones from fossil and modern bats. Wefound that the lengths of the third, fourth, and fifth digits (theprimary supportive elements of the wing) have remained constantrelative to body size over the last 50 million years. This absence oftransitional forms in the fossil record led us to look elsewhere tounderstand bat wing evolution. Investigating embryonic develop-ment, we found that the digits in bats (Carollia perspicillata) areinitially similar in size to those of mice (Mus musculus) but that,subsequently, bat digits greatly lengthen. The developmentaltiming of the change in wing digit length points to a change inlongitudinal cartilage growth, a process that depends on therelative proliferation and differentiation of chondrocytes. Wefound that bat forelimb digits exhibit relatively high rates ofchondrocyte proliferation and differentiation. We show that bonemorphogenetic protein 2 (Bmp2) can stimulate cartilage prolifer-ation and differentiation and increase digit length in the batembryonic forelimb. Also, we show that Bmp2 expression and Bmpsignaling are increased in bat forelimb embryonic digits relative tomouse or bat hind limb digits. Together, our results suggest that anup-regulation of the Bmp pathway is one of the major factors in thedevelopmental elongation of bat forelimb digits, and it is poten-tially a key mechanism in their evolutionary elongation as well.

Chiroptera � Bmp � cartilage

As a consequence of their achievement of powered flight, bats(order Chiroptera) underwent one of the greatest adaptive

radiations in the history of mammalian evolution and nowconstitute one of every five mammalian species (1). A keyinnovation that enabled this extraordinary radiation is the batwing. The bat wing consists of a membrane of skin stretchedbetween dramatically elongated third, fourth, and fifth forelimbdigits. Because of their importance in wing support, understand-ing the mechanisms that are responsible for the elongation of batforelimb digits is key to understanding the evolutionary tempoand morphological transitions that underlie this major mamma-lian radiation.

Molecular phylogenetic evidence suggests that Chiroptera(consisting of both microbats and megabats) is a monophyleticclade that is nested within the Laurasiatheria, which is a groupthat comprises carnivorans, pangolins, ungulates, and ‘‘core’’insectivores (or, eulipotyphlans; e.g., shrews, hedgehogs, moles,and solenodons) (2–5). There is a general consensus that thecommon ancestor of bats was a small, quadrupedal mammal,with a limb morphology that was similar to that of mice (6, 7).The earliest known bats appear in the fossil record �50 millionyears ago, and they appear suddenly and already possessing theanatomical hallmarks of powered flight (including elongatedthird, fourth, and fifth forelimb digits) (6–8). Thus, it seems tobe likely that the earliest known fossil bats were already capableof powered flight (3–5). In the first component of this study, we

used morphometric analyses to quantitatively demonstrate thesimilarity of the wing supportive digits between the earliest fossiland modern bats.

Because of the similarity between the forelimb digits of theearliest preserved and modern bats, the fossil record currentlycan provide little evidence of the evolutionary transitions thatled to the elongation of bat forelimb digits and the associatedevolution of powered flight in mammals, although this situationmay change with the discovery of additional fossil material. Thefossil record, as well as molecular-clock studies (2, 9), suggestthat bats achieved powered flight in a few million years, whichis a relatively short span of geologic time. However, these datado not preclude the morphological prerequisites of poweredflight (e.g., elongated digits) having evolved by means of gradualprocesses.

Several studies (10, 11–15) have shown that major morpho-logical transitions can be accommodated by a few key develop-mental genetic changes. Here, we provide functional and mo-lecular comparisons of the development of the forelimb digits ofthe short-tailed fruit bat Carollia perspicillata with the digits ofthe bat hind limb and the digits of the forelimb of a moregeneralized quadruped, the mouse Mus musculus. Using thesedata, we identified uniquely derived developmental features ofbat wing digits. Doing so allows us to highlight a key develop-mental genetic change and suggest evolutionary mechanismsunderlying bat digit elongation.

Developmental elongation of the digits (and other long bones)is achieved by means of the relative rates of proliferation anddifferentiation of cartilage cells (chondrocytes) in the growthplate. Within the growth plate of developing digits, chondrocytesgo through the following series of maturation steps: resting (inthe Resting zone), proliferation (Proliferative zone), early dif-ferentiation (Prehypertrophic zone), and terminal differentia-tion (Hypertrophic zone) (16). Upon differentiation, chondro-cyte cell division ceases. Subsequently, the hypertrophicchondrocytes secrete extracellular matrix in which ossificationbegins. When the cartilage matrix ossifies, the hypertrophicchondrocytes undergo apoptosis. Several genes that have a rolein chondrocyte maturation have been identified (i.e., Ihh, Ffggenes, Bmp genes, and Pthrp, etc.). The bone morphogeneticprotein (Bmp) family of secreted growth factors is of particularinterest. Members of the Bmp family are involved in almost everyaspect of chondrogenesis, from chondrocyte commitment toterminal differentiation (17). In the mouse limb, Bmps are

Conflict of interest statement: No conflicts declared.

This paper was submitted directly (Track II) to the PNAS office. C.T. is a guest editor invitedby the Editorial Board.

Abbreviations: Bmp, bone morphogenetic protein; En, embryonic day n; PC, principalcomponent.

Data deposition: The sequences reported in this paper have been deposited in the GenBankdatabase (accession nos. DQ279782–DQ279785).

§To whom correspondence should be addressed. E-mail: lee.niswander@uchsc.edu.

© 2006 by The National Academy of Sciences of the USA

www.pnas.org�cgi�doi�10.1073�pnas.0509716103 PNAS � April 25, 2006 � vol. 103 � no. 17 � 6581–6586

EVO

LUTI

ON

Dow

nloa

ded

by g

uest

on

Aug

ust 2

4, 2

020

weakly expressed within the growth plate in proliferating(Bmp7), prehypertrophic (Bmp4), and hypertrophic (Bmp2)cells, and they are moderately expressed in the perichondrium (adense fibrous connective tissue) that surrounds the growth plate(Bmp2–Bmp5 and Bmp7) (18). Proliferation and maturation ofchondrocytes are the result of many complex interactions be-tween the perichondrium and the growth plate. Bmp from boththe perichondrium and the growth plate itself interacts withother factors within the growth plate and, thus, mediates chon-drocyte maturation (17). Intriguingly, it has been shown thatmouse and rat limbs that are cultured in the presence of Bmp2protein increase in overall length, whereas mouse and rat limbsthat are cultured in the presence of the Bmp antagonist Nogginresult in stunted digits (19, 20). Bmp2 protein affects thesechanges by stimulating proliferation and the transition to hyper-trophic differentiation and by inhibiting the most terminal stagesof hypertrophic differentiation (19).

To determine the developmental basis of bat digit elongation,we compared the embryonic development of the digits of the batforelimb and hind limb and mouse forelimb in terms of (i) theirgross and cellular morphology throughout development; (ii)their relative rates of chondrocyte proliferation and differenti-ation during digit elongation; (iii) the response of the limbs toculture in the presence of Bmp2 protein or a Bmp antagonist(Noggin); and (iv) the expression of many important develop-mental genes, including several members of the Bmp family. Ourresults demonstrate that bat digit length can be altered inresponse to changes in Bmp. Also, we show that, in the batforelimb, there is a dramatic change in the intensity of Bmp2expression and Bmp signaling relative to the bat hind limb andmouse forelimb. This species- and limb-specific change suggeststhat Bmp2 has a major role in the developmental elongation ofbat wing digits. By linking small changes in molecular patterningto dramatically different phenotypes, we provide a potentialexplanation for the evolution of the wings of bats, which is a keyinnovation in mammalian history.

ResultsForelimb Digits of Fossil and Modern Bats Are Highly Similar. First, wecompared the wing elements of the earliest known fossil (Fig. 1a)and modern bats (Fig. 1b) by using a morphometric analysis oflength and width data from the forelimb bones of several fossilbats and representative species from many modern bat families.Independent regressions of the lengths of the metacarpals andphalanges of the third, fourth, and fifth digits (the primarysupportive elements of the wing membrane) on a proxy for bodysize [principal component (PC)1] show that digits from extinctbats are not proportionally different from those of modern bats(Fig. 1c). As expected, PC1 was highly and evenly positivelycorrelated with many variables (data not shown), suggesting thatit is highly correlated with body size and, therefore, is anappropriate body-size proxy. These findings indicate that the batwing digit proportions have not changed substantially during thepast 50 million years of evolution.

Initial Digit Condensations Are Similar in Proportion in Embryonic Batsand Mice. To study when during ontogeny the changes in bat wingdigit elongation occur, we examined embryonic stages of devel-opment and compared the bat forelimb with both the bat hindlimb and mouse forelimb. Mice are thought to be similar inmorphology to the ancestor of bats, and much is known aboutmouse limb development (21). The early cartilage condensationsand segmentation (i.e., joint) patterns of the bat embryo (stage16; Fig. 2a), as revealed by Alcian blue staining, are relativelysimilar in size and position to those of a comparably aged mouseembryo [embryonic day (E)12.5 or Carnegie stage 16; Fig. 2b]until bat stage 20. Examination of skeletal preparations of batembryos from progressively later stages indicates that bat fore-

limb digits do not begin their rapid elongation relative to thoseof mouse until stage 20 (Fig. 2d).

Later-Stage Bat Wing Digits Have a Greatly Enlarged HypertrophicZone and Increased Proliferation Relative to Mice. To study thehistological changes that may underlie the elongation of the batwing digits, we examined the developing cartilage at the cellular

Fig. 1. The relative length of bat forelimb digits has not changed in 50million years. (a) Icaronycteris index (American Museum of Natural Historyspecimen no. 125000), which is a 50-million-year-old bat fossil. (b) Extant adultbat skeleton. The metacarpals (red arrows) of the first fossil bats are alreadyelongated and closely resemble modern bats. This observation is confirmed bymorphometric analysis of bat forelimb skeletal elements. (c) Results of regres-sion analysis of the log of fifth metacarpal length versus a proxy for body size(PC1). (c and d) Extinct bats are indicated by red crosses, and modern bats areindicated by blue circles. Modern and extinct bats fall along the same regres-sion line, indicating that their metacarpals are similar in relative length.

6582 � www.pnas.org�cgi�doi�10.1073�pnas.0509716103 Sears et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 2

4, 2

020

level. These analyses reveal that the major difference in themorphology of the bat growth plate is a great expansion of thehypertrophic zone of differentiated chondrocytes in the meta-carpals and phalanges of the third, fourth, and fifth digits,relative to mouse (Fig. 2c). In mice, the metacarpal hypertrophiczone comprises, at its maximum, �12% of the growth plate (Fig.2c). At stages 18 and 19, bat forelimb metacarpals have a similarpercentage of the growth plate occupied by the hypertrophiczone (Fig. 2 c and d). Strikingly, by stage 20, the relative size ofthe hypertrophic zones in the third, fourth, and fifth bat meta-carpals have increased to �30% of the bat growth plate (Fig. 2d).This abrupt increase in the extent of the bat hypertrophic zonecorresponds with the onset of exponential elongation in the batforelimb digits (Fig. 2d). In addition to increased chondrocytehypertrophy, bat forelimb digits also display increased rates ofproliferation within the growth plate at stage 20 relative to bathind limbs and mouse forelimbs of comparable stages, as re-vealed by phospho-histone H3 (Ser-10) Ab staining (Fig. 3 a–c).

Changing the Levels of BMP Can Alter Embryonic Bat Digit Length. Totest the ability of bat forelimb digits to respond to gain or loss ofBmp signaling, we cultured the bat embryonic handplate incontrol media or media supplemented with either Bmp2 orNoggin protein. Cultures containing Bmp2 caused a significantincrease in metacarpal length compared with the contralateralbat forelimb cultured in control media (average increase, 239�m; P � 0.003). Also, Bmp2 increased the relative proportion ofthe growth plate composed of the hypertrophic zone comparedwith controls (average increase, 16.9%; n � 10, P � 0.028). In

contrast, Noggin treatment resulted in significantly shortermetacarpals (average decrease, 183 �m; P � 0.015) and asignificantly smaller hypertrophic zone compared with controls(average decrease, 6.8%; n � 12, P � 0.046).

Bat Forelimb Digits Express Higher Levels of Bmp2 than the Digits ofEither Bat Hind Limbs or Mouse Forelimbs. To assess whether the batexhibits a different pattern of Bmp expression relative to mouse,we performed immunofluorescence and semiquantitative RT-PCR to assay Bmp protein localization and gene-expressionlevels, respectively. In mice, Bmp2, Bmp4, and a known down-stream component of Bmp signaling (phospho-Smad proteins1�5�8) are expressed at moderate levels in the perichondrium ofthe metacarpals and metatarsals with weaker levels within thehypertrophic zone (Bmp2) and immediately adjacent areas(Bmp4) (17–18) (Fig. 3 g and k). We detected no major differ-ences in the general protein localization of Bmp2�4 and phos-pho-Smad in the bat forelimb metacarpals (Fig. 3 d, e, and i) andbat hindlimb metatarsals (Fig. 3 f and j) at stages 18, 19, 20, 21,or 22 or mouse forelimb metacarpals (Fig. 3 g and k) at E13.5,E14, E14.5, E15, and E15.5. Strikingly however, both Bmp andphospho-Smad proteins are more intense and continuous in theperichondrium of stage-20 bat forelimb metacarpals (Fig. 3 d, e,and i) than they are in the homologous elements of the bat hindlimb (Fig. 3 f and j) or mouse forelimb (Fig. 3 g and k) ofcomparable stages. We confirmed this difference in expressionlevel by semiquantitative RT-PCR performed on stage-20 batand mouse metacarpals. By using 18S rRNA as a control, wefound that Bmp2 expression is significantly higher (�31%; P �

Fig. 2. Developmental elongation of bat digits occurs after the initial cartilage condensations are formed. (a and b) Cartilage revealed by Alcian blue stainingof stage-16 bat forelimb (a; courtesy of C. Cretekos, University of Texas M. D. Anderson Cancer Center) and E12.5 mouse forelimb (b; courtesy of M. Barna, FoxChase Cancer Center, Philadelphia). (c) Percentage of metacarpal composed of resting (white), proliferative (green), prehypertrophic (yellow), hypertrophic(blue), and ossification (red) zones in mice (Left) and bats (Right) at stages 18–24. The size of the hypertrophic zone is initially comparable in bat and mouse digits,and it then increases in relative size in the bat forelimb at stage 20. (d) Size of the bat hypertrophic zone (blue; measured as a percentage of the total lengthof the fifth metacarpal) and length of the bat fifth metacarpal (purple; measured in micrometers) against bat developmental stage. At stage 20, the hypertrophiczone greatly increases in size, along with the beginning of a phase of exponential lengthening of the bat digits.

Sears et al. PNAS � April 25, 2006 � vol. 103 � no. 17 � 6583

EVO

LUTI

ON

Dow

nloa

ded

by g

uest

on

Aug

ust 2

4, 2

020

0.04) in bat metacarpals relative to mice (Fig. 3h). This increasewas confirmed by using �-actin as an additional control (�35%increase in Bmp2 expression in bat metacarpals). To determinewhether this difference was specific to Bmp2, we also performedsemiquantitative RT-PCR for Bmp4 and Bmp7. Our results with18S rRNA and �-actin as controls indicate that Bmp4 and Bmp7expression levels are not significantly increased in bats relativeto mice (data not shown). Also, we examined the expressionpatterns of several genes that are known to be associated with thematuration of chondrocytes within the growth plate (i.e., Ihh,Pthrp, Fgfr1, Fgfr2, and ColX) by using RNA in situ hybridization,and we did not observe any notable differences between bat andmouse digits (data not shown). These data demonstrate asignificant and specific increase in Bmp2 expression as well asphosphorylation of Smad proteins, the Bmp signal transducers,which also serve as a read-out of active Bmp signaling, in the batforelimb digits.

DiscussionThe great evolutionary success of bats can be attributed in largepart to their achievement of powered flight. Bat powered flightis made possible by several key morphological innovations, oneof the most crucial being the elongation of the forelimb digits(specifically, digits three, four, and five) to support the wingmembrane. Our morphometric analyses indicate that the relativelengths of these bat digits have not significantly changed since thetime when bats were first fossilized �50 million years ago.Therefore, little knowledge regarding one of the key morpho-

logical transitions in mammalian evolutionary history, that of theelongation of bat forelimb digits to support the wing membrane,can currently be gleaned from the fossil record.

Here, we used morphological and molecular techniques touncover the developmental basis of the elongation of the digitsof the bat forelimb. We find that the early embryonic bat digits(immediately after the formation of joints) are similar in size tothose of mouse embryos of a comparable age. This findingsuggests that the major developmental changes resulting inelongated bat forelimb digits occur after the early condensationsand after segmentation relative to the ancestral, mouse-likepattern. This result therefore points to developmental changes inthe regulation of longitudinal growth and differentiation withinindividual cartilage elements. Within bat and mouse all of theelements of the forelimb (i.e., phalanges, radius, ulna, andhumerus) are similar in length at the time of segmentation. Thus,the similar length of the phalanges in bats and mice may be aresult of a developmental constraint on skeletal development. Inthis respect, it could be that the segmentation program is set upto create skeletal primordia of similar size, thus forcing adaptivechange in relative lengths to be controlled by subsequent post-segmental growth. Postsegmental longitudinal growth is con-trolled by the rates of chondrocyte proliferation and differenti-ation in the growth plate of the developing digits. We find thatthe region of the bat growth plate occupied by terminallydifferentiated chondrocytes, the hypertrophic zone, is greatlyexpanded in bats relative to mouse. Intriguingly, the increase inthe relative size of the bat hypertrophic zone corresponds to the

Fig. 3. Proliferation and Bmp levels are increased in bat forelimb digits relative to mouse forelimb and bat hind limb digits. (a–c) phospho-histone H3 (Ser-10)Ab staining of proliferating cells in a stage-20 bat metacarpal (a), stage-20 bat metatarsal (b), and E14.5 (stage 20) mouse metacarpal (c). Bat forelimb metacarpalsshow areas of increased proliferation in the growth plate (white arrows). (d–g) Bmp2�4 Ab staining (red; blue is hematoxylin counterstain) of an entire stage-20bat metacarpal (d) and high-magnification views of the bat metacarpal perichondrium (e), a stage-20 bat metatarsal perichondrium ( f) and an E14.5 mousemetacarpal perichondrium of a comparable region (g). (i–k) Phospho-Smad 1�5�8 Ab staining and a high-magnification view of a similar region of theperichondrium as shown in d–g of a stage-20 bat metacarpal (i), stage 20 bat metatarsal (j), and E14.5 mouse metacarpal (k). Bmp2�4 and phospho-Smad 1�5�8proteins are similarly localized in bat digits as they are in mice (18), but strikingly, these proteins are more intensely expressed in the perichondrium of batsmetacarpals than they are in either mouse metacarpals or bat metatarsals. (h) Semiquantitative RT-PCR of Bmp2 RNA from stage-20 bat and stage-20 mousemetacarpals by using 18S rRNA as a control. Bat Bmp2 RNA is expressed at �30% higher levels relative to mouse.

6584 � www.pnas.org�cgi�doi�10.1073�pnas.0509716103 Sears et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 2

4, 2

020

onset of the relative lengthening of the bat forelimb digits,suggesting a causative relationship between these two phenom-ena. In addition to the increase in size of the hypertrophic zone,the cartilage cells of bat forelimb digits also display higher ratesof proliferation relative to those of either bat hind limbs ormouse forelimbs. Together, these findings suggest that increasesin the extent of chondrocyte proliferation and differentiation areresponsible for the remarkable elongation of bat forelimb digitsduring their development.

To understand the underlying molecular mechanisms by whichproliferation and differentiation are affected in bat forelimbdigits, we took a clue from studies in mice and rats. In mice,numerous Bmps (2–5 and 7) are expressed within the growthplate and perichondrium of the developing digits (17, 18). Also,mouse and rat digits that are cultured in the presence of Bmp2protein grow longer than their controls, whereas digits that arecultured in the presence of Noggin (a known Bmp antagonist)are shorter (19, 20). Bmp2 protein affects these changes bystimulating both chondrocyte proliferation and initial hypertro-phic differentiation and inhibiting terminal hypertrophic differ-entiation (19), a pattern that is strikingly similar to the patternof cartilage differentiation observed in bat wing digits.

By using a similar limb-culture system, we demonstrate thatthe addition of Bmp2 protein can stimulate the further elonga-tion of bat forelimb digits and increase the hypertrophic zonewhereas the application of Noggin protein stunts their growthand decreases the hypertrophic zone. These results suggest thateither an increase in Bmp expression or a decrease in theexpression of Bmp antagonists such as Noggin could have driventhe developmental elongation of bat forelimb digits. Althoughthe spatial expression of Bmp2, Bmp4, and Bmp7 are similar inbats and mice, we found that there is a dramatic change in thelevel of Bmp2 expression in the bat forelimb digits. This resultwas confirmed by semiquantitative RT-PCR. Also, Bmp signal-ing is greatly increased in the bat forelimb digits relative to bathind limb or mouse, as assayed by the phosphorylation of theSmad proteins, the Bmp signal transducers.

Together, our results indicate the up-regulation of the Bmppathway as a major and fundamental (although not necessarilythe only) mechanism responsible for the developmental elon-gation of bat forelimb digits. Based on our results, we raise theintriguing possibility that a similar up-regulation of the Bmppathway had a role in the evolutionary elongation of bat forelimbdigits, which is an event that was critical to the achievement ofpowered flight in bats. Recent studies (22, 23) have suggestedthat modifications to the cis-regulatory elements of develop-mental genes have central roles in the evolutionary diversifica-tion of morphology. Our evidence that Bmp2, but not Bmp4 orBmp7, is differentially expressed in the bat wing digits is sug-gestive of a cis-regulatory change that affects the level, but notthe temporal or spatial regulation, of Bmp2 expression. Bylinking a simple change in a single developmental pathway todramatically different morphologies, we provide a potentialexplanation as to how bats were able to achieve powered flightsoon after they diverged from other mammals nearly 65 millionyears ago (2, 9).

Materials and MethodsAdult Skeletal Morphometrics. To evaluate the digit dimensionsfrom fossil and modern bats, we performed a morphometricanalysis. Measurement data of the lengths (distal to proximaland parallel to axis of the diaphysis) and widths (at the diaphysismidpoint) of all long bones of the forelimb and hindlimb (i.e.,humerus, radius, ulna, femur, tibia, fibula, metacarpals, meta-tarsals, and phalanges) were obtained from osteological speci-mens of adult bats housed primarily at the Field Museum ofNatural History (Chicago) (extant bats) and the AmericanMuseum of Natural History (AMNH; New York) (extinct bats),

as well as from published photographs (8). In total, 10 extant andfour extinct bat species were measured. The extant bats speciesspan a broad phylogenetic range and were as follows: Rousettusegyptiacus, Glossophaga soricina, Nycteris macrotis, Rhinopomahardwickei, Hipposideros commersoni, Pteronotus parnellii, Nata-lus stramineus, Balantiopteryx io, Eptesicus fuscus, and Tadaridabrasiliensis. The extinct bat species are were as follows: Icaro-nycteris index (AMNH specimen nos. 125000 and 39501), Hip-posideros sp. (AMNH specimen nos. 10019 and 10020), Archae-onycteris trigonodon [original Senckenburg Museum (Frankfurt)80�1379; ref. 8], Paleochiropteryx tupaidodon (cast AMNH spec-imen no. 107679, original Senckenburg Museum Messel FossilLocality 10; ref. 8). Measurements were taken three times andaveraged to minimize the effect of measurement error. Forextant bats, three specimens were measured and the resultsaveraged. Measurements of �150 mm were taken with Mitutoyoabsolute digimatic calipers, and measurements from 150 mm to30 cm were taken with Fowler vernier calipers. Linear measure-ments were log-transformed before analysis to standardize theirvariances.

Linear regression analyses, with the lengths of the third,fourth, and fifth metacarpal as the dependent variables and PC1(as a proxy for body size) as the independent variable, wereperformed to compare the relative lengths of the metacarpals ofextinct and extant bats. Only the data from extant bats were usedto generate regression lines. This approach allows for compar-ison of the observed digit lengths of extinct bats with theexpected digit lengths of modern bats of a comparable size. PC1was determined from a PC analysis (PCA) that was performedon the correlation matrix that was obtained by using the com-bined length and width data of all forelimb elements of thesegroups. PCA is a multivariate statistical technique that summa-rizes the variation that is present in a data set on a series oforthogonal axes, or PCs (24). PC1 summarizes most of thevariation in the data, and as a result, it is commonly highlycorrelated with body size. If so, PC1 can be used as an appro-priate proxy for regression analysis.

Embryos. C. perspicillata makes an excellent model taxon becauseof its great abundance in the wild (25), the existence of proce-dures for maintaining and breeding it in the laboratory (26), andits recent use in several developmental studies (27–29). C.perspicillata embryos were collected from wild-caught, pregnantfemales captured on Trinidad. Bat embryos were dissected,staged (30), and compared with WT C3H mouse embryos at asimilar stage in development (mice were staged according to theCarnegie staging system).

Limb Cultures. Bat metacarpals from embryos of various stages(19–22) were stripped of skin and muscle and cultured for 4 daysin BGJb medium (GIBCO�BRL), antibiotic�antimycotic (LifeTechnologies, Grand Island, NY), and 0.1% BSA at 37°C with5% CO2 (19, 31). Cultures were supplemented with 500 ng�mlrecombinant human Bmp2 (R & D Systems) or 500 ng�mlrecombinant mouse Noggin protein (R & D Systems). The rightlimb from a given embryo was compared with the left limb fromthe same embryo that was cultured in unsupplemented media.

Tissue Processing. For skeletal analysis, embryos at stages �20were fixed overnight in Bouin’s solution and stained for acidicglycosaminoglycans (cartilage) with Alcian blue; older embryoswere fixed overnight in 4% paraformaldehyde and stained forcartilage and calcium (bone) with Alcian blue and Alizarin red,respectively. At least two bat and five mouse embryos from allstages 16–24 were examined. For histology, at least three bat andthree mouse embryos from stages 18–22 were fixed overnight in4% paraformaldehyde, and the limbs were embedded in paraf-

Sears et al. PNAS � April 25, 2006 � vol. 103 � no. 17 � 6585

EVO

LUTI

ON

Dow

nloa

ded

by g

uest

on

Aug

ust 2

4, 2

020

fin, sectioned at 10 �m, stained in hematoxylin�eosin, andanalyzed.

In situ hybridization was performed on embryos that werefixed overnight in 4% paraformaldehyde, embedded in paraffin,sectioned at 10 �m, and processed by using digoxigenin-labeledRNA probes. In all cases, mouse riboprobes with known func-tions in the mammalian growth plate (i.e., Ihh, Pthrp, and Bmp2,etc.) also recognized bat transcripts as shown by comparison ofexpression in various embryonic tissues. Immunohistochemistryand immunofluorescence were performed on frozen 10-�msections with Abs against Bmp2�4 (Santa Cruz Biotechnology),phosphorylated Smad 1�5�8 (Cell Signaling Technology, Bev-erly, MA), and phosphorylated histone H3 (Ser-10) (Cell Sig-naling Technology). In the immunohistochemical experiments,hematoxylin was used as a counterstain. At least two bat and twomouse embryos from stages 18–22 were analyzed by immuno-fluorescence and in situ hybridization.

Semiquantitative RT-PCR. To quantify Bmp2, Bmp4, and Bmp7transcripts in bat and mouse, we performed two separatesemiquantitative RT-PCR analyses, one analysis using 18SrRNA and the other analysis using �-actin RNA as a control.Metacarpals were dissected from comparably aged bat (stage 20)and mouse (E14.5, equivalent to Carnegie stage 20) embryos;samples from three bats and three mice were used. RNA wasextracted (RNeasy kit; Qiagen, Valencia, CA), and cDNA wasgenerated for each sample with the SuperScript III First-StrandSynthesis system for RT-PCR (Invitrogen).

To generate conserved primers for Bmp2, we first performedRT-PCR to amplify fragments of bat Bmp2 by using E90 battestes mRNA (GenBank accession no. DQ279784). Degenera-tive primer sequences were obtained by aligning Bmp2 sequencesfrom human (Homo), mouse (Mus), chick (Gallus), frog (Xeno-pus), and fish (Danio). The bat fragments were sequenced andaligned with mouse sequences to find conserved regions togenerate the following primers (which span a 407-bp region) thatare homologous to both bat and mouse: GCCTGCAGCAGC-CAACTTG (sense) and CAGTCATTCCACCCCACATC (an-tisense). We followed the same procedure to generate conservedprimers for Bmp4 (GenBank accession no. DQ279782) and

Bmp7 (GenBank accession no. DQ279783). The conservedBmp4 primers (which span a 429-bp region) are as follows:CTCATCACACGACTACTGGAC (sense) and GCAGTA-GAAGGCCTGGTAGC (antisense). The conserved Bmp7primers (which span a 410-bp region) are as follows:CAGGGCTTCTCCTACCCCTAC (sense) and TGACCAC-CCAGTGGTTGCTGG (antisense).

Semiquantitative RT-PCR using 18S rRNA as a control wasperformed with a QuantumRNA Universal 18S Internal Stan-dard kit (the primers of which isolate a 315-bp fragment)according to the manufacturer’s protocol (Ambion, Austin, TX)and a primer�competimer ratio of 2:8 and 42 PCR cycles.

To perform semiquantitative RT-PCR using �-actin RNA asa control, we generated conserved primers for �-actin (GenBankaccession no. DQ279785) as described for Bmp2. The conservedprimers homologous to both bat and mouse �-actin (spanning a569-bp region) are as follows: CCATCCTGCGTCTGGACCTG(sense) and ACGATGGAGGGGCCGGACTC (antisense). Be-cause �-actin is expressed at a much higher level than Bmp2within metacarpal tissues, we used differing cycles (20 for �-actinand 55 for Bmp2) to be within the linear range. We used thefollowing PCR conditions: 94°C for 20 sec, 55°C for 30 sec, and72°C for 45 sec. PCR products were run on 1.5% agarose gels,and the resulting bands were quantified by using QUANTITY ONE1D analysis software (Bio-Rad). Significance of differencesbetween bat and mouse levels were evaluated by using Mann–Whitney U tests (32).

We thank Chris Cretekos and Scott Weatherbee for field support andstimulating discussions; Jonathan Marcot and three anonymous review-ers for critical manuscript review; the collections staff of the FieldMuseum of Natural History and American Museum of Natural History;Simeon Williams, Dr. Indira Omah-Maharaj, and the Department of LifeSciences at the University of the West Indies (St. Augustine, Trinidad)for help with fieldwork in Trinidad; and the Wildlife Section, ForestryDivision, Ministry of Agriculture, Land, and Marine Resources (cur-rently in the Ministry of Public Utilities and the Environment) of theRepublic of Trinidad and Tobago for the issuance of required collectingand export permits. This work was supported by National ResearchService Award F32 HD050042-01 (to K.E.S.), National Science Foun-dation Grant IBN 0220458 (to R.R.B.), and National Institutes of HealthGrant HD32427 (to L.A.N.). L.A.N. is an Investigator of the HowardHughes Medical Institute.

1. Nowak, R. M. (1994) Walker’s Bats of the World (Johns Hopkins Univ. Press,Baltimore).

2. Teeling, E. C., Springer, M. S., Madsen, O., Bates, P., O’Brien, S. J. & Murphy,W. J. (2005) Science 307, 580–584.

3. Teeling, E. C., Scally, M., Kao, D. J., Romagnoli, M. L., Springer, M. S. &Stanhope, M. J. (2000) Nature 403, 188–192.

4. Stanhope, M. J., Czelusniak, J., Si, J. S., Nickerson, J. & Goodman, M. (1992)Mol. Phylogenet. Evol. 1, 148–160.

5. Springer, M. S., Stanhope, M. J., Madsen, O. & de Jong, W. W. (2004) TrendsEcol. Evol. 19, 430–438.

6. Thewissen, J. G. M. & Babcock, S. K. (1992) Bioscience 42, 340–345.7. Speakman, J. R. (2001) Mamm. Rev. 31, 111–130.8. Simmons, N. B. & Geisler, J. H. (1998) Bull. Am. Mus. Nat. Hist. 235,

4–182.9. Cao, Y., Fujiwara, M., Nikaido, M., Okada, N. & Hasegawa, M. (2000) Gene

259, 149–158.10. Valentine, J. W., Jablonski, D. & Erwin, D. H. (1999) Development (Cambridge,

U.K.) 126, 851–859.11. Rutherford, S. L. & Lindquist, S. (1998) Nature 396, 336–342.12. Jernvall, J. (2000) Proc. Natl. Acad. Sci. USA 97, 2641–2645.13. Cohn, M. J. & Tickle, C. (1999) Nature 399, 474–479.14. Fondon, J. W. & Garner, H. R. (2004) Proc. Natl. Acad. Sci. USA 101,

18058–18063.15. Abzhanov, A., Protas, M., Grant, B. R., Grant, P. R. & Tabin, C. J. (2004)

Science 305, 1462–1465.16. Ballock, R. T. & O’Keefe, R. J. (2003) J. Bone Joint Surg. 85A, 715–726.17. Yoon, B. S. & Lyons, K. M. (2004) J. Cell. Biochem. 93, 93–103.

18. Solloway, M. J., Dudley, A. T., Bikoff, E. K., Lyons, K. M., Hogan, B. L. M.& Robertson, E. J. (1998) Dev. Genet. 22, 321–339.

19. Minina, E., Wenzel, H., Kreschel, C., Karp, S., Gaffield, W., McMahon, A. &Vortkamp, A. (2001) Development (Cambridge, U.K.) 128, 4523–4534.

20. De Luca, F., Barnes, K. M., Uyeda, J. A., De-Levi, S., Abad, V., Palese, T.,Mericq, V. & Baron, J. (2001) Endocrinology 142, 430–436.

21. Niswander, L. (2003) Nat. Rev. Genet. 4, 133–143.22. Gompel, N., Prud’homme, B., Wittkopp, P. J., Kassner, V. A. & Carroll, S. B.

(2005) Nature 433, 481–487.23. Shapiro, M. D., Marks, M. E., Peichel, C. L., Blackman, B. K., Nereng, K. S.,

Jonsson, B., Schluter, D. & Kingsley, D. M. (2004) Nature 428, 717–723.24. Reyment, R. & Joreskog, K. G. (1993) Applied Factor Analysis in the Natural

Sciences (Cambridge Univ. Press, Cambridge, U.K.).25. Fleming, T. H. (1988) The Short-Tailed Fruit Bat (Univ. of Chicago Press,

Chicago).26. Rasweiler, J. J., IV, & Badwaik, N. K. (1996) Lab. Anim. Sci. 2, 171–181.27. Evarts, J. L., Rasweiler, J. J., IV, Behringer, R. R., Hennighausen, L. &

Robinson, G. W. (2004) Biol. Reprod. 70, 1573–1579.28. Cretekos, C. J., Rasweiler, J. J., IV, & Behringer, R. R. (2001) Reprod. Fertil.

Dev. 13, 691–695.29. Chen, C. H., Cretekos, C. J., Rasweiler, J. J., IV, & Behringer, R. R. (2005)

Evol. Dev. 7, 130–141.30. Cretekos, C. J., Weatherbee, S. D., Chen, C. H., Badwaik, N. K., Niswander,

L., Behringer, R. R. & Rasweiler, J. J., IV (2005) Dev. Dyn. 233, 721–728.31. Vortkamp, A., Lee, K., Lanske, B., Segre, G. V., Kronenberg, H. M. & Tabin,

C. J. (1996) Science 273, 613–622.32. Sokal, R. R. & Rohlf, F. J. (1995) Biometry (Freeman, New York).

6586 � www.pnas.org�cgi�doi�10.1073�pnas.0509716103 Sears et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 2

4, 2

020