JOURNAL OF CLINICAL MICROBIOLOGY, July 2010, p. 2330–2336 Vol. 48, No. 70095-1137/10/$12.00 doi:10.1128/JCM.01224-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Development and Evaluation of a Simple Assay for Marburg VirusDetection Using a Reverse Transcription-Loop-Mediated

Isothermal Amplification Method�

Yohei Kurosaki,1,2 Allen Grolla,3 Aiko Fukuma,1,2 Heinz Feldmann,3,4,5 and Jiro Yasuda1,2*National Research Institute of Police Science, Kashiwa 277-0882, Japan1; CREST, Japan Science and Technology Agency,

Saitama 332-0012, Japan2; National Microbiology Laboratory, Public Health Agency of Canada, Winnipeg, Manitoba R3E 3R2,Canada3; Department of Medical Microbiology, University of Manitoba, Winnipeg, Manitoba, Canada4; and

Laboratory of Virology, Division of Intramural Research, National Institutes of Allergy andInfectious Diseases Rocky Mountain Laboratories, Hamilton, Montana5

Received 23 June 2009/Returned for modification 25 October 2009/Accepted 19 April 2010

Marburg virus (MARV) causes a severe hemorrhagic fever in humans with a high mortality rate. The rapidand accurate identification of the virus is required to appropriately provide infection control and outbreakmanagement. Here, we developed and evaluated a one-step reverse transcription-loop-mediated isothermalamplification (RT-LAMP) assay for the rapid and simple detection of MARV. By combining two sets of primersspecific for the Musoke and Ravn genetic lineages, a multiple RT-LAMP assay detected MARV strains of bothlineages, and no cross-reactivity with other hemorrhagic fever viruses (Ebola virus and Lassa virus) wasobserved. The assay could detect 102 copies of the viral RNA per tube within 40 min by real-time monitoringof the turbidities of the reaction mixtures. The assay was further evaluated using viral RNA extracted fromclinical specimens collected in the 2005 Marburg hemorrhagic fever outbreak in Angola and yielded positiveresults for samples containing MARV at greater than 104 50% tissue culture infective doses/ml, exhibiting 78%(14 of 18 samples positive) consistency with the results of a reverse transcription-PCR assay carried out in thefield laboratory. The results obtained by both agarose gel electrophoresis and naked-eye judgment indicatedthat the RT-LAMP assay developed in this study is an effective tool for the molecular detection of MARV.Furthermore, it seems suitable for use for field diagnostics or in laboratories in areas where MARV is endemic.

Marburg virus (MARV) is the causative agent of a severehemorrhagic fever in humans with a high mortality rate. Afterthe first documented outbreak of Marburg hemorrhagic fever(MHF) in Germany and the former Yugoslavia in 1967, severalsporadic outbreaks have been reported in central Africancountries (19, 20). The largest outbreak of MHF occurred inUige Province in Angola from 2004 to 2005 and had a mortalityrate of 90% among 252 cases (25). As with Ebola virus(EBOV), transmission of MARV is associated with close con-tact with infected individuals, particularly their body fluids.Therefore, diagnosis early in the course of an MHF outbreakis essential to control infection and to prevent further trans-mission (3, 4, 5).

Virus isolation, transmission electron microscopy, immuno-histochemistry, antigen-capture enzyme-linked immunosor-bent assay (ELISA), IgG or IgM virus-specific antibody-cap-ture ELISA, and reverse transcription-PCR (RT-PCR) havebeen used for the laboratory diagnosis of MARV (9, 20, 23).As the viral load in the serum of individuals infected withfiloviruses could be as high as 109 copies per milliliter (26, 28),molecular detection methods based on viral protein or genomesequences have taken over as the first-choice diagnostic tech-

niques for use with clinical specimens. Both antigen-captureELISA and real-time RT-PCR have been used to detectMARV in field laboratories during some MHF outbreaks, asthese methods can yield a positive result rapidly and specifi-cally, but they require expensive apparatuses and sophisticatedtechniques.

MARV is a member of the family Filoviridae, along withEBOV, and is a single, nonsegmented, negative-sense RNAvirus. The virus genome is almost 19 kb in length and encodesseven viral proteins. In contrast to the genus Ebola virus, whichincludes four definite species, Zaire Ebola virus (ZEBOV),Sudan Ebola virus (SEBOV), Ebola virus Reston (REBOV),and Ivory Coast Ebola virus (ICEBOV), and a putative species,Bundibugyo Ebola virus (27), the genus Marburg virus consistsof a single species, Lake Victoria Marburg virus (LVMARV)(6). Comparative sequence analyses of the GP and VP35 genesor the full-length genome of MARV strains showed that thereare two distinct lineages within LVMARV and a difference ofapproximately 20% between the two lineages at the nucleotidesequence level (2, 21, 25). The Ravn (Kenya, 1987) (12) and09DRC99 (Democratic Republic of Congo [DRC], 1999)strains (2) comprise a distinct minor lineage (Ravn lineage),and the other strains, including the high-virulence strains iso-lated in Angola, comprise the major genetic lineage within thegenus Marburg virus, represented by the Musoke strain (Kenya,1980) (Musoke lineage) (22). Thus, the development ofMARV detection methods based on nucleic acid amplificationand applicable to all known MARV isolates has been limited.Therefore, it is necessary to establish a method for MARV

* Corresponding author. Mailing address: Fifth Biology Section forMicrobiology, First Department of Forensic Science, National Re-search Institute of Police Science, 6-3-1 Kashiwanoha, Kashiwa 277-0882, Japan. Phone: 81-4-7135-8001. Fax: 81-4-7133-9159. E-mail:yasuda@nrips.go.jp.

� Published ahead of print on 26 April 2010.

2330

on June 7, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

detection based on a rapid and simple molecular detectiontechnique adapted to the sequence variants of each strain.

Reverse transcription-loop-mediated isothermal amplifica-tion (RT-LAMP) is a promising technique for nucleic acidamplification (16). The use of this method has recently beendemonstrated for the diagnosis of several human pathogenicRNA viruses (11, 14, 18). This technique is based on theprinciple of strand-displacing DNA synthesis by the Bst DNApolymerase with six distinct primers that recognize a total ofeight independent sites. cDNA synthesis by avian myeloblas-tosis virus reverse transcriptase and DNA amplification wereperformed in one step under isothermal conditions (60° to65°C), thereby obviating the need for a thermal cycler. More-over, LAMP of positive samples could be performed simplywith real-time monitoring of the turbidities of the reactionmixtures as well as naked-eye judgment with addition of afluorescent substance (calcein) to the reaction mixture (24).

In the present study, we developed a MARV-specific RT-LAMP assay which is highly specific for MARV and shows nocross-reactivity with the viral RNA of closely related EBOVstrains. The assay could detect 102 RNA molecules per tube.The RT-LAMP assay does not require the use of sophisticatedequipment or highly skilled personnel and can provide accu-rate results within a short time frame. These characteristicsmake this assay potentially useful for the clinical diagnosis ofMARV infection in a field laboratory.

MATERIALS AND METHODS

Viruses and RNA extraction. All virus strains used in this study, Lassa virus(LASV) strains Josiah and Pinneo, ZEBOV strains Mayinga’76 and Kikwit’95,SEBOV strain Boniface, REBOV strain Reston, and ICEBOV strain Coted’Ivoire, and MARV strains Musoke, Ozolin, Ravn, and Angola, were propa-gated in Vero E6 cells, as described previously (15). With the exception of theMARV Angola strain, which was isolated from clinical material from the out-break in Uige, Angola, all viruses were kindly provided to the National Micro-biology Laboratory (NML), Public Health Agency of Canada (PHAC), by theSpecial Pathogens Branch of the Centers for Disease Control and Prevention (atthat time, from T. G. Ksiazek and P. E. Rollin) and the Virology Division of theU.S. Army Medical Research Institute of Infectious Diseases (at that time, fromP. B. Jahrling and T. W. Geisbert). Viral RNAs were extracted manually fromvirus suspensions using a QIAamp viral RNA minikit (Qiagen, Hilden, Ger-many). All infectious materials were handled in the biosafety level 4 facility ofNML, PHAC.

Standard transcript RNA. The 3� end of the virus genome was amplified byRT-PCR using Musoke-specific forward (5�-AGACACACAAAAACAAGAGA-3�) and reverse (5�-CTTGGATGGG/CGCCAGGCATC-3�) primers andRavn-specific forward (5�-AGACACACAAAAACAAGAGATGATG-3�) andreverse (5�-CTTTGGACGGGCGC/CAAGCATC-3�) primers. Fragments of thepredicted size (�5.1 kb) were cloned into the vector pGEM-3Zf(�) (Promega,Madison, WI), and partial viral genome clones were obtained (pGEM-Mus1 andpGEM-Rav1, respectively). The nucleoprotein (NP)-coding sequence of eachstrain was amplified by PCR using primers MusNP� (5�-ATGGATTTACACAGTTTGTTGGAGTTGGG-3�) and MusNP� (5�-CTACAAGTTCATCGCAACATGTCTCCTTTC-3�) and the template pGEM-Mus1 and primers RavNP�

(5�-ATGGATTTACATAGTTTGCTAGAATTAGG-3�) and RavNP� (5�-TTACAAGTTCATAGCAACATGCCTCCTCTC-3�) and the template pGEM-Rav1. Fragments of the expected size (2,088 bp each) were purified with a gelextraction kit (Qiagen) and subcloned into pGEM-3Zf(�) in inverse orientationrelative to the orientation of the T7 promoter sequence. The negative-sense NPRNAs of the Musoke strain (Mus-NP) and the Ravn strain (Rav-NP) weresynthesized in vitro using each of the subclones of the NP gene with T7 RNApolymerase (Promega). The transcripts were extracted using an RNeasy minikit(Qiagen) and resuspended in 50 �l of diethyl pyrocarbonate (DEPC)-treatedwater. The RNA concentration was determined by measuring the optical densityat 260 nm (OD260), and the RNA was diluted with DEPC-treated water toachieve the appropriate concentrations.

Primer design. MARV-specific primers for RT-LAMP were designed basedon the sequences of the NP gene, and two sets of lineage-specific primers forMusoke and Ravn were designed. The complete MARV NP-coding sequencesavailable in the GenBank database were aligned using DNA analysis software(GENETYX, Tokyo, Japan) to identify a conserved region and determine aconsensus sequence for each lineage (Fig. 1). Potential target regions in theconsensus sequence for Musoke lineage were analyzed using the LAMP primerdesign support software program PrimerExplorer (version 3; Net Laboratory,Tokyo, Japan; http://primerexplorer.jp/e/), and the Musoke lineage-specificprimers were designed automatically. Ravn lineage-specific primers were de-signed based on the Musoke lineage primers by replacement with nucleotidescomplementary to the Ravn lineage consensus sequence. The lineage-specificRT-LAMP assay required a set of six primers: two outer primers (F3 and B3), aforward inner primer (FIP), a reverse inner primer (BIP), a forward loop primer(LF), and a reverse loop primer (LB). FIP consisted of F1c complementary to theF1 sequence, a TTTT spacer, and the F2 sequence. BIP consisted of B1c com-plementary to the B1 sequence, a TTTT spacer, and the B2 sequence. Primer LFwas commonly used for the Musoke (Mus) and Ravn (Rav) lineage-specificRT-LAMPs. A multiple RT-LAMP reaction was performed by combining a totalof 11 primers specific for each lineage. The locations and sequences of theoligonucleotide primers are shown in Fig. 1 and Table 1. All the primers usedwere oligonucleotide purification cartridge-purified primers and were purchasedfrom Hokkaido System Science (Sapporo, Japan).

RT-LAMP reaction and restriction enzyme analysis. The RT-LAMP reactionwas performed in 25-�l reaction mixtures with an RNA amplification kit (EikenChemical Co., Ltd., Tokyo, Japan), in accordance with the manufacturer’s pro-tocol. The reaction mixture contained 1.6 �M each primers FIP and BIP, 0.2 �Meach outer primers F3 and B3, 0.8 �M each loop primers LF and LB, and 1 �lof RNA extract (0.2 ng RNA). The reaction mixture was incubated in a heatblock at 63°C for 45 or 60 min and was then heated at 80°C for 5 min to terminatethe reaction. To distinguish the amplified DNA products of a Musoke-lineagestrain from those of a Ravn-lineage strain, aliquots of 1 �l of the products in a10-�l reaction mixture were digested with 20 units of SmlI at 55°C or 40 units ofXbaI at 37°C for 30 min. Aliquots of 1 �l of each amplified product or 10 �l ofdigested DNA products were analyzed on a 3% agarose gel, followed by stainingwith ethidium bromide and visualization on an imaging analyzer (LAS-3000;FujiFilm, Tokyo, Japan). For visual detection, 1 �l of fluorescent reagent (EikenChemical) was added to the RT-LAMP reaction mixture, and the incubatedreaction tube was irradiated with UV light (254 nm) using a handheld irradiator(UVP, San Francisco, CA). For real-time monitoring of RT-LAMP amplifica-tion, the reaction mixtures were incubated at 63°C and examined by spectropho-tometric analysis using a real-time turbidimeter (LA-200; Teramecs, Kyoto,Japan). A turbidity value of �0.1 was considered a positive result.

RT-PCR and TaqMan RT-PCR. The RT-PCR assay for filoviruses was per-formed in 25-�l reaction mixtures containing 1 �l of RNA template using aOne-Step RT-PCR kit (Qiagen). The cycling profiles and the primers targetinga region of the L gene described by Zhai et al. (29) were used. The TaqManRT-PCR assay was performed using a One Step PrimerScript RT-PCR kit(Perfect Real Time; Takara Bio, Shiga, Japan) and a SmartCycler II system(Cepheid, Sunnyvale, CA). Amplifications were carried out in 25-�l reactionmixtures containing 1 �l of the target virus RNA, 0.5 �M each sense andantisense primers, and 0.2 �M TaqMan probe targeting a region of the nucleo-protein, as described by Weidmann et al. (28). The number of RNA copies inviral RNA extracts of each MARV strain was calculated from the standard curveprepared with the in vitro-transcribed RNA standard and the cycle threshold(CT) value obtained with the TaqMan RT-PCR.

Clinical specimens. A total of 24 clinical specimens from whole blood (9specimens), serum (3 specimens), oral swabs (11 specimens), and breast milk (1specimen) were obtained from 16 individuals with suspected MARV infectionduring the outbreak in Uige, Angola, from 2004 to 2005. The RNAs wereextracted directly from the clinical specimens using a QIAamp viral RNA mini-kit, according to the manufacturer’s instructions.

RT-PCR diagnostic assays. Initially, two quantitative RT-PCR (Q-RT-PCR)assays were used that targeted regions of the polymerase (L) gene (MARVLF,TTATTGCATCAGGCTTCTTGGCA; MARVLR, GGTATTAAAAAATGCATCCAA [GenBank accession number AY358025; bp 13321 to 133517]) and theglycoprotein (GP) gene (MARVGPF, AAAGTTGCTGATTCCCCTTTGGA;MARVGPR, GCATGAGGGTTTTGACCTTGAAT [GenBank accession num-ber AY358025; bp 6131 to 6355]). Later, an assay that targeted a region of NP(MARVNPF; TGAATTTATCAGGGATTAAC; MARVNPR, GTTCATGTCGCCTTTGTAG [GenBank accession number AY358025; bp 967 to 1146]) wasused in place of the GP gene assay. MARV RNA was detected using a Light-Cycler RNA amplification SYBR green I kit (Roche). Briefly, 5 �l of RNA was

VOL. 48, 2010 RAPID DETECTION OF MARBURG VIRUS BY RT-LAMP 2331

on June 7, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

added to 20 �l of a master mixture containing 1� SYBR green I mix, 5 mMMgCl2, 0.6 �M forward and reverse primers, and 0.5 �l of the enzyme mix.Q-RT-PCR assays were run on Smartcycler II thermocyclers. A reverse trans-criptase step at 50°C for 20 min and a 2-min inactivation step at 94°C werefollowed by 40 cycles at 94°C for 15 s, 50°C for 30 s, and 72°C for 30 s, where asingle datum point was taken. Melt curve analysis was performed to confirm theidentities of the amplification products. Samples were considered positive if theyproduced melting point-confirmed amplification products in both assays. Theamplification products were returned to NML and directly sequenced using bothforward and reverse primers. A titrated virus stock, previously isolated from aMARV-positive blood sample, was used to provide a standard curve between the50% tissue culture infective dose (TCID50) per milliliter and the CT value. Thetiters of the other samples were calculated on the basis of this standard curve.Aliquots of 1 �l of each RNA extract were tested by RT-LAMP assay usingMusoke lineage-specific primers.

RESULTS

Specificities and sensitivities of RT-LAMP assay. We ini-tially examined the target region for RT-LAMP, which islonger than 250 nucleotides and which is highly conservedamong the NP genes of the strains of each of the Musoke andRavn lineages (Fig. 1). A set of six primers specific for theMusoke or Ravn lineage was designed for this target region, as

TABLE 1. LAMP primers for MARV detection

Primer Type Sequence (5�–3�)a

Mus-F3 F3 TTCATCAAGGAGTAAATTTGGTMus-B3 B3c GCCTGCTTGAAACTAGCAMus-FIP F2-T4-F1c GAAGTCCTGAGAATCTAGTTTGACC

TTTTGACAGGTCATGATGCCTATMus-BIP B1-T4-B2c TCATCTTGCAAAAAACTGATTCAGT

TTTCTTCATTTTTTACTTTGGAGGT

Mus-LFb LF TACTGAATTACTRATGATACTGTCMus-LB LBc TGACACTACATCCTTTGGTGCGGRav-F3 F3 TCCATCAGGGAGTAAACTTGGTRav-B3 B3c GCCTGTTTGAAGCTTGCARav-FIP F2-T4-F1c GAAGCCCTGAGAATCTAGTTTGTCC

TTTTGACAGGTCATGATGCCTATRav-BIP B1-T4-B2c TCATCCTACAAAAAACTGATTCAGT

TTTCTTCATTTTTTACTTTTGAGGTRav-LB LBc TGGCATTGCATCCACTTGTGCGG

a Characters in boldface indicate Ravn lineage-specific nucleotides. Under-lined characters indicate the TTTT spacer (T4).

b Mus-LF primers were commonly used for RT-LAMP for detecting Musoke-and Ravn-lineage strains.

FIG. 1. Alignment of MARV NP gene sequences and positions of primers for RT-LAMP assay. Primers were designed according to aconserved region of the NP gene (nucleotides 693 to 897, GenBank accession number DQ217792) determined by use of the NP genes of Musoke-and Ravn-lineage consensus sequences (Mus-cons and Rav-cons, respectively). The arrows show the locations of the primer binding sequences andthe direction of primer extension. The restriction enzyme sites for SmlI and XbaI, which were used to identify the LAMP products from Musoke-and Ravn-lineage strain sequences, respectively, are boxed. The GenBank accession numbers for the strains aligned (from top to bottom) areZ29337 (Popp), DQ217792 (Musoke), AY358025 (Ozolin), DQ447651 (05DRC99), DQ447650 (07DRC99), DQ447653 (Angola), DQ447649(Ravn), and DQ447652 (09DRC99).

2332 KUROSAKI ET AL. J. CLIN. MICROBIOL.

on June 7, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

described in Materials and Methods. To amplify all of theMARV strains simultaneously in one tube, we performed amultiple RT-LAMP (mRT-LAMP) assay with a combinationof two sets of primers specific for both the Musoke and Ravnlineages (Table 1).

To evaluate the specificities of the mRT-LAMP assay, ali-quots of 0.2 ng of RNA extract of each virus-infected cellculture were tested. Eleven virus strains, nine filoviruses (fourMARV strains, two ZEBOV strains, one SEBOV strain, one

REBOV strain, and one ICEBOV strain), and two arenavi-ruses (two LASV strains) (see Materials and Methods), wereexamined. The reaction was monitored by agarose gel deposi-tion and naked-eye visualization, following incubation of thereaction mixture at 63°C for 60 min. The mRT-LAMP specif-ically amplified products with typical ladder-like patterns fromall four MARV strains tested (Fig. 2, upper panel). No cross-reaction with the RNA of EBOV and LASV was observed inany RT-LAMP assay. In addition, we have confirmed by aBLAST homology search that the sequences of the primers forMARV do not have any homology with the genes of any otherhemorrhagic fever viruses, including EBOV, LASV, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, yellowfever virus, and dengue virus. The assay also did not show anycross-reactivity with these viruses, since the assay did not showany positivity even for EBOV, which belongs to the same virusfamily as MARV, indicating that the MARV-specific primersdemonstrated a high degree of specificity for MARV. Corre-sponding positive results could be seen visually by UV irradi-ation of the reaction mixture containing fluorescence reagents(Fig. 2, lower panel). The assay with the Musoke and the Ravnlineage-specific primers reacted only with MARV Musoke-lineage strains Musoke, Ozolin, and Angola and the Ravnstrain, respectively (data not shown).

To confirm that the products were amplified from the targetregion, the RT-LAMP products were digested with restrictionendonucleases SmlI and XbaI, which recognized the sequenceson the amplification products conserved among the Musoke-and Ravn-lineage strains, respectively (Fig. 1). The mRT-LAMP products from standard RNAs with the correspondingMus-NP and Rav-NP sequences were digested with SmlI andXbaI, respectively. As shown in Fig. 3, the sizes of the frag-ments were consistent with the sizes predicted for each strain(105 bp and 140 bp for Mus-NP, 107 bp and 138 bp for Rav-NP). The same results were seen for the products of RT-LAMP with viral RNAs, indicating that the mRT-LAMP re-action was specific.

FIG. 2. Specificities of mRT-LAMP assay for detecting MARV.The assay was performed at 63°C for 60 min using a mixture of Musokeand Ravn lineage-specific primers. Amplification was detected byelectrophoretic analysis on a 3% agarose gel (upper panel) andfrom the fluorescence of the reaction mixtures observed under UVirradiation (lower panel). Lane 1, ZEBOV strain Mayinga’76; lane2, ZEBOV strain Kikwit’95; lane 3, SEBOV strain Boniface; lane 4,REBOV strain Reston; lane 5, ICEBOV strain Cote d’Ivoire; lane6, MARV strain Musoke; lane 7, MARV strain Ozolin; lane 8,MARV strain Angola; lane 9, MARV strain Ravn; lane 10, LASVstrain Josiah; lane 11, LASV strain Pinneo; lane N, RT-LAMP withdistilled water (negative control); lane M, 100-bp DNA laddermarker.

FIG. 3. Restriction enzyme analysis of LAMP products. Products were obtained by LAMP in a reaction using multiple primers with thestandard RNAs of the NP-coding sequence of the Musoke strain (lanes 1 and 2) or the Ravn strain (lanes 3 and 4) or viral RNA of MARV strainsMusoke (lanes 5 to 7), Ozolin (lanes 8 to 10), Angola (lanes 11 to 13), and Ravn (lanes 14 to 16). The complete LAMP products (lanes 1, 3, 5,8, 11, and 14) and DNA fragments of the LAMP products digested with SmlI (lanes 2, 6, 9, 12, and 15) or XbaI (lane 4, 7, 10, 13, and 16) weresubjected to electrophoresis on a 3% agarose gel. � and �, LAMP products were incubated in the presence and absence of XbaI or SmlI,respectively. Lane M, 100-bp ladder marker.

VOL. 48, 2010 RAPID DETECTION OF MARBURG VIRUS BY RT-LAMP 2333

on June 7, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

The sensitivity of the RT-LAMP assay for MARV was de-termined by testing serial 10-fold dilutions of viral genomicRNAs of MARV. The viral genomic RNAs of the Musoke andRavn strains, ranging from 104 to 100 copies per reaction vol-ume, were tested in three separate runs for each dilution on areal-time turbidity-monitoring device. The detection limit ofthe mRT-LAMP assay was 102 copies per tube for both theMusoke and Ravn strains, and positive results were obtained in20 to 35 min (Table 2). The detection limits were furtherconfirmed by testing two additional strains, Angola and Ozolin(data not shown). The assay was equivalent or more sensitivethan conventional RT-PCR specific for filoviruses, but real-time RT-PCR using TaqMan probes targeting the NP gene ofMARV could detect a lower viral RNA copy number in thetest using the same diluted viral RNA template. For furtheranalysis of the sensitivities of the assay, the dose-responsecurves for RT-LAMP were determined by testing serial 10-folddilutions of in vitro-transcribed standard RNAs (standard tran-script RNAs). The mRT-LAMP using a total of 11 primersshowed RNA standard dose-response curves similar to thoseof ordinary RT-LAMP using 6 primers specific for Musoke- orRavn-lineage strains (Fig. 4). The mRT-LAMP assay showed100% sensitivity in detecting more than 103 copies of Mus-NPand 104 copies of Rav-NP standard transcript RNAs per reac-tion. The borderline analytical detection limit for mRT-LAMPwas 102 RNA copies per reaction. The average times for de-tection of 102 copies were 39.9 min with a 50% positivity ratefor Mus-NP RNA and 34.8 min with a 37.5% positivity rate forRav-NP RNA. Real-time monitoring of the turbidity coulddetermine most of the positive results in less than 45 min in thereaction using multiple primers or lineage-specific primers.

Evaluation of RT-LAMP assay with clinical specimens. Atotal of 24 clinical specimens obtained from the outbreak inAngola were used for evaluation of the RT-LAMP assay, andthe results were compared with those of the real-time RT-PCRassay performed in the field laboratory. The RT-LAMP reac-tion was performed at 63°C for 45 min using Musoke lineage-specific primers with 1 �l of RNA extracted from the clinicalsamples, followed by detection of the LAMP products by aga-rose gel electrophoresis or visually with fluorescence of the

reaction mixture (Table 3). A concordance of 78% (14 of 18samples) of positive results between the RT-LAMP assay andthe real-time RT-PCR was observed. All six samples negativeby RT-PCR were also negative by RT-LAMP. The sensitivityof the RT-LAMP assay with clinical specimens was approxi-mately 104 TCID50s/ml. In this study, each sample was tested induplicate, and the samples that showed positive results in both

TABLE 2. Comparison of sensitivities of the mRT-LAMP and RT-PCR methods for detection of MARV RNAa

StrainNo. of RNA

copies/reactionmixture

RT-PCRresults

TaqManRT-PCR

results

mRT-LAMPresults Tt (min)

Musoke 2.5 � 104 �/�/� �/�/� �/�/� 21.8103 �/�/� �/�/� �/�/� 26.5102 �/�/� �/�/� �/�/� 32.4101 �/�/� �/�/� �/�/�100 �/�/� �/�/� �/�/�

Ravn 2.2 � 104 �/�/� �/�/� �/�/� 20.7103 �/�/� �/�/� �/�/� 27.3102 �/�/� �/�/� �/�/� 33.4101 �/�/� �/�/� �/�/�100 �/�/� �/�/� �/�/�

a Tenfold serial dilutions of viral genomic RNAs of MARV strains Musokeand Ravn were subjected to each nucleic amplification method. Replicates ofthree samples were tested at each dilution. Tt, average threshold time, accordingto the mRT-LAMP-positive results. �, positive result; �, negative result.

FIG. 4. RNA dose-response curve of RT-LAMP assays. Tenfoldserially diluted transcript RNAs ranging from 1 to 100,000 copies weretested in eight replicate assays each. The RT-LAMP reaction wascarried out for 60 min on a real-time turbidity-monitoring device. Theobserved rates of positive results performed with each transcript RNAcopy number are plotted. The standard transcript RNA encoding thenucleoprotein gene of strain Musoke was assayed with primers specificfor the Musoke lineage (Mus-NP/Musoke) or multiple primers (Mus-NP/mRT-LAMP), and the standard transcript RNA encoding the nu-cleoprotein gene of strain Ravn was assayed with primers specific forthe Ravn lineage (Rav-NP/Ravn) or multiple primers (Rav-NP/mRT-LAMP).

TABLE 3. Evaluation of the RT-LAMP assay with clinicalspecimens from MARV outbreak in Angola, 2004–2005

Resultfor

MARVaTiterb

No. ofspecimens

assayed

No. (%) of samples positivec by:

Electrophoresis Fluorescence

Positive 107–106 3 3 (100) 3 (100)106–105 6 6 (100) 6 (100)105–104 5 4 (80) 4 (80)104–103 3 0 (0) 0 (0)ND 1 1 (100) 1 (100)Totald 18 14 (78) 14 (78)

Negative 6 0 (0) 0 (0)

a Samples were determined to be MARV positive by real-time RT-PCR, asdescribed in Materials and Methods.

b The virus titers of each sample are described as the number of TCID50s/ml.ND, not determined.

c Each sample was tested in duplicate, and the samples indicating positiveresults in both reactions were finally determined to be positive by the RT-LAMPassay.

d The total results of the RT-LAMP assay for MARV-positive samples.

2334 KUROSAKI ET AL. J. CLIN. MICROBIOL.

on June 7, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

reactions were finally determined to be MARV positive. TwoRNA samples from the specimens containing the viruses at3.5 � 104 and 8 � 103 TCID50s/ml showed one positive reac-tion. The RT-LAMP-negative samples were retested by exten-sion of the incubation to 60 min; however, the results did notchange. These negative samples were tested in duplicate usingthe assay deployed during the Angola outbreak; both replicatesof three of four samples were positive but produced higher CT

values, indicating that they had lower levels of viral RNA. Theother sample produced a positive signal in only one replicate.

In this study, we did not carry out the mRT-LAMP withclinical samples, since sufficient amounts of viral RNA fromthe clinical specimens did not remain. However, we supposethat similar results could be obtained from the mRT-LAMP,since the sensitivities of the mRT-LAMP for the in vitro-tran-scribed viral RNA were almost equivalent to those of thelineage-specific RT-LAMP (Fig. 4).

DISCUSSION

Phylogenetic analysis indicated that MARV strains could beseparated into two genetic lineages, the minor Ravn lineageand the major Musoke lineage, and strains of both lineages arepathogenic in humans (2, 25). In the outbreak in Durba, DRC,multiple genetically distinct viruses of both lineages werethought to have been introduced into the human population(2). Thus, it is necessary to establish clinical diagnostic meth-ods for detection of the genetic diversity within the genusMarburg virus.

Degenerate primers are often used for the simultaneousdetection of diverged sequences by PCR or other nucleotideamplification methods. We initially attempted to use prim-ers with several mixed bases for the simultaneous detectionof strains within the main and minor lineages, but these didnot work for rapid amplification. The advantage of LAMPusing multiple primers for the simultaneous detection ofdistinct genetic sequences, such as those of Babesia bovisand Babesia bigemina and norovirus genogroups I and II,has previously been reported by other groups (7, 10). Theviral genome sequences were highly conserved among thestrains in the respective MARV lineages. Therefore, weadopted the mRT-LAMP assay using two sets of primersdesigned according to the Musoke or Ravn lineage consen-sus sequence. There was no significant loss of specificity orsensitivity with the mRT-LAMP assay when the results werecompared to those of lineage-specific RT-LAMP assays(Fig. 2 and 4).

Agarose gel electrophoresis is a reliable method for detect-ing LAMP products, By this method, ladder-like patterns areobserved, and the sizes of fragments are determined by diges-tion of the products with a restriction endonuclease (16). Nev-ertheless, agarose gel electrophoresis is less suitable for fieldlaboratories. The LAMP assay with real-time turbidity moni-toring or naked-eye judgment should be applied as a screeningtest for MARV infection due to its rapidity and simplicity. Inreal-time turbidity monitoring, mRT-LAMP-positive resultscould be observed within approximately 20 min in reactionswith 104 copies of viral RNA (Table 2). In addition, the am-plification reaction with naked-eye judgments showed specific-

ities consistent with those by detection by agarose gel electro-phoresis in the reaction with viral RNAs (Fig. 2).

Recently, RT-PCR and TaqMan RT-PCR assays that couldpotentially detect all known MARV strains have been reported(8, 17, 23, 28, 29). Our RT-LAMP assay had sensitivity equiv-alent to or greater than that of RT-PCR in parallel tests usingthe same template RNAs. However, TaqMan RT-PCR couldprovide positive results with a lower copy number than themRT-LAMP assay (Table 2). The mRT-LAMP reactions werepositive at approximately 102 copies of viral RNA or the invitro-transcribed RNA per reaction within 35 or 45 min, andthe sensitivities of the assay did not differ significantly amongthe MARV strains. These results indicate that the RT-LAMPassay has a specificity and a sensitivity sufficiently high to detectMARV genomes.

In the evaluation test with clinical specimens obtainedfrom the outbreak in Angola, the RT-LAMP assay usingMusoke lineage-specific primers showed good performancewith regard to concordance and specificity, even with visualdetection using a fluorescent reagent (Table 3). This willmake the RT-LAMP assay more highly beneficial than RT-PCR or other nucleic acid amplification methods for use asa field diagnosis technique, as the only apparatus requiredfor the assay is a simple device, such as a water bath or aheat block, that furnishes a constant temperature of 63°C. Ithas been reported that LAMP was less influenced by PCRinhibitors in blood components (1, 13), and with its highsensitivity, the assay could be used with clinical specimens,such as blood or body fluids. In this study, the MARV-positive rate of the assay was less than that of RT-PCRperformed in the field laboratory in Uige, Angola. FourRT-PCR-positive samples with titers less than 104 or 103

TCID50s/ml were negative by RT-LAMP. There are severalpossible reasons for this. First, the quality of viral RNA inthe clinical specimens did affect the differences in sensitivitybetween RT-LAMP and RT-PCR. We used clinical samplesthat had been repeatedly frozen and thawed before thisstudy, and therefore, the viral RNA was likely partially de-graded, as indicated by the higher CT values obtained whenthe samples were retested using the field RT-PCR assay.Second, the field RT-PCR assay had higher sensitivities thanthe RT-LAMP assay used for the clinical specimens. Theretest with the field RT-PCR exhibited positive results evenwith the clinical samples negative by RT-LAMP. In addi-tion, the RT-PCR assay used in the field laboratory utilizeda sample volume of 5 �l, whereas the LAMP assay used 1 �l,which would likely have also contributed to the negativeresults for these samples.

The assay developed in this study is highly specific and rapidfor the molecular diagnosis of MARV infections. However, thespecificities and sensitivities of the assay must be continuouslyassessed and improved due to the emergence of unknownMARV strains in future outbreaks. The assay does not requirethe use of sophisticated equipment or highly skilled personnel.The cost of the assay per sample is lower than that of RT-PCRor ELISA, and the assay can provide accurate results in a shorttime frame. These characteristics make it potentially useful forthe clinical diagnosis and management of MARV outbreaks inareas where it is epidemic.

VOL. 48, 2010 RAPID DETECTION OF MARBURG VIRUS BY RT-LAMP 2335

on June 7, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

ACKNOWLEDGMENTS

We thank Hideki Ebihara, Institute of Medical Sciences, Universityof Tokyo, Tokyo, Japan, and Ayato Takada, Hokkaido University,Sapporo, Japan, for their contributions to the present study.

This work was supported by grants from the Ministry of Health,Labor, and Welfare of Japan, the Japan Society for the Promotion ofScience, and the Japan Science and Technology Agency (JST). Thestudy was further supported by the National Microbiology Laboratoryof the Public Health Agency of Canada.

REFERENCES

1. Al-Soud, W. A., and P. Radstrom. 2001. Purification and characterization ofPCR-inhibitory components in blood cells. J. Clin. Microbiol. 39:485–493.

2. Bausch, D. G., S. T. Nichol, J. J. Muyembe-Tamfum, M. Borchert, P. E.Rollin, H. Sleurs, P. Campbell, F. K. Tshioko, C. Roth, R. Colebunders, P.Pirard, S. Mardel, L. A. Olinda, H. Zeller, A. Tshomba, A. Kulidri, M. L.Libande, S. Mulangu, P. Formenty, T. Grein, H. Leirs, L. Braack, T. Ksi-azek, S. Zaki, M. D. Bowen, S. B. Smit, P. A. Leman, F. J. Burt, A. Kemp, andR. Swanepoel. 2006. Marburg hemorrhagic fever associated with multiplegenetic lineages of virus. N. Engl. J. Med. 355:909–919.

3. Bausch, D. G., J. S. Towner, S. F. Dowell, F. Kaducu, M. Lukwiya, A.Sanchez, S. T. Nichol, T. G. Ksiazek, and P. E. Rollin. 2007. Assessment ofthe risk of Ebola virus transmission from bodily fluids and fomites. J. Infect.Dis. 196(Suppl. 2):S142–S147.

4. Borchert, M., S. Mulangu, P. Lefevre, A. Tshomba, M. L. Libande, A.Kulidri, J. J. Muyembe-Tamfum, and P. Van der Stuyft. 2007. Use of pro-tective gear and the occurrence of occupational Marburg hemorrhagic feverin health workers from Watsa health zone, Democratic Republic of theCongo. J. Infect. Dis. 196(Suppl. 2):S168–S175.

5. Colebunders, R., H. Sleurs, P. Pirard, M. Borchert, M. Libande, J. P.Mustin, A. Tshomba, L. Kinuani, L. A. Olinda, F. Tshioko, and J. J.Muyembe-Tamfum. 2004. Organisation of health care during an outbreak ofMarburg haemorrhagic fever in the Democratic Republic of Congo, 1999.J. Infect. 48:347–353.

6. Feldmann, H., T. W. Geisbert, P. B. Jahrling, H. D. Klenk, S. V. Netesov,C. J. Peters, A. Sanchez, R. Swanepoel, and V. E. Volchkov. 2005. Filoviridae,p. 645–653. In C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger, andL. A. Ball (ed.), Virus taxonomy. VIIIth report of the ICTV. AcademicPress, London, United Kingdom.

7. Fukuda, S., S. Takao, M. Kuwayama, Y. Shimazu, and K. Miyazaki. 2006.Rapid detection of norovirus from fecal specimens by real-time reversetranscription-loop-mediated isothermal amplification assay. J. Clin. Micro-biol. 44:1376–1381.

8. Gibb, T. R., D. A. Norwood, Jr., N. Woollen, and E. A. Henchal. 2001.Development and evaluation of a fluorogenic 5�-nuclease assay to identifyMarburg virus. Mol. Cell. Probes 15:259–266.

9. Grolla, A., A. Lucht, D. Dick, J. E. Strong, and H. Feldmann. 2005. Labo-ratory diagnosis of Ebola and Marburg hemorrhagic fever. Bull. Soc Pathol.Exot. 98:205–209.

10. Iseki, H., A. Alhassan, N. Ohta, O. M. Thekisoe, N. Yokoyama, N. Inoue, A.Nambota, J. Yasuda, and I. Igarashi. 2007. Development of a multiplexloop-mediated isothermal amplification (mLAMP) method for the simulta-neous detection of bovine Babesia parasites. J. Microbiol. Methods 71:281–287.

11. Ito, M., M. Watanabe, N. Nakagawa, T. Ihara, and Y. Okuno. 2006. Rapiddetection and typing of influenza A and B by loop-mediated isothermalamplification: comparison with immunochromatography and virus isolation.J. Virol. Methods 135:272–275.

12. Johnson, E. D., B. K. Johnson, D. Silverstein, P. Tukei, T. W. Geisbert, A. N.Sanchez, and P. B. Jahrling. 1996. Characterization of a new Marburg virusisolated from a 1987 fatal case in Kenya. Arch. Virol. Suppl. 11:101–114.

13. Kurosaki, Y., T. Sakuma, A. Fukuma, Y. Fujinami, K. Kawamoto, N. Kamo,S. I. Makino, and J. Yasuda. 2009. A simple and sensitive method for

detection of Bacillus anthracis by loop-mediated isothermal amplification.J. Appl. Microbiol. 107:1947–1956.

14. Kurosaki, Y., A. Takada, H. Ebihara, A. Grolla, N. Kamo, H. Feldmann, Y.Kawaoka, and J. Yasuda. 2007. Rapid and simple detection of Ebola virus byreverse transcription-loop-mediated isothermal amplification. J. Virol.Methods 141:78–83.

15. Muhlberger, E., A. Sanchez, A. Randolf, C. Will, M. P. Kiley, H. D. Klenk,and H. Feldmann. 1992. The nucleotide sequence of the L gene of Marburgvirus, a filovirus: homologies with paramyxoviruses and rhabdoviruses. Vi-rology 187:534–547.

16. Notomi, T., H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N.Amino, and T. Hase. 2000. Loop-mediated isothermal amplification of DNA.Nucleic Acids Res. 28:E63.

17. Panning, M., T. Laue, S. Olschlager, M. Eickmann, S. Becker, S. Raith,M. C. Courbot, M. Nilsson, R. Gopal, A. Lundkvist, A. Caro, D. Brown, H.Meyer, G. Lloyd, B. M. Kummerer, S. Gunther, and C. Drosten. 2007.Diagnostic reverse-transcription polymerase chain reaction kit for filovirusesbased on the strain collections of all European biosafety level 4 laboratories.J. Infect. Dis. 196(Suppl. 2):S199–S204.

18. Parida, M., K. Horioke, H. Ishida, P. K. Dash, P. Saxena, A. M. Jana, M. A.Islam, S. Inoue, N. Hosaka, and K. Morita. 2005. Rapid detection anddifferentiation of dengue virus serotypes by a real-time reverse transcription-loop-mediated isothermal amplification assay. J. Clin. Microbiol. 43:2895–2903.

19. Peterson, A. T., R. R. Lash, D. S. Carroll, and K. M. Johnson. 2006. Geo-graphic potential for outbreaks of Marburg hemorrhagic fever. Am. J. Trop.Med. Hyg. 75:9–15.

20. Sanchez, A., T. W. Geisbert, and H. Feldmann. 2007. Filoviridae: Mar-burg and Ebola viruses, p. 1409–1448. In D. M. Knipe, and P. M. Howley(ed.), Fields virology, vol. 1, 5th ed. Lippincott Williams & Wilkins,Philadelphia, PA.

21. Sanchez, A., S. G. Trappier, U. Stroher, S. T. Nichol, M. D. Bowen, and H.Feldmann. 1998. Variation in the glycoprotein and VP35 genes of Marburgvirus strains. Virology 240:138–146.

22. Smith, D. H., B. K. Johnson, M. Isaacson, R. Swanepoel, K. M. Johnson, M.Killey, A. Bagshawe, T. Siongok, and W. K. Keruga. 1982. Marburg-virusdisease in Kenya. Lancet i:816–820.

23. Strong, J. E., A. Grolla, P. B. Jahrling, and H. Feldmann. 2006. Filovirusesand arenaviruses, p. 774–790. In B. Detrick, R. G. Hamilton, and J. D. Folds(ed.), Manual of molecular and clinical laboratory immunology, 7th ed. ASMPress, Washington, DC.

24. Tomita, N., Y. Mori, H. Kanda, and T. Notomi. 2008. Loop-mediated iso-thermal amplification (LAMP) of gene sequences and simple visual detec-tion of products. Nat. Protoc. 3:877–882.

25. Towner, J. S., M. L. Khristova, T. K. Sealy, M. J. Vincent, B. R. Erickson,D. A. Bawiec, A. L. Hartman, J. A. Comer, S. R. Zaki, U. Stroher, F. Gomesda Silva, F. del Castillo, P. E. Rollin, T. G. Ksiazek, and S. T. Nichol. 2006.Marburg virus genomics and association with a large hemorrhagic feveroutbreak in Angola. J. Virol. 80:6497–6516.

26. Towner, J. S., P. E. Rollin, D. G. Bausch, A. Sanchez, S. M. Crary, M.Vincent, W. F. Lee, C. F. Spiropoulou, T. G. Ksiazek, M. Lukwiya, F.Kaducu, R. Downing, and S. T. Nichol. 2004. Rapid diagnosis of Ebolahemorrhagic fever by reverse transcription-PCR in an outbreak setting andassessment of patient viral load as a predictor of outcome. J. Virol. 78:4330–4341.

27. Towner, J. S., T. K. Sealy, M. L. Khristova, C. G. Albarino, S. Conlan, S. A.Reeder, P. L. Quan, W. I. Lipkin, R. Downing, J. W. Tappero, S. Okware, J.Lutwama, B. Bakamutumaho, J. Kayiwa, J. A. Comer, P. E. Rollin, T. G.Ksiazek, and S. T. Nichol. 2008. Newly discovered Ebola virus associatedwith hemorrhagic fever outbreak in Uganda. PLoS Pathog. 4:e1000212.

28. Weidmann, M., F. T. Hufert, and A. A. Sall. 2007. Viral load among patientsinfected with Marburgvirus in Angola. J. Clin. Virol. 39:65–66.

29. Zhai, J., G. Palacios, J. S. Towner, O. Jabado, V. Kapoor, M. Venter, A.Grolla, T. Briese, J. Paweska, R. Swanepoel, H. Feldmann, S. T. Nichol, andW. I. Lipkin. 2007. Rapid molecular strategy for filovirus detection andcharacterization. J. Clin. Microbiol. 45:224–226.

2336 KUROSAKI ET AL. J. CLIN. MICROBIOL.

on June 7, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from