Analytical Biochemistry 403 (2010) 13–19

Contents lists available at ScienceDirect

Analytical Biochemistry

journal homepage: www.elsevier .com/locate /yabio

Development of a high-throughput fluorescence polarization assayfor the discovery of phosphopantetheinyl transferase inhibitors

Benjamin P. Duckworth, Courtney C. Aldrich *

Center for Drug Design, University of Minnesota, Minneapolis, MN 55455, USA

a r t i c l e i n f o a b s t r a c t

Article history:Received 8 December 2009Received in revised form 5 March 2010Accepted 3 April 2010Available online 9 April 2010

Keywords:SfpPhosphopantetheinyl transferaseFluorescence polarizationHigh-throughput screeningEnzyme assay

0003-2697/$ - see front matter � 2010 Elsevier Inc. Adoi:10.1016/j.ab.2010.04.009

* Corresponding author. Fax: +1 612 626 5173.E-mail address: aldri015@umn.edu (C.C. Aldrich).

1 Abbreviations used: NRPS, nonribosomal peptidesynthase; PPTase, phosphopantetheinyl transferase; Cosynthase; AcpS, acyl carrier protein synthase; PCP, peptcarrier protein; ACP, acyl carrier protein; FRET, flutransfer; FP, fluorescence polarization; HTS, high-throumal titration calorimetry; PAP, 30 ,50-diphosphate adenreaction; LB, Luria–Bertani; IPTG, isopropyl-b-D-thinickel–nitrilotriacetic acid; HPLC, high-performance ltris-(2-carboxyethyl)phosphine hydrochloride; DMSO,MS, liquid chromatography–tandem mass spectrometr

An alarming number of clinically relevant bacterial pathogens are becoming resistant to many antibiotics,thereby fueling intense research into the discovery of novel therapeutic targets. Phosphopantetheinyltransferases (PPTases) represent a promising target for antibacterial development because these enzymesare crucial for the biosynthesis of a multitude of a pathogen’s collection of essential metabolites and vir-ulence factors biosynthesized via polyketide synthase (PKS) and nonribosomal peptide synthetase (NRPS)pathways. Here we describe the development of a fluorescence polarization (FP) assay that is amenablefor high-throughput screening to identify PPTase inhibitors. The FP assay was validated against a panel ofcompetitive ligands and displayed an excellent Z0 score.

� 2010 Elsevier Inc. All rights reserved.

Microorganisms produce a diverse array of virulence factors andtoxins that are directly implicated in pathogenesis. Examples ofsuch effectors of virulence include the siderophores produced bymost microorganisms under iron-limiting conditions as well asan array of structurally diverse lipids produced by Mycobacteriumtuberculosis, including mycolic acids and phenolic glycolipids [1–4]. In addition, the mycolactones produced by Mycobacterium ulc-erans are polyketide toxins that are the causative agent of theBuruli ulcer [5]. These small molecules are examples of secondarymetabolites produced via modular and multifunctional nonriboso-mal peptide synthetase (NRPS)1 and polyketide synthase (PKS) en-zymes. Construction of these complex metabolites is achieved bythe elaboration of a starting monomer unit along an NRPS or PKSprotein assembly line. At each chemical transformation throughoutthe assembly, the elongating biosynthetic intermediate is covalentlytethered to a carrier protein domain within the polypeptide [6].

ll rights reserved.

synthetase; PKS, polyketideA, coenzyme A; FAS, fatty acididyl carrier protein; ArCP, arylorescence resonance energyghput screening; ITC, isother-osine; PCR, polymerase chainogalactopyranoside; Ni–NTA,iquid chromatography; TCEP,

dimethyl sulfoxide; LC–MS/y.

However, before the NRPS- or PKS-catalyzed biosynthesis of any sec-ondary metabolite may begin, the carrier protein must first be post-translationally converted into its active holo form by a Mg2+-dependent phosphopantetheinyl transferase (PPTase) [7,8]. PPTasestransfer the 4-phosphopantetheinyl portion of coenzyme A (CoA,2) (Fig. 1) onto a conserved serine residue within the carrier protein(1) to yield a thiolated carrier protein (3). It is this thiol that serves asthe key anchor point for tethering activated thioesters during chainelongation of essential primary and secondary metabolites catalyzedby the fatty acid synthase (FAS), NRPS, and PKS machinery. There-fore, PPTases represent potential antimicrobial drug targets becauseinhibition of these enzymes would disrupt the production of a mul-titude of metabolites and virulence factors essential to manypathogens.

A majority of bacteria contain two types of PPTases [7]. Group IPPTases, represented by AcpS (acyl carrier protein synthase) fromEscherichia coli, are responsible for modifying the carrier proteinsof FAS involved in primary metabolism [9–12]. Group II PPTases,represented by Sfp from Bacillus subtilis, are more promiscuous intheir substrate specificity [7,9,13] and are dedicated to primingcarrier proteins involved in secondary metabolism, including thepeptidyl carrier proteins (PCPs) and aryl carrier proteins (ArCPs)of NRPS pathways as well as the acyl carrier proteins (ACPs) fromFAS and PKS systems [6,14]. In organisms lacking a group I enzyme,a group II PPTase will be the sole enzyme responsible for the acti-vation of FAS, NRPS, and PKS carrier proteins [15,16]. Furthermore,genetic inactivation of group I PPTases is not always lethal due torescue by group II PPTases [10].

Fig. 1. Enzymatic phosphopantetheinylation reaction catalyzed by PPTases. PPTa-ses transfer the phosphopantetheine moiety of CoA (2) onto an invariant serineresidue within apo carrier proteins (1) to yield the active holo form (3). CP, carrierprotein.

14 Assay for discovery of PPTase inhibitors / B.P. Duckworth, C.C. Aldrich / Anal. Biochem. 403 (2010) 13–19

Sfp from B. subtilis is the prototypical enzyme of the group IIPPTases and is responsible for phosphopantetheinylation of thePCP domains of the surfactin NRPS proteins [7,17]. Sfp catalysisemploys a Bi–Bi kinetic mechanism. Following binding of bothCoA-SH and PCP substrates, Sfp catalyzes nucleophilic attack ofthe PCP’s hydroxyl group (from a conserved serine) to the b-phos-phate of CoA, thereby linking the phosphopantetheinyl arm to thePCP and releasing 30,50-adenosine diphosphate [18]. Sfp is uniquein its promiscuity to accept modified CoA analogues as well as avariety of carrier proteins [10,19,20]. Furthermore, the X-raycocrystal structure of Sfp and CoA is reported and reveals a pseudotwofold symmetry, and CoA binds to Sfp at the domain interface[11]. Additional mutational analysis and sequence comparison pro-vided evidence that the PCP substrate binds to a flexible loop (res-idues T111–S124) within Sfp [18]. Mofid and coworkers suggestedthat this loop’s flexibility is responsible for Sfp’s remarkable sub-strate tolerance [18].

A high-throughput steady-state kinetic assay of Sfp, in whichSfp labels a fluorescent peptide with a fluorescent CoA derivative,has been described recently [21,22]; enzyme activity is subse-quently monitored using fluorescence resonance energy transfer(FRET). This innovative assay was miniaturized to a 1536-well for-mat and screened against a library of pharmacologically activecompounds [22]. We developed a complementary thermody-namic-based fluorescence polarization (FP) equilibrium assay toscreen for Sfp inhibition. FP is a robust detection method thathas been successfully implemented in several high-throughputscreening (HTS) campaigns [23–25]. In FP experiments, a fluores-cent molecule is excited with polarized light. If the fluorescentprobe is not bound, it will tumble rapidly in solution, resulting inemission of light with low polarization. However, if the fluorescentprobe is bound to a large biomolecule such as a protein, this highermolecular weight species will tumble much more slowly than thefree fluorophore and will emit a higher percentage of polarizedlight. Displacement of the fluorescent ligand from the enzyme’s ac-tive site by a competitive inhibitor is readily observed by a de-crease in polarization.

Here we report the development of a high-throughput FP assayto discover small molecule inhibitors of Sfp. This homogeneous as-say exploits the relaxed substrate specificity of Sfp to accept a fluo-rescent CoA derivative. The KD value of the fluorescent CoA ligandwas determined by measuring the anisotropy during titration withSfp and was in good agreement with the KD determined by isother-

mal titration calorimetry (ITC). Next, we demonstrate that the FPprobe could be displaced by both the native substrate, CoA, andthe Sfp-catalyzed reaction product, 30,50-diphosphate adenosine(PAP). Furthermore, the assay was remarkably robust, possessinga Z0 score of P0.65 in a 384-well format. This inexpensive, sin-gle-step addition assay is well-suited to HTS for identifying inhib-itors of group II PPTases.

Materials and methods

Protein expression and purification

Sfp was subcloned to express the protein with the same aminoacid sequence as that described previously by Mofid and coworkers[26]. Sfp was polymerase chain reaction (PCR) amplified frompDHS4032, a vector for in vivo coexpression of Sfp kindly providedby David Sherman (University of Michigan), using the primersCACCCATATGAAGATTTACGGAATTTA and CCTCGAGTCAGTGGTGGTGGTGGTGGTGAGATCTTAAAAGCTCTTCGTACGAGAC. The C-termi-nal 6� His tag was incorporated into the reverse primer, and theresulting PCR product was captured in pENTR/SD/D-TOPO (Invitro-gen, Carlsbad, CA, USA). The gene was subsequently digested withNdeI and XhoI and was cloned into pET24b, creating pCDD118. Theplasmid was transformed into BL21 STAR(DE3) (Invitrogen) foroverexpression. E. coli cultures were grown in 100 ml of Luria–Ber-tani (LB) broth containing kanamycin (50 lg/ml) at 37 �C over-night. An overnight culture (15 ml) was added to 1.0 L of LBbroth containing kanamycin (50 lg/ml). This culture was shakenat 37 �C until the OD600 reached 0.7, at which point Sfp expressionwas induced with 1.0 mM isopropyl-b-D-thiogalactopyranoside(IPTG). This suspension was then shaken for an additional 5.5 hat 25 �C. Cells were pelleted and resuspended in 30 ml of lysis buf-fer (50 mM Hepes [pH 8.0], 300 mM NaCl, and 10 mM imidazole).This suspension was sonicated at 0 �C with three bursts(10 W � 1 min) with a 1-min break between each burst. The lysatewas centrifuged at 45,000g for 10 min, 2.0 ml of a nickel–nitrilotri-acetic acid (Ni–NTA) slurry was added to the cleared lysate, and thesuspension was incubated at 4 �C for 1 h. The lysate was loadedonto a column, and the flow-through was collected. The columnwas washed with 15 ml of wash buffer (50 mM Hepes [pH 8.0],300 mM NaCl, and 20 mM imidazole) and eluted with 3.0 ml ofelution buffer (50 mM Hepes [pH 8.0], 300 mM NaCl, and250 mM imidazole). The first 0.5 ml of this elution was discarded,and the remaining volume was desalted on a PD-10 column intostorage buffer (50 mM Hepes [pH 8.0], 200 mM NaCl, and 20% glyc-erol) to yield 28 mg/L pure protein (determined using an e280 of27,200 mol�1 cm�1). Sfp was stored at �80 �C.

Synthesis of BODIPY–TMR–CoA (4)

Synthesis of 4 was accomplished by reaction of 1.4 mg(1.78 lmol) of CoA disodium salt (Sigma, St. Louis, MO, USA) with1.0 mg (1.78 lmol) of BODIPY–TMR maleimide (Invitrogen) in100 ll of 9:1 DMF/50 mM Tris (pH 7.5). The reaction was stirredat room temperature for 3 h, after which 20 ml of water was added.The diluted reaction was then washed with ethyl acetate(2 � 20 ml) to remove unreacted fluorescent dye. Purification of 4was achieved using a semipreparative reversed-phase high-perfor-mance liquid chromatography (HPLC) Varian Microsorb 100-5 C18column (250 � 10.0 mm) at a flow rate of 3.0 ml/min and detectionat 543 nm, with a linear gradient of buffer A (25 mM ammoniumacetate, pH 6.5) to 80% CH3CN in buffer A over 40 min. Compound4 eluted at 28 min. Fractions containing 4 were pooled and lyoph-ilized. The identity of 4 was confirmed by electrospray ionization(ESI) mass spectrometry, which showed an [M�2H]2� mass of663.67 (calculated 663.68).

Assay for discovery of PPTase inhibitors / B.P. Duckworth, C.C. Aldrich / Anal. Biochem. 403 (2010) 13–19 15

Determination of probe KD

To determine the KD of probe 4 with Sfp, 10 ll of a 3� stocksolution of Sfp diluted in FP buffer (50 mM Mes [pH 6.0], 10 mMMgCl2, 1.0 mM tris-(2-carboxyethyl)phosphine hydrochloride[TCEP], 0.0025% Igepal CA-360, and 1.0% dimethyl sulfoxide[DMSO]) was added to 20 ll of master mix (45 nM [1.5 � final con-centration] 4 in FP buffer) in a 384-well black plate (Corning, prod-uct no. 3575). The plate was then centrifuged at 800g for 1 min.After 20 min at room temperature, the fluorescence anisotropywas read using a SpectraMax M5e plate reader with the followingsettings: kex = 535 nm, kem = 580, emission cutoff = 570 nm, and Gfactor = 1.057. The KD value was determined by fitting the experi-mentally observed anisotropies to Eqs. (1) and (2) below by nonlin-ear regression analysis using a Q value of 1.0 and an AF value of0.08.

ITC

ITC experiments were performed using a Microcal VP-ITCmicrocalorimeter (Northampton, MA, USA). All measurementswere carried out at 20 �C in 50 mM Mes (pH 6.0) with 10 mMMgCl2. Sfp was exchanged into the above buffer using an AmiconUltra concentrator (Millipore, Billerica, MA, USA), and all ligandsolutions were prepared from the final eluent. The following finalconcentrations of Sfp and ligands were used for ITC experiments:43.2 lM Sfp titrated with 320 lM 4, 28.6 lM Sfp titrated with320 lM CoA, and 122 lM Sfp titrated with 300 lM PAP. All titra-tions were performed in duplicate with a stirring speed of307 rpm and a 300-s interval between 10-ll injections. The initialinjection was omitted from data fitting. Titrations were run pastthe point of enzyme saturation to determine and correct for heatsof dilution. The KA (association constant in M�1) and n (number ofbinding sites per monomer) values were obtained by nonlinearleast squares fitting to experimental data using the Origin softwarepackage (version 7.0) provided with the instrument.

Equilibrium dissociation constant analysis

Displacement experiments with compounds employed three-fold serial dilutions of ligands in Table 1 that were individuallyadded to 4 (final concentration of 30 nM) and Sfp (final concentra-tion of 370 nM) in FP buffer. After 20 min at room temperature, thefluorescence anisotropy was measured. The KD value of each com-pound was determined by fitting the observed anisotropies to Eqs.(1) and (3) below.

Z0 determination

Master mix (28 ll) containing FP buffer, Sfp, and 4 was added to16 wells containing 2.0 ll of a 3.0-mM CoA solution in water to

Table 1Equilibrium dissociation constants of Sfp ligands.

Ligand FP KD (lM) ITC KD (lM)

4 0.180 ± 0.018 0.609 ± 0.088CoA (2) 1.11 ± 0.15 0.562 ± 0.2295 1.67 ± 0.21 3.5 ± 0.36 >500 nd7 26.3 ± 3.1 nd8 >500 nd9 >500 nd10 457 ± 96 nd11 nd nd

Note. nd, not determined.

serve as the positive controls or to 16 wells containing 2.0 ll ofwater to serve as the negative controls so that final concentrationswere as follows: 370 nM Sfp, 30 nM 4, and 200 lM CoA (positivecontrols) or 0 lM CoA (negative controls). For incubation timestudies, the plate was read (as described above) after 5, 30, 65,120, 190, and 1080 min at ambient temperature. For incubationtemperature studies, the plate was preincubated at the desiredtemperature prior to CoA and master mix addition. After assaycomponent addition, the plate was incubated at that temperaturefor 1 h prior to anisotropy measurement.

Results and discussion

Assay design and rationale

In this study, we report the development of a high-throughputassay to identify small molecule inhibitors of Sfp, the prototypicalgroup II PPTase from B. subtilis. Further motivation for selecting Sfpwas the ability to produce large amounts of protein through over-expression in E. coli. Among the many diverse choices of assay plat-forms, we chose to develop an FP assay that capitalizes on theability of Sfp to bind thioester derivatives of CoA. The overall de-sign of the Sfp FP assay is shown in Fig. 2. When a fluorescently la-beled CoA derivative (4) binds to Sfp and is excited with plane-polarized light (Fig. 2A), the resulting large protein–probe complexdoes not significantly tumble in solution before reemitting a pho-ton and remains polarized. As shown in Fig. 2B, binding of a smallmolecule inhibitor to Sfp displaces the fluorescent substrate fromthe active site and into solution. After excitation of the fluorophore,the small-molecular-weight species tumbles rapidly before reemit-ting a photon. Due to this tumbling, the emitted light is largelydepolarized [27].

Because Sfp is quite promiscuous in its acceptance of fluores-cent CoA derivatives, we had a wide variety of fluorescent probesto choose from for the design of an FP assay. Although fluoresceinhas been widely used in many screens, a significant percentage oflibrary compounds autofluoresce in the spectral region of fluores-cein, and this can give rise to assay interference and false positives[24,27–29]. Therefore, we selected the red-shifted fluorophore,BODIPY–TMR, which has been successfully used in HTS [30,31].The synthesis of BODIPY-labeled CoA (4) (Fig. 2C) was accom-plished by reacting BODIPY–TMR maleimide with CoA for 3 h atroom temperature, after which the unreacted dye was removedby extraction with ethyl acetate. The remaining aqueous crudemixture was purified by reversed-phase HPLC to provide BODI-PY–TMR-labeled CoA (4).

Determination of KD for FP probe (4)

To confirm that 4 binds to Sfp and produces a measurable in-crease in anisotropy when compared with free fluorescent CoA,30 nM 4 was incubated with saturating concentrations of Sfp(50 lM) in FP buffer (50 mM Mes [pH 6.0], 10 mM Mg2Cl2,1.0 mM TCEP, 0.0025% Igepal CA-630, and 1.0% DMSO). Shoichetand coworkers showed that a small amount of nonionic detergentis sufficient to prevent the formation of aggregates caused by cer-tain library compounds and, thus, to avoid detection of these falsepositive hits [32]. Free 4 produced an average anisotropy value of0.08, whereas 4 incubated with 50 lM Sfp gave an anisotropy va-lue of 0.26. These results indicate that 4 does bind Sfp and pro-duces a robust signal-to-noise (S/N) ratio. We next determinedthe equilibrium dissociation constant, KD, of FP probe 4 with Sfpby titration of 30 nM probe 4 with Sfp (Fig. 3). Experimentally ob-served anisotropies (AOBS) were fit to Eqs. (1) and (2) by nonlinearregression analysis to provide a KD of 180 nM (Table 1). In Eqs. (1)

Fig. 2. Overview of the FP assay. (A) Direct binding of fluorescent CoA FP probe to Sfp results in a large polarization. (B) Displacement of FP probe 4 from Sfp by ligand (I).Excitation with polarized light results in decreased polarization when compared with Sfp-bound probe. (C) Structure of FP ligand 4.

Fig. 3. Direct binding of 30 nM BODIPY–TMR–CoA 4 to Sfp as measured by FP.Experimental points are shown with error bars, and the line is the result of fittingdata to Eqs. (1) and (2).

Fig. 4. Upper panel: ITC analysis at 20 �C of 43 lM Sfp titrated with 320 lMBODIPY–TMR–CoA 4. Lower panel: Integration of the data, corrected for the heat ofdilution. The line represents the least squares fit to the single-site binding model bythe Origin program.

16 Assay for discovery of PPTase inhibitors / B.P. Duckworth, C.C. Aldrich / Anal. Biochem. 403 (2010) 13–19

and (2), FSB is the fraction of bound labeled probe 4, AF and AB arethe anisotropies of the free and bound probe, respectively, Q is theratio of the fluorescence intensities of the bound and free probe(1.0 in the case of 4 and Sfp), LST is the total probe concentration,and RT is the concentration of Sfp [33]. In FP assays, the concentra-tion of the fluorescent FP ligand should not be greater than 2 � KD,so that stoichiometric titration of the ligand is avoided [34]; this isnot an issue in this assay because the probe concentration is heldat a much lower concentration (30 nM) than its KD (180 nM):

AOBS ¼QFSBAB þ 1� FSBð ÞAF

1� ð1� QÞFSBð1Þ

FSB ¼KD1 þ LST þ RT �

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiKD1 þ LST þ RTð Þ2 � 4LSTRT

q

2LST: ð2Þ

Measurements of dissociation constants of competitive ligandsby FP require an accurate KD value of the fluorescent probe. There-fore, the KD of probe 4 with Sfp was confirmed using ITC. ITC exper-iments were performed by titration of Sfp with 4 at 20 �C. It isimportant to note that attempts to perform ITC experiments at30 �C were unsuccessful due to an unstable baseline signal caused

by denaturation of Sfp. However, decreasing the temperature ofthe ITC cell to 20 �C dramatically improved baseline stability.Duplicate ITC experiments of probe 4 and Sfp provided a KD of609 nM, which is in good agreement with the KD determined byFP (Fig. 4 and Table 1).

Competitive binding experiments using FP assay

To validate the FP assay for identification of ligands that bindSfp, we performed competitive displacement assays. For these as-says, careful attention was given to the choice of Sfp concentration.Ideally, probe and protein concentrations should be chosen to pro-vide a bound probe fraction (FSB) P 0.5 (Eq. (3) below) [33]. This

Assay for discovery of PPTase inhibitors / B.P. Duckworth, C.C. Aldrich / Anal. Biochem. 403 (2010) 13–19 17

ensures that the change in anisotropy caused by complete dis-placement of the fluorescent probe by a ligand is readily observed.Using Eq. (3) and a free probe concentration of 30 nM, an Sfp con-centration of 370 nM yields FSB = 0.5. The first ligand tested, CoA(2) (Fig. 5B), is the native substrate of Sfp and has a reported KM va-lue of 700 nM [17]. Sfp (370 nM) and 4 (30 nM) were titrated witha solution of CoA, and the observed anisotropies were fit to Eqs. (1)and (3) to yield a KD of 1.11 lM (Fig. 5A and Table 1). This value isin excellent agreement with the KD of CoA as determined by ITCthat was found to be 0.56 lM (Table 1 and Fig. S1 in supplementarymaterial). Next, we studied the competitive displacement of probe4 by PAP (5) (Fig. 5B), a by-product of the Sfp-catalyzed enzymereaction. Sfp and 4 were titrated with 5, and the observed anisotro-pies were fit to provide a KD of 1.67 lM (Fig. 5A and Table 1). ITCexperiments in which PAP was titrated into a solution of Sfpyielded a KD of 3.5 lM (Fig. S2). The KD of PAP determined by bothFP and ITC are in reasonable agreement with the IC50 of PAP withSfp (12.3 lM) as reported by Foley and Burkart [21]. Two addi-tional CoA analogues, adenosine 30-monophosphate (6) and aden-osine 30-phospho-50-methylenebisphosphonate (7) (Fig. 5B), weretested for their ability to displace the fluorescent probe from Sfp.The KD of compound 6 was found to be greater than 1 mM, suggest-ing that the 50-phosphate is crucial for Sfp binding. Alternatively,the KD of compound 7 was found to be 26.3 lM. Although 7 resem-bles CoA more closely than does PAP, its affinity for Sfp is roughly15-fold lower than PAP, suggesting that the bridging meth-ylenebisphosphonate moiety is a poor diphosphate isostere.

A

B

POPOO

O O

O

NH OH

O

NH

OHS

N

NN

N

NH2

O

OHO

O

PO

O OH2

PHOO

ON

NN

N

NH2

O

OHO

O

PO

O OH

5

N

NN

N

NH2

O

OHO

HO

PO

O OH

PO

ON

NN

N

NH2

O

OHO

O

PO

O OH

6 7

NN

SN

N

S

N NHN

O

OO

O

ClN N

ClCl

Cl

Cl

Cl

ClCl

8 9 10 11

PHOO

O

Fig. 5. (A) Competitive displacement of FP probe 4 from Sfp with 2 (curve in blue)and 5 (curve in red). Experimental points are shown with error bars, and the linesare the result of fitting data to Eqs. (1) and (3). (B) Structures of compounds testedfor validation of FP assay. (For interpretation of the references to color in this figurelegend, the reader is referred to the Web version of this article.)

Recently, a kinetic Sfp assay was developed and used to screenthe LOPAC library of pharmacologically relevant compounds [22].This assay yielded several hits possessing low- to mid-micromolaractivity. Because only IC50 values of these hits were described, wetested four compounds in our FP assay to determine whether theywere competitive with respect to CoA. As shown in Table 1, com-pound 10 displayed very weak displacement of CoA with a KD of457 ± 96 lM, whereas hits 8 and 9 did not displace the fluorescentprobe at a concentration of 500 lM. The KD of hit 11 was not cal-culated because this compound was found to quench the fluores-cence of probe 4:

FSB ¼2

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiða2 � 3bÞ cosðh=3Þ � a

p

3KD1 þ 2ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiða2 � 3bÞ cosðh=3Þ � a

p with ð3Þ

a ¼ KD1 þ KD2 þ LST þ LT � RT

b ¼ LT � RTð ÞKD1 þ LST � RTð ÞKD2 þ KD1KD2

c ¼ �KD1KD2RT

h ¼ arccos�2a3 þ 9ab� 27c

2ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiða2 � 3bÞ3

q264

375:

Impact of assay parameters

The quality of the FP assay was assessed by varying several fac-tors, including pH, DMSO concentration, incubation time, and tem-perature. Of these, pH was the most critical assay parameter.Because a majority of studies that employ Sfp use a pH range of7.2–8.0, we attempted to perform FP experiments at pH 8.0. At thispH, however, we observed a time-dependent decrease in FP signal,possibly due to slow inactivation of the enzyme. Simply loweringthe pH to 6.0, originally reported as the optimal pH for Sfp activity,greatly improved the stability of the FP signal [17]. As a measure ofassay quality, we calculated the Z0 factor (Eqs. (4) and (5) below),which is a statistical parameter often used to determine therobustness of an assay [35]. To determine the S/N ratio and Z0 factorat ambient temperature with no DMSO present, Sfp and 4 wereincubated in the presence and absence of 200 lM CoA and the FPsignal was read after 30 min. The experimentally observed aniso-tropies in the absence (AU) and presence (AF) of CoA, along withthe respective standard deviations (rU and rF), provided a signal-to-noise ratio of 14.9 and a Z0 of 0.65. Because Z0 scores of 0.5–1.0 are considered as excellent, our FP assay shows great promisefor HTS:

S=N ¼ AU � AFffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffir2

U þ r2F

q ð4Þ

Z0 ¼ 1� ð3rU þ 3rFÞAU � AF

: ð5Þ

We next turned our attention to assessing FP signal stability (bymeasuring Z0) over time as well as the equilibration time requiredto reach complete displacement. Sfp (370 nM) was added to 30 nM4 in FP buffer in the presence or absence of 200 lM CoA, and theanisotropy was read after 5, 30, 65, 120, 190, and 1080 min on 2separate days. As shown in Fig. 6A, the Z0 remained greater than0.5 for more than 18 h. We also measured the effect of temperatureon the Z0 score because ambient laboratory temperatures can vary.Again, Sfp was incubated with 4 in the presence or absence of CoAto assess the Z0 score. Fig. 6B shows that the Z0 score is stable from20 to 28 �C. Finally, we determined the tolerance of the FP assay toDMSO because a majority of library compounds in HTS collectionsare dissolved in DMSO. Concentrations of up to 5% (v/v) were welltolerated with anisotropy values within ±2% of the control lackingDMSO.

Fig. 6. Effect of incubation time (A) and temperature (B) on assay performance. Forincubation time studies, assays were performed in replicates of 16 and were testedon 2 separate days. For temperature studies, assays were performed in replicates of5 and were tested on 2 separate days.

18 Assay for discovery of PPTase inhibitors / B.P. Duckworth, C.C. Aldrich / Anal. Biochem. 403 (2010) 13–19

The work presented here has highlighted the development of anovel FP assay amenable to HTS that can be used to discover smallmolecule inhibitors of Sfp. Beyond the roles of PPTase inhibitors aspotential novel antimicrobial agents, PPTase inhibitors could alsoprove to be useful in identifying PKS- and NRPS-derived naturalproducts through comparative analysis of bacterial fermentationextracts using liquid chromatography–tandem mass spectrometry(LC–MS/MS) of treated and untreated strains. Inhibitors could alsoaid proteomic profiling techniques used to study microbial multi-modular PKS, NRPS, and FAS. In one example, Burkart and cowork-ers used a mutant strain of B. subtilis that lacks a functional sfp tometabolically label carrier proteins with fluorescent analogues[20]. PPTase inhibitors could potentially circumvent the need toproduce microbial strains lacking functional PPTases. In closing,we expect that the FP assay described here will allow rapid discov-ery of potent Sfp inhibitors. These small molecule inhibitors notonly will lead to the novel antimicrobial agents but also will serveas valuable probes to further our understanding of PKS and NRPSproteins and their derived natural products.

Acknowledgment

We thank Daniel Wilson for cloning of sfp and ZhengqiangWang for compounds 6 and 7.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.ab.2010.04.009.

References

[1] J.J. De Voss, K. Rutter, B.G. Schroeder, H. Su, Y. Zhu, C.E.I. Barry, The salicylate-derived mycobactin siderophores of Mycobacterium tuberculosis are essentialfor growth in macrophages, Proc. Natl. Acad. Sci. USA 97 (2000) 1252–1257.

[2] M.B. Reed, P. Domenech, C. Manca, H. Su, A.K. Barczak, B.N. Kreiswirth, G.Kaplan, C.E.I. Barry, A glycolipid of hypervirulent tuberculosis strains thatinhibits the innate immune response, Nature 431 (2004) 84–87.

[3] J.A. Ferreras, K.L. Stirrett, X. Lu, J.S. Ryu, C.E. Soll, D.S. Tan, L.E. Quadri,Mycobacterial phenolic glycolipid virulence factor biosynthesis: mechanismand small-molecule inhibition of polyketide chain initiation, Chem. Biol. 15(2008) 51–61.

[4] J.H. Crosa, C.T. Walsh, Genetics and assembly line enzymology of siderophorebiosynthesis in bacteria, Microbiol. Mol. Biol. Rev. 66 (2002) 223–249.

[5] K.M. George, D. Chatterjee, G. Gunawardana, J. Hayman, P.L. Small,Mycolactone: a polyketide toxin from Mycobacterium ulcerans required forvirulence, Science 283 (1999) 854–857.

[6] T.A. Keating, C.T. Walsh, Initiation, elongation, and termination strategies inpolyketide and polypeptide antibiotic biosynthesis, Curr. Opin. Chem. Biol. 3(1999) 598–606.

[7] R.H. Lambalot, A.M. Gehring, R.S. Flugel, P. Zuber, M. LaCelle, M.A. Marahiel, R.Reid, C. Khosla, C.T. Walsh, A new enzyme superfamily: thephosphopantetheinyl transferases, Chem. Biol. 3 (1996) 923–936.

[8] C.T. Walsh, A.M. Gehring, P.H. Weinreb, L.E.N. Quadri, R.S. Flugel, Post-translational modification of polyketide and nonribosomal peptide synthases,Curr. Opin. Chem. Biol. 1 (1997) 309–315.

[9] R.S. Flugel, Y. Hwangbo, R.H. Lambalot, J.E. Cronan Jr., C.T. Walsh, Holo-(acylcarrier protein) synthase and phosphopantetheinyl transfer in Escherichia coli,J. Biol. Chem. 275 (2000) 959–968.

[10] H.D. Mootz, R. Finking, M.A. Marahiel, 4-Phosphopantetheinyl transfer inprimary and secondary metabolism of Bacillus subtilis, J. Biol. Chem. 276 (2001)37289–37298.

[11] K. Reuter, M.R. Mofid, M.A. Marahiel, R. Ficner, Crystal structure of thesurfactin synthetase-activating enzyme sfp: a prototype of the 40-phosphopantetheinyl transferase superfamily, EMBO J. 18 (1999) 6823–6831.

[12] G. Bunkoczi, S. Pasta, A. Joshi, X. Wu, K.L. Kavanagh, S. Smith, U. Oppermann,Mechanism and substrate recognition of human holo ACP synthase, Chem.Biol. 14 (2007) 1243–1253.

[13] Z. Zhou, P. Cironi, A.J. Lin, Y. Xu, S. Hrvatin, D.E. Golan, P.A. Silver, C.T. Walsh, J.Yin, Genetically encoded short peptide tags for orthogonal protein labeling bySfp and AcpS phosphopantetheinyl transferases, ACS Chem. Biol. 2 (2007) 337–346.

[14] M.A. Marahiel, T. Stachelhaus, H.D. Mootz, Modular peptide synthetasesinvolved in nonribosomal peptide synthesis, Chem. Rev. 97 (1997) 2651–2674.

[15] J.N. Copp, B.A. Neilan, The phosphopantetheinyl transferase superfamily:phylogenetic analysis and functional implications in cyanobacteria, Appl.Environ. Microbiol. 72 (2006) 2298–2305.

[16] R. Finking, J. Solsbacher, D. Konz, M. Schobert, A. Schafer, D. Jahn, M.A.Marahiel, Characterization of a new type of phosphopantetheinyl transferasefor fatty acid and siderophore synthesis in Pseudomonas aeruginosa, J. Biol.Chem. 277 (2002) 50293–50302.

[17] L.E. Quadri, P.H. Weinreb, M. Lei, M.M. Nakano, P. Zuber, C.T. Walsh,Characterization of Sfp, a Bacillus subtilis phosphopantetheinyl transferasefor peptidyl carrier protein domains in peptide synthetases, Biochemistry 37(1998) 1585–1595.

[18] M.R. Mofid, R. Finking, L.O. Essen, M.A. Marahiel, Structure-based mutationalanalysis of the 40-phosphopantetheinyl transferases Sfp from Bacillus subtilis:carrier protein recognition and reaction mechanism, Biochemistry 43 (2004)4128–4136.

[19] J. Yin, P.D. Straight, S. Hrvatin, P.C. Dorrestein, S.B. Bumpus, C. Jao, N.L. Kelleher,R. Kolter, C.T. Walsh, Genome-wide high-throughput mining of natural-product biosynthetic gene clusters by phage display, Chem. Biol. 14 (2007)303–312.

[20] J.L. Meier, A.C. Mercer, M.D. Burkart, Fluorescent profiling of modularbiosynthetic enzymes by complementary metabolic and activity basedprobes, J. Am. Chem. Soc. 130 (2008) 5443–5445.

[21] T.L. Foley, M.D. Burkart, A homogeneous resonance energy transfer assay forphosphopantetheinyl transferase, Anal. Biochem. 394 (2009) 39–47.

[22] A. Yasgar, T.L. Foley, A. Jadhav, J. Inglese, M.D. Burkart, A. Simeonov, A strategyto discover inhibitors of Bacillus subtilis surfactin-type phosphopantetheinyltransferase, Mol. Biosyst. 6 (2010) 365–375.

[23] M.H. Roehrl, J.Y. Wang, G. Wagner, Discovery of small-molecule inhibitors ofthe NFAT–calcineurin interaction by competitive high-throughputfluorescence polarization screening, Biochemistry 43 (2004) 16067–16075.

[24] J. Neres, D.J. Wilson, L. Celia, B.J. Beck, C.C. Aldrich, Aryl acid adenylatingenzymes involved in siderophore biosynthesis: fluorescence polarizationassay, ligand specificity, and discovery of non-nucleoside inhibitors via high-throughput screening, Biochemistry 47 (2008) 11735–11749.

Assay for discovery of PPTase inhibitors / B.P. Duckworth, C.C. Aldrich / Anal. Biochem. 403 (2010) 13–19 19

[25] W. Reindl, J. Yuan, A. Kramer, K. Strebhardt, T. Berg, Inhibition of polo-like kinase1 by blocking polo-box domain-dependent protein–protein interactions, Chem.Biol. 15 (2008) 459–466.

[26] M.R. Mofid, M.A. Marahiel, R. Ficner, K. Reuter, Crystallization and preliminarycrystallographic studies of Sfp: a phosphopantetheinyl transferase of modularpeptide synthetases, Acta Crystallogr. D 55 (1999) 1098–1100.

[27] K.L. Vedvik, H.C. Eliason, R.L. Hoffman, J.R. Gibson, K.R. Kupcho, R.L. Somberg,K.W. Vogel, Overcoming compound interference in fluorescence polarization-based kinase assays using far-red tracers, Assay Drug Dev. Technol. 2 (2004)193–203.

[28] G.J. Parker, T.L. Law, F.J. Lenoch, R.E. Bolger, Development of highthroughput screening assays using fluorescence polarization: nuclearreceptor–ligand-binding and kinase/phosphatase assays, J. Biomol. Screen.5 (2000) 77–88.

[29] J. Schust, T. Berg, A high-throughput fluorescence polarization assay for signaltransducer and activator of transcription 3, Anal. Biochem. 330 (2004) 114–118.

[30] P. Banks, M. Gosselin, L. Prystay, Impact of a red-shifted dye label for highthroughput fluorescence polarization assays of G protein-coupled receptors, J.Biomol. Screen. 5 (2000) 329–334.

[31] P. Banks, M. Harvey, Considerations for using fluorescence polarization in thescreening of G protein-coupled receptors, J. Biomol. Screen. 7 (2002) 111–117.

[32] S.L. McGovern, B.T. Helfand, B. Feng, B.K. Shoichet, A specific mechanism ofnonspecific inhibition, J. Med. Chem. 46 (2003) 4265–4272.

[33] M.H. Roehrl, J.Y. Wang, G. Wagner, A general framework for development anddata analysis of competitive high-throughput screens for small-moleculeinhibitors of protein–protein interactions by fluorescence polarization,Biochemistry 43 (2004) 16056–16066.

[34] X. Huang, Fluorescence polarization competition assay: the range of resolvableinhibitor potency is limited by the affinity of the fluorescent ligand, J. Biomol.Screen. 8 (2003) 34–38.

[35] J.H. Zhang, T.D.Y. Chung, K.R. Oldenbug, A simple statistical parameter for usein evaluation and validation of high throughput screening assays, J. Biomol.Screen. 4 (1999) 67–73.